Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2024 Mar 10;14(4):107. doi: 10.1007/s13205-024-03950-7

Isolation and molecular characterization of multidrug‑resistant Escherichia coli from chicken meat

Anugya Jaiswal 1, Aquib Khan 1, Akanksha Yogi 1, Sweta Singh 1, Arun Kumar Pal 1, Ramendra Soni 1, Pooja Tripathi 2, Jonathan A Lal 1, Vijay Tripathi 1,3,✉
PMCID: PMC10925582  PMID: 38476645

Abstract

Antibiotics in animal farms play a significant role in the proliferation and spread of antibiotic-resistant genes (ARGs) and antibiotic-resistant bacteria (ARB). The dissemination of antibiotic resistance from animal facilities to the nearby environment has become an emerging concern. The present study was focused on the isolation and molecular identification of Escherichia coli (E. coli) isolates from broiler chicken meat and further access their antibiotic-resistant profile against different antibiotics. Broiler chicken meat samples were collected from 44 retail poultry slaughter shops in Prayagraj district, Uttar Pradesh, India. Standard bacteriological protocols were followed to first isolate the E. coli, and molecular characterization was performed with genus-specific PCR. Phenotypic and genotypic antibiotic-resistant profiles of all confirmed 154 E. coli isolates were screened against 09 antibiotics using the disc diffusion and PCR-based method for selected resistance genes. In antibiotic sensitivity testing, the isolates have shown maximum resistance potential against tetracycline (78%), ciprofloxacin (57.8%), trimethoprim (54.00%) and erythromycin (49.35%). E. coli bacterial isolates have shown relative resistant to amoxicillin-clavulanic acid (43.00%) and against ampicillin (44.15%). Notably, 64.28% E. coli bacteria were found to be multidrug resistant. The results of PCR assays exposed that tetA and blaTEM genes were the most abundant genes harboured by 83 (84.0%) and 82 (82.0%) out of all 99 targeted E. coli isolates, followed by 48.0% for AmpC (CITM) gene and cmlA (23.00%) for chloramphenicol resistance. It is notable that most of the isolates collected from chicken meat samples were multidrug resistant (> 3 antibiotics), with more than 80% of them carrying tetracycline (tetA) and beta-lactam gene (blaTEM). This study highlights the high risk associated with poultry products due to MDR-E. coli and promote the limited use of antibiotics in poultry farms.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13205-024-03950-7.

Keywords: E. coli, Chicken meat, Antibiotic resistance, Antibiotic-resistance genes, Multidrug resistant

Introduction

The application of antibiotics to animals began around eight decades ago, after the discovery of enhanced growth by alimenting them with tetracycline (Zellweger et al. 2017). In the current scenario, the majority of food animals, up to 80%, are being supplemented with antibiotics either in the form of growth promoters to fatten the birds, for prophylactic uses or for therapeutic uses (Arsène et al. 2022; Darwish et al. 2013). Prophylactic antibiotics are generally administered to prevent any infection caused by unhygienic conditions, whereas therapeutic antibiotics are given to treat infection. Growth promoter antibiotics are also commonly supplemented for therapeutic applications; however, the concentrations are lessened for growth promotion (Apata 2009; Nisha 2008; Shareef et al. 2009; Rahman et al. 2022). As a common practice, poultry animals are generally supplied with chlortetracycline, oxytetracycline, neomycin, virginiamycin, tylosin, bacitracin, salinomycin, bambermycin and avoparcin for prophylactic and growth promotion purposes, but the doses of antibiotic are increased in the case of any disease or infection (Diarra and Malouin 2014; Gonzalez Ronquillo and Angeles Hernandez 2017; Andrew et al. 2020). As per the German surveillance data obtained during the winter, spring and summer seasons of 2019, broiler chickens are amongst the largest consumers of antibiotics after turkeys (Wallinga 2018). The excessive dosage of these antibiotics and their unmetabolized residues may be deposited in the tissues of chickens (Muaz et al. 2018; Mund et al. 2017). The antibiotic residues of enrofloxacin, ciprofloxacin, doxycycline, oxytetracycline and chlortetracycline were detected in 28 out of 40 tested samples of chicken meat collected from retail shops in New Delhi, India (Sahu and Saxena 2023). In a similar study, the antibiotics tetracycline and sulphonamides were detected above the permissible maximum residual limits of 100 μg/kg body weight for sulphonamides and 600 μg/kg body weight for tetracycline (FAO 2020, 2013) in the chicken meat samples collected from the local markets of Tanzania (Ulomi et al. 2022). Inat et al. 2023, found extended-spectrum β-lactamase-producing Enterobacteriaceae in chicken meat and also detected the blaTEM and blaSHV genes in E. coli and C. braakii isolates. Furthermore, this intense usage of antibiotics favours and elevates the potential menace for selecting antibiotic-resistant bacteria in chicken microbiota, which is also disseminated in their litter (Roth et al. 2019). Chicken litter is widely used as fertilizer and a budding nutrient source for agriculture (Ngogang et al. 2020). Chicken manure has a high content of nitrogen (N), phosphorus (P), and potash (K) and significantly improves soil health along with enhanced crop yield (Lin et al. 2018; Ofori et al. 2021). However, it also plays a significant role in disseminating antibiotics and antibiotic-resistant genes (ARGs) in the environment (Fatoba et al. 2022; Karamova et al. 2022). Lack of proper hygiene and poor sanitization practices in slaughterhouses are liable for defiling chicken meat with the most common E. coli and other antibiotic-resistant bacteria (ARBs) (Bhushan et al. 2017; Wang et al. 2021). Chicken meat has been adopted as a significant diet source by a large share of the population (Murray et al. 2021; de Mesquita Souza Saraiva et al. 2022), and consumption of contaminated chicken meat with ARBs and ARGs can be considered farm-to-fork transmission and pose a significant threat to human health (Marshall and Levy 2011; da Costa et al. 2013; Lundborg and Tamhankar 2017). E. coli, a typical member of the Enterobacteriaceae family and a significant wellspring of foodborne diseases, is a critical inhabitant of the gastrointestinal region of poultry, animals and humans. Feasting or interaction of MDR E. coli via contaminated chicken meat also affects the existing E. coli flora of the human gut and promotes the emergence probability of antibiotic resistance (Koju et al. 2022). The fast emergence and spread of MDR E. coli have elevated human infection and mortality rates (Shawa et al. 2022). Colistin has been highly used in the poultry and animal husbandry sectors worldwide for a decade, and its occurrence was also reported by various studies (Uddin et al. 2022). The ESBL-producing Enterobacteriaceae are also posing a serious threat to healthcare settings, recently isolated from the animal husbandry settings mainly in poultry sectors (Nawaz et al. 2021). The antibiotic resistance in bacteria, mainly in Salmonella and E. coli isolates, is a significant concern for food safety, and the dissemination of resistant isolates along with the food chain is to be adequately handled for public health (Telli et al. 2022).

