Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Mar 11.
Published in final edited form as: Probiotics Antimicrob Proteins. 2023 May 13;15(4):1001–1013. doi: 10.1007/s12602-023-10089-z

Probiotic-derived ecto-5’-nucleotidase produces anti-inflammatory adenosine metabolites in Treg-deficient scurfy mice

Yuying Liu 1,*, Shabba A Armbrister 1, Beanna Okeugo 1, Tingting W Mills 2, Rhea C Daniel 1, Jee-Hwan Oh 3, Jan-Peter van Pijkeren 3, Evelyn S Park 1, Zeina M Saleh 1, Sharmistha Lahiri 1, Stefan Roos 4,5, J Marc Rhoads 1
PMCID: PMC10926147  NIHMSID: NIHMS1967145  PMID: 37178405

Abstract

Probiotic Limosilactobacillus reuteri DSM 17938 (DSM 17938) prolonges the survival of Treg-deficient scurfy (SF) mice and reduces multiorgan inflammation by a process requiring adenosine receptor 2A (A2A) on T cells. We hypothesized that L. reuteri-derived ecto-5’-nucleotidase (ecto-5’NT) activity acts to generate adenosine, which may be a central mediator for L. reuteri protection in SF mice. We evaluated DSM 17938–5’NT activity and the associated adenosine and inosine levels in plasma, gut and liver of SF mice. We examined orally fed DSM 17938, DSM 17938Δ5NT (with a deleted 5’NT gene), and DSM 32846 (BG-R46) (a naturally selected strain derived from DSM 17938). Results showed that DSM 17938 and BG-R46 produced adenosine while “exhausting” AMP, whereas DSM 17938∆5NT did not generate adenosine in culture. Plasma 5’NT activity was increased by DSM 17938 or BG-R46, but not by DSM 17938Δ5NT in SF mice. BG-R46 increased both adenosine and inosine levels in the cecum of SF mice. DSM 17938 increased adenosine levels, whereas BG-R46 increased inosine levels in the liver. DSM 17938Δ5NT did not significantly change the levels of adenosine or inosine in the GI tract or the liver of SF mice. Although regulatory CD73+CD8+ T cells were decreased in spleen and blood of SF mice, these regulatory T cells could be increased by orally feeding DSM 17938 or BG-R46, but not DSM 17938Δ5NT. In conclusion, probiotic-5’NT may be a central mediator of DSM 17938 protection against autoimmunity. Optimal 5’NT activity from various probiotic strains could be beneficial in treating Treg-associated immune disorders in humans.

Keywords: Limosilactobacillus reuteri, CD73, regulatory T cell, Treg-deficiency, autoimmunity, IPEX syndrome

Introduction

Regulatory T cells (Tregs) maintain immune homeostasis and play a pivotal role in immune tolerance [1]. Forkhead box protein 3 (Foxp3) is a major transcription factor that is associated with Treg cell development and function [2]. Genetic mutations or deletions of the Foxp3 gene result in a primary immunodeficiency (PID) disease known as IPEX (immunodysregulation, polyendocrinopathy, and enteropathy, with X-linked inheritance) syndrome in humans [3,4]. The most common clinical presentation of IPEX syndrome is the classical triad of enteropathy, type I diabetes, and eczema, with early disease onset (the median age at disease onset 1.5–2 months) [3–7]. The scurfy (SF) mouse, bearing a mutation in the Foxp3 gene, displays a similar clinical phenotype with early onset dermatitis, progressive multiorgan inflammation, and death within the first month of life caused by a lymphoproliferative syndrome [8,9].

One key mechanism by which Tregs control inflammatory effector T cells (Teffs) (including Th1 and Th2 cells) has been the adenosine pathway, wherein extracellular adenosine triphosphate (ATP) is promptly converted into adenosine through the coordinated activity of CD39 and CD73 (the latter the same as 5’-nucleotidase, 5’NT activity) [10]. CD39 and CD73 are highly expressed on the surface of Foxp3+Tregs and are increasingly used as markers of Tregs [11]. Upon Treg-derived adenosine’s release into the extracellular compartment, adenosine exerts anti-inflammatory functions via stimulation of specific G-protein-coupled receptors (adenosine receptors), which are predominantly expressed on Th1 and Th2 lymphocytes [12], inhibiting Th1/Th2 differentiation reducing inflammation [10]. In addition, adenosine generation triggers a self-reinforcing loop of Treg functions due to the stimulation of one adenosine receptor, A2A, on Tregs, eliciting A2A expansion, and enhanced Foxp3 expression, ans increasing immunoregulatory activity [10,13].

The mechanism of Treg-derived adenosine to inhibit Th1/Th2 is unknown in human IPEX syndrome and SF mice. Previous studies found severe CD4+Th1 and Th2-cell-induced pathology in SF mice [14,15] and in IPEX syndrome in humans [16,17]. The intestinal microbiota drives host immune homeostasis by regulating the development T cells [18]. We have demonstrated the evolution of autoimmunity and microbial dysbiosis in the SF mice. We found that oral administration of probiotic Limosilactobacillus reuteri DSM 17938 (DSM 17938) remodeled gut microbiota and suppressed autoimmunity. DSM 17938 markedly prolonged the SF mouse’s lifespan from <1 month to > 4 months [19].

Probiotics have the capacity to induce large-scale changes in the host microbiota composition and also to modulate the global metabolic function of the intestinal microbiome [20–22]. Probiotic DSM 17938 has been shown to have a mutualistic relationship between microbe and host [23–25]. Commercially available worldwide, DSM 17938 was derived from Limosilactobacillus reuteri ATCC 55730 (subcultured from a Peruvian mother’s breast milk) by removing two plasmids harboring antibiotic resistance genes [26]. DSM 17938 inhibits pathogen growth and modulates the immune system [21]. In humans, DSM 17938 also reduces the severity of acute infant diarrhea [27–29]; may reduce the incidence of necrotizing enterocolitis (NEC) in premature infants [30–33]; and has been shown to reduce crying time in babies with colic [34,35].

We have tested the effects of DSM 17938 in several mouse models of human inflammatory and autoimmune diseases. We found this strain prevents experimental necrotizing enterocolitis (NEC) in newborn animals while inhibiting the toll-like receptor (TLR) 4-mediated NF-κB pathway [36], facilitating the induction of Tregs, and lowering the number of Teffs in the intestinal mucosa [37,38] – by a mechanism requiring TLR2 [39]. In addition, DSM 17938 reduced the severity of experimental autoimmune encephalomyelitis (EAE), a mouse model of multiple sclerosis mainly driven by Th1- and Th17cell- induced inflammation [40]. Both of these conditions were associated with altered gut microbiota [41–43].

In testing the effect of DSM 17938 on SF mice, we identified a novel mechanism wherein the adenosine receptor 2A (A2A) expressed predominantly on T cells was required for probiotic protection, inasmuch as DSM 17938 had no therapeutic effect on SF mice with A2A knocked out [19,44]. We discovered that the adenosine metabolite inosine (formed from adenosine by the action of adenosine deaminase, ADA) was reduced in plasma of SF mice and was restored by DSM 17938 treatment, probably because DSM 17938 has ecto-5-nucleotidase (ecto-5’NT) activity comparable to CD73, producing adenosine. Oral administration of inosine to SF mice also prolonged the survival and controlled inflammation (in multiple organs) by acting as an A2A agonist [19].

A major gap in probiotic biology has been our lack of understanding how DSM 17938 can activate the adenosine pathway and whether during Treg-deficiency, a probiotic-derived 5’NT activity, if present, could play an important role in generation of adenosine. In this study, we focused on evaluating the probiotic-derived 5’NT activity in vitro bacterial culture and the effect of probiotic-derived 5’NT on host plasma 5’NT activity, adenosine, and inosine levels.

