Skip to main content
NCBI home page
Journal of Traditional and Complementary Medicine logoLink to Journal of Traditional and Complementary Medicine
. 2023 Nov 8;14(2):203–214. doi: 10.1016/j.jtcme.2023.11.003

Eriodictyol attenuates doxorubicin-induced nephropathy by activating the AMPK/Nrf2 signalling pathway

Rehab Mustafa Badi a,∗, Eman Farok Khaleel a, Huda Hammed Satti b, Rehan Monir c,d
PMCID: PMC10927380  PMID: 38481546

Abstract

Doxorubicin (DOX), an anthracycline chemotherapy, plays a prominent role in the treatment of various cancers. Unfortunately, its nephrotoxic effects limit its dosing and expose cancer survivors to increased morbidity and mortality. This study examined the nephroprotective effects of eriodictyol, a natural polyphenolic flavanone, in DOX-treated rats and the molecular pathways involved. Forty adult rats were divided into five groups (8/group): Control; eriodictyol (20 mg/kg/day); DOX (2.5 mg/kg, twice/week); DOX + Eriodictyol; and DOX + Eriodictyol + Compound C (CC), an AMPK inhibitor (0.2 mg/kg/day). Experiments continued for 21 days. Eriodictyol administration in DOX-treated rats reduced their fasting glucose levels and increased food intake, final body weight, and kidney weight, improved kidney function, prevented glomerular and tubular damage, and reduced collagen deposition and renal TGF-β1 mRNA levels. Furthermore, eriodictyol reduced their renal levels of Bax, caspase-3, and cytochrome-c; and enhanced the levels of Bcl2. Noticeably, in the kidneys of both controls and DOX-treated rats, eriodictyol increased levels of phosphorylated-AMPK(Thr172) but not AMPK mRNA nor protein levels. Also, in the same two groups, eriodictyol increased mRNA and nuclear Nrf2 levels, and levels of glutathione, superoxide dismutase, catalase, and hemeoxygenase-1, but reduced the levels of malonaldehyde, TNF-α, and mRNA, total, and nuclear levels of NF-κB. All the detected nephroprotective effects and improvements in the levels of markers of oxidation and inflammation were prevented by coadministration of CC. In conclusion, the coadministration of eriodictyol and DOX alleviates DOX-induced renal damage. In renal tissues, eriodictyol is an AMPK activator and its nephroprotective antioxidant and anti-inflammatory effects are AMPK-dependent.

Keywords: Eriodictyol, Doxorubicin, Nephroprotective, Flavanone, p-AMPK

Graphical abstract

* and in bold: parameters which are increased by Eriodictyol in control kidneys AMPK: AMP-activated protein kinase, p-AMPK: phosphorylated AMPK (active form), Nrf2: Nuclear factor erythroid 2–related factor, NF-κB: Nuclear factor kappa-beta, TGF-β1: Transforming growth factor-β1, GSH: glutathione. MDA: Malondialdehyde/lipid peroxides,CAT: Catalase, SOD: superoxide dismutase, HO-1: Heme-oxygenase-1.

Image 1

Open in a new tab

1. Introduction

Anthracycline drugs demonstrated effective chemotherapy for a variety of cancers.1 Doxorubicin (DOX), brand name Adriamycin, is the most common anthracycline chemotherapeutic drug used for the treatment of solid and hematological tumors.2 However, doubts have been raised regarding the efficiency of DOX due to its systemic toxicities. Nephrotoxicity and chronic kidney disease (CKD) are among the well-reported side effects associated with DOX usage.3 This has been confirmed in both cancer patients and experimental animals treated with single or repeated doses of DOX.3, 4, 5, 6 Therefore preventing or alleviating DOX-associated renal damage, as well as other toxicities remains a challenge for physicians and researchers.2

Up-to-date, the precise mechanisms by which DOX mediates multi-organ damage and nephropathy remain not fully understood. However, oxidative stress is considered the major central pathological mechanism.1,7 DOX-induced oxidative stress involves its oxidation to semiquinone, interfering with iron metabolism, and scavenging of antioxidants.7 In addition, DOX-mediated nephrotoxicity is associated with altered signaling pathways which normally regulate the cellular antioxidant systems, inflammation, and fibrosis. These include impairment in the functions of nuclear factor erythroid 2–related factor 2 (Nrf2), nuclear factor kappa-beta (NF-κB), and transforming growth factor-β1 (TGF-β1) transcription factors.8, 9, 10, 11, 12 AMP-activated protein kinase (AMPK) acts as an energy sensor in the majority of mammalian cells and is stimulated by low ATP levels or a high ratio of AMP/ADP to ATP.13,14 Interestingly, suppression of AMPK was implicated in DOX-induced cardiac, hepatic, and renal damage whereas genetic or pharmacological activation of these molecules improved organs’ structure and function by attenuating oxidative stress, fibrosis, inflammation, and apoptosis.13,15,16 In this context, it was shown that AMPK stimulates antioxidant expressions by upregulating and activating Nrf2.17 In addition, AMPK can prevent cytokines production by suppressing NF-κB.17,18

Eriodictyol is a common flavanone isolated from many citrus plants.19 During the last decades, much was revealed regarding the protective effects of eriodictyol against various neoplastic, neural, pulmonary, hepatic, renal, intestinal, and cardiac disorders in different animal models.20 All these pharmacological potentials of eriodictyol were attributed to its potent antioxidant and anti-inflammatory effects which involved the activation of the Nrf2/antioxidant axis and suppression of NF-κB.20, 21, 22, 23, 24, 25 Interestingly, eriodictyol prevented cisplatin-induced renal damage in rats.26 In this regard, Li and collages26 demonstrated that the renoprotective effect of eriodictyol in these cisplatin-treated rodents included the suppression of reactive oxygen species (ROS), upregulation of antioxidants, and inhibition of inflammatory cytokines production through upregulation of Nrf2 and inhibition of NF-κB.26 Unlike their nephroprotection in cisplatin nephrotoxicity, the protective effect of eriodictyol on DOX-mediated nephrotoxicity was never investigated before, This deserved further research, given the reported anti-cancer efficiency of DOX.

Yet, several plant-derived flavonoids such as Fisetin, Quercetin, resveratrol, and berberine were reported to induce AMPK signaling to protect against multi-organ damage in a variety of situations activating Nrf2 and suppressing NF-κB.27,28 Up to date, it is still unknown if eriodictyol can activate or inhibit Nrf2. Based on the data in our hands, and given the stimulatory effect of this drug on Nrf2 signaling and suppression of NF-κB, it seems responsible that eriodictyol may act by activating AMPK.

Therefore, this study was designed with three major objectives. First of all, and similar to its effect in cisplatin-induced nephrotoxicity, is important to examine if treatment with eriodictyol could alleviate DOX-mediated renal damage and dysfunction. Second, to examine the possible mechanism of renoprotective action of eriodictyol in these DOX-treated rats by targeting Nrf2 and NF-κB axes. Third, we aimed to study whether the protection afforded by eriodictyol in these two antioxidant and inflammatory axes involves the activation of AMPK.

2. Materials and methods

2.1. Animals

Forty adult male Wistar-Kyoto rats (weighing 220–240 gm at 12 weeks old) were obtained from the animal house at King Khalid University (KKU), Abha, Saudi Arabia. The rats were kept in plastic cages under ambient normal living conditions (22 ± 5 °C, and 12-h light/dark cycles). They had unrestricted access to drinking water and were fed normal diet chow. All experimental protocols included in this study were approved by the Research Ethics Committee at KKU.