This study aimed to isolate E. coli from broiler chicken meat from retail poultry slaughter shops in Prayagraj district of U.P., India, and identified the resistance pattern against commonly used antibiotics in the poultry industry. The primary objective of this study was to investigate the presence of MDR E.coli in broiler farm environments, identify the phenotypic and genotypic pattern of bacterial isolates harboured against some selected antibiotics and evaluate the probable risks to human health.

Materials and methods

Sample location and sample collection

One hundred and thirty-two chicken meat samples were collected from 44 local retail poultry slaughter shops in Prayagraj district, Uttar Pradesh, India, from January 2021 to February 2021 (Sudarmadi et al. 2020). Chicken meat samples (breast and muscle) were collected randomly from three birds from one poultry slaughter shop and pooled. All meat samples were adequately labelled and kept in separate sterile plastic bags to avoid cross-contamination and immediately transported to the Department of Molecular and Cellular Engineering, Jacob Institute of Biotechnology and Bioengineering laboratory. All the samples were stored at 4℃ for further processing after 1–2 days of purchase.

Isolation and identification of E. coli

About 5 g of pooled meat samples was chopped into small pieces and mixed with 90 ml of 1% sterile peptone, then incubated in an incubator shaker for 24 h at 125 rpm at 370C. The samples were processed in serial dilution, and bacteria from 10–2 diluted suspensions were inoculated on the EMB agar plate to isolate specific E. coli colonies. After the inoculation, plates were incubated at 370C for 24 h, and metallic sheen colonies with a dark black in the centre were presumably identified as E. coli. Based on the morphological variances, 620 sheen green colonies were selected for purification and further streaked on LA plates. E. coli bacterial isolates were biochemically confirmed using indole, methyl red and citrate utilization tests. Biochemically identified E. coli spp. isolates were stored at -800C.

Extraction of bacterial genomic DNA and Identification of E. coli through PCR

Biochemically confirmed 154 E. coli colonies were selected for molecular characterization. The bacterial genomic DNA of these isolates was extracted using the phenol:chloroform:isoamyl alcohol (25:24:1) method. The concentration of the genomic DNA was analysed by a nano-spectrophotometer. The PCR amplification for E. coli confirmation was performed using uidA gene primers (uidA-F-CCGATCACCTGTGTCAATGT, uidA-R-GTTACCGCCAACGCGCAATA) (Bower et al. 2005). The PCR was performed in a total volume reaction of 25 µL consisting of 12.5 µL Master mix (Takara, Japan), 1 µL (10 µM) of each primer (Eurofines, Bengaluru, India), 1 µL DNA template and molecular-grade water (9.5 µL). The following conditions were carried out for PCR amplification: initial denaturation for 5 min at 950C, 35 cycles of denaturation at 950C for 1 min, annealing at 550C for 60 s and extension at 720C for 1 min and final extension of 10 min at 720C. The expected PCR product size for the target gene was 199 bp. The amplified products (5µL) were run on 1% agarose gel for 1 h at 90 V and visualized under the gel documentation system.

Antibiotic susceptibility test

A total of 154 confirmed E. coli isolates from biochemical and molecular characterization were selected for antibiotic resistance screening by disc diffusion method. Each isolate was cultured on Mueller–Hinton agar (MHA) plate using a sterile cotton swab against nine antibiotics, viz., trimethoprim (TR) (5 µg), tetracycline (TE) (30 µg), chloramphenicol (C) (30 µg), ciprofloxacin (CIP) (5 µg), erythromycin (E) (15 µg), gentamycin (GEN) (10 µg), amoxicillin-clavulanic acid (AMC) (30 µg), streptomycin (HLS) (10 µg) and ampicillin (AMP) (10 µg) for Kirby–Bauer disc diffusion method. After 24 h incubation, the inhibited zone surrounding each disc was measured in millimetres with the help of a calliper. The standards of the Clinical Laboratory Standards Institute (Fatoba et al. 2022) were used for the disc diffusion test to assess the antibiotic resistance of E. coli isolates.