Material and methods

Mice

Wild-type (WT) C57BL/6J and heterozygous B6.Cg-Foxp3sf/J mice were purchased from Jackson Laboratories and allowed to acclimatize for 2 weeks before experimentation. SF mice with hemizygous B6.Cg-Foxp3sf/Y were generated from breeding heterozygous B6.Cg-Foxp3sf/J female (Jackson Lab 004088) to C57BL/6J male (Jackson Lab 000664). Only male mice were used in this study due to the Foxp3 gene existing on the X chromosome. In each litter of breeding pairs, all males were either SF used as experimental groups or WT littermates used as the control groups. all mice were housed in the animal facility at the UT Health Science Center at Houston. This study was carried out in accordance with the recommendation of the Guide for the Care and Use of Laboratory Animals (NIH) and the Institutional Animal Care and Use Committee (IACUC) of the University of Texas Health Science Center at Houston has approved the study (protocol numbers: AWC-20-0032).

Preparation of Probiotics

Probiotic DSM 17938 and DSM 32846 (BG-R46) were provided by BioGaia AB (Sweden). DSM 32846 (BG-R46) is a new probiotic strain obtained after selective breeding of DSM 17938 with higher levels of bile acid tolerance and adenosine production [45]. These probiotics were prepared as described previously [19]. Briefly, probiotics were anaerobically cultured in deMan-Rogosa-Sharpe (MRS) medium at 37°C for 24 h followed by plating in MRS agar at specific serial dilution and culturing anaerobically at 37°C for 48–72 h. quantitative analysis for bacteria in culture media was performed by comparing optical density (OD) at 600 nm of cultures at known concentrations using a standard curve of bacterial colony forming unit (CFU)/mL grown on MRS agar.

Adenosine metabolism-associated enzymes: bacterial proteomic analysis

Sixteen-hour-DSM 17938 culture in MRS (n=6) were collected and washed with phosphate buffered saline (PBS) three times before pellets were stored at −80° C until ready for use. Pellets were suspended in 500 μL of 40 mM Tris, 30 mM NaCl, pH 8.0, and protease inhibitor, then sonicated 6 times (10 s/cycle, 15 s in between cycles). All samples were then centrifuged at 15.4 g for 5 min at 10°C, and supernatants were saved. Protein concentrations of each samples were measured using DC™ Protein Assay (BioRad, Hercules, CA USA) according to manufactuer’s protocol. Aliquots of 50 μg of samples were sent to the Clinical and Translational Proteomics Service Center at the Institute of Molecular Medicine at The University of Texas Health Science Center at Houston for proteomic analysis, as described in our previous study [46]. The raw peptide data files were processed using Thermo Scientific Proteome discoverer TM software version 1.4 (Waltham, MA, USA). Spectra were searched against the Limosilactobacillus reuteri (previously Lactobacillus reuteri) strain ATCC 55730/SD2112, the parent strain of DSM 17938 [23] database using Sequest HT search engine [46].

By searching the genome of DSM 17938 [23] from UniProt (https://www.uniprot.org/) ELIXIR core data resources and confirmed proteins/genes in the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/protein/), we found that DSM 17938 contains a gene encoding a protein with homology to the 5’NT, named as LPXTG-motif cell wall anchor domain protein (https://www.uniprot.org/uniprot/F8DRN6) predicted to convert AMP to adenosine. Proteomics data have been reported in previous study [46]. We focused on detection of this enzyme (peptide) in DSM 17938 bacterial lysates, expressed as protein score (Score), the percentage of the protein sequence covered by identified peptides (Coverage), the number of distinct peptide sequences in the protein (#Peptides), and the total number of identified peptide sequences for the protein (#PSMs).

Generation of 5’NT deletion strain of probiotic DSM 17938 (DSM 17938Δ5NT)

To delete 5’NT gene in DSM 17938, we used a counter-selection plasmid pVPL3002 that is broadly applicable in lactobacilli [47]. Ligase cycling reaction (LCR) [48] was performed to clone the upstream (oVPL3468–3469) and downstream (oVPL3470–3471) flanks of 5NTE gene in pVPL3002 backbone (oVPL187–188) by using three bridging oligos (oVPL3472, 3473, and 3474) to yield pVPL31137 in E. coli EC1000 [47] (oligonucleotides/ plasmid Table 1). First, pVPL31137 (2–5 μg) was electroporated in DSM 17938 followed by recovery in MRS (3 h at 37°C) and plating on MRS agar containing 5 μg/mL erythromycin. Erythromycin-resistant colonies were screened by colony PCR to confirm single-crossover homologous recombination using oVPL49-3475-3476 and oVPL97-3475-3476 for upstream and downstream integration of pVPL31137, respectively. Upon confirmation of single-crossover homologous recombination, a single colony was cultured in MRS for 20 h and plated on MRS agar containing 500 μg/mL vancomycin, which yields only colonies after a second homologous recombination event. Deletion of 5’NT gene was confirmed with oVPL3522–3476 (Supplementary Figure 1), and the sequence integrity was verified by Sanger sequencing. The resultant strain was named VPL4171 (DSM 17938Δ5NT).

Table 1.

Primers used for amplifying u/s and d/s flanking sequence

SCO screening oligo (d/s) oVPL49 acaatttcacacaggaaacagc
SCO screening oligo, (u/s) oVPL97 cccccattaagtgccgagtgc
u/s flank Fwd oVPL3468 tgctgatcaggcgtatggta
u/s flank Rev oVPL3469 tatagtcctaacagcgctgtcc
d/s flank Fwd oVPL3470 agctgaccagcaagcagctt
d/s flank Rev oVPL3471 ctgaccatgatggagagcaa
Bridging oligo1 oVPL3472 aaacgacggccagtgaattcgagctcggtatgctgatcaggcgtatggtagatttttgaa
Bridging oligo2 oVPL3473 attgttagggacagcgctgttaggactataagctgaccagcaagcagctttaccacaaac
Bridging oligo3 oVPL3474 atccagttaattgctctccatcatggtcagatcctctagagtcgacctgcaggcatgcaa
DCO screening oligo, Fwd oVPL3522 atagcgaccgttgtttccac
DCO screening oligo, Rev oVPL3476 ttactcgcatttggtgagca
Open in a new tab

d/s: downstream, u/s: upstream, SCO: single-crossover, DCO: double-crossover

Probiotic culture preparation for measuring probiotic ecto-5`-nucleotidase (5’NT) activity

Overnight-cultured probiotics DSM 17938, BG-R46, and DSM17938Δ5NT were sampled to calculate CFU/mL, based on OD600nm against a standard curve. Immediately, 5 mL of bacterial cultures were treated with 400 μM AMP, 10 μM Deoxycoformycin (ADA inhibitor, from Sigma-Aldrich), and 10 μM Dipyridamole (nucleoside transport inhibitor, from Sigma-Aldrich); and 5 mL of control bacterial cultures had no added AMP. A “media control” had 5 mL of MRS bacterial culture medium. Cultures were incubated anaerobically at 37° C with shaking (220 rpm), and the culture supernatants were collected by centrifuge at 0 min, 5 min, 15 min, 30 min and 60 min, followed by storing at −80 ° C for measuring adenosine and AMP levels by using reverse-phase high-performance liquid chromatography (HPLC). The adenosine levels were expressed as nmoles/109 CFU bacteria. The AMP levels were expressed as μM.

Treatment of mice and collection of blood and tissues for analysis

Newborn male mice (both SF and WT littermate) mice from SF breeding pairs stayed with their dams and were given by gavage DSM 17938, BG-R46 or DSM 17938Δ5NT in fresh MRS medium or control MRS medium. The experimental groups included WTC (WT male fed with MRS), SFC (SF mice fed with MRS), SF+DSM 17938 (SF mice fed with DSM 17938), SF+BG-R46 (SF mice fed with BG-R46), and SF+DSM17938Δ5NT (SF mice fed with DSM 17938Δ5NT). Oral gavage feeding started from day of life 10 (d10), once a SF phenotype could be recognized; gavage feeding was daily from d10 to d20, containing 107 CFU in 100 μL. We used a Nutriline 1252.31G catheter (VYGON GmbH & Co., KG, Germany) to gavage the newborn mouse less than 12 d of age; and a polypropylene feeding tube (22-gauge × 25 mm, Instech Laboratories, Inc., Plymouth Meeting, PA) to gavage the newborn mouse after d12 of age. At d21 (weaning date), blood and tissues including duodenum, jejunum, ileum, cecum, colon, liver, lung, and spleen were collected. To 200 μL of plasma, we immediately added nucleoside preservation cocktail (NPC) containing 10 μmole/L deoxycoformycin, 10 μmole/L dipyridamole, and 10 μmole/L-adenosine-5-a, b-methylene diphosphate (a CD73, 5’NT inhibitor, from Sigma-Aldrich) to prevent adenosine degradation. Samples were stored at −80°C freezer for further nucleoside purification and HPLC. Another 20 μL of plasma without addition of NPC was stored for measuring ecto-5’NT activity. Collected Tissues were freshly frozen and stored at −80°C for further processing to assess adenosine and inosine levels by HPLC.

Plasma and tissue preparation for assessing the levels of adenosine, inosine, AMP, and 5’NT activity

Nucleosides were extracted from the plasma or the tissues using perchloric acid (PCA) extraction procedure [49]. Briefly, mouse plasma was collected or tissue lysates were prepared in the presence of protease inhibitor cocktail and nucleosides-preserving cocktail (10 µmole/L dipyridamole; 10 µmole/L deoxycoformycin, and 10 µmole/L αβ-methylene ADP), and plasma was mixed with 0.4 mole/L (0.4 N) PCA to precipitate the proteins. Samples were then neutralized with KHCO3/KOH, followed by acidification with NH4PO4 and phosphoric acid. The supernatant was collected after centrifugation and analyzed by reverse-phase HPLC as described previously [50–53]. Representative adenosine, inosine, and AMP peaks were identified and quantified using standard external curves. Data were normalized to the total protein amount of tissue lysates. 5’NT activities were measured as the amount of AMP converted to adenosine by each μL of plasma in 30 mins at 37 degrees. The samples were heat-inactivated at 95 degrees for 5 mins at the end of the reaction. Adenosine generated was measured using HPLC and presented as nmole adenosine/μL/min.

Spleen single cell suspension preparation and blood cells for analyzing CD73 expression in T cells

Single cell suspensions from the spleen were obtained by gently fragmenting and filtering the tissues through 40-μm cell strainers (BD Bioscience, San Jose, CA) into RPMI 1640 (Sigma-Aldrich, St. Louis, MO) complete medium. MACS buffer consisting of phosphate-buffered saline, 0.5% bovine serum albumin (Hyclone GE Life Science, Logan, UT), and 2 mM EDTA (Lonza, Bethesda, MD) was used for washing the cells. Finally, cells were resuspended in MACS buffer for surface and intracellular staining using specific anti-mouse antibodies. The antibodies that we used were CD4 (GK1.5) conjugated with peridinin-chlorophyll protein/cyanine 5.5 (PerCP/Cy5.5), CD8a (53–6.7) conjugated with brilliant violet 421, CD73 (TY/11.8) conjugated with allophycocyanin (APC), CD25 (PC61) conjugated with Alexa Fluor (AF) 700, and Foxp3 (150D) conjugated with AF 488 for T cell analysis. All antibodies were purchased from BioLegend (San Diego, CA). All samples were analyzed with BD LSRFortessa Flow Cytometer (BD Bioscience) and processed with FlowJo (FlowJo, BD, Ashland, OR). For gating strategies for the flow cytometry (Supplementary Figure 2), we initially defined the lymphocyte population, followed by identifying the % of CD4+T cells and CD8+T cells among the lymphocytes. Further separation of CD73+CD8+ in CD8+T cells and CD73+CD4+ in CD4+T cells, as well as Foxp3+Treg in CD4+T cells and CD25+ activated CD4+ in CD4+T cells were defined as shown and % was recorded.

Statistical analysis

Two-way ANOVA with Tukey’s Multiple Comparisons Test was used to compare the significance of adenosine levels in culture medium with 4 groups (MRS control, DSM 17938, DSM 17938Δ5NT and BG-R46), samples of which were measured in four different time points for each group. Significance in all other experiments was determined using one-way ANOVA with Tukey’s Multiple Comparisons Test. Computed Pearson correlation coefficients analysis was used for correlation analysis. The statistical analysis was performed using GraphPad Prism version 9.4.1 (GraphPad Software, San Diego, CA). Data are represented as means ± SD. Values p<0.05 were considered statistically significant. Only p values < 0.05 between groups are indicated in the Figures.

Results

Gene encoded 5’NT peptides associated with adenosine generation is detected by proteomics analysis

Peptides that encoded by gene LPXTG-motif cell wall anchor domain protein (F8DRN6) with 5’NT function to convert AMP to adenosine were detected with different expression measurement units including protein score, coverage, number of peptides and number of PSMs (Figure 1a) to confirm the transcript.

Figure 1.

Figure 1.

Open in a new tab

Probiotic-derived 5’NT activity in bacterial culture. a: Proteomics analysis detected 5’NT encoded peptides in bacterial lysates (n=6). From proteomic analysis, specifically detected 5’NT encoded peptides were expressed as protein score (Score), the percentage of the protein sequence covered by identified 5’NT peptides (Coverage), the number of 5’NT peptide sequences in the protein (#Peptides), and the total number of 5’NT peptide sequences for the protein (#PSMs). b: Probiotic-derived 5’NT converting AMP to adenosine in culture medium with incubation time (n=4 indepednet experiments). c: AMP levels in the culture medium (n=4 independent experiments). Two-way ANOVA with Tukey’s Multiple Comparisons Test was used to compare the significance of adenosine levels in culture medium in 4 groups of MRS control, DSM 17938, DSM 17938Δ5NT and BG-R46 respectively with four time points. Only p values which are significant are shown in the Figure 1b.

DSM 17938 and BG-R46 have 5’NT enzymatic activity to convert AMP to adenosine

We measured adenosine levels by HPLC in bacterial culture medium after addition of AMP. The adenosine levels were normalized by bacterial CFUs in culture to evaluate the ability of bacteria to convert AMP to adenosine by probiotic-5’NT; importantly, inhibitors were added to prevent adenosine degradation. The levels of AMP (nmole/mL=μM) in the culture medium were assessed by HPLC. We found that at as early as 5 min after addition of 400 μM of AMP to DSM 17938 bacterial culture, adenosine was detected, and the levels increased over the time of culture, whereas no adenosine was detected in DSM 17938Δ5NT cultures. The results also showed even higher levels of adenosine in cultures of probiotic BG-R46 compared to DSM 17938 (Figure 1b). By measuring concentrations of AMP in the media, we showed that AMP was consumed and converted to adenosine by both strains, DSM 17938 and BG-R46.

Probiotic-derived 5’NT plays a role in plasma levels of adenosine and inosine and 5’NT activity

Plasma levels of adenosine and inosine at normal WT mice are very low: <0.1 nmole/mg total protein (for adenosine, Figure 2a) and <0.02 nmole/mg total protein (for inosine, Figure 2b). SF mice showed significantly decreased plasma levels of adenosine and inosine compared to controls. However, oral gavage feeding of DSM 17938 significantly increased plasma inosine (Figure 2b), while feeding BG-R46 to SF mice significantly increased plasma levels of adenosine and inosine. As expected, DSM 17938Δ5NT strain did not affect plasma levels of adenosine and inosine (Figure 2a and 2b). Soluble 5’NT (CD73) activity in plasma was also measured; and results demonstrated that the 5’NT activity in SF mice was significantly reduced compared to WT mice, while 5’NT activity was increased by oral feeding of DSM 17938 or BG-R46. BG-46 was more potent than DSM 17938 in enhancing plasma 5’NT activity (Figure 2c). However, DSM 17938Δ5NT did not affect 5’NT activity in SF mice, indicating DSM 17938-derived 5’NT plays an important role in adenosine metabolism in SF mice.

Figure 2.

Figure 2.

Open in a new tab

Plasma levels of adenosine, inosine and 5’NT activity in SF mice after feeding DSM 17938, BG-R46, or DSM 17938Δ5NT. a: plasma adenosine level in SF mice. b: plasma inosine level in SF mice. c: plasma 5’NT activity in SF mice. Levels were measured by HPLC. Data are represented as mean ± SD. n=5–8 mice per group. One-way ANOVA with Tukey’s Multiple Comparisons Test was used to compared the significance between groups. Only p values which are significant are shown in the Figures.

Probiotic-derived 5’NT increases levels of adenosine and inosine in the gut and liver of SF mice

We measured the levels of adenosine and inosine in different regions of the gastrointestinal tract (duodenum, jejunum, ileum, cecum, and colon) and in liver and spleen, and we normalized the levels from nmole/mL (by HPLC) to total protein concentration (mg/mL). Subsequently, the levels were expressed as nmole/mg total protein. We found that adenosine levels are < 10 nmole/mg; and no significant differences were observed between SF and WT mice; also, the adenosine levels were not significantly affected by probiotic treatment in the duodenum, jejunum, and ileum (Figure 3a: (a)-(c)). However, we observed a significantly increased amount of adenosine in the cecum of SF mice when the mice orally feed with probiotic BG-R46 (Figure 3-a: (d)). Note that, in the colon, the adenosine levels in SF mice were significantly reduced compared to that in WT mice, with no enhancement by probiotics (Figure 3a: (e)). In the liver of SF mice, the adenosine levels were increased by DSM 17938 but not by BG-R46 and DSM 17938Δ5NT (Figure 3a: (f)); whereas BG-R46 significantly increased levels of the metabolite inosine levels in the liver of SF mice (Figure 3b: (f)).

Figure 3.

Figure 3.

Open in a new tab

Adenosine and inosine levels in gut and liver of SF mice after probiotic treatment. a: Adenosine levels in duodenum (a), jejunum (b), ileum (c), cecum (d), colon (e), and liver (f). b: Inosine levels in duodenum (a), jejunum (b), ileum (c), cecum (d), colon (e), and liver (f). n=5–8 mice per group. Note that only in panels (d)-(f) were there any significant differences in regional expression. Data are represented as mean ± SD. n=5–8 mice per group. One-way ANOVA with Tukey’s Multiple Comparisons Test was used to compared the significance between groups. Only p values which are significant are shown in the Figures.

Inosine could be measured in the duodenum, jejunum, ileum and colon; however, the concentrations were less than 5 nmole/mg and were not affected by probiotic treatment (Figure 3b: (a)-(c) (e)) - except in the cecum, where BG-R46 significantly increased inosine levels (Figure 3b: (d)), similarly to the increase in adenosine level in the cecum.

In summary, BG-R46 increased both adenosine and inosine levels in the cecum of SF mice. DSM 17938 increased adenosine levels in the liver of SF mice, whereas BG-R46 increased inosine levels in the liver of SF mice. Again, the 5’NT mutant strain DSM 17938Δ5NT did not change the levels of adenosine or inosine in the GI tract or the liver of SF mice (Figure 3).

Probiotic-derived 5’NT participates in immune regulation

Immune cells, specifically T cell populations in the spleen and blood, were analyzed by flow cytometry. We defined CD4+T cells and CD8+T cells in the lymphocyte population and further analyzed CD39 and CD73-expressing CD4+T cell and CD8+T cells and activated CD25+T cells. We found that CD73+CD8+ T cells were significantly decreased in both spleen and blood of SF mice, a lymphocyte populatoin which could be increased by orally feeding SF mice with either DSM 17938 or BG-R46. These probiotic-related increases did not reach the levels found in normal WT mice (Figure 4a). Orally feeding of DSM 17938Δ5NT to SF mice did not change the percentage of CD73+CD8+ T cells (Figure 4a), indicating probiotic 5’NT plays an important role in regulating this cell population. We also observed that SF mice had increased CD8+T cells in spleen and blood compared to that in WT mice, percentages which could be reduced by BG-R46, but not by DSM 17938 (Figure 4b) (Figure 4a).

Figure 4.

Figure 4.

Open in a new tab

Regulatory CD73+CD8+T cells affected by orally feeding DSM 17938, BG-R46, or DSM 17938Δ5NT to SF mice. a: The proportion of CD73+CD8+T cells among CD8+T cells in spleen and blood analyzed by flow cytometry. b: The proportion of CD8+T cells in lymphocyte population in spleen and blood. c: The proportion of activated CD4+T cells among CD4+T cells in spleen and blood. d: The correlation between adenosine levels and % of CD73+CD8+T in CD8+T cells in the spleen (Top) and blood (bottom). Data are represented as mean ± SD. n=5–8 mice per group. One-way ANOVA with Tukey’s Multiple Comparisons Test was used to compared the significance between groups. Only p values which are significant are shown in the Figures. Correlation analysis was performed by using Pearson Correlation Coefficients analysis.

SF mice are known to harbor increased activated CD4+T cells in the spleen and blood due to Foxp3+Treg deficiency. We observed that all 3 strains of lactobacilli (DSM 17938, BG-R46, and DSM 17938Δ5NT) were associated with reduced activated CD4+T cells in SF mice (Figure 4c).

To test if probiotic-promoted adenosine levels are related to regulatory CD8+T cells, we performed a correlation analysis and found that adenosine levels in both spleen and blood were positively correlated with the percentage of CD73+CD8+ T cells (Figure 4d).

Discussion

Different probiotic strains have pleotropic effects. Some have bacteriocidal effects toward pathogens or pathobionts, others affect gut epithelial permeability, and still others are known to down-regulate inflammation. Our lab’s contribution has been to show that certain probiotics, such as Limosilactobacillus reuteri DSM 17938, may generate adenosine in the intestine, which is associated with reduced inflammation. This concept is based on our finding that the beneficial effect of DSM 17938 on a the scurfy mouse, a model of human IPEX syndrome, is dependent on adenosine receptor A2A on T cells. The adenosine metabolite inosine was found to act as an agonist of its receptor to produce therapeutic effects [19,44]. We found that Treg-derived adenosine interacted with A2A expressed on Teff to inhibit Th cell differentiation and reduce inflammation. Formation of extracellular adenosine requires CD39 and CD73 present on Treg cells [54]. In Treg-deficient SF mice, this protective mechanism is disrupted.

Mechanistically, adenosine may be generated by modulation of host gut enzymatic activities and/or by microbial enzymes. DSM 17938 contains a gene encoding a secreted ecto 5’nucleotidase (5’NT). In probing a newly discovered mechanism of action of DSM 17938, we aimed to determine whether microbial 5’NT plays a role in adenosine production. In this study, we confirmed that DSM 17938 produced adenosine while “exhausting” AMP. DSM 17938∆5NT had no effect on adenosine production.

Mammalian CD73 is a 71kDa homodimer which can be a membrane-bound phospholipase or a soluble form of the protein [55]. Host soluble CD73 can be purified from tissues such as human placenta and shows a similar affinity for AMP as the membrane-bound form [56]. Previous studies showed that the host soluble CD73 can result from protein shedding through hydrolysis by endogenous membrane phospholipase or by proteolytic cleavage [55,57]. In our study, SF mice have lower levels of plasma 5’NT (CD73) activity compared to those of WT mice, indicating that there is likely reduced endogenous CD73 generated by host cells such as intestinal epithelial cells and/or immune cells in SF mice. We showed that both probiotic strains DSM 17938 and BG-R46 increased mouse plasma 5’NT enzymatic activity in SF mice, whereas the mutant strain with a deleted 5’NT gene was inactive (with no change in the mouse plasma level of 5’NT activity) in SF mice. We inferred that this increased soluble 5’NT activity in peripheral blood of SF mice most likely originated from the probiotic. It is possible that probiotic DSM 17938-derived 5’NT in the intestine caused from microbial shedding to yield the free form to the circulating blood; but it is also possible that bacterial 5’NT in the intestine upregulated endogenous CD73 from enterocytes and/or from lamina propria immunue cells that was released as the free form of 5’NT. We showed in this study that bacterial 5’NT did promote endogenous CD73 expression on T cells.

CD73 is one of a number of ectoenzymes that are present in soluble form in peripheral blood. Other enzymes that participate in purine-metabolism, such as alkaline phosphatase, adenosine deaminase, ATP-degrading enzyme (CD39) and ATP-regenerating kinases are also present, indicating a complex network of enzymatically active molecules that can counterbalance purinergic signaling to modulate the immune response [55]. Specifically, one of the functions of this network is involved in maintaining Treg cell stability [58]. In Foxp3+Treg deficient SF mice, it appears that the balance of purine metabolism is disrupted, because our results show reduced levels adenosine, inosine, and CD73 activity in plasma, along with significantly reduced populations of CD73+CD8+T cells in spleen and blood.

Studies in healthy infants demonstrate that probiotics cannot permanently change intestinal microbiota community structure or diversity [59], and colonization resistance may be one of the important reasons for limitation of the long-term effects of probiotics. The SF mouse has been characterized by gut microbial dysbiosis [19]. Our finding in this study that BG-R46, a naturally selected strain from DSM 17938 [45], significantly increased adenosine levels in cecum in the SF mice after gavage feeding. We hypothesize that the cecum may be a site for generating adenosine and its metabolite inosine, further being absorped and translocated to sites such as the liver to execute its anti-inflammatory actions. In fact, we found that BG-R46 increased levels of adenosine in the plasma, while both probiotics increased levels of inosine in plasma and liver. It should be noted that studies in mouse models and human cells and tissues have identified that the production of adenosine and its subsequent signaling through its receptors plays largely beneficial roles in acute or early disease states such as inflammation [60]. In contrast, beyond the acute/early phase, adenosine signaling can become detrimental and promote tissue injury and fibrosis such as lung or liver fibrosis [61,62]. Probiotic-derived adenosine and its metabolite inosine have beneficial effects in SF mice when adenosine-producing DSM 17938 is given before or shortly after SF mice exhibit significant multi-organ inflammation in the liver and lung [19,44].

In vivo, the converstion of adenosine to inosine may happen rapidly because of the much shorter biological half-life of adenosine compared with inosine [63]. The observation of sometimes discrepant adenosine and inosine levels (for example, increased adenosine by DSM 17938 versus increased inosine by BG-R46 in the liver of SF mice) could be an artifact of rapid conversion and perhaps less than 100% blocking of ADA by deoxycoformycin. In our previous studies, we showed that DSM 17938 feeding increases in the levels of adenosine or inosine expressed either as a relative fold change or an intensity scale in the plasma of healthy newborn [64] or Treg-deficienct SF mouse [19,65]. The current study provided absolute values of measured adenosine and inosine and confirmed the observations from our previous studies.

Recent studies have shown that bacterial extracellular membrane vesicles isolated from BG-R46 and DSM 17938 have 5’NT activity in vitro, and their administration upregulated IL-1beta and IL-6 produced by peripheral blood mononuclear cells (PBMCs) but dampened IFN-γ and TNF-α responses in PBMC challenged with Staphylococcus aureus [45]. In Treg-deficienct SF mice, possible mechanisms for high levels of adenosine and inosine in the plasma and liver after probiotic feeding include: (a) probiotic-5’NT generated from adenosine/inosine in the cecum may be transported via nucleotidase transporters to the blood; (b) soluble or MV bound probiotic-derived 5’NT could be released into the blood and could have enzymatic activity in the liver to convert AMP to adenosine; and (c) higher levels of ATP in the inflamed liver in SF mice could provide a source for probiotic-derived 5-NT to generate more adenosine or inosine.

CD73+CD8+T cells have been shown to have regulatory functions relevant to autoimmune disorders. Recent studies showed CD8+T cells yielded extracelluar vesicles (EVs) into cell culture supernatants with enzymatically active CD73. These activated CD73+CD8+T cell-derived EVs are immunosuppressive, for example in patients with juvenile idiopathic arthritis [66]. In SF mice, the % of CD73+CD8+T cells significantly decreased in the spleen and blood compared to that in WT mice. We hypothesized that DSM 17938 and BG-R46-derived 5’NT activity could enhance the proportion of CD73 expressing CD8+T cells in spleen. We found that 5’NT-mediated adenosine generation positively correlated with CD73+CD8+T cell numbers.

The inflammation of SF mice due to Treg-deficiency is mainly associated with Th1 and Th2 responses [14,15,19]. In the current study, we found an increase in activated CD4+T cells in the spleen and blood of SF mice compared to WT mice, while probiotic DSM 17938 and BG-R46 reduced the percentage of activated CD4+T cells. Interestingly, DSM 17938Δ5NTE also reduced activated CD4+T cells, indicating other possible anti-inflammatory mechanisms of this probiotic. As an example of another anti-inflammatory mechanism, we previously found in a NEC model that DSM 17938 promotes tolerogenic DCs via TLR2 to reduce inflammation [39]. The membrane vesicles isolated from BG-R46 and DSM 17938 carry the TLR2 agonist lipoteichic acid [45].

In conclusion, probiotic-derived 5’NT plays a central role in DSM 17938-mediated protection against autoimmunity in Treg-deficient SF mice. In humans, primary immunodeficiency diseases associated with Treg-deficiency/dysfunction are not limited to IPEX syndrome. There are a number of IPEX-like syndromes with a normal FoxP3 genotype, as well as other single gene defects that affect the function of Tregs, including CD25, the signal transducer and activator of transcription (STAT)5b, itchy E3 ubiquitin protein ligase (ITCH), the cytotoxic T lymphocyte antigen-4 (CTLA4), and Wiskott-Aldrich syndrome gene (WAS) [67]. Mechanistic insights in adenosine generation by probiotic-5’NT that are involved in immune regulation could eventually allow screening of various probiotic strains to determine which is capable of nucleoside signaling to be used for treating Treg-associated immune disorders in humans.

Supplementary Material

Supplementary Figures

Supplementary Figure 1. PCR by using oVPL3522–3476 to confirm the mutations of 5’-NT in DSM 17938. a. Bands in gel electrophoresis show DSM 17938 (3,950 bp) and two 5’-NT mutants (1,877 bp), VPL4171 and VPL4172. VPL4171 was selected, named DSM 17938∆5NT for this study. b. 5’-NT gene sequence. Deletion of 2073 bp was highlighted as yellow color.

Supplementary Figure 2. Gating strategies for the flow cytometry. We initially defined the lymphocyte population, followed by identifying the % of CD4+T cells and CD8+T cells among the lymphocytes. Further separation of CD73+CD8+ in CD8+T cells and CD73+CD4+ in CD4+T cells, as well as Foxp3+Treg in CD4+T cells and CD25+ activated CD4+ in CD4+T cells were defined as shown and % was recorded.

Funding

This study has been funded by National Institutes of Health (NIH)/National Institute of Allergy and Infectious Diseases (NIAID) R03AI153725 (Y Liu), NIH/National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS) R01AR073284 (TW Mills) and NIH/National Institute on Aging (NIA) R56AG076144 (TW Mills), and in part, by BioGaia AB Investigator Initiated Research Fund (JM Rhoads).

Footnotes

Declarations of Conflict of interest

Stefan Roos has part-time employment by BioGaia AB, Stockholm, Sweden. Jan-Peter van Pijkeren is the founder and owner of the consulting company Next-Gen Probiotics, LLC. Other authors declare no conflict of interest, financial or otherwise.

Data Availability

Most data generated or analysed during this study are included in this published article. Those data generated and/or analysed during the current study that are not published here are available from corresponding author on reasonable request.

References

  • 1.Shevach EM (2008) Special regulatory T cell review: How I became a T suppressor/regulatory cell maven. Immunology 123:3–5. 10.1111/j.1365-2567.2007.02777.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Shevach EM, Tran DQ, Davidson TS, Andersson J (2008) The critical contribution of TGF-beta to the induction of Foxp3 expression and regulatory T cell function. Eur J Immunol 38:915–917. 10.1002/eji.200738111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bennett CL, Brunkow ME, Ramsdell F, O’Briant KC, Zhu Q, Fuleihan RL, Shigeoka AO, Ochs HD et al. (2001) A rare polyadenylation signal mutation of the FOXP3 gene (AAUAAA-->AAUGAA) leads to the IPEX syndrome. Immunogenetics 53:435–439. 10.1007/s002510100358 [DOI] [PubMed] [Google Scholar]
  • 4.Tan QKG, Louie RJ, Sleasman JW (1993) IPEX Syndrome. In: GeneReviews((R)), vol. (Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Gripp KW, Mirzaa GM et al. , eds). Seattle (WA): https://www.ncbi.nlm.nih.gov/pubmed/20301297 [PubMed] [Google Scholar]
  • 5.Bennett CL, Christie J, Ramsdell F, Brunkow ME, Ferguson PJ, Whitesell L, Kelly TE, Saulsbury FT et al. (2001) The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat Genet 27:20–21. 10.1038/83713 [DOI] [PubMed] [Google Scholar]
  • 6.Barzaghi F, Amaya Hernandez LC, Neven B, Ricci S, Kucuk ZY, Bleesing JJ, Nademi Z, Slatter MA et al. (2018) Long-term follow-up of IPEX syndrome patients after different therapeutic strategies: An international multicenter retrospective study. J Allergy Clin Immunol 141:1036–1049 e1035. 10.1016/j.jaci.2017.10.041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Duclaux-Loras R, Charbit-Henrion F, Neven B, Nowak J, Collardeau-Frachon S, Malcus C, Ray PF, Moshous D et al. (2018) Clinical Heterogeneity of Immune Dysregulation, Polyendocrinopathy, Enteropathy, X-Linked Syndrome: A French Multicenter Retrospective Study. Clin Transl Gastroenterol 9:201. 10.1038/s41424-018-0064-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Godfrey VL, Wilkinson JE, Russell LB (1991) X-linked lymphoreticular disease in the scurfy (sf) mutant mouse. Am J Pathol 138:1379–1387. https://www.ncbi.nlm.nih.gov/pubmed/2053595 [PMC free article] [PubMed] [Google Scholar]
  • 9.Sharma R, Deshmukh US, Zheng L, Fu SM, Ju ST (2009) X-linked Foxp3 (Scurfy) mutation dominantly inhibits submandibular gland development and inflammation respectively through adaptive and innate immune mechanisms. J Immunol 183:3212–3218. 10.4049/jimmunol.0804355 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Antonioli L, Pacher P, Vizi ES, Hasko G (2013) CD39 and CD73 in immunity and inflammation. Trends Mol Med 19:355–367. 10.1016/j.molmed.2013.03.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bono MR, Fernandez D, Flores-Santibanez F, Rosemblatt M, Sauma D (2015) CD73 and CD39 ectonucleotidases in T cell differentiation: Beyond immunosuppression. FEBS Lett 589:3454–3460. 10.1016/j.febslet.2015.07.027 [DOI] [PubMed] [Google Scholar]
  • 12.Gomez G, Sitkovsky MV (2003) Targeting G protein-coupled A2a adenosine receptors to engineer inflammation in vivo. Int J Biochem Cell Biol 35:410–414. 10.1016/s1357-2725(02)00177-2 [DOI] [PubMed] [Google Scholar]
  • 13.Borsellino G, Kleinewietfeld M, Di Mitri D, Sternjak A, Diamantini A, Giometto R, Hopner S, Centonze D et al. (2007) Expression of ectonucleotidase CD39 by Foxp3+ Treg cells: hydrolysis of extracellular ATP and immune suppression. Blood 110:1225–1232. 10.1182/blood-2006-12-064527 [DOI] [PubMed] [Google Scholar]
  • 14.Sharma R, Sharma PR, Kim YC, Leitinger N, Lee JK, Fu SM, Ju ST (2011) IL-2-controlled expression of multiple T cell trafficking genes and Th2 cytokines in the regulatory T cell-deficient scurfy mice: implication to multiorgan inflammation and control of skin and lung inflammation. J Immunol 186:1268–1278. 10.4049/jimmunol.1002677 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Suscovich TJ, Perdue NR, Campbell DJ (2012) Type-1 immunity drives early lethality in scurfy mice. Eur J Immunol 42:2305–2310. 10.1002/eji.201242391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Baris S, Schulze I, Ozen A, Karakoc Aydiner E, Altuncu E, Karasu GT, Ozturk N, Lorenz M et al. (2014) Clinical heterogeneity of immunodysregulation, polyendocrinopathy, enteropathy, X-linked: pulmonary involvement as a non-classical disease manifestation. J Clin Immunol 34:601–606. 10.1007/s10875-014-0059-7 [DOI] [PubMed] [Google Scholar]
  • 17.Chen CA, Chung WC, Chiou YY, Yang YJ, Lin YC, Ochs HD, Shieh CC (2016) Quantitative analysis of tissue inflammation and responses to treatment in immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome, and review of literature. J Microbiol Immunol Infect 49:775–782. 10.1016/j.jmii.2015.10.015 [DOI] [PubMed] [Google Scholar]
  • 18.Hooper LV, Littman DR, Macpherson AJ (2012) Interactions between the microbiota and the immune system. Science 336:1268–1273. 10.1126/science.1223490 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.He B, Hoang TK, Wang T, Ferris M, Taylor CM, Tian X, Luo M, Tran DQ et al. (2017) Resetting microbiota by Lactobacillus reuteri inhibits T reg deficiency-induced autoimmunity via adenosine A2A receptors. J Exp Med 214:107–123. 10.1084/jem.20160961 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Liu Y, Alookaran JJ, Rhoads JM (2018) Probiotics in Autoimmune and Inflammatory Disorders. Nutrients 10. 10.3390/nu10101537 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Liu Y, Tran DQ, Rhoads JM (2018) Probiotics in Disease Prevention and Treatment. J Clin Pharmacol 58 Suppl 10:S164–S179. 10.1002/jcph.1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mazziotta C, Tognon M, Martini F, Torreggiani E, Rotondo JC (2023) Probiotics Mechanism of Action on Immune Cells and Beneficial Effects on Human Health. Cells 12. 10.3390/cells12010184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Walter J, Britton RA, Roos S (2011) Host-microbial symbiosis in the vertebrate gastrointestinal tract and the Lactobacillus reuteri paradigm. Proc Natl Acad Sci U S A 108 Suppl 1:4645–4652. 10.1073/pnas.1000099107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Abuqwider J, Altamimi M, Mauriello G (2022) Limosilactobacillus reuteri in Health and Disease. Microorganisms 10. 10.3390/microorganisms10030522 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Walter J, Ley R (2011) The human gut microbiome: ecology and recent evolutionary changes. Annu Rev Microbiol 65:411–429. 10.1146/annurev-micro-090110-102830 [DOI] [PubMed] [Google Scholar]
  • 26.Rosander A, Connolly E, Roos S (2008) Removal of antibiotic resistance gene-carrying plasmids from Lactobacillus reuteri ATCC 55730 and characterization of the resulting daughter strain, L. reuteri DSM 17938. Appl Environ Microbiol 74:6032–6040. 10.1128/AEM.00991-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Francavilla R, Lionetti E, Castellaneta S, Ciruzzi F, Indrio F, Masciale A, Fontana C, La Rosa MM et al. (2012) Randomised clinical trial: Lactobacillus reuteri DSM 17938 vs. placebo in children with acute diarrhoea--a double-blind study. Aliment Pharmacol Ther 36:363–369. 10.1111/j.1365-2036.2012.05180.x [DOI] [PubMed] [Google Scholar]
  • 28.Shornikova AV, Casas IA, Isolauri E, Mykkänen H, Vesikari T (1997) Lactobacillus reuteri as a therapeutic agent in acute diarrhea in young children. J Pediatr Gastroenterol Nutr 24:399–404. 10.1097/00005176-199704000-00008 [DOI] [PubMed] [Google Scholar]
  • 29.Urbańska M, Gieruszczak-Białek D, Szymański H, Szajewska H (2016) Effectiveness of Lactobacillus reuteri DSM 17938 for the Prevention of Nosocomial Diarrhea in Children: A Randomized, Double-blind, Placebo-controlled Trial. Pediatr Infect Dis J 35:142–145. 10.1097/inf.0000000000000948 [DOI] [PubMed] [Google Scholar]
  • 30.Athalye-Jape G, Rao S, Patole S (2016) Lactobacillus reuteri DSM 17938 as a Probiotic for Preterm Neonates: A Strain-Specific Systematic Review. JPEN J Parenter Enteral Nutr 40:783–794. 10.1177/0148607115588113 [DOI] [PubMed] [Google Scholar]
  • 31.Oncel MY, Sari FN, Arayici S, Guzoglu N, Erdeve O, Uras N, Oguz SS, Dilmen U (2014) Lactobacillus Reuteri for the prevention of necrotising enterocolitis in very low birthweight infants: a randomised controlled trial. Arch Dis Child Fetal Neonatal Ed 99:F110–115. 10.1136/archdischild-2013-304745 [DOI] [PubMed] [Google Scholar]
  • 32.Rojas MA, Lozano JM, Rojas MX, Rodriguez VA, Rondon MA, Bastidas JA, Perez LA, Rojas C et al. (2012) Prophylactic probiotics to prevent death and nosocomial infection in preterm infants. Pediatrics 130:e1113–1120. 10.1542/peds.2011-3584 [DOI] [PubMed] [Google Scholar]
  • 33.Gutiérrez Escárate C, Bustos Medina L, Caniulao Ríos K, Taito Antivil C, Gallegos Casanova Y, Silva Beltrán C (2021) Probiotic intervention to prevent necrotizing enterocolitis in extremely preterm infants born before 32 weeks of gestation or with a birth weight of less than 1500 g. Arch Argent Pediatr 119:185–191. 10.5546/aap.2021.eng.185 [DOI] [PubMed] [Google Scholar]
  • 34.Gutierrez-Castrellon P, Indrio F, Bolio-Galvis A, Jimenez-Gutierrez C, Jimenez-Escobar I, Lopez-Velazquez G (2017) Efficacy of Lactobacillus reuteri DSM 17938 for infantile colic: Systematic review with network meta-analysis. Medicine (Baltimore) 96:e9375. 10.1097/MD.0000000000009375 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sung V, D’Amico F, Cabana MD, Chau K, Koren G, Savino F, Szajewska H, Deshpande G et al. (2018) Lactobacillus reuteri to Treat Infant Colic: A Meta-analysis. Pediatrics 141. 10.1542/peds.2017-1811 [DOI] [PubMed] [Google Scholar]
  • 36.Liu Y, Fatheree NY, Mangalat N, Rhoads JM (2012) Lactobacillus reuteri strains reduce incidence and severity of experimental necrotizing enterocolitis via modulation of TLR4 and NF-kappaB signaling in the intestine. Am J Physiol Gastrointest Liver Physiol 302:G608–617. 10.1152/ajpgi.00266.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Liu Y, Fatheree NY, Dingle BM, Tran DQ, Rhoads JM (2013) Lactobacillus reuteri DSM 17938 changes the frequency of Foxp3+ regulatory T cells in the intestine and mesenteric lymph node in experimental necrotizing enterocolitis. PLoS One 8:e56547. 10.1371/journal.pone.0056547 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Liu Y, Tran DQ, Fatheree NY, Marc Rhoads J (2014) Lactobacillus reuteri DSM 17938 differentially modulates effector memory T cells and Foxp3+ regulatory T cells in a mouse model of necrotizing enterocolitis. Am J Physiol Gastrointest Liver Physiol 307:G177–186. 10.1152/ajpgi.00038.2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hoang TK, He B, Wang T, Tran DQ, Rhoads JM, Liu Y (2018) Protective effect of Lactobacillus reuteri DSM 17938 against experimental necrotizing enterocolitis is mediated by Toll-like receptor 2. Am J Physiol Gastrointest Liver Physiol 315:G231–G240. 10.1152/ajpgi.00084.2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.He B, Hoang TK, Tian X, Taylor CM, Blanchard E, Luo M, Bhattacharjee MB, Freeborn J et al. (2019) Lactobacillus reuteri Reduces the Severity of Experimental Autoimmune Encephalomyelitis in Mice by Modulating Gut Microbiota. Front Immunol 10:385. 10.3389/fimmu.2019.00385 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kaplina A, Kononova S, Zaikova E, Pervunina T, Petrova N, Sitkin S (2023) Necrotizing Enterocolitis: The Role of Hypoxia, Gut Microbiome, and Microbial Metabolites. Int J Mol Sci 24. 10.3390/ijms24032471 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Markel TA, Martin CA, Chaaban H, Canvasser J, Tanner H, Denchik H, Good M (2020) New directions in necrotizing enterocolitis with early-stage investigators. Pediatr Res 88:35–40. 10.1038/s41390-020-1078-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Thirion F, Sellebjerg F, Fan Y, Lyu L, Hansen TH, Pons N, Levenez F, Quinquis B et al. (2023) The gut microbiota in multiple sclerosis varies with disease activity. Genome Med 15:1. 10.1186/s13073-022-01148-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.He B, Hoang TK, Tran DQ, Rhoads JM, Liu Y (2017) Adenosine A2A Receptor Deletion Blocks the Beneficial Effects of Lactobacillus reuteri in Regulatory T-Deficient Scurfy Mice. Front Immunol 8:1680. 10.3389/fimmu.2017.01680 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Pang Y, Ermann Lundberg L, Mata Forsberg M, Ahl D, Bysell H, Pallin A, Sverremark-Ekstrom E, Karlsson R et al. (2022) Extracellular membrane vesicles from Limosilactobacillus reuteri strengthen the intestinal epithelial integrity, modulate cytokine responses and antagonize activation of TRPV1. Front Microbiol 13:1032202. 10.3389/fmicb.2022.1032202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Mai TT, Tran DQ, Roos S, Rhoads JM, Liu Y (2019) Human Breast Milk Promotes the Secretion of Potentially Beneficial Metabolites by Probiotic Lactobacillus reuteri DSM 17938. Nutrients 11. 10.3390/nu11071548 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhang S, Oh JH, Alexander LM, Ozcam M, van Pijkeren JP (2018) d-Alanyl-d-Alanine Ligase as a Broad-Host-Range Counterselection Marker in Vancomycin-Resistant Lactic Acid Bacteria. J Bacteriol 200. 10.1128/JB.00607-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.de Kok S, Stanton LH, Slaby T, Durot M, Holmes VF, Patel KG, Platt D, Shapland EB et al. (2014) Rapid and reliable DNA assembly via ligase cycling reaction. ACS Synth Biol 3:97–106. 10.1021/sb4001992 [DOI] [PubMed] [Google Scholar]
  • 49.Li J, Conrad C, Mills TW, Berg NK, Kim B, Ruan W, Lee JW, Zhang X et al. (2021) PMN-derived netrin-1 attenuates cardiac ischemia-reperfusion injury via myeloid ADORA2B signaling. J Exp Med 218. 10.1084/jem.20210008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Aherne CM, Collins CB, Rapp CR, Olli KE, Perrenoud L, Jedlicka P, Bowser JL, Mills TW et al. (2018) Coordination of ENT2-dependent adenosine transport and signaling dampens mucosal inflammation. JCI Insight 3. 10.1172/jci.insight.121521 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Liu H, Adebiyi M, Liu RR, Song A, Manalo J, Wen YE, Wen AQ, Weng T et al. (2018) Elevated ecto-5’-nucleotidase: a missing pathogenic factor and new therapeutic target for sickle cell disease. Blood Adv 2:1957–1968. 10.1182/bloodadvances.2018015784 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Song A, Zhang Y, Han L, Yegutkin GG, Liu H, Sun K, D’Alessandro A, Li J et al. (2017) Erythrocytes retain hypoxic adenosine response for faster acclimatization upon re-ascent. Nat Commun 8:14108. 10.1038/ncomms14108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Wang W, Chen NY, Ren D, Davies J, Philip K, Eltzschig HK, Blackburn MR, Akkanti B et al. (2021) Enhancing Extracellular Adenosine Levels Restores Barrier Function in Acute Lung Injury Through Expression of Focal Adhesion Proteins. Front Mol Biosci 8:636678. 10.3389/fmolb.2021.636678 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Timperi E, Barnaba V (2021) CD39 Regulation and Functions in T Cells. Int J Mol Sci 22. 10.3390/ijms22158068 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Schneider E, Rissiek A, Winzer R, Puig B, Rissiek B, Haag F, Mittrucker HW, Magnus T et al. (2019) Generation and Function of Non-cell-bound CD73 in Inflammation. Front Immunol 10:1729. 10.3389/fimmu.2019.01729 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Klemens MR, Sherman WR, Holmberg NJ, Ruedi JM, Low MG, Thompson LF (1990) Characterization of soluble vs membrane-bound human placental 5’-nucleotidase. Biochem Biophys Res Commun 172:1371–1377. 10.1016/0006-291x(90)91601-n [DOI] [PubMed] [Google Scholar]
  • 57.Kalsi K, Lawson C, Dominguez M, Taylor P, Yacoub MH, Smolenski RT (2002) Regulation of ecto-5’-nucleotidase by TNF-alpha in human endothelial cells. Mol Cell Biochem 232:113–119. 10.1023/a:1014806916844 [DOI] [PubMed] [Google Scholar]
  • 58.Shi H, Chi H (2019) Metabolic Control of Treg Cell Stability, Plasticity, and Tissue-Specific Heterogeneity. Front Immunol 10:2716. 10.3389/fimmu.2019.02716 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Han S, Lu Y, Xie J, Fei Y, Zheng G, Wang Z, Liu J, Lv L et al. (2021) Probiotic Gastrointestinal Transit and Colonization After Oral Administration: A Long Journey. Front Cell Infect Microbiol 11:609722. 10.3389/fcimb.2021.609722 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Le TT, Berg NK, Harting MT, Li X, Eltzschig HK, Yuan X (2019) Purinergic Signaling in Pulmonary Inflammation. Front Immunol 10:1633. 10.3389/fimmu.2019.01633 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Tiwari-Heckler S, Jiang ZG (2019) Adenosinergic Signaling in Liver Fibrosis. Clin Liver Dis (Hoboken) 14:1–4. 10.1002/cld.777 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Collum SD, Molina JG, Hanmandlu A, Bi W, Pedroza M, Mertens TCJ, Wareing N, Wei W et al. (2019) Adenosine and hyaluronan promote lung fibrosis and pulmonary hypertension in combined pulmonary fibrosis and emphysema. Dis Model Mech 12. 10.1242/dmm.038711 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Viegas TX, Omura GA, Stoltz RR, Kisicki J (2000) Pharmacokinetics and pharmacodynamics of peldesine (BCX-34), a purine nucleoside phosphorylase inhibitor, following single and multiple oral doses in healthy volunteers. J Clin Pharmacol 40:410–420. 10.1177/00912700022008991 [DOI] [PubMed] [Google Scholar]
  • 64.Liu Y, Tian X, He B, Hoang TK, Taylor CM, Blanchard E, Freeborn J, Park S et al. (2019) Lactobacillus reuteri DSM 17938 feeding of healthy newborn mice regulates immune responses while modulating gut microbiota and boosting beneficial metabolites. Am J Physiol Gastrointest Liver Physiol 317:G824–G838. 10.1152/ajpgi.00107.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Liu Y, Hoang TK, Taylor CM, Park ES, Freeborn J, Luo M, Roos S, Rhoads JM (2021) Limosilactobacillus reuteri and Lacticaseibacillus rhamnosus GG differentially affect gut microbes and metabolites in mice with Treg deficiency. Am J Physiol Gastrointest Liver Physiol 320:G969–G981. 10.1152/ajpgi.00072.2021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Schneider E, Winzer R, Rissiek A, Ricklefs I, Meyer-Schwesinger C, Ricklefs FL, Bauche A, Behrends J et al. (2021) CD73-mediated adenosine production by CD8 T cell-derived extracellular vesicles constitutes an intrinsic mechanism of immune suppression. Nat Commun 12:5911. 10.1038/s41467-021-26134-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Liu Y, Freeborn J, Armbrister SA, Tran DQ, Rhoads JM (2022) Treg-associated monogenic autoimmune disorders and gut microbial dysbiosis. Pediatr Res 91:35–43. 10.1038/s41390-021-01445-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures

Supplementary Figure 1. PCR by using oVPL3522–3476 to confirm the mutations of 5’-NT in DSM 17938. a. Bands in gel electrophoresis show DSM 17938 (3,950 bp) and two 5’-NT mutants (1,877 bp), VPL4171 and VPL4172. VPL4171 was selected, named DSM 17938∆5NT for this study. b. 5’-NT gene sequence. Deletion of 2073 bp was highlighted as yellow color.

Supplementary Figure 2. Gating strategies for the flow cytometry. We initially defined the lymphocyte population, followed by identifying the % of CD4+T cells and CD8+T cells among the lymphocytes. Further separation of CD73+CD8+ in CD8+T cells and CD73+CD4+ in CD4+T cells, as well as Foxp3+Treg in CD4+T cells and CD25+ activated CD4+ in CD4+T cells were defined as shown and % was recorded.

NIHMS1967145-supplement-Supplementary_Figures.pdf (425.8KB, pdf)

Data Availability Statement

Most data generated or analysed during this study are included in this published article. Those data generated and/or analysed during the current study that are not published here are available from corresponding author on reasonable request.

RESOURCES