2.2. Experimental design

The experimental design was based on the recent study of Shati and Elkott (2021)11 who have shown that treatment with DOX at a dose of 15 mg/kg can induce nephrotoxicity in rats within 3 weeks. Rats were randomly selected and segregated into 5 groups (each of 8 rats) as 1) control rats: orally administered 0.1 % diluted DMSO, daily for 3 weeks; 2) Eriodictyol-treated-rats: orally administered eriodictyol (20 mg/kg) daily for 3 weeks; (3) DOX-treated rats: intraperitoneal injection of DOX. Accumulative dose of DOX was 15 mg/kg, over 3 weeks. DOX was administered in 6 doses (A dose of 2.5 mg/kg given twice/per week); 4) DOX + eriodictyol-treated rats: treated with DOX as in groups 3 but were also treated with oral eriodictyol (20 mg/kg) daily for 3 weeks; and 5) DOX + eriodictyol + CC: treated with DOX and eriodictyol as in groups 4 but were also given intraperitoneal compound C (CC), a selective AMPK inhibitor (0.2 mg/kg) daily, 1 h before treatment with eriodictyol. Changes in food intake and body weight were recorded every 2 days.

2.3. Dose selection

The dose and route of administration of eriodictyol were selected based on the study of Li et al.28 who demonstrated a renoprotective effect of eriodictyol at this dose in cisplatin-treated rats by attenuating oxidative stress and inflammation through activating Nrf2 and inhibiting NF-κB activation. The in vivo use and dose of CC to block tissue activation of AMPK was based on the studies of Shati et al.29 and Mohammed et al.30

2.4. Biochemical measurements in the urine and serum

By the end of day 21, urine samples were collected from each rat of all experimental groups using metabolic cages. The next day, all animals were fasted overnight and were anesthetized (ketamine/xylazine; 80:10 mg/mg). Blood samples (1 ml) were collected by cardiac puncture into EDAT-containing and plain tubes and then centrifuged at 1100×g at room temperature for 10 min to collect plasma and serum, respectively. Fasting blood glucose levels were measured by a colorimetric kit (Cat. NO. EIAGLUC, ThermoFisher, USA). Serum and urinary albumin and creatinine (Cr) levels were measured using an assay kit (Cat. No. MBS841754, MyBioSource, CA, USA). Serum urea levels were measured using a colorimetric kit (Cat. No. DIUR-100, Bioassay Systems). All measurements were conducted for n = 8 rats/group and as recommended by each kit.

2.5. Collection and processing of kidney tissues

After blood collection, the animals were ethically killed by cervical dislocation, and their kidneys were extracted on ice and weighed. Both kidneys were cut into smaller pieces. Some of these parts were fixed in 10 % buffered formalin and forwarded to the pathology laboratory at the College of Medicine at KKU for further histological processing. All other parts were then snap-frozen in liquid nitrogen and stored at −80 °C. Later, parts of frozen kidneys were homogenized in ice-cold phosphate-buffered saline (PBS/pH −7.4) and centrifuged at 1200×g for 15 min to collect supernatants (total cell homogenates) for the biochemical analysis. Other parts were homogenized in radioimmunoassay (RIPA) buffer (Cat. No. 89901, ThermoFisher, Germany), and centrifuged at 12000×g at 4 °C for 10 min to isolate total protein for western blotting. Also, parts of the frozen kidneys were used to extract the cytoplasmic/nuclear protein fractions with the help of a commercial kit (Cat. No. 4110147; Bio-Rad, CA, USA). In addition, total RNA was extracted from other parts using a commercial kit (Cat. # 74004; Qiagen, Germany). All protocols followed each kit instruction and all preparations were stored at −20 °C until use.

2.6. Biochemical analysis in the renal homogenates

The levels of total glutathione (GSH), malondialdehyde (MDA/lipid peroxides), catalase (CAT), and superoxide dismutase (SOD) in the kidney homogenates of all groups of rats were measured using ELISA kits (Cat. NO. MBS265966, Cat No. MBS268427, Cat. No. MBS726781, and Cat. No. MBS036924, MyBiosources, CA, USA, respectively). Renal levels of heme-oxygenase-1 (HO-1) were measured using a rat-special ELISA kit (Ab279414, Abcam, Cambridge, UK). Renal tissue homogenate levels of tumor necrosis factor-α and interleukine-6 (IL-6) were measured by ELISA (Cat. No. BMS622, ThermoFisher, Germany; and Cat. No. R6000B R&D System, MN, USA, respectively). Total levels of Bcl2, Bax, and caspase-3 in renal homogenates were measured by ELISA (Cat. No. MBS2881713, Cat. No. MBS935667, and Cat. No. MBS018987 MyBiosources, CA, USA, respectively). All measurements were performed for 8 samples/groups as per the kits’ instructions.

2.7. Biochemical analysis in the nuclear and cytoplasmic extract

The levels of erythroid 2-related factor 2 (Nrf2) and nuclear factor kappa-beta (NF-κB) in the prepared renal nuclear fractions were measured by ELISA (Cat. No. 50296 and Cat. No. 31102 TransAM, Active Motif, Tokyo, Japan). Levels of cytochrome-c in the cytoplasmic fraction were measured using an ELISA-based kit (Cat. No. MBS9304546, MyBiosources, CA, USA). All measurements were conducted for 8 samples/groups as per the kits’ instructions.

2.8. Real-time PCR

The levels of the mRNA of AMPKα, transforming growth factor-β1 (TGF-β1), Nrf2, NF-κB, and β-actin (the reference gene) were measured in the kidney of each rat. The primer pair sequences of have been previously validated in our laboratories and described by us are shown in Table 1. In brief, the first-strand cDNA was synthesized from the isolated RNA using the supplied commercial kit (Cat. #K1621, The ThromoFisher kit). Amplification of mRNA was conducted using the Ssofast™ Evergreen Supermix kit (Cat. No. 172–5200, BioRad, USA) and Bio-Rad qPCR amplification (model CFX96) as instructed by the kit. The following steps were followed for each target: 1) heating (1 cycle/98 °C/30 s), 2) denaturation (40 cycles/98 °C/5 s), 3) annealing (40 cycles/60 °C/5 s), and 4) melting (1 cycle/95 °C/5 s/step). The relative mRNA expression of all target genes was presented after the normalization of GAPDH using the 2ΔΔCT method.

Table 1.

Primer pairs used in the real-time PCR reaction.

Gene Primers (5’→3′) accession # BP
AMPKα1 F: GAAGTCAAAGCCGACCCAAT NM_019142 116
TGF-β1 R: AGGGTTCTTCCTTCGCACAC
F: GCTGAACCAAGGAGACGGAAT NM_021578 129
R: CGGTTCATGTCATGGATGGTG
Nrf2 F: AAAATCATTAACCTCCCTGTTGAT NM_031789 118
R: R: ′-CGGCGACTTTATTCTTACCTCTC
NF-κB F: GTGCAGAAAGAAGACATTGAGGTG XM_342346.4 176
R: AGGCTAGGGTCAGCGTATGG
Β-actin F: GACCTCTATGCCAACACAGT NM_031144 154
R: CACCAATCCACACAGAGTAC
Open in a new tab

2.9. Western blotting

Total protein levels in the total, nuclear, and cytoplasmic samples were measured using the Pierce™ BCA Protein Assay Kit (Cat # 23225, ThermoFisher, USA). Proteins were diluted in the loading buffer and then equal volumes of each sample were separated by the SDS-PAGE. The proteins were then transferred to nitrocellulose membranes, blocked with 5 % skimmed milk, and incubated with primary antibodies against total and phospho-AMPK (Cat # 2532 and Cat # 2531; Cell Signaling Technology, USA; 62 kDa, 1:1000 & 1:500, respectively) or β-actin (# 3700, 45 kD, 1:1000). The membranes were then incubated with the corresponding secondary antibodies and incubated with West pico PLUS chemiluminescence substrate (Cat # 34580, ThermoFisher, USA) for 5 min the developed bands were scanned and analyzed using the C-Di Git blot scanner. Washing three times each of 10 min with TBST buffer was conducted between steps. All antibodies, as well as the skimmed milk, were diluted in the TBST buffer. Incubations with the primary or secondary antibodies were performed at room temperature for 2 h and with continuous shaking. The expression of all target proteins was normalized against β-actin.

2.10. Histopathological evaluation

All formalin-preserved kidney tissues were then rehydrated in increasing ethanol concentrations of ethanol and were then cleaned with xylene. The tissues were subsequently coated in paraffin wax and sectioned with a microtome (5 μm). The tissues were then routinely stained with hematoxylin and eosin (HE) for overall morphology and with Masson's trichrome stain for collagen deposition. All photos were captured using a light microscope at a magnification of 200×.

2.11. Statistical analysis

All data were fed into a computer and analyzed by one-way ANOVA using GraphPad prism software. Normality was tested using the Kolmogorov-Smirnov test. The comparison between various groups was done using Tukey's test as post hoc. Data were considered significantly different at p < 0.05.

3. Results

3.1. Eriodictyol stimulates the activation of AMPK in the kidneys of the control and DOX-treated rats

mRNA and total protein levels of AMPK were not significantly varied in all rats on any treatment (Fig. 1). However, levels of p-AMPK (Thr172) were significantly reduced in the kidneys of DOX-treated rats as compared to control rats (Fig. 1). Levels of p-AMPK (Thr172) were significantly increased in the kidneys of the eriodictyol-treated rats when compared to either the control or DOX-treated rats (Fig. 1). Interestingly, No significant variations were seen in p-AMPK (Thr172) levels between the control and DOX + eriodictyol-treated rats. More importantly, the levels of p-AMPK (Thr172) were significantly higher in the kidneys of the DOX + eriodictyol-treated rats when compared to DOX-treated rats. On the contrary, levels of p-AMPK (Thr172) were significantly reduced in DOX + eriodictyol + CC-treated rats as compared to control and DOX + Eriodictyol-treated rats (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Eriodictyol enhances AMPK phosphorylation (activation) in the kidneys of the control and doxorubicin-treated rats: Renal mRNA levels of AMPK and levels of total phosphorylated AMPK in all experimental groups (n = 8/group). Data are presented as means ± SD. Value were considered significantly different at p < 0.05.

a: Significantly different as compared to control; b: Significantly different as compared to eriodictyol-treated rats; c: Significantly different as compared to DOX-treated rats; and d: Significantly different as compared to DOX + eriodictyol-treated rats. DOX: Doxorubicin, CC: compound C (Selective AMPK inhibitor.).

3.2. Eriodictyol improves food intake, suppresses hyperglycemia, and prevents the reduction of kidney weight in DOX-treated rats in an AMPK-dependent manner

Food intake by DOX-treated rats was significantly reduced starting from day 10 to the end of the study as compared to control rats (Fig. 2A). As a result, the area under the curve (UAC) for the accumulative food intake of DOX-treated rats was significantly less as compared to control rats (Fig. 2B). Also, kidney weights were significantly reduced but fasting plasma glucose levels were significantly higher in DOX-treated rats as compared to control rats (Fig. 2C&D). Only plasma glucose levels were significantly decreased in eriodictyol-treated rats as compared to control rats (Fig. 2D). Accumulative food intake and its UAC, as well as kidney weights, were significantly increased, and fasting plasma glucose levels were significantly reduced in DOX + eriodictyol-treated rats as compared to DOX-treated animals, effects that were reversed after treatment with CC (DOX + eriodictyol + CC) (Fig. 2A–D).

Fig. 2.

Fig. 2

Open in a new tab

Eriodictyol increases daily food intake (A&B) and kidney weight (C) but lowers fasting glucose levels (D) in doxorubicin-treated rats.

Data are presented as means ± SD, (n = 8/group). Values were considered significantly different at p < 0.05.

a: Significantly different as compared to control; b: Significantly different as compared to eriodictyol-treated rats; c: Significantly different as compared to DOX-treated rats; and d: Significantly different as compared to DOX + eriodictyol-treated rats. DOX: Doxorubicin, CC: compound C (Selective AMPK inhibitor.).

3.3. Eriodictyol improves body weight and kidney function in DOX-treated animals in an AMPK-dependent manner

Animals in the control and eriodictyol-treated groups did not show significant variations in their final body weights or any of the measured renal function biomarkers (Table 2). The percentages of the kidneys to final body weights were not significantly different between all groups of rats (Table 1). Final body weights, serum levels of albumin, and urinary Cr levels were decreased whereas urine volume and serum levels of Cr and urea were significantly increased in DOX-treated rats as compared to the control or eriodictyol-treated animals. All these alterations were significantly reversed in DOX + eriodictyol-treated rats (Table 2). Only serum and urinary Cr and serum urea measured in DOX + eriodictyol-treated animals remained slightly but significantly different as compared to their basal levels depicted in the control rats. However, final body weights, serum levels of albumin and urinary Cr levels were significantly lower, and serum levels of Cr and urea, as well as urine volume, were significantly higher in DOX + eriodictyol + CC-treated rats as compared to eriodictyol + DOX treated animals (Table 2). No significant variations in body weights and renal function parameters were seen between DOX + eriodictyol + CC and DOX-treated rats (Table 2).

Table 2.

Eriodictyol attenuates doxorubicin (DOX) induced weight loss and improves renal function in DOX-treated rats.

Parameter Control Eriodictyol DOX DOX + Eriodictyol DOX + eriodictyol + CC
Final body weight (g) 343 ± 31.7 356.4 ± 27.8 298 ± 21.4ab 338 ± 34.6c 287 ± 33.4abd
Kidney/body weights (%) 0.54 ± 0.08 0.48 ± 0.07 0.49 ± 0.06ab 0.52 ± 0.07c 0.50 ± 0.07abd
Serum Albumin (g/dl) 3.6 ± 0.54 3.6 ± 0.62 2.1 ± 0.23 ab 3.37 ± 0.31c 2.27 ± 0.34 abd
Urea (mg/dl) 6.1 ± 0.93 6.7 ± 1.1 47.3 ± 5.6ab 8.5 ± 1.8abc 52.3 ± 5.1abd
Creatinine (mg/dl) 0.45 ± 0.08 0.41 ± 0.07 5.4 ± 0.52ab 1.1 ± 0.14abc 5.9 ± 0.56abd
Urine Volume (ml) 12.1 ± 1.9 11.7 ± 1.7 20.3 ± 2.5ab 11.6 ± 2.1ac 22.1 ± 3.1abd
Albumin (μg/dl) 9.2 ± 1.4 10.3 ± 2.4 55.9 ± 5.4ab 11.4 ± 1.6c 49.7 ± 3.8abd
Creatinine (mg/dl) 102.3 ± 9.3 105.1 ± 8.2 25.7 ± 3.7ab 85.1 ± 9.1abc 22.9 ± 2.7abd
Open in a new tab

Data are presented as means ± SD (n = 8/group). Values were considered significantly different at p < 0.05.

a: Significantly different as compared to control.

b: Significantly different as compared to eriodictyol-treated rats.

c: Significantly different as compared to DOX-treated rats; and.

d: Significantly different as compared to DOX + eriodictyol-treated rats. CC: compound C (Selective AMPK inhibitor.).

3.4. Eriodictyol stimulates the Nrf2/antioxidant axis in the kidneys of both the control and DOX-treated animals in an AMPK-dependent manner

The levels of MDA were significantly lower whereas the levels of GSH, SOD, CAT, and HO-1, as well as mRNA, total cytoplasmic, and nuclear levels of Nrf2, and nuclear/cytoplasmic ratio of Nrf2 were significantly higher in eriodictyol treated rats as compared to the control group (Fig. 3A–D and Fig. 4A–F). Renal levels of MDA were significantly increased in DOX-treated rats as compared to control rats (Fig. 3A). On the contrary, levels of GSH, SOD, CAT (Fig. 3B–D), and HO-1 (Fig. 4F) were significantly reduced in the kidneys of DOX-treated rats compared to controls. Kidneys of DOX-treated rats also showed a significant reduction in the levels of Nrf2 mRNA, total, nuclear levels of Nrf2, as well as in the cytoplasmic/nuclear ratio of Nrf2 (Fig. 4A–D). Renal levels of MDA were significantly lower, whereas levels of GSH, SOD, CAT, and HO-1 were significantly higher in the kidneys of DOX + eriodictyol-treated rats as compared to the DOX-treated animals. All the evaluated markers of oxidative stress in the kidneys of DOX + eriodictyol-treated rats were similar to their levels in the control group (Fig. 3B–D, Fig. 4F) except for MDA levels which were slightly but significantly higher than control levels (Fig. 3A). Also, the levels of Nrf2 mRNA, total and nuclear Nrf2, and nuclear/cytoplasmic ratio of Nrf2 were significantly higher in the kidneys DOX + eriodictyol -treated rats compared to DOX-treated animals but similar to their levels in the control group (Fig. 4A–C). Interestingly, renal levels of MDA were increased whereas levels of GSH, SOD, CAT, HO-1, Nrf2 mRNA, and total and nuclear Nrf2 were reduced in the kidneys of DOX + eriodictyol + CC-treated rats as compared to DOX + eriodictyol-treated (Fig. 3A–D and Fig. 4A–F). No significant variations in the levels of all these markers were seen between DOX + eriodictyol + CC-treated animals and DOX-treated rats.

Fig. 3.

Fig. 3

Open in a new tab

Eriodictyol lowers the levels of malondialdehyde (MDA) (A) and increases levels of total glutathione (GSH) (B), superoxide dismutase (SOD) (C), and catalase (CAT) (D) in the kidneys of the control and doxorubicin-treated rats. Data are presented as means ± SD (n = 8/group). Values were considered significantly different at p < 0.05. a: Significantly different as compared to control; b: Significantly different as compared to eriodictyol-treated rats; c: Significantly different as compared to DOX-treated rats; and d: Significantly different as compared to DOX + eriodictyol-treated rats. DOX: Doxorubicin, CC: compound C (Selective AMPK inhibitor.).

Fig. 4.

Fig. 4

Open in a new tab

Eriodictyol upregulate Nrf2 mRNA levels (A), increases total and cytoplasmic levels of Nrf2 (B&C) and the nuclear/cytoplasmic ratio of Nrf2, and boosts the levels of hemeoxygenase-1 (HO-1) in the kidneys of the control and doxorubicin-treated rats. Values were considered significantly different at p < 0.05.

a: Significantly different as compared to control; b: Significantly different as compared to eriodictyol-treated rats; c: Significantly different as compared to DOX-treated rats; and d: Significantly different as compared to DOX + eriodictyol-treated rats. DOX: Doxorubicin, CC: compound C (Selective AMPK inhibitor.).

3.5. Eriodictyol suppresses NF-κB levels and activation and reduces levels of TNF-α in the kidneys of both the control and DOX-treated animals in an AMPK-dependent manner

Levels of NF-κB mRNA, cytoplasmic, and nuclear NF-κB p65 and of TNF-α were significantly reduced in the kidneys of eriodictyol-treated rats as compared to the control rats (Fig. 5A–D). Interestingly, although NF-κB mRNA, as well as total, and nuclear NF-κB p65, and TNF-α levels, were significantly higher in the kidneys of DOX-treated rats as compared to control rats, these values were significantly reduced to control levels in the kidneys of DOX + eriodictyol -treated rats (Fig. 5A–D). However, significant increases in NF-κB mRNA, cytoplasmic, and nuclear NF-κB p65 and TNF-α levels were detected in the kidneys of DOX + eriodictyol + CC-treated animals as compared to DOX + eriodictyol -treated rats, levels which were not significantly different from those reported in DOX-treated group (Fig. 5A–D).

Fig. 5.

Fig. 5

Open in a new tab

Eriodictyol downregulates NF-κB mRNA levels (A) and decreases total cytoplasmic and nuclear levels of NF-κB p65 (B&C), as well as levels of tumor necrosis factor-α1 (TNF-α1) (D) in the kidneys of the control and doxorubicin-treated rats. Data are presented as means ± SD. Value were considered significantly different at p < 0.05.

a: Significantly different as compared to control; b: Significantly different as compared to eriodictyol-treated rats; c: Significantly different as compared to DOX-treated rats; and d: Significantly different as compared to DOX + eriodictyol-treated rats. DOX: Doxorubicin, CC: compound C (Selective AMPK inhibitor.).

3.6. Eriodictyol inhibits intrinsic cell apoptosis in the kidneys of DOX-treated animals in an AMPK-dependent manner

No significant variations in the levels of all apoptotic markers were seen in the kidneys of control and eriodictyol-treated rats (Fig. 6A–D). Total levels of Bax and caspase-3, as well as cytoplasmic levels of cytochrome-c, were significantly higher, whereas total levels of Bcl2 were significantly lower in the kidneys of DOX- and DOX + eriodictyol + CC- treated groups when compared to the control or DOX + eriodictyol-treated animals (Fig. 6A–D). The levels of all these parameters were not significantly different between DOX and DOX + eriodictyol + CC-treated animals (Fig. 6A–D).

Fig. 6.

Fig. 6

Open in a new tab

Eriodictyol increases total levels of Bcl2 (A) but reduces total levels of Bax (B) and caspapse-3 (C), as well as cytoplasmic level of cytochrome-c in the kidneys of the doxorubicin-treated rats. Data are presented as means ± SD (n = 8/group). Values were considered significantly different at p < 0.05.

a: Significantly different as compared to control; b: Significantly different as compared to eriodictyol-treated rats; c: Significantly different as compared to DOX-treated rats; and d: Significantly different as compared to DOX + eriodictyol-treated rats. DOX: Doxorubicin, CC: compound C (Selective AMPK inhibitor.).

3.7. Eriodictyol suppresses mRNA levels of TGF-β1 and fibrosis in the kidneys of DOX-treated animals in an AMPK-dependent manner

Collagen fiber deposition (Fig. 7A and C) and TGF-β1 mRNA levels (Fig. 7F) were significantly increased in the kidneys of DOX-treated animals as compared to control rats. TGF-β1 mRNA levels were not significantly different between the control and eriodictyol-treated animals but were significantly decreased in DOX + eriodictyol-treated rats as compared to DOX-treated animals. Also, less amount of collagen fibers was seen in the kidneys of DOX + eriodictyol-treated animals as compared to DOX-treated animals (Fig. 7D). The amount of collagen fibers and TGF-β1 mRNA levels were significantly increased in DOX + eriodictyol + CC-treated animals as compared to DOX + eriodictyol-treated rats (Fig. 7D, E and F) and were similar to levels seen in DOX-treated animals (Fig. 7).

Fig. 7.

Fig. 7

Open in a new tab

Eriodictyol inhibits collagen deposition (blue coloured fibers, black arrow) and downregulates transforming growth factor-β1 (TGF-β1) mRNA expression of in the kidneys of doxorubicin (DOX)-treated rats. A: control kidney, B: eriodictyol-treated kidney, C: DOX-treated kidney, D: DOX + eriodictyol-treated kidney, E: DOX + eriodictyol + CC-treated kidney. 200x (Masson's trichrome stain). F: renal levels of TGF-β1 mRNA in all groups. Values were considered significantly different at p < 0.05. a: Significantly different as compared to control; b: Significantly different as compared to eriodictyol-treated rats; c: Significantly different as compared to DOX-treated rats; and d: Significantly different as compared to DOX + eriodictyol-treated rats. DOX: Doxorubicin, CC: compound C (Selective AMPK inhibitor.).

3.8. Eriodictyol improves the kidney structure in DOX-treated animals in an AMPK-dependent manner

Kidneys of control and eriodictyol-treated animals showed normal features including intact glomeruli, proximal convolutes tubules (PCTs), and distal convoluted tubules (DTCs) (Fig. 8A&B). Kidneys of DOX-treated animals showed severe degeneration in their glomeruli, PCTs, and DCTs (Fig. 8C). The kidney showed considerable improvement with almost normal features regarding the structure of the glomeruli, PCTs, and DCts in the DOX + eriodictyol-treated animals (Fig. 8D&E). However, Similar pathological damages in the glomeruli, PCTs, and DCTs that are seen in the kidneys of DOX-treated animals were also seen in the kidneys of DOX + eriodictyol + CC-treated rats (Fig. 8F).

Fig. 8.

Fig. 8

Open in a new tab

Eriodictyol improves kidney structure in the kidneys of the doxorubicin (DOX)-treated rats. A&B were taken from control and eriodictyol-treated kidney and showed normal structure of glomerulus with intact capillaries, space, and membrane (arrowhead). Also shown are the proximal convoluted tubules (PCTs) (short arrow) and DCT (long arrow). C was taken form a DOX-treated kidney and shows severe damage in the glomerulus, PCTs (short arrow) and DCT (long arrow). D and E were taken from DOX + eriodictyol-treated kidneys and show considerable improvement in the structure of the glomeruli and PCTs and DCTs (short and long black arrows, respectively). However, some abnormal glomeruli (yellow arrow head) and damaged PCTs (short yellow arrow) and DCTs (long yellow arrow) are visible. F was taken from a DOX + eriodictyol + CC-treated kidney and shows severe damage in the glomeruli (arrowhead) PCTs (short arrow) and DCTs (long arrow). 200x (Hematoxylin and eosin stain).

4. Discussion

Data from this study provides the first evidence in the literature for the protective effect of eriodictyol against DOX-induced nephrotoxicity in rodents. In addition, it confirms that the protection afforded by eriodictyol involves antioxidant and anti-inflammatory effects mediated by its exceptional ability to upregulate/activate Nrf2 and inhibit/downregulate NF-κB in an AMPK-dependent manner. Indeed, pre-treatment with CC, a selective AMPK inhibitor that prevents AMPK phosphorylation, diminished all the antioxidant and anti-inflammatory nephroprotective effects afforded by eriodictyol.

4.1. Eriodictyol is nephroprotective against DOX-induced renal damage

Urine analysis and histological biopsies are valid approaches to validating chronic kidney disorders.31 Renal damage induced by DOX is characterized by severe lesions in the glomeruli and in the proximal and distal convoluted tubules that result in a reduction in glomerular filtration rate (GFR), increased serum urea and Cr, hypoalbuminemia, a reduction in Cr clearance, and albuminuria.32,33 These pathological biochemical and histological findings were indeed seen in the DOX-treated animals of this study which validate our animal model. Our findings provided strong evidence for the nephroprotective effect of eriodictyol since eriodictyol attenuated DOX-induced reduction in kidney weights and reversed DOX-induced alteration in these biochemical and histological changes. This will add to the well-reported effectiveness of flavonoids against renal damage in rats.34, 35, 36

4.2. Eriodictyol is a potent antioxidant and anti-inflammatory molecule that acts by modulating the levels and activities of Nrf2 and NF-κB

Oxidative damage is the main listed mechanism by which DOX induces renal, neural, hepatic, and cardiac damage.1,7 Nrf2 is a major antioxidant transcription factor that prevents cell oxidative damage by stimulating GSH and phase II antioxidant enzymes such as glutathione peroxidase (GPx), CAT, and SOD.37 On the other hand, NF-κB is the best-known inflammatory and oxidant mediator which enhances cell inflammation and oxidative stress through increasing cytokines and ROS production.38 In this study, DOX treatment increased the levels of lipid peroxidation (MDA), depleted SOD, GSH, and CAT, and reduced Nrf2 mRNA expression and Nrf2 nuclear levels in the kidneys of treated rats. These findings support previous studies that claimed that DOX-mediated hepatic, renal, neural, and cardiac damage involved targeting the Nrf2/antioxidant axis.39,40 On the other hand, treatment with eriodictyol significantly reversed these biochemical events illustrating its potent antioxidant and anti-inflammatory effects. Eriodictyol treatment increased, in renal tissue, levels of Nrf2 mRNA and nuclear Nrf2, enhanced GSH, SOD, and CAT levels, reduced MDA, and TNF-α levels, and suppressed the expression and activation of NF-κB. Those effects were detected not only in the kidneys of DOX-treated rats but also in the renal tissues of control rats. A group of in vitro and in vivo studies support our findings. Within this view, eriodictyol protected against diabetic retinopathy41 and lipopolysaccharides (LPS)-induced brain19 and lung24 injury by scavenging ROS, boosting endogenous antioxidants, and inhibiting inflammatory cytokine production. It also prevented H2O242,43 and high glucose-induced44 cell death in neural cells, fibroblast, and cardiac endothelial cells by suppressing ROS generation and activating Nrf2/antioxidant axis. In addition, eriodictyol protected against experimentally-induced cerebral ischemia21 and cisplatin-mediated nephrotoxicity45 by suppressing lipid peroxidation, activating Nrf2 signaling, and increasing the levels of GSH, SOD, and other antioxidants. In the same line, eriodictyol induced long-term protection against oxidative stress-mediated damage in the ARPE-19 retinal cell line via the activation of Nrf2 and upregulation of phase II antioxidant enzymes.46 Also, eriodictyol inhibited the expression of mucin in the airway epithelial cells,26 the proliferation and metastasis of glioma cells,20 and trinitrobenzenesulfonic acid (TNBS)-mediated colitis27 in mice by inhibiting NF-κB signaling.

4.3. Eriodictyol has antiapoptotic and anti-fibrosis effects

Other mechanisms involved in DOX-mediated nephrotoxicity are fibrosis and apoptosis.47,48 TGF-β1 is the major fibrotic transcription factor that promotes cell fibrosis by activating the Smad2/3.49 Intrinsic (mitochondria-mediated) cell death is activated by the translocation of Bax, an apoptotic protein to the mitochondria, and the subsequent release of cytochrome-c from the mitochondria.50 As a result, cytochrome-c stimulates the activation of caspases9/3 to induce cell death. Bcl2 is the major anti-apoptotic protein in the cell that inhibits and prevents BAX/BAK oligomerization and the leakage of cytochrome-c from the mitochondria.50 Intrinsic (mitochondria-mediated) apoptosis is the major modality of cell death seen in the kidneys of animals following DOX treatment. mRNA and protein levels of Bax, as well as the cytoplasmic levels of cytochrome-c, were significantly increased whereas the expression of Bcl2 was downregulated in the kidneys of DOX-treated animals.9,12 In support of previous reports, data from this study also showed a significant increase in mRNA levels of TGF-β1 and higher cytoplasmic levels of Bax, total capapse-3, and cytochrome-c in the kidneys of DOX-treated rats. In addition, total levels of Bcl2 were significantly depleted in the kidneys of DOX-treated rats. These data confirm the role of fibrosis and apoptosis in the kidneys of DOX-treated animals which could be a result of higher oxidative stress and inflammation. ROS and TNF-α, IL-6 are major upstream regulators that induce intrinsic cell death by upregulating Bax and suppressing BCl2.51 It is worth pointing out that in our study eriodictyol repressed collagen deposition and TGF-β1, boosted levels of Bcl2, and reduced the levels of Bax and cytochrome-c only in the kidneys of DOX-treated rats and not in the normal kidneys of the control group. This observation strongly suggests that the anti-fibrotic and anti-apoptotic effect of eriodictyol is secondary to its antioxidant and anti-inflammatory actions. Indeed, ROS and inflammatory cytokines are potent activators whereas Nrf2 is a natural inhibitor of the TGF-β1/Smad2/3 signaling pathway.52, 53, 54 However, the measured caspase-3 in this study was the total form. Therefore, future studies should focus on measuring the cleaved form of caspase-3 as well as other more specific markers of apoptosis.

4.4. Eriodictyol nephroprotective effects are dependent on the activation of AMPK

To investigate the mechanism of the antioxidant, anti-inflammatory, anti-apoptotic, and anti-fibrosis effects of eriodictyol we targeted the AMPK energy signaling pathway which is usually activated to stimulate cell survival in the majority of tissue.55 Several previous reports identified AMPK as a novel target to treat various kidney disorders.14,56 AMPK is known to enhance cell antioxidants, reduce oxidative stress, and inhibit inflammation. Also, AMPK can suppress fibroblast activation and is a negative inhibitor of the fibrotic factor, TGF-β.57,58 Recently these actions of AMPK were linked to the upregulation of Nrf2 and suppression of NF-κB signaling.17,18 In his study, mRNA and total protein levels of AMPK were not affected whereas the rate of phosphorylation was significantly reduced in the kidneys of DOX-treated animals. This is in line with other studies that have shown a reduction in the activation of AMPK in the heart, liver, and kidneys of rats post-treatment with DOX.13,15,16 On the other hand, higher levels of p-AMPK were depicted not only in the kidneys of DOX-treated rats but also in those of control rats, indicating the potential of this drug to stimulate AMPK. Interestingly, suppressing AMPK by CC prevented all the nephroprotective effects afforded by eriodictyol in DOX-treated animals and allowed for DOX-mediated activation of oxidant, inflammatory, fibrotic, and apoptotic pathways in CC + eriodictyol + DOX-treated rats. Hence, it seems reasonable to suggest that all the protection afforded by eriodictyol depended on p-AMPK-mediated activation/upregulation of Nrf2 and suppression/downregulation of NF-κB.

4.5. Eriodictyol prevented DOX-induced anorexia, weight loss, and hyperglycemia

Weight loss and hyperglycemia are the major satiety side effects associated with repetitive DOX treatment.11 The reduction in body and kidney weights post-DOX treatment was attributed to the ability of DOX to promote anorexia (loss of appetite), reduce intestinal absorption of nutrients, promote insulin resistance (IR), and induce apoptosis in the kidneys and other organs.11 It has been suggested that DOX induces IR and hyperglycemia which adversely affects body weight is secondary to skeletal muscle wasting and adipose tissue lipolysis mediated through decreased expression and activities of AMPK.59 An interesting finding of this study was the ability of eriodictyol to reverse the reduction in food intake and the concomitant decrease in body and kidney weights of DOX-treated animals. It also lowered fasting glucose levels in the plasma of these rats which indicates improvement of the glycaemic index. Our findings support the study of Zhang et al.,60 who has previously described the ability of eriodictyol to stimulate glucose uptake in both human hepatocellular liver carcinoma cells (HepG2) and differentiated 3T3-L1 adipocytes under high-glucose conditions. Therefore, such improvement in kidney weights could be explained by the anti-apoptotic potential of eriodictyol secondary to the suppression of oxidative stress and inflammation. Also, based on our findings in the kidneys, such improvement in body weights and glucose levels could be explained by the ability of eriodictyol to stimulate AMPK and subsequently insulin signaling in the muscles and adipose tissue of rats. This can be supported by the disappearance of this positive effect in DOX + eriodictyol-treated rats which were co-treated with CC. Unfortunately, we didn't measure the alterations in AMPK levels/activities in muscles and adipose tissues to support this hypothesis.

4.6. Conclusion

In conclusion, our study reports novel findings in animals that can later be tested in clinical trials to provide unique replacement and treatment options. Our study demonstrated the ability of eriodictyol to alleviate DOX-associated nephrotoxicity in rats. It also identified the effect of eriodictyol on AMPK signaling which underlies eriodictyol antioxidant and anti-inflammatory effects. Since AMPK is an excellent target to treat cardiac, renal, neural, and hepatic damage in a variety of disorders, the findings of this study encourage the application and use of eriodictyol as an AMPK activator in the treatment of other AMPK-related disorders.

Ethical consideration

All procedures used in this study were approved by the animal ethics and use committee at KKU where their regulations follow those established by the US National Institutes of Health (NIH publication no. 85–23, revised 1996).

Declaration of competing interest

The authors declare that there is no conflict of interest.

Acknowledgment and Funding

This study was funded by the Deanship of Scientific Research at King Khalid University (KKU) through the Small Group Research Project, under grant number RGP1/296/44. The authors would like to express their appreciation and gratitude to the staff of the animal house facility at KKU for their assistance during the current study.

Footnotes

Peer review under responsibility of The Center for Food and Biomolecules, National Taiwan University.

References

  • 1.Thorn C.F., Oshiro C., Marsh S., et al. Doxorubicin pathways: pharmacodynamics and adverse effects. Pharmacogenetics Genom. 2011;21(7):440–446. doi: 10.1097/FPC.0b013e32833ffb56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Alhusaini A.M., Fadda L.M., Alanazi A.M., et al. Nano-resveratrol: a promising candidate for the treatment of renal toxicity induced by doxorubicin in rats through modulation of beclin-1 and mTOR. Front Pharmacol. 2022;13 doi: 10.3389/fphar.2022.826908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ikewuchi C.C., Ifeanacho M.O., Ikewuchi J.C. Moderation of doxorubicin-induced nephrotoxicity in Wistar rats by aqueous leaf-extracts of Chromolaena odorata and Tridax procumbens. Porto Biomed J. 2021;6(1):e129. doi: 10.1097/j.pbj.0000000000000129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ayla S., Seckin I., Tanriverdi G., et al. Doxorubicin induced nephrotoxicity: protective effect of nicotinamide. Int J Cell Biol. 2011;2011 doi: 10.1155/2011/390238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Afsar T., Razak S., Almajwal A., Al-Disi D. Doxorubicin-induced alterations in kidney functioning, oxidative stress, DNA damage, and renal tissue morphology; Improvement by Acacia hydaspica tannin-rich ethyl acetate fraction. Saudi J Biol Sci. 2020;27(9):2251–2260. doi: 10.1016/j.sjbs.2020.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hekmat S.A., Chenari A., Alipanah H., Javanmardi K. Protective effect of alamandine on doxorubicin-induced nephrotoxicity in rats. BMC Pharmacol Toxicol. 2021;22:31. doi: 10.1186/s40360-021-00494-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Songbo M., Lang H., Xinyong C., Bin X., Ping Z., Liang S. Oxidative stress injury in doxorubicin-induced cardiotoxicity. Toxicol Lett. 2019;307(1):41–48. doi: 10.1016/j.toxlet.2019.02.013. [DOI] [PubMed] [Google Scholar]
  • 8.Su Z., Ye J., Qin Z., Ding X. Protective effects of madecassoside against Doxorubicin induced nephrotoxicity in vivo and in vitro. Sci Rep. 2016;5 doi: 10.1038/srep18314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ren X., Bo Y., Fan J., et al. Dalbergioidin ameliorates doxorubicin-induced renal fibrosis by suppressing the TGF-β signal pathway. Mediat Inflamm. 2016;2016 doi: 10.1155/2016/5147571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wu Q., Li W., Zhao J., et al. Apigenin ameliorates doxorubicin-induced renal injury via inhibition of oxidative stress and inflammation. Biomed Pharmacother. 2021;137 doi: 10.1016/j.biopha.2021.111308. [DOI] [PubMed] [Google Scholar]
  • 11.Shati A.A., El-Kott A.F. Acylated ghrelin protects against doxorubicin-induced nephropathy by activating silent information regulator 1. Basic Clin Pharmacol Toxicol. 2021;128(6):805–821. doi: 10.1111/bcpt.13569. [DOI] [PubMed] [Google Scholar]
  • 12.AlAsmari A.F., Ali N., Alharbi M., et al. Geraniol ameliorates doxorubicin-mediated kidney injury through alteration of antioxidant status, inflammation, and apoptosis: potential roles of NF-κB and Nrf2/Ho-1. Nutrients. 2022;14(8):1620. doi: 10.3390/nu14081620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Xu X., Liu Q., Li J., et al. Co-treatment with resveratrol and FGF1 protects against acute liver toxicity after doxorubicin treatment via the AMPK/NRF2 pathway. Front Pharmacol. 2022;13 doi: 10.3389/fphar.2022.940406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Huang L., Shao M., Zhu Y. Gastrodin inhibits high glucose-induced inflammation, oxidative stress and apoptosis in podocytes by activating the AMPK/Nrf2 signaling pathway. Exp Ther Med. 2022;23(2):168. doi: 10.3892/etm.2021.11091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mohamed E.A., Ahmed H.I., Zaky H.S. Protective effect of irbesartan against doxorubicin-induced nephrotoxicity in rats: implication of AMPK, PI3K/Akt, and mTOR signaling pathways. Can J Physiol Pharmacol. 2018;96(12):1209–1217. doi: 10.1139/cjpp-2018-0259. [DOI] [PubMed] [Google Scholar]
  • 16.Timm K.N., Tyler D.J. The role of AMPK activation for cardioprotection in doxorubicin-induced cardiotoxicity. Cardiovasc Drugs Ther. 2020;34(2):255–269. doi: 10.1007/s10557-020-06941-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Petsouki E., Cabrera S.N.S., Heiss E.H. AMPK and NRF2: interactive players in the same team for cellular homeostasis? Free Radic Biol Med. 2022;190:75–93. doi: 10.1016/j.freeradbiomed.2022.07.014. [DOI] [PubMed] [Google Scholar]
  • 18.Salminen A., Hyttinen J.M., Kaarniranta K. AMP-activated protein kinase inhibits NF-κB signaling and inflammation: impact on healthspan and lifespan. J Mol Med (Berl). 2011;89(7):667–676. doi: 10.1007/s00109-011-0748-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.He P., Yan S., Wen X., et al. Eriodictyol alleviates lipopolysaccharide‐triggered oxidative stress and synaptic dysfunctions in BV‐2 microglial cells and mouse brain. J Cell Biochem. 2019;120(9):14756–14770. doi: 10.1002/jcb.28736. [DOI] [PubMed] [Google Scholar]
  • 20.Li W., Du Q., Li X., et al. Eriodictyol inhibits proliferation, metastasis and induces apoptosis of glioma cells via PI3K/akt/NF-κB signaling pathway. Front Pharmacol. 2020 Feb 25;11:114. doi: 10.3389/fphar.2020.00114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jing X., Shi H., Zhu X., et al. Eriodictyol attenuates β-amyloid 25–35 peptide-induced oxidative cell death in primary cultured neurons by activation of Nrf2. Neurochem Res. 2015;40:1463–1471. doi: 10.1007/s11064-015-1616-z. [DOI] [PubMed] [Google Scholar]
  • 22.Lee S.E., Yang H., Son G.W., et al. Eriodictyol protects endothelial cells against oxidative stress-induced cell death through modulating ERK/Nrf2/ARE-Dependent heme oxygenase-1 expression. Int J Mol Sci. 2015;16(7):14526–14539. doi: 10.3390/ijms160714526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li L., Li W.J., Zheng X.R., et al. Eriodictyol ameliorates cognitive dysfunction in APP/PS1 mice by inhibiting ferroptosis via vitamin D receptor-mediated Nrf2 activation. Mol Med. 2022;28:11. doi: 10.1186/s10020-022-00442-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yun C., Lee H.J., Lee C.J. Eriodictyol inhibits the production and gene expression of MUC5AC mucin via the IκBα-NF-κb p65 signaling pathway in airway epithelial cells. Biomol Ther (Seoul). 2021;29(6):637–642. doi: 10.4062/biomolther.2021.091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hu L.H., Liu J.Y., Yin J.B. Eriodictyol attenuates TNBS-induced ulcerative colitis through repressing TLR4/NF-kB signaling pathway in rats. Kaohsiung J Med Sci. 2021;37(9):812–818. doi: 10.1002/kjm2.12400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li C.Z., Jin H.H., Sun H.X., et al. Eriodictyol attenuates cisplatin-induced kidney injury by inhibiting oxidative stress and inflammation. Eur J Pharmacol. 2016;772:124–130. doi: 10.1016/j.ejphar.2015.12.042. [DOI] [PubMed] [Google Scholar]
  • 27.Yong Y., Shin S.Y., Jung Y., et al. Flavonoids activating adenosine monophosphate-activated protein kinase. J Korean Soc Appl Biol Chem. 2015;58:13–19. [Google Scholar]
  • 28.Francini F., Schinella G.R., Ríos J.L. Activation of AMPK by medicinal plants and natural products: its role in type 2 diabetes mellitus. Mini Rev Med Chem. 2019;19(11):880–901. doi: 10.2174/1389557519666181128120726. [DOI] [PubMed] [Google Scholar]
  • 29.Shati A.A. Salidroside ameliorates diabetic nephropathy in rats by activating renal AMPK/SIRT1 signaling pathway. J Food Biochem. 2020;44(4) doi: 10.1111/jfbc.13158. [DOI] [PubMed] [Google Scholar]
  • 30.Mohammed H.M. Zingerone ameliorates non-alcoholic fatty liver disease in rats by activating AMPK. J Food Biochem. 2022;46(7) doi: 10.1111/jfbc.14149. [DOI] [PubMed] [Google Scholar]
  • 31.Park J.I., Baek H., Kim B.R., Jung H.H. Comparison of urine dipstick and albumin:creatinine ratio for chronic kidney disease screening: a population-based study. PLoS One. 2017;12(2) doi: 10.1371/journal.pone.0171106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yagmurca M., Yasar Z., Bas O. Effects of quercetin on kidney injury induced by doxorubicin. Bratisl Lek Listy. 2015;116(8):486–489. doi: 10.4149/bll_2015_092. [DOI] [PubMed] [Google Scholar]
  • 33.Refaie M.M., Amin E.F., El-Tahawy N.F., Abdelrahman A.M. Possible protective effect of diacerein on doxorubicin-induced nephrotoxicity in rats. J Toxicol. 2016;2016 doi: 10.1155/2016/9507563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Vargas F., Romecín P., García-Guillén A.I., et al. Flavonoids in kidney Health and disease. Front Physiol. 2018;9:394. doi: 10.3389/fphys.2018.00394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Hu Q., Qu C., Xiao X., et al. Flavonoids on diabetic nephropathy: advances and therapeutic opportunities. Chin Med. 2021;6:74. doi: 10.1186/s13020-021-00485-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Cao Y.L., Lin J.H., Hammes H.P., Zhang C. Flavonoids in treatment of chronic kidney disease. Molecules. 2022;27(7):2365. doi: 10.3390/molecules27072365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ma Q. Role of nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol. 2013;53:401–426. doi: 10.1146/annurev-pharmtox-011112-140320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Morgan M.J., Liu Z.G. Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res. 2011;21(1):103–115. doi: 10.1038/cr.2010.178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Sharma A., Parikh M., Shah H., Gandhi T. Modulation of Nrf2 by quercetin in doxorubicin-treated rats. Heliyon. 2020;6(4) doi: 10.1016/j.heliyon.2020.e03803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Saleh D.O., Mahmoud S.S., Hassan A., Sanad E.F. Doxorubicin-induced hepatic toxicity in rats: mechanistic protective role of Omega-3 fatty acids through Nrf2/HO-1 activation and PI3K/Akt/GSK-3β axis modulation. Saudi J Biol Sci. 2022;29(7) doi: 10.1016/j.sjbs.2022.103308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bucolo C., Leggio G.M., Drago F., Salomone S. Eriodictyol prevents early retinal and plasma abnormalities in streptozotocininduced diabetic rats. Biochem Pharmacol. 2012;84:88–92. doi: 10.1016/j.bcp.2012.03.019. [DOI] [PubMed] [Google Scholar]
  • 42.Lou H., Jing X., Ren D., Wei X., Zhang X. Eriodictyol protects against H(2)O(2)-induced neuron-like PC12 cell death through activation of Nrf2/ARE signaling pathway. Neurochem Int. 2012;61:251–257. doi: 10.1016/j.neuint.2012.05.013. [DOI] [PubMed] [Google Scholar]
  • 43.Buranasudja V., Muangnoi C., Sanookpan K., Halim H., Sritularak B., Rojsitthisak P. Eriodictyol attenuates H2O2-induced oxidative damage in human dermal fibroblasts through enhanced capacity of antioxidant machinery. Nutrients. 2022;14(12):2553. doi: 10.3390/nu14122553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Lv P., Yu J., Xu X., Lu T., Xu F. Eriodictyol inhibits high glucose-induced oxidative stress and inflammation in retinal ganglial cells. J Cell Biochem. 2019;120:5644–5651. doi: 10.1002/jcb.27848. [DOI] [PubMed] [Google Scholar]
  • 45.Hu Q., Zhang D.D., Wang L., Lou H., Ren D. Eriodictyol-7-O-glucoside, a novel Nrf2 activator, confers protection against cisplatin-induced toxicity. Food Chem Toxicol. 2012;50(6):1927–1932. doi: 10.1016/j.fct.2012.03.059. [DOI] [PubMed] [Google Scholar]
  • 46.Johnson J., Maher P., Hanneken A. The flavonoid, eriodictyol, induces long-term protection in ARPE-19 cells through its effects on Nrf2 activation and phase 2 gene expression. Invest Ophthalmol Vis Sci. 2009;50(5):2398–2406. doi: 10.1167/iovs.08-2088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Lahoti T.S., Patel D., Thekkemadom V., Beckett R., Ray S.D. Doxorubicin-induced in vivo nephrotoxicity involves oxidative stress-mediated multiple pro- and anti-apoptotic signaling pathways. Curr Neurovascular Res. 2012;9(4):282–295. doi: 10.2174/156720212803530636. [DOI] [PubMed] [Google Scholar]
  • 48.Szalay C.I., Erdélyi K., Kökény G., et al. Oxidative/nitrative stress and inflammation drive progression of doxorubicin-induced renal fibrosis in rats as revealed by comparing a normal and a fibrosis-resistant rat strain. PLoS One. 2015;10(6) doi: 10.1371/journal.pone.0127090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hu H.H., Chen D.Q., Wang Y.N., et al. New insights into TGF-β/Smad signaling in tissue fibrosis. Chem Biol Interact. 2018;25(292):76–83. doi: 10.1016/j.cbi.2018.07.008. [DOI] [PubMed] [Google Scholar]
  • 50.Cavalcante G.C., Schaan A.P., Cabral G.F., et al. A cell's fate: an overview of the molecular biology and genetics of apoptosis. Int J Mol Sci. 2019;20(17):4133. doi: 10.3390/ijms20174133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Redza-Dutordoir M., Averill-Bates D.A. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim Biophys Acta. 2016;1863(12):2977–2992. doi: 10.1016/j.bbamcr.2016.09.012. [DOI] [PubMed] [Google Scholar]
  • 52.Liu R.M., Gaston-Pravia K.A. Oxidative stress and glutathione in TGF-beta-mediated fibrogenesis. Free Radic Biol Med. 2010;48(1):1–15. doi: 10.1016/j.freeradbiomed.2009.09.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Guan Y., Tan Y., Liu W., et al. NF-E2-Related factor 2 suppresses intestinal fibrosis by inhibiting reactive oxygen species-dependent TGF-β1/SMADs pathway. Dig Dis Sci. 2018;63(2):366–380. doi: 10.1007/s10620-017-4710-z. [DOI] [PubMed] [Google Scholar]
  • 54.Sisto M., Ribatti D., Lisi S. Organ fibrosis and autoimmunity: the role of inflammation in TGFβ-dependent EMT. Biomolecules. 2021;11(2):310. doi: 10.3390/biom11020310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Jeon S.M. Regulation and function of AMPK in physiology and diseases. Exp Mol Med. 2016;48:e245. doi: 10.1038/emm.2016.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Entezari M., Hashemi D., Taheriazam A., et al. AMPK signaling in diabetes mellitus, insulin resistance and diabetic complications: a pre-clinical and clinical investigation. Biomed Pharmacother. 2022;146 doi: 10.1016/j.biopha.2021.112563. [DOI] [PubMed] [Google Scholar]
  • 57.Thakur S., Viswanadhapalli S., Kopp J.B., et al. Activation of AMP-activated protein kinase prevents TGF-β1-induced epithelial-mesenchymal transition and myofibroblast activation. Am J Pathol. 2015;185(8):2168–2180. doi: 10.1016/j.ajpath.2015.04.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Juban G., Saclier M., Yacoub-Youssef H., et al. AMPK activation regulates LTBP4-dependent TGF-β1 secretion by pro-inflammatory macrophages and controls fibrosis in duchenne muscular dystrophy. Cell Rep. 2018;25(8):2163–2176. doi: 10.1016/j.celrep.2018.10.077. [DOI] [PubMed] [Google Scholar]
  • 59.Lima-Junior E.A., Yamashita A.S., Pimentel G.D., et al. Doxorubicin caused severe hyperglycaemia and insulin resistance, mediated by inhibition in AMPk signalling in skeletal muscle. J Cachexia Sarcopenia Muscle. 2016;7(5):615–625. doi: 10.1002/jcsm.12104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Zhang W.Y., Lee J.J., Kim Y., et al. Effect of eriodictyol on glucose uptake and insulin resistance in vitro. J Agric Food Chem. 2012;60(31):7652–7658. doi: 10.1021/jf300601z. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Traditional and Complementary Medicine are provided here courtesy of Elsevier

RESOURCES