PCR Amplification and detection of antibiotic-resistant genes

All multidrug-resistant E. coli isolates (n = 64) were PCR-screened for the presence of a different group of antibiotic-resistant genes such as tetA, cmlA, ereA, CITM and blaTEM. Details of the specific primer sequences, PCR product size and annealing temperature are summarized in Table 1.

Table 1.

Antibiotic-resistant genes, primer sequence and PCR thermal conditions

S. no. Antimicrobial agent Resistance
gene		 Primer Sequence Size Annealing
temp		 References
1. Tetracycline tetA F GGTTCACTCGAACGACGTCA 577 56 (Van et al. 2008)
R CTGTCCGACAAGTTGCATGA
2. Erythromycin ereA F GCCGGTGCTCATGAA CTTGAG 419 58 (Van et al. 2008)
R CGACTCTATTCGATC AGAGGC
3. Chloramphenicol cmlA F CCGCCACGGGT TGTTGTTATC 698 58 (Van et al. 2008)
R CACCTTGCCTGCCCATCATTAG
4. AmpC CITM F TGGCCAGAACTGACAGGCAAA 462 58 (Van et al. 2008)
R TTTCTCCTGAACGTGGCTGGC
5. Beta-lactam blaTEM F GCGGAACCCCTATTTG 964 55 (Olesen et al. 2004)
R ACCAATGCTTAATCAGTGAG
Open in a new tab

The thermal set-up of the conventional PCR for tetA primer comprised a pre-denaturation step at 95 °C for 15 min, followed by denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s and extension at 72 °C for 1 min. A total of 30 cycles were repeated for amplification steps adjacent to a final extension at 72 °C for 10 min. The thermal conditions for ereA, cmlA and CITM involved a pre-denaturation step at 95 °C for 15 min, followed by denaturation at 94 °C for 1 min, annealing at 58 °C for 30 s and extension at 72 °C for 1 min. The amplification cycle was repeated 35 times followed by a final extension at 72 °C for 10 min. blaTEM was amplified using the thermal conditions consisting of pre-denaturation at 94 °C for 3 min, followed by 30 cycles of denaturation at 94 °C for 3 min, annealing at 55 °C for 3 min and extension at 72 °C for 1 min, providing a final extension at 72 °C for 10 min.

Results

Occurrence of E. coli in chicken meat

A total of 620 green sheen isolates picked from EMB agar plates based on morphological variations were selected for further purification and identification through biochemical (MR-VP test, indole and citrate utilization tests) and molecular (uidA gene amplification) methods, out of which 154 isolates were confirmed to be E. coli, with an overall occurrence of 24.83%. The positive 154 E. coli isolates were further chosen for the antibiotic sensitivity test.

Antibiotic resistance profile of E. coli

All the confirmed E. coli isolates (n = 154) were screened for antibiotic resistance against nine antibiotics by disc diffusion method. The pattern of antibiotic resistance for all isolates is represented in Table 2.

Table 2.

Antimicrobial resistance profile of E. coli isolated from chicken meat (154)

Antimicrobial class Antimicrobial agent (conc.) No. of E. coli tested No. (%) of E. coli isolates
Resistance Intermediate Sensitive
Aminoglycoside Gentamycin 154 13 (8.44%) 3 (2.0%) 138 (90.0%)
Streptomycin 154 2 (1.3%) 5 (3.24%) 147 (95.45%)
Beta-lactams Amoxicillin-clavulanic acid 154 73 (47.4%) 0 (0.00%) 81 (52.60%)
Ampicillin 154 68 (44.15%) 3 (2.0%) 83 (54.0%)
Phenicols Chloramphenicol 154 17 (11.03%) 4 (2.6%) 133 (86.36%)
Macrolides Erythromycin 154 76 (49.35%) 64 (41.55%) 14 (9.09%)
Tetracycline Tetracycline 154 120 (78.0%) 7 (4.54%) 27 (17.53%)
Fluoroquinolones Ciprofloxacin 154 89 (57.8%) 20 (13.0%) 45 (29.22%)
Sulfonamide Trimethoprim 154 83 (54.0%) 2 (1.3%) 69 (44.80%)
Open in a new tab

In this study, generally, 53.2%, 39.0% and 7.8% of the bacterial isolates were sensitive, resistant and intermediate, respectively, against all the 09 antibiotics. Out of 154 E. coli isolates, antibiogram analysis showed that 14 (9.0%) isolates were resistant to at least one antibiotic, whereas 30 (19.48%) isolates were against two antibiotics, 27 (17.53%) isolates against three antibiotics, 30 (19.4%) isolates against four antibiotics, 16 (10.4%) against five antibiotics, 19 (12.3) isolates against six antibiotics, 5 (3.24%) isolates against seven antibiotics and 2 (2%) isolates against eight antibiotics. However, eight (8.0%) E. coli isolates were not antibiotic resistant. The antimicrobial resistance patterns of 154 E. coli isolates have shown a very high degree of resistance against tetracycline (78.0%), ciprofloxacin (57.8%), trimethoprim (54.0%), erythromycin (49.35%), amoxicillin-clavulanic acid (47.4%) and ampicillin (44.15%). However, the lowest rate of resistance was observed for chloramphenicol (11.03%), gentamicin (8.44%) and streptomycin (1.3%). As shown in Table 3, 99 out of the 154 isolates (64.3%) showed resistance to more than three antibiotics, and about 46.75% showed resistance against 4 to 8 different antibiotics. E. coli isolates that showed multidrug resistance were selected for the antibiotic resistance gene amplification.

