Abstract
OBJECTIVE:
To examine the nephroprotective mechanism of modified Huangqi Chifeng decoction (加味黄芪赤风汤, MHCD) in immunoglobulin A nephropathy (IgAN) rats.
METHODS:
To establish the IgAN rat model, the bovine serum albumin, lipopolysaccharide, and carbon tetrachloride 4 method was employed. The rats were then randomly assigned to the control, model, telmisartan, and high-, medium-, and low-dose MHCD groups, and were administered the respective treatments via intragastric administration for 8 weeks. The levels of 24-h urinary protein, serum creatinine (CRE), and blood urea nitrogen (BUN) were measured in each group. Pathological alterations were detected. IgA deposition was visualized through the use of immunofluorescence staining. The ultrastructure of the kidney was observed using a transmission electron microscope. The expression levels of interleukin-6 (IL-6), monocyte chemoattractant protein-1 (MCP-1), and transforming growth factor-β1 (TGF-β1) were examined by immunohistochemistry and quantitative polymerase chain reaction. Levels of toll-like receptor 4 (TLR4), myeloid differentiation factor 88 (MyD88), and nuclear factor-kappa B (NF-κB) P65, were examined by immunohistochemistry, Western blotting, and quantitative polymerase chain reaction.
RESULTS:
The 24-h urine protein level in each group increased significantly at week 6, and worsen from then on. But this process can be reversed by treatments of telmisartan, and high-, medium-, and low-dose of MHCD, and these treatments did not affect renal function. Telmisartan, and high-, and medium-dose of MHCD reduced IgA deposition. Renal histopathology demonstrated the protective effect of high-, medium-, and low-dose of MHCD against kidney injury. The expression levels of MCP-1, IL-6, and TGF-β1 in kidney tissues were downregulated by low, medium and high doses of MHCD treatment. Additionally, treatment of low, medium and high doses of MHCD decreased the protein and mRNA levels of TLR4, MyD88, and NF-κB.
CONCLUSIONS:
MHCD exerted nephroprotective effects on IgAN rats, and MHCD regulated the expressions of key targets in TLR4/MyD88/NF-κB signaling pathway, thereby alleviating renal inflammation by inhibiting MCP-1, IL-6 expressions, and ameliorating renal fibrosis by inhibiting TGF-β1 expression.
Keywords: glomerulonephritis, IGA; toll-like receptor 4; myeloid differentiation factor 88; NF-kappa B; signal transduction; inflammation; renal fibrosis; modified Huangqi Chifeng decoction
1. INTRODUCTION
Immunoglobulin A nephropathy (IgAN) is known as an immune complex-mediated primary glomerular disease.1 It is characterized by IgA deposits in the mesangial area and mesangial cell proliferation. IgAN, as one of the most ordinary kinds of primary glomerulonephritis globally, is one of the reasons for end-stage renal disease (ESRD).2 Additionally, patients with IgAN in Asia have a higher risk of developing ESRD than other ethnic groups.3 Currently, the treatment of IgAN is inadequate. Therefore, there is an urgent need for new treatments to delay the progression of kidney disease of IgAN.
The pathogenesis of IgAN is complex and has not yet been fully elucidated.4 Studies have shown that toll-like receptor 4 (TLR4) and its signaling pathways play an important role in the development of renal inflammation and fibrosis.5,6 TLR4 induces mesangial cell injury and renal interstitial fibrosis by promoting the production of inflammatory markers, such as monocyte chemoattractant protein-1 (MCP-1), interleukin-6 (IL-6), and the production of profibrotic molecules, such as transforming growth factor-β1 (TGF-β1) in chronic kidney disease (CKD).7,8 One of the major signaling pathways of TLR4 is through myeloid differentiation factor 88 (MyD88), which binds to the toll/IL-1R resistance (TIR) region of TLR4 cells, resulting in the activation of nuclear factor-kappa B (NF-κB), and then promoting the expression of IL-6 and MCP-1.9 TLR4/MyD88/NF-κB signaling pathway plays an important role in kidney diseases. Over-activation of TLR4/MyD88/NF-κB signaling pathway was involved in the occurrence and progression of diabetic nephropathy.10 TLR4/MyD88/NF-κB signaling pathway was also associated with lipopolysaccharide (LPS)-induced inflammatory response in human renal tubular epithelial cells.11 A recent study reported that TLR4 shRNA silencing and NF-κB inhibition both reduced the expression of IL-6 and MCP-1, which indicated that TLR4/MyD88/NF-κB signaling pathway mediating kidney injury of IgAN.12
In China, patients often choose Traditional Chinese Medicine to treat IgAN. Modified Huangqi Chifeng decoction (加味黄芪赤风汤, MHCD), a Traditional Chinese Medicine, is known as an efficient treatment for IgAN and has been reported to be effective in reducing proteinuria in patients with IgA nephropathy in clinical trials.13,14 In addition, we conducted an in vivo study showing that MHCD could reduce proteinuria and alleviate glomerular and podocyte injury in adriamycin-induced nephrotic syndrome rats,15 and we also conducted an in vitro experiment showing that MHCD could inhibit LPS-evoked extracellular matrix deposition of glomerular mesangial cells and prevent renal fibrosis.16
In this study, we confirmed that MHCD exerted nephroprotective effects in reducing proteinuria and ameliorating renal pathological injury in IgAN rats, and examined the mechanisms of its effects.
2. MATERIALS AND METHODS
2.1. Drugs and antibodies
The composition of MHCD was as follows: 30 g Huangqi (Radix Astragali Mongolici), 10 g Chishao (Radix Paeoniae Rubra), 10 g Fangfeng (Radix Saposhnikoviae), 20 g Qianshi (Semen Euryales), 10 g Jinyingzi (Fructus Rosae Laevigatae), 20 g Chuanshanlong (Rhizoma Dioscoreae Nippponicae), and 20 g Baihuasheshecao (Herba Hedyotdis). The decoction was provided and the water decoction was manufactured by the Manufacturing Laboratory of Xiyuan Hospital of the China Academy of Chinese Medical Sciences.
Telmisartan (Micardis, 80 mg/pill) was purchased from Boehringer Ingelheim International GmbH (Ingelheim am Rhein, Germany). Bovine serum albumin (BSA), LPS, and carbon tetrachloride (CCL4) were all purchased from Sigma-Aldrich (St. Louis, MO, USA). Castor oil was purchased from Guangfu Fine Chemical Reagent Co., Ltd. (Tianjin, China). FITC-labeled rabbit anti-rat antibody was purchased from Abcam, UK. Abcam (Cambridge, UK) provided primary antibodies, including anti-TLR4 (ab22048), anti-MyD88 (ab2064), anti-NF-κB P65 (ab16502), anti-IL6 (ab9622), anti-MCP-1 (ab9669), anti-TGF-β1 (ab220084). Secondary antibodies were all received from Cell Signaling Technology (Danvers, MA, USA). Tissue Mitochondria Isolation Kit was acquired from Beyotime (Shanghai, China). Hematoxylin and eosin (HE), Masson’s Trichrome stain, periodic acid-silver metheramine (PASM) stain and plasma biochemical assay kits for measuring creatinine (CRE), blood urea nitrogen (BUN) were acquired from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). UNIQ-10 Column-Based Trizol Total RNA Extraction Kit and Tap PCR Master Mix (2×, blue dye) were purchased from Sangon Biotech (Shanghai, China). Special reagents for quantitative polymerase chain reaction (qPCR) kit SYBR Premix Ex Taq II were acquired from TransGen Biotech (Beijing, China).
2.2. Animal grouping and treatment
Sixty-six male, specific pathogen free grade, Sprague-Dawley rats [average weight, (150 ± 10) g; age, 3-6 weeks] were purchased from Beijing HFK Bioscience Co., Ltd. (Beijing, China) under Certificate of Quality No. SCXK (JING) 2016-0011. Rats were housed in humidity-controlled rooms (60% ± 10%) at (24 ± 1) ℃ with a 12 h light/dark cycle and free access to standard food and water.
After acclimatization to laboratory conditions for a week, rats were randomly divided into the control (n = 13) and the model (n = 53) groups. The rat model of IgAN was established according to our previously described method.17,18 Briefly, rats in the model group were administered 400 mg/kg BSA by gavage on alternate days for 8 weeks, while 0.1 mL CCL4 in 0.3 mL castor oil was subcutaneously injected once a week for 9 weeks. Additionally, 0.05 mg LPS was injected once into the tail vein at the 6th and 8th week. Three rats in each group were sacrificed to examine if the model was successful at the 10th week. A qualified model included IgA deposition in the glomerular mesangial area, the proliferation of mesangial cells, and deposition of mesangial matrix which were seen by HE staining.
After the model was successfully established, rats in the control group were set as the control group (n = 10), while rats in the model group were equally divided into 5 groups, the model group (n = 10), telmisartan group (n = 10), high-dose MHCD (MHCD-H) group (n = 10), medium-dose MHCD (MHCD-M) group (n = 10), and the low-dose MHCD (MHCD-L) group (n = 10). Drug intervention was initiated from the 11th week, and rats in each group were given successive intragastric administration every morning for 8 weeks. Rats in the control and model groups were given the same volumes of normal saline, and the telmisartan and each MHCD groups were administered telmisartan (8.33 mg·kg-1·d-1), MHCD (25.00, 12.50, 6.25 g·kg-1·d-1) respectively. All drugs were diluted with distilled water, and the dosages were evaluated by body surface area coefficient conversion between humans and rats.
2.3. Sample and tissues collection
Urine was collected once every two weeks to determine the 24-h urine protein level from the beginning of the experiment. At the 18th week, blood from the abdominal aorta of the rats was collected and kidney tissues were harvested. Blood was obtained to determine creatinine (CRE), and blood urea nitrogen (BUN) levels. The kidneys were then harvested for the subsequent experiments after rats were sacrificed by cervical dislocation. All experiments were performed following the US guidelines (NIH publication #85-23, revised in 1985), and in accordance with the protocols of the Institutional Animal Care and Use Committee at Xiyuan Hospital of the China Academy of Chinese Medical Sciences (2019XLC018).
2.4. Immunofluorescence staining
Partial slices were embedded in optimal cutting temperature compound and stored at -70 °C, followed by frozen sectioning. IgA deposited in the glomerular mesangial area was visualized after slices were stained with immunofluorescence and the semi-quantitative method was used to evaluate the intensity of the immunofluorescent IgA deposition. There are 5 grades of IgA immunofluorescence staining, grade -: no staining under low magnification, possible staining under high magnification; grade +: possible staining under low magnification, staining under high magnification; grade ++: staining under low magnification, clear staining under high magnification; grade +++: clear staining under low magnification, bright staining under high magnification; grade ++++: bright staining under low magnification, glare staining under high magnification.
2.5. Histopathological analysis
Sections of renal cortex tissues were fixed in 10% buffered formalin for 24 h at 25 ℃, and then embedded in paraffin and sliced to 3 μm. Partial slices were visualized under light microscopy after staining with HE, Masson's trichrome, and PASM. The Katafuchi R semiquantitative score system, according to the method previous reported,19 was adopted to further evaluate the pathological injury of kidney tissue under HE. Masson staining images were analyzed by Image-Pro Plus 6.0 image analysis system to calculate the score of glomerular and interstitial fibrosis. The procedure was observing the cortical glomerulus concentration area at low magnification, and then capturing the image at 200 magnification, calculating the percentage of the green-stained area in the total field area under each field, and finally taking the mean value.
Partial slices were fixed in 2.5% glutaraldehyde at 4 ℃ for 24 h and then sliced to 70-90 nm. After staining with osmium tetroxide and lead citrate, the ultrastructure of the kidney was visualized using a transmission electron microscope (Hitachi, Ltd., Tokyo, Japan).
2.6. Immunohistochemistry
The paraffin-embedded tissue sections were dewaxed with xylene and rehydrated with a descending alcohol series. The tissue sections were incubated with 3% H2O2 at 25 ℃ for 10 min and then washed three times with phosphate buffered saline (PBS). Then, the tissue sections were incubated overnight at 4 ℃ with primary antibodies. After washing thrice with PBS, sections were incubated with secondary antibodies and washed three times with PBS. The tissue sections were successively stained with diaminobenzidine, washed, dehydrated, permeabