Molecular Detection of Multidrug Resistance and Characterizations of Mutations in Mycobacterium Tuberculosis Using Polycarbonate Track-Etched Membrane Based DNA Bio-Chip

Abstract

With the widespread use of rifampicin (RMP) and isoniazid (INH), multidrug resistance (MDR) in Mycobacterium tuberculosis (M.tb) poses a threat to the success of tuberculosis (TB) control programs. We have developed a new polycarbonate track-etched membranes (PC-TEM) based DNA bio-chip designed for rapid detection of mutations conferring MDR in M.tb culture isolates. Bio-chips were designed to contain 14 specific probes for wild type and mutated allele of selected codons within 80 bp rifampicin resistance determining region of rpoB gene, katG gene and mabA-inhA regulatory region. RMP-resistance-associated gene mutation points rpoB 516, 526, 531 and 533, and the INH-resistance-associated gene mutation points katG315 and inhA-15 were targeted. Bio-chip signal was detected using enhanced chemiluminescence. A total of 50 culture isolates that were sensitive or resistant to RMP and/or INH were analyzed by bio-chip. The results of culture-based drug susceptibility testing (DST) were used as the gold standard and gene sequencing was performed to resolve the discordance. Amongst 50 culture isolates, we have detected 18 MDR, 9 RMP mono‐resistant, 6 INH mono‐resistant, and 17 fully susceptible isolates. The developed DNA bio-chip has a sensitivity of 90% for RMP and MDR and 100% for INH resistance. The bio-chip has a specificity of 100% for RMP and MDR and 88.8% for INH detection. The identification of mutations using the DNA bio-chip was 100% concordant with the sequencing data for the probes covered by the bio-chip. The detection of rpoB, katG and inhA gene mutation points by a DNA bio-chip may be used as a rapid, accurate, and economical, clinical detection method for MDR detection in M.tb. This is very valuable for the control of TB epidemics.

Introduction

TB is still considered a deadly disease, ranked 7th in the top 10 list of lethal diseases in low and middle income countries like India. According to a survey from the World Health Organization (WHO) in 2022, around 10.6 million people across the world were diagnosed with TB in 2021, an increase of 4.5% from 2020, while 1.6 million patients died of TB [1]. With 28% of cases, India accounts for more than ¼ of global TB burden [1]. Similarly, the TB incidence rate has increased by 3.6% between 2020 and 2021, following declines of about 2% per year for most of the past two decades, due to Covid -19 pandemic [1]. Over and above that, the drug-resistant form of TB is more fatal and complex. The disease caused by M.tb resistant to two primary anti-tubercular drugs, RMP and INH is known as MDR-TB. The burden of drug-resistant TB was increased by 3% globally between 2020 and 2021. An upward trend has been reported in the number of people developing both TB and drug-resistant TB for the first time in several years, attributable to Covid-19 pandemic [1]. It is evident that such drug-resistant TB should be detected as early as possible so that the clinicians can provide accurate and effective treatment to the infected patient, and thus prevent transmission.

Bacterial culture-based DST is still the standard practice for detecting MDR-TB in low and middle income countries like India. However, culture-based DST, due to slow growth in cultures, contributes to reported treatment initiation delays of 8–80 days from the patient’s first contact with health services [2, 3]. The failure to quickly recognize and treat infected patients leads to increased mortality, secondary resistance (including extensively drug-resistant tuberculosis), and ongoing transmission [4]. Additionally, all culture-based conventional methods require a biosafety category III laboratory facility and extensive training of personnel, requirements that are largely unattainable in resource-limited regions [5]. To respond to the urgent need for simple and rapid diagnostic tools in addressing drug-resistant and MDR-TB testing, several molecular techniques have been applied to identify M.tb isolates and associated drug resistance, including real-time polymerase chain reaction, line probe assays (LPAs), DNA sequencing, and oligonucleotide/DNA microarrays [6, 7]. DNA microarray is a specialized technique that can detect multiple mutations in multiple genes involved in MDR-TB. For such reasons, we have developed DNA bio-chip capable of detecting mutations in rpoB, inhA and katG genes responsible for MDR-TB. The unique feature of our DNA bio-chip is that bio-chip was developed on PC-TEM as a solid support. PC-TEM are very thin and highly microporous membranes that provides high immobilization capacity as compared to planar surfaces as well as flat, smooth and hydrophobic surface for good spot morphology which are absent in other 3-D and microporous supports such as gels.

For each anti-TB drug, mutations in one or several genes have been described, and each mutation relates to different levels of drug resistance. Generally, 97% of the cases of resistance to RMP are linked to mutations in the rpoB gene, mostly in an 81 bp hotspot region (codon 507–533) [8]. Mutations at codons 526–531 of rpoB show the highest frequency and confer high-level RMP resistance. INH resistance is acquired through mutations in the katG, inhA and its promoter, ahpC, ndh, and furA genes but mainly in katG, inhA and its promoter [8]. The most frequent katG mutations (50–90%) are found at codon 315 and confer high-level resistance to INH. Our DNA bio-chip targets these most frequently mutated sites on most frequently mutated genes. Our bio-chip was designed and developed to detect the mutations at the 516, 526, 531 and 533 codons in rpoB gene to give indication of RMP resistance, codon 315 of katG gene and -15 mutation in inhA promoter region to give indication of INH resistance.

We have previously developed antibody microarray for detection in thyroid disorders in serum [9, 10]. Additionally, we have developed DNA bio-chip for detection of mutation in rpoB, inhA and embB gene of M.Tb on a single chip [11]. Present bio-chip is developed for the detection of MDR-TB as MDR-TB represent 14% of previously treated cases. Bio-chip is developed for detection of mutations in rpoB, inhA and katG genes on a single chip and required separate standardizations for doing so. This bio-chip incorporated katG gene, which is mainly responsible for INH resistance.

Materials and Methods

M.tb Culture Isolates

We selected 58 M.tb culture isolates with different drug resistance profile from TB Hospital, Sewari, Mumbai, India. This study utilized retrospective, sputum samples that were collected for a different research objective. M.tb culture isolates were originally derived from patients sputum collected from TB Hospital, Sewari, Mumbai and a prior primary sputum sample testing positive for acid-fast bacilli by Ziehl–Neelsen staining was performed at TB hospital, Sewari. The samples were then tested for drug susceptibility to RMP and INH, by the proportion method as described by Cannetti et al. (1963) [12]. Drug susceptibility data of clinical specimens were collected from the TB hospital, Sewari. All respiratory specimens had been decontaminated by the N-acetyl-L-cysteine-NaOH conventional method described by Kent and Kubica, 1985 [13]. Tuberculosis culture isolates were derived from these sputum samples at our centre by culturing on LJ slants. In this study, 58 culture isolates were evaluated, including fully susceptible isolates, RMP mono-resistant, INH mono- resistant and MDR isolates.

Preparation of DNA

DNA was extracted from M.tb cultures grown on L.J. medium using CTAB method [14]. Briefly, a loop full of M.tb colonies was suspended in 400 μl of 10 mM Tris–HCl, 1 mM ethylene-diamine-tetra-acetic acid and heated for 20 min at 80 °C. Then 1 mg/ml of lysozyme was added and incubated for 2 h at 37 °C. This was followed by the addition of proteinase K (0.2 mg/ml) and 10% sodium dodecyl sulfate and incubation at 65 °C for 20 min. After incubation, a mixture of N-acetyl-N, N, N-trimethyl ammonium bromide [40 mM], and NaCl (0.1 M) was added, and then NaCl (0.6 M) was immediately added. The mixture was vortexed until it turned milky and incubated at 65 °C for 10 min. A 750 μl chloroform-isoamyl alcohol (24:1) was added, vortexed, and then centrifuged at 13,000 rpm for 5 min at room temperature. DNA was precipitated with 70% ethanol and re-suspended in 30 μl Tris–EDTA buffer. Finally, DNA quality and concentration were determined by taking optical density at 260 and 280 nm.

Preparation of Target DNA for Hybridisation on Bio-Chip

Fragments of drug resistance-related genes (rpoB, inhA, and katG) containing drug-sensitive or drug-resistant polymorphisms were amplified by multiplex PCR using 3 sets of primers. The lengths of the amplified fragments were 437 bp (rpoB), 210 bp (katG), 284 bp (inhA). Primers used and conditions for amplification of these segments are listed in Table 1. The reverse primers were biotin-labeled at 5’end and all primers were obtained from Integrated DNA Technologies, USA. Concentrated primer mixture was prepared by combination of three pairs of forward and reverse primers were combined in a 1:1 ratio to achieve a final primer concentration of 15 nM each per reaction. Each reaction mix (25 µL) contained 10 µl of mastermix (containing nucleotides and buffer) supplied by Jonaki, Board of Radiation and Isotope Technology, Hyderabad, India, 10 µl of primer mixture, 5 µl (50–100 ng) of extracted DNA. The PCR products were analyzed by electrophoresis in a 1.5% agarose gel.

Table 1.

Primers used for multiplex PCR of rpoB, katG and inhA. The reverse primers are biotin labelled at 5’ end

Gene	Primer (15 nM /reaction)	Sequence 5’ to 3’	PCR master-mix (2.5X) (10 µl /reaction)	PCR conditions
rpoB	RpoB- for RpoB- rev	TGGTCCGCTTGCACGAGGGTCAGA CTCAGGGGTTTCGATCGGGCACAT	50 units/ml of Taq DNA polymerase in a proprietary reaction buffer (pH 8.5), 400 µM dATP, 400 µM dGTP, 400 µM dCTP, 400 µM dTTP, 3 mM MgCl2	2 min at 98 °C; 45 cycles of 20 s at 96 °C, 20 s at 62 °C and 20 s at 72 °C; and 1 min at 72 °C
katG	katG-for katG-rev	GAAACAGCGGCGCTGATCGT               GTTGTCCCATTTCGTCGGGG
inhA	inhA-for inhA-rev	CGCTGCCCAGAAAGGGA                           CCGGGTTTCCTCCGGT

Design and Preparation of the DNA Bio-Chip

The DNA bio-chip was prepared by immobilizing the capture probes on PC-TEM (Millipore, HTTP025200). The capture probes are between 16 and 22 nucleotide long, and carry an immobilization tag (amino modification with C6 spacer) at their 5’ end. PC-TEMs were activated with 2.5% glutaraldehyde. Capture probes were printed onto glutaraldehyde-activated PC-TEMs at a concentration of 10 μmol/L in 0.025 M phosphate buffer saline and were covalently immobilized on the PC-TEMs via an amino group at their 5’ ends. Capture probes were spotted as duplicates in a 5X6 pattern, (spotting pattern shown in Fig. 1) with average spot diameters of 2 mm. Fifteen capture probes were designed to detect mutations of rpoB region (codons 531, 526, 516, 533), inhA (nucleotide -15 within the promoter) and katG (codon 315). Six capture probes, representing the wild-type (wt) sequence and 8 capture probes for the most frequent mutations are immobilized. Additionally, a non-specific probe was included as negative control (NC). Sequence of the probes used in preparation of bio-chip is given in Table 2. Each probe was printed in duplicate. After 16 h of incubation, PC-TEMs were washed with three times with phosphate buffer saline and blocked using 2% bovine serum albumin for two hours. Prepared bio-chip can  be used for assay immidiately and can also be stored at 4 °C for later use.

Fig. 1.

Bio-chip images showing drug resistance and associated codon mutations.

(a) Pattern of probes immobilized on the bio-chip (b) Hybridization pattern of clinical isolates on DNA bio-chip

Table 2.

Probes used for the preparation of DNA bio-chip

Probe name	Gene-probe	Sequence
rpoB 1	rpoB 514–520 WT	TTCATGGACCAGAACAACCCG
rpoB 2	rpoB 521–525 WT	CTGTCGGGGTTGACC
rpoB 3	rpoB 524–529 WT	TTGACCCACAAGCVGCCGA
rpoB 4	rpoB 530–534 WT	CTGTCGGCGCTGGGG
rpoB 5	rpoB 531-TTG	CTGTTGGCGCTGGGG
rpoB 6	rpoB 531-TGG	CTGTGGGCGCTGGGG
rpoB 7	rpoB 533-CCG	GCGCCGGGGCCC
rpoB 8	rpoB 526-TAC	TTGACCTACAAGCGCCGA
rpoB 9	rpoB 526-GAC	TTGACCGACAAGCGCCGA
rpoB 10	rpoB 516-TAC	TTCATGTACCAGAAC
inhA 1	inhA:-15-C WT	GCGGCGAGACGATAGGT
inhA 2	inhA:-15-T	CGCGGCGAGATGATAGG
katG 1	katG WT	GATCAGCACCGGCATCGAGG
katG 2	katG 315-ACC	GATCACCACCGGCATCGAGG
Negative control (NC)		CTGGCAGCGCTGGGG

WT indicates the wild type sequence and mutated codons are given in bold

Detection of Mutations by Bio-Chip

Hybridization sample was prepared by adding 7 µl of the biotinylated PCR product from multiplex PCR and inhA PCR reaction tube each, in 150 µl of the hybridization buffer (2X SSPE with 0.1% SDS). The hybridization sample was heat denatured at 95 °C for 8 min followed by snap chilling on ice for 5 min. The DNA bio-chip placed in 12 well culture plate was hybridized with hybridization samples (~ 160 µL). Over a period of a year, series of experiments with varying probe concentrations (0.3–100 M), different hybridization temperatures (50–60 °C), washing temperatures (50–60 °C),) were performed to standardize the assay conditions. Final bio-chip hybridization was performed at 50 °C for 1 h in a hybridization oven with constant shaking. After hybridization, bio-chips were washed two times sequentially in the pre-warmed (54 °C) wash solution (2 X SSPE with 0.5% SDS) for 5 min.

The specifically bound biotinylated PCR products in biochip were further incubated at 42 °C with 1:4000-diluted streptavidin-HRP conjugate in wash solution for an hour, washed twice with 0.5 ml of wash solution at 42 °C for 10 min, rinsed twice with 2XSSPE at room temperature for 5 min. Specific hybridizations events were visualized with an enhanced chemiluminescence detection system using Chemidoc XRS⁺ system from Biorad.

DNA Sequencing

The DNA extracted from the culture isolates was amplified using single primer pair for rpoB, katG and inhA. PCR products were purified using DNA purification kit (BRIT, Mumbai, India) and sequenced using forward primer by DNA sequencing Services (Apical Scientific Sequencing, Malaysia).

Results

PCR

DNA extracted from clinical isolates were subjected to multiplex PCR for rpoB, inhA, and katG genes. Two bands corresponding to 437 bp and 210 bp as expected for rpoB and katG respectively were obtained on agarose gel electrophoresis of multiplex PCR. However, the 284 bp band expected for inhA was not detected. Hence, the inhA gene was amplified separately and a 284 bp band was seen on agarose gel as expected for inhA. Amplification by PCR was successful for 50 TB isolates, and these were included for molecular characterization. Eight isolates that did not show amplification in either multiplex PCR or inhA PCR and were excluded from further analysis.

Since the study utilized retrospective samples, non-amplification in 8 samples is due to low concentration of DNA in some samples and degradation of DNA in other samples.

DST and Microarray

Clinical M.tb isolates were obtained from 58 patients from TB hospital, Sewari, Mumbai. The susceptibility to first-line anti-TB drugs RMP and INH  was determined by proportion method on LJ medium. DST analysis show that out of 50 isolates which show amplification in multiplex PCR, 16 (32%) were susceptible to both RMP and INH. 10 (20%) were resistant to RMP and 4 (8%) samples were resistant to INH. MDR was found in 20 (40%) of the 50 strains isolates.

Detection and Analysis of Gene Mutations

Rifampicin Resistance-Related Gene Mutations in rpoB

The isolates were analysed by the prepared DNA bio-chip. Figure 1 show the images obtained with both wild type and mutated samples. Among the 50 clinical isolates, 9 were found to be RMP resistant. The following mutations were found: 6 (12%) cases with TCG (531) TTG, 1 (2%) case with CAC(526)TAC, 1 (2%) case with CAC(526)GAC, 1(2%) case with CTG(533)CCG (Table 3). The overall sensitivity and specificity was 90 and 100% respectively, for detection of M.tb RMP resistance as compared to culture based DST (Table 4).

Table 3.

Mutations obtained in M.tb culture isolates by DNA bio-chip analysis

Drug resistance		Gene mutation
		rpoB	inhA	katG	No. (% of isolates)
Sensitive		WT	WT	WT	17 (38)
Mono drug resistance	RMP	TCG(531)TTG	–	–	6 (12)
		CAC(526)TAC	–	–	1 (2)
		CAC(526)GAC	–	–	1 (2)
		CTG(533)CCG	–	–	1 (2)
	INH	–	C-15 T	–	4 (8)
		–	–	AGC(315)ACC	2 (4)
MDR	RMP and INH	TCG(531)TTG	–	AGC(315)ACC	11 (22)
		GAC(516)TAC	C-15 T	–	1 (2)
		TCG(531)TTG	C-15 T	AGC(315)ACC	1 (2)
		TCG(531)TGG	–	AGC(315)ACC	1 (2)
		CAC(526)GAC	–	AGC(315)ACC	1 (2)
		CAC(526)TAC	–	AGC(315)ACC	2 (4)
		CAC(526)TAC	C-15 T	AGC(315)ACC	1 (2)

Table 4.

Comparison of outcomes of the drug susceptibility testing (DST) and DNA biochip

Drug resistance	Conventional testing (proportion method)	Detected by bio-chip	Sensitivity	Specificity
RMP resistant	10	9	90	100
INH resistant	4	6	100	88.8
MDR	20	18	90	100
All susceptible	16	17	–	–
Total	50	50	–	–

Isoniazid Resistance-Related Gene Mutations in katG and inhA

Among the 50 clinical isolates, 4 cases had the inhA -15 (C—T) mutation (8%) and 2 isolates had katG AGC (315)ACC mutation (4%) (Table 3). Figure 1 show the images representing both wild type and mutation hybridization patterns. The overall sensitivity and specificity was 100 and 88.8% respectively, for detection of M.tb INH resistance as compared to DST (Table 4).

Rifampicin and Isoniazid Resistance-Related Gene Mutations in rpoB, katG and inhA

Among the 50 clinical isolates, 11 (22%) samples showed rpoB TCG(531)TTG and katG AGC(315)ACC, 1 (2%) sample show rpoB GAC(516)TAC and inhA promoter − 15 (C → T), 1 (2%) sample show rpoB TCG(531)TTG, inhA promoter − 15 (C → T) and katG AGC(315)ACC, 1(2%) show TCG(531)TGG and katG AGC(315)ACC mutations, 1 (2%) show rpoB CAC(526)GAC and katG AGC(315)ACC, 2 (4%) sample show rpoB CAC(526)TAC and katG AGC(315)ACC mutations and 1 (2%) show rpoB CAC(526)TAC, inhA promoter − 15 (C → T), and katG AGC(315)ACC (Table 3). Figure 1 show the images representing both wild type and mutation hybridization patterns. The overall sensitivity and specificity was 90 and 100% respectively, for detection of M.tb MDR as compared to DST (Table 4).

Analysis of Discordant Results

Sequencing of the isolates was done to resolve the discordance between culture-based DST and results obtained by the bio-chip. No mutations were detected in any INH- or RMP- susceptible isolates. Three samples that were RMP resistant were missed by the bio-chip. One sample had rpoB CAC (526) CGC mutation, the probe for which was not covered on the bio-chip. The sample also had katG AGC (315) ACC mutation and was marked as INH resistant by the bio-chip although it was MDR by DST. Two samples had codon addition between amino acid 513 and 514 which could not be detected by the bio-chip. Bio-chip displayed hybridization with several wild type probes and several mutated probes of rpoB gene and the results were uninterpretable. One of these sample also had katG AGC (315) ACC mutation was found to be INH resistant by the biochip although being MDR.

Discussion

Delayed diagnosis, inadequate treatment regimens and mortality characterize drug-resistant and MDR-TB. Steps should be taken to ensure that all patients are diagnosed and treated effectively to avoid creation and transmission of the resistant strains in the community. The retrieval of antibiograms for M.tb is severely delayed when DST is culture based. Routine application of rapid molecular tests in the clinical management of drug-resistant TB is essential. Thus, a rapid molecular technique to detect resistance to RMP and INH in M.tb using hybridisation analysis on microarrays/bio-chips was developed in this study. The method allows the identification of mutations within the rpoB, katG and inhA genes (the regions responsible for RMP and INH resistance respectively). The unique characteristic of the bio-chip is that, it utilizes PC-TEM as a novel support. PC-TEM provides flat smooth surface with higher immobilization capacity as compared to planar surfaces like glass owing to increased surface area due to high porosity. We had initially developed a DNA bio-chip for detection of drug-resistant for RMP, INH and ethambutol. Many MDR were missed by that bio-chip as katG AGC (315) ACC mutation which represents 90% of the mutations on INH resistant isolates, was not included in that bio-chip. Now we have incorporated the probe for detection of mutation in katG gene which ultimately will help to detect MDR. Each bio-chip, we prepared required number of standardizations as the multiplex PCR amplification conditions were to match for multiple targets and most importantly the hybridization conditions for all the targets have to be same to get the desired signal.

Real-time PCR assays are widely used in TB testing since they provide rapid results (testing time of 1.5–2 h) and reduced risk of contamination. WHO endorsed Xpert MTB/RIF and Xpert Ultra (Cepheid) in 2010 and 2017 respectively, as the initial TB diagnostic test for adults and children, regardless of HIV status, over smear microscopy and culture [15, 16]. However, limited number of genes can be tested in a reaction. Another disadvantage is high cost and sophisticated instrumentation required for the assay. In addition, Xpert MTB/RIF does not detect mutations in genes associated with INH resistance, but uses only RIF resistance as a proxy for MDR-TB detection [17]. Consequently, many INH mono-resistant TB cases are misdiagnosed. As Xpert MTB/RIF can detect only RIF resistance, it is unable to identify MDR-TB in its earliest form (i.e., INH mono-resistance). In addition, it must always be used together with other tests, such as DST, to confirm and identify the whole resistance phenotype of each MTB isolate. Solid-phase hybridization assays, including linear probe assays and DNA microarrays/bio-chips, are commercially available. Currently, the LPAs recommended by WHO for the initial drug resistance screening of sputum smear-positive samples include GenoType MTBDRplus, GenoType MTBDRsl (Hain LifeScience GmbH, Germany), and Nipro NTM + MDRTB (Nipro Co., Osaka, Japan) (WHO, 2017b). GenoType MTBDRplus VER2.0 has the advantage of detecting both RIF and INH resistance by screening mutations in rpoB, katG, and the inhA promoter. Although, LPAs are rapid, simple and easy to perform, they require complex laboratory infrastructure and expensive equipment that is normally only available in reference laboratories. Moreover, limited number of probes could be printed on a single strip thus limits the application of linear probe assays [18].

DNA microarray assays have been used in the testing of rifampicin, pyrazinamide, streptomycin, isoniazid, and ethambutol [19–23]. Fluorescence-based microarray assays require expensive equipment and reagents, which could limit their application. As more and more genes were proved to be related with drug resistance in recent years [24], and PCR limits the number of genes tested in a single reaction, bio-chip based assays provide an advantage. Our chemiluminescence based biochip assay has several advantages compared with other LPA and real time PCR assays in terms of testing flux, result completeness, versatility, sample preparation, and testing time. The chemiluminescence based biochip improves the flux of a single reaction and number of genes tested. Our bio-chip can identify exact nucleotide substitutions in the mutated codon(s) to provide a clearer interpretation of results for personalized medicine.

Regarding RMP resistance, loss of sensitivity may be due to rare mutations present which was not included on the bio-chip. Sequencing analysis show that discordant profiles obtained from phenotypic and bio-chip assays had the rpoB CAC (526) CGC mutation, the probe for which was not present on the bio-chip. Two samples had amino acid addition therefore gave signal on multiple wild type and mutated probes resulting in uninterpretable results. Two of these three samples also had katG AGC (315) ACC mutation and samples were interpreted as INH resistant although they were MDR owing to presence of rpoB gene mutations. This resulted in loss of specificity for INH resistance.

The results of this study suggest that our bio-chip assay has the potential for rapid identification MDR in M.tb  clinical isolates. Our bio-chip assay is highly advantageous in term of speed providing results in a single day as compared with traditional culture-based DST which takes 4–8 weeks. Also compared to DST which costs ~ Rs. 4000 for MDR, bio-chip assay is cheaper costing ~ Rs. 500 for MDR detection. However, some limitations to our study should be noted. First, the retrospective design and the exclusion of patients with missing data might have led to bias. Second, our study was carried in a single center with a relatively small sample size, which might have limited the applicability of the study’s conclusions. Bio-chip assay can detect only those mutations that are covered by the wild-type or mutant probe. The inability to detect novel mutations at locations other than the probe region or outside the amplified region would be a shortcoming, but the system is an open system, wherein newer probes can be added. Though molecular assays have a short turnaround time and are the state of the art, they cannot completely replace the conventional methods, as there are multiple genes involved in resistance and the molecular assays target only known mutations.

In summary, DNA bio-chip/microarray is a rapid, accurate, and practical method for detecting drug-resistant TB in clinical settings. Traditional culture methods are time-consuming and have high technical laboratory requirements. In contrast, DNA bio-chip enables the early and rapid detection of drug-resistant mutations, which is particularly important for effective treatment of drug-resistant TB and the prevention and control of TB transmission. Future research should focus on improving the ability of detecting drug-resistant mutations in M.tb and establishing and optimizing surveillance systems, for which the DNA bio-chip assay may serve a critical role.

Author Contributions

Conceptualization: [SK and BJ]; Methodology: [BJ]; Formal analysis and investigation: [BJ]; Writing—original draft preparation: [BJ]; Writing—review and editing: [SK]; Supervision: [SK].

Funding

This study was funded by BARC.

Declarations

Conflict of interest

All the authors declare that they have no conflict of interest.