Table 3.

Distribution of resistance profiles of E. coli (n = 154)

Number of antibiotics No. (%) of resistant E. coli isolates No. of MDR isolates (%)
1. 14 (9.0%) No
2. 30 (19.48%)
3. 27 (17.5%) Yes (99)
4. 30 (19.4%)
5. 16 (10.4%)
6. 19 (12.3%)
7. 5 (3.24)
8. 2 (1.2)
9. 0(0)
Open in a new tab

The resistance profile of E. coli isolates revealed that the chicken which fed antibiotics to prevent diseases is prone to acquiring antibiotic resistance properties. Most Indian avian farmers and producers feed their chickens with tetracycline and trimethoprim for prophylactic and growth promotion purposes; therefore, the resistance against TE and TR was observed the highest in all the collected samples.

Prevalence of antibiotic resistance genes in E. coli

The overall prevalence of five ARGs amongst the investigated E. coli isolates in chicken meat samples in retail poultry shops of the Prayagraj division is shown in Table 4. The most abundant genes were tetracycline (tetA) and beta-lactam (blaTEM), harboured by 84% and 82% of total targeted E. coli isolates, respectively. About 48% of the isolates harboured the ampicillin (CITM) gene, and 62% harboured the macrolide (ereA) gene. Also, 22% and 23% of the isolates have shown resistance against aadA1 and cmlA, respectively. Similar to the phenotypic prevalence of ARBs as per the antibiogram analysis, the genotypic data obtained by the PCR analysis also evidenced that the abuse of antibiotics generates antibiotic resistance potential in the host organisms. In this study, maximum isolates were found to be resistant to TE and TR; similarly, they also harbour a higher number of genes resistant to TE.

Table 4.

Distribution of antimicrobial resistance genes (ARGs) in E. coli isolates (99)

Antimicrobial class Antimicrobial agent ARGs No. of E. coli-positive isolates (%)
Beta-lactams Ampicillin blaTEM 82 (82.0)
CITM 48 (48)
Phenicols Chloramphenicol cmlA 23 (23)
Macrolides Erythromycin ereA 61 (62)
Tetracycline Tetracycline tetA 83 (84.0)
Open in a new tab

Discussion

E. coli is the most common foodborne pathogen in vertebrates’ intestinal tract, which usually infects commercial meat products (Parvin et al. 2020). Antibiotics are widely used in the poultry industry to increase the production rate and reduce the economic loss caused by E. coli (Wibisono et al. 2018). However, unregulated use and consumption of antibiotics may increase the dissemination of antibiotic residues in poultry litter and be transmitted into human populations (Yang et al. 2019). Chicken meat is a significant source of multidrug-resistant ESBL-producing E. coli strains, which are accountable for potential human health issues around the globe (Badr et al. 2022). Some recent research studies from different parts of India revealed the presence of antibiotic residues and multidrug-resistant pathogenic bacteria in chicken meat due to the uncontrolled use of antibiotics in the poultry industry (Bhardwaj et al. 2021). The results obtained from our study also revealed that the poultry meat was contaminated with multidrug-resistant E. coli. This is an alarming situation for antibiotic resistance development and could seriously threaten human health (Rahman et al. 2020). The present study found out raw chicken meat from retail poultry shops has MDR E. coli. These isolates were frequently resistant against tetracycline (78%), trimethoprim (83%), erythromycin (76%), amoxicillin-clavulanic acid (73%) and ampicillin (68%) antibiotics. This situation happens due to the high use of tetracycline, fluoroquinolone and aminoglycoside antibiotics in the poultry industry in India. This is a global alarming issue, where retail poultry shops barely uphold the appropriate hygienic practices in handling chicken meat. A very similar pattern was also observed in Bangladesh (Saha et al. 2020), Sri Lanka (Kottawatta et al. 2017) and Vietnam (Sary et al. 2019). A similar study conducted by Rahman et al. 2020, observed the identical prevalence of tetA; however, the detection of ereA was higher in E. coli isolated from broiler chickens in Bangladesh. Another study conducted in India by Debbarma et al. 2022, reported that most broiler chicken samples collected from retail poultry shops were contaminated with E. coli. The high occurrence rate of E. coli in broiler chicken in Bangladesh was also reported by Jakaria et al. 2013. A study conducted in Iran reported a high prevalence rate (64.91%) of MDR strains amongst E. coli isolates from commercial chicken meat (Farhoumand et al. 2020). Studies have demonstrated even higher prevalence rates of MDR E. coli in the broiler (94%) and layer (60%) chicken in Nepal (80.0%) (Shrestha et al. 2017) and India (Brower et al. 2017). Such a high prevalence of MDR isolates may be due to misuse of antibiotics, which may ultimately replace the drug-sensitive microorganisms in an antibiotic-saturated environment.

The emergence of MDR bacterial pathogens in the livestock or poultry sector is a major challenge (Eeswaran et al. 2022). In the present study, about 64% of E. coli isolates were found MDR and 73% of these MDR bacterial isolates showed resistance against four to eight antibiotics. Our antibiogram analysis is very similar to the recent finding of phenotypes of MDR E. coli. The antibiotic resistance pattern (ampicillin, amoxicillin-clavulanic acid, tetracycline, chloramphenicol, trimethoprim and erythromycin) of E. coli isolates advised the careful use of antibiotics (Rahman et al. 2020). The genes coding for the extended-spectrum beta-lactam (blaTEM) were detected in E. coli isolates (82%) isolated from broiler chicken. In the present study, it has also been found that the 84% of bacterial pathogens carried tetA genes, followed by ere (61%), CITM (48%), cmlA (23%) and A1(22%) genes. The antibiotic genotype and phenotype correlation was observed very strongly in mainly investigated E. coli isolates, which were also observed earlier (Hossain et al. 2023). However, in this study, some bacterial strains carried the resistance genes but did not show resistance phenotypically against the same antibiotics used in this study. The antibiotype of two isolates (shown resistance to nearly all used antibiotics) was different in the present study (Table 2), indicating an alarming signal for human consumption, public health and microbial drug resistance. It would be more meaningful and informative if we could collect more samples from many Indian cities. This study briefly explains the current scenario of antibiotic contamination in chicken meat.

Conclusion

The current study focussed mainly on isolating and identifying antibiotic-resistant E. coli from broiler chicken meat samples in the Prayagraj district of Uttar Pradesh, India. However, most of the E. coli isolates showed resistance against at least three antibiotics (multidrug resistant) which are most frequently used in poultry sectors such as tetracycline, beta lactams and macrolides. Easy availability, less awareness and overuse of antibiotics by farmers are the major issues contributing towards antibiotic resistance. Our study promotes the limited use of antibiotics in poultry farms, proper cooking practices and their handling to reduce the risk of antibiotic-resistant bacteria. Moreover, the MAR index revealed an essential public health problem, indicating the isolate originated from a source where antibiotics are used to a great degree and/or in large amounts. The poultry industry should focus on implementing control measures to reduce the spread of pathogens.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary file1 (DOCX 713 kb) (713.3KB, docx)

Acknowledgements

We would like to thank the respective departments and institution for their support in conducting this research.

Authors contribution

PT, JAL and VT were involved in conceptualization; AJ, AK, SS and AKP were involved in methodology; AKP and VT performed validation and VT and RS were involved in writing. All authors have read and agreed to publish.

Funding

The work has been supported by the Uttar Pradesh Council of Agricultural Research, Lucknow, India (15/VT/AH&D/RF/2022).

Data availability

Data are contained within the article.

Declarations

Conflict of interest

The authors have declared no conflict of interest.

Ethical approval

This study was carried out under the permission of the laboratory biosafety guideline from Sam Higginbottom University of Agriculture, Technology and Sciences, Prayagraj, India. Animal ethics approval was taken (IAEC/LAF/SHUATS/PROTOCOL/02) on March 05, 2021.

References

  1. Andrew Selaledi L, Mohammed Hassan Z, Manyelo TG, Mabelebele M. The current status of the alternative use to antibiotics in poultry production: An African perspective. Antibiotics. 2020;9:594. doi: 10.3390/antibiotics9090594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Apata DF. Antibiotic resistance in poultry. Int J Poult Sci. 2009;8:404–408. doi: 10.3923/ijps.2009.404.408. [DOI] [Google Scholar]
  3. Arsène MMJ, Davares AKL, Viktorovna PI, Andreevna SL, Sarra S, Khelifi I, Sergueïevna DM. The public health issue of antibiotic residues in food and feed: causes, consequences, and potential solutions. Vet World. 2022;15:662–671. doi: 10.14202/vetworld.2022.662-671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Badr H, Reda RM, Hagag NM, Kamel E, Elnomrosy SM, Mansour AI, Shahein MA, Ali SF, Ali HR. Multidrug-resistant and genetic characterization of extended-spectrum beta-lactamase-producing E. Coli recovered from chickens and humans in Egypt. Animals. 2022;12:346. doi: 10.3390/ani12030346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bhardwaj K, Shenoy MS, Baliga S. Research note: characterization of antibiotic resistant phenotypes and linked genes of Escherichia Coli and Klebsiella pneumoniae from healthy broiler chickens, Karnataka. India Poult Sci. 2021;100:101094. doi: 10.1016/j.psj.2021.101094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bhushan C, Khurana A, Sinha R, Nagaraju R (2017) Antibiotic resistance in poultry environment: spread of resistance from poultry farm to agricultural field. In: Shankar A (ed) Centre for science and environment, New Delhi, India, pp 1–36
  7. Bower PA, Scopel CO, Jensen ET, Depas MM, McLellan SL. Detection of genetic markers of fecal indicator bacteria in Lake Michigan and determination of their relationship to Escherichia coli densities using standard microbiological methods. Appl Environ Microbiol. 2005;71(12):8305–8313. doi: 10.1128/AEM.71.12.8305-8313.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Brower CH, Mandal S, Hayer S, Sran M, Zehra A, Patel SJ, Kaur R, Chatterjee L, Mishra S, Singh DBR. The prevalence of extended-spectrum beta-lactamase-producing multidrug-resistant Escherichia coli in poultry chickens and variation according to farming practices in Punjab. India Environ Health Perspect. 2017;125:077015. doi: 10.1289/EHP292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. da Costa PM, Loureiro L, Matos AJF. Transfer of multidrug-resistant bacteria between intermingled ecological niches: the interface between humans, animals and the environment. Int J Environ Res Public Health. 2013;10:278–294. doi: 10.3390/ijerph10010278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Darwish WS, Eldaly EA, El-Abbasy MT, Ikenaka Y, Nakayama S, Ishizuka M. Antibiotic residues in food: The African Scenario. Jpn J Vet Res. 2013;61(Suppl):S13–22. [PubMed] [Google Scholar]
  11. de Mesquita Souza Saraiva M, Lim K, do Monte DFM, Givisiez PEN, Alves LBR, de Freitas Neto OC, Kariuki S, Júnior AB, de Oliveira CJB, Gebreyes WA (2022) Antimicrobial resistance in the globalized food chain: a one health perspective applied to the poultry industry. Braz J Microbiol 53:465–486. 10.1007/s42770-021-00635-8 [DOI] [PMC free article] [PubMed]
  12. Debbarma M, Deka D, ChaaTolenkhomba T, Rajesh JB. Microbiological contamination of retail meat from Mizoram (India) with special reference to molecular detection and multidrug resistance of Escherichia coli. Indian J Vet Sci Biotechnol. 2022;18(2):32–35. [Google Scholar]
  13. Diarra MS, Malouin F. Antibiotics in Canadian poultry productions and anticipated alternatives. Front Microbiol. 2014;5:282. doi: 10.3389/fmicb.2014.00282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Eeswaran R, Nejadhashemi AP, Faye A, Min D, Prasad PVV, Ciampitti IA. Current and future challenges and opportunities for livestock farming in West Africa: perspectives from the case of senegal. Agronomy. 2022;12:1818. doi: 10.3390/agronomy12081818. [DOI] [Google Scholar]
  15. FAO (2020) Meat market review: overview of global meat market developments in 2019
  16. FAO, WHO (2013) Codex alimentarius commission, procedural manual. Joint FAO/WHO food standard programme, FAO: Rome, Italy, WHO: Geneva, Switzerland, 21–24
  17. Farhoumand P, Hassanzadazar H, Soltanpour MS, Aminzare M, Abbasi Z. Prevalence, genotyping and antibiotic resistance of listeria monocytogenes and Escherichia Coli in fresh beef and chicken meats marketed in Zanjan. Iran Iran J Microbiol. 2020;12(6):537–546. doi: 10.18502/ijm.v12i6.5028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Fatoba DO, Amoako DG, Abia ALK, Essack SY. Transmission of antibiotic-resistant escherichia coli from chicken litter to agricultural soil. Front Environ Sci. 2022;9:751732. doi: 10.3389/fenvs.2021.751732. [DOI] [Google Scholar]
  19. Gonzalez Ronquillo M, Angeles Hernandez JC. Antibiotic and synthetic growth promoters in animal diets: review of impact and analytical methods. Food Control. 2017;72:255–267. doi: 10.1016/j.foodcont.2016.03.001. [DOI] [Google Scholar]
  20. Hossain Mridha MdK, Islam MdS, Uddin MdS, Rahman ATMM, Ud-Daula A, Islam MdA, Rubaya R, Bhuiya AA, Alim MdA, Jahan N, Li J, Alam J. Isolation, identification and genetic characterization of antibiotic resistant Escherichia Coli from frozen chicken meat obtained from supermarkets at Dhaka City in Bangladesh. Antibiotics. 2023;12:41. doi: 10.3390/antibiotics12010041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. İnat G, Sırıken B, Çiftci A, Erol İ, Başkan C, Yıldırım T. Molecular characterization of extended-spectrum β-lactamases-producing Enterobacteriaceae species in ground beef and chicken meat. Int J Food Microbiol. 2023;398:110228. doi: 10.1016/j.ijfoodmicro.2023.110228. [DOI] [PubMed] [Google Scholar]
  22. Jakaria A, Islam MA, Khatun MM. Prevalence, characteristics and antibiogram profiles of escherichia coli isolated from apparently healthy chickens in Mymensingh, Bangladesh. Microbes Health. 2013;1:27–29. doi: 10.3329/mh.v1i1.13710. [DOI] [Google Scholar]
  23. Karamova K, Danilova N, Selivanovskaya S, Galitskaya P. The impact of chicken manure biochar on antibiotic resistance genes in chicken manure composting. Agriculture. 2022;12:1158. doi: 10.3390/agriculture12081158. [DOI] [Google Scholar]
  24. Koju P, Shrestha R, Shrestha A, Tamrakar S, Rai A, Shrestha P, Madhup SK, Katuwal N, Shrestha A, Shrestha A, Shrestha S. Antimicrobial resistance in E. Coli isolated from chicken cecum samples and factors contributing to antimicrobial resistance in Nepal. Tropical Med. 2022;7:249. doi: 10.3390/tropicalmed7090249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kottawatta K, Van Bergen M, Abeynayake P, Wagenaar J, Veldman K, Kalupahana R. Campylobacter in broiler chicken and broiler meat in Sri Lanka: influence of semi-automated vs. wet market processing on campylobacter contamination of broiler neck skin samples. Foods. 2017;6:105. doi: 10.3390/foods6120105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lin Y, Watts DB, Santen E, Cao G. Influence of poultry litter on crop productivity under different field conditions: a meta-analysis. Agron J. 2018;110:807–818. doi: 10.2134/agronj2017.09.0513. [DOI] [Google Scholar]
  27. Lundborg CS, Tamhankar AJ. Antibiotic residues in the environment of South East Asia. BMJ. 2017;358:j2440. doi: 10.1136/bmj.j2440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Marshall BM, Levy SB. Food Animals and antimicrobials: impacts on human health. Clin Microbiol Rev. 2011;24:718–733. doi: 10.1128/CMR.00002-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Muaz K, Riaz M, Akhtar S, Park S, Ismail A. Antibiotic residues in chicken meat: global prevalence, threats, and decontamination strategies: a review. J Food Prot. 2018;81:619–627. doi: 10.4315/0362-028X.JFP-17-086. [DOI] [PubMed] [Google Scholar]
  30. Mund MD, Khan UH, Tahir U, Mustafa BE, Fayyaz A. Antimicrobial drug residues in poultry products and implications on public health: a review. Int J Food Prop. 2017;20:1433–1446. doi: 10.1080/10942912.2016.1212874. [DOI] [Google Scholar]
  31. Murray M, Salvatierra G, Dávila-Barclay A, Ayzanoa B, Castillo-Vilcahuaman C, Huang M, Pajuelo MJ, Lescano AG, Cabrera L, Calderón M, Berg DE, Gilman RH, Tsukayama P. Market chickens as a source of antibiotic-resistant Escherichia Coli in a peri-urban community in Lima. Peru Front Microbiol. 2021;12:635871. doi: 10.3389/fmicb.2021.635871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Nawaz Z, Aslam B, Zahoor MA, Siddique AB, Rafique A, Aslam R, Qamar MU, Ali S, Mubeen MU. Frequency of extended spectrum beta lactamase producing escherichia coli in fresh and frozen meat. Pak Vet J. 2021;41(1):102–106. doi: 10.29261/pakvetj/2020.059. [DOI] [Google Scholar]
  33. Ngogang MP, Ernest T, Kariuki J, Mouliom Mouiche MM, Ngogang J, Wade A, van der Sande MAB. Microbial contamination of chicken litter manure and antimicrobial resistance threat in an urban area setting in Cameroon. Antibiotics. 2020;10:20. doi: 10.3390/antibiotics10010020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Nisha A. Antibiotic residues - a global health hazard. Vet World. 2008;2:375. doi: 10.5455/vetworld.2008.375-377. [DOI] [Google Scholar]
  35. Ofori P, Asamoah G, Amoah B, Agyeman KOA, Yeboah E. Combined application of poultry litter biochar and NPK fertilizer improves cabbage yield and soil chemical properties. Open Agriculture. 2021;6:356–368. doi: 10.1515/opag-2021-0217. [DOI] [Google Scholar]
  36. Olesen I, Hasman H, Aarestrup FM. Prevalence of beta-lactamases among ampicillin-resistant Escherichia coli and Salmonella isolated from food animals in Denmark. Microb Drug Resist. 2004;10(4):334–340. doi: 10.1089/mdr.2004.10.334. [DOI] [PubMed] [Google Scholar]
  37. Parvin Mst S, Talukder S, Ali MdY, Chowdhury EH, Rahman MdT, Islam MdT. Antimicrobial resistance pattern of Escherichia Coli isolated from frozen chicken meat in Bangladesh. Pathogens. 2020;9:420. doi: 10.3390/pathogens9060420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rahman MdM, Husna A, Elshabrawy HA, Alam J, Runa NY, Badruzzaman ATM, Banu NA, Al Mamun M, Paul B, Das S, Rahman MM, Mahbub-E-Elahi ATM, Khairalla AS, Ashour HA. Isolation and molecular characterization of multidrug-resistant escherichia coli from chicken meat. Sci Rep. 2020;10:21999. doi: 10.1038/s41598-020-78367-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Rahman M, Fliss I, Biron E. Insights in the development and uses of alternatives to antibiotic growth promoters in poultry and swine production. Antibiotics. 2022;11:766. doi: 10.3390/antibiotics11060766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Roth N, Käsbohrer A, Mayrhofer S, Zitz U, Hofacre C, Domig KJ. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia Coli: a global overview. Poult Sci. 2019;98:1791–1804. doi: 10.3382/ps/pey539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Saha O, Hoque MN, Islam OK, Rahaman MdM, Sultana M, Hossain MA. Multidrug-resistant avian pathogenic Escherichia Coli strains and association of their virulence genes in Bangladesh. Microorganisms. 2020;8:1135. doi: 10.3390/microorganisms8081135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sary K, Fairbrother JM, Arsenault J, de Lagarde M, Boulianne M. Antimicrobial resistance and virulence gene profiles among Escherichia Coli Isolates from retail chicken carcasses in Vietnam. Foodborne Pathog and Dis. 2019;16:298–306. doi: 10.1089/fpd.2018.2555. [DOI] [PubMed] [Google Scholar]
  43. Sahu R, Saxena P (2023) New Delhi, India: centre for science and environment, centre for science and environment, India, Antibiotics in chicken meat. PML/PR-48/2014. Available online: https://cdn.cseindia.org/userfiles/Antibiotics%20in%20Chicken_Lab%20Report_Final%2029%20July.pdf. Accessed 31 Jan 2023
  44. Shareef A, Jamel ZT, Yonis KM. Detection of antibiotic residues in stored poultry products. Iraqi J Vet Sci. 2009;23:45–48. [Google Scholar]
  45. Shawa M, Furuta Y, Paudel A, Kabunda O, Mulenga E, Mubanga M, Kamboyi H, Zorigt T, Chambaro H, Simbotwe M, Hangombe B, Higashi H. Clonal relationship between multidrug-resistant Escherichia Coli ST69 from poultry and humans in Lusaka. Zambia. FEMS Microbiol Lett. 2022;368(21–24):fnac004. doi: 10.1093/femsle/fnac004. [DOI] [PubMed] [Google Scholar]
  46. Shrestha A, Bajracharya AM, Subedi H, Turha RS, Kafle S, Sharma S, Neupane S, Chaudhary DK. Multidrug resistance and extended spectrum beta lactamase producing gram negative bacteria from chicken meat in Bharatpur Metropolitan. Nepal BMC Res Notes. 2017;10:574. doi: 10.1186/s13104-017-2917-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sudarmadi AAM, Prajitno S, Widodo ADW. Antibiotic Resistance in Escherichia coli and Staphylococcus aureus from Retail Chicken Meat in Surabaya, Indonesia. Biomol Health Sci J. 2020;3(1):109–113. doi: 10.20473/bhsj.v3i2.22170. [DOI] [Google Scholar]
  48. Telli AE, Biçer Y, Telli N, Güngör C, Turkal G, Onmaz NE. Pathogenic Escherichia coli and Salmonella spp. in chicken rinse carcasses: Isolation and genotyping by ERIC-PCR. Pak Vet J. 2022;42(4):493498. doi: 10.29261/pakvetj/2022.049. [DOI] [Google Scholar]
  49. Uddin MB, Alam MN, Hasan M, Hossain SMB, Debnath M, Begum R, Samad MA, Hoque SF, Chowdhury MSR, Rahman MM, Hossain MM, Hassan MM, Lundkvist Å, Järhult JD, El Zowalaty ME, Ahmed SSU. Molecular detection of colistin resistance mcr-1 gene in multidrug-resistant Escherichia coli Isolated from chicken. Antibiotics (basel) 2022;11(1):97. doi: 10.3390/antibiotics11010097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Ulomi WJ, Mgaya FX, Kimera Z, Matee MI. Determination of sulphonamides and tetracycline residues in liver tissues of broiler chicken sold in Kinondoni and Ilala Municipalities, Dar Es Salaam. Tanzania Antibiotics. 2022;11:1222. doi: 10.3390/antibiotics11091222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Van TT, Chin J, Chapman T, Tran LT, Coloe PJ. Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int J Food Microbiol. 2008;124(3):217–223. doi: 10.1016/j.ijfoodmicro.2008.03.029. [DOI] [PubMed] [Google Scholar]
  52. Wallinga D (2018) Turkey is bad on antibiotics—pork and beef, even worse. Available online: https://www.nrdc.org/experts/david-wallinga-md/analysis-high-intensity-antibiotics-us-beef-pork. Accessed 22 Sep 2021
  53. Wang Y, Lyu N, Liu F, Liu WJ, Bi Y, Zhang Z, Ma S, Cao J, Song X, Wang A, Zhang G, Hu Y, Zhu B, Gao GF. More diversified antibiotic resistance genes in chickens and workers of the live poultry markets. Environ Int. 2021;153:106534. doi: 10.1016/j.envint.2021.106534. [DOI] [PubMed] [Google Scholar]
  54. Wibisono FJ, Sumiarto B, Kusumastuti TA. Economic losses estimation of pathogenic Escherichia coli infection in Indonesian poultry farming. Buletin Peternak. 2018 doi: 10.21059/buletinpeternak.v42i4.37505. [DOI] [Google Scholar]
  55. Yang Y, Ashworth AJ, Willett C, Cook K, Upadhyay A, Owens PR, Ricke SC, DeBruyn JM, Moore PA., Jr Review of antibiotic resistance, ecology, dissemination, and mitigation in U.S. broiler poultry systems. Front Microbiol. 2019;10:2639. doi: 10.3389/fmicb.2019.02639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zellweger RM, Carrique-Mas J, Limmathurotsakul D, Day NPJ, Thwaites GE, Baker S. Southeast Asia antimicrobial resistance network a current perspective on antimicrobial resistance in Southeast Asia. J Antimicrob Chemother. 2017;72:2963–2972. doi: 10.1093/jac/dkx260. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (DOCX 713 kb) (713.3KB, docx)

Data Availability Statement

Data are contained within the article.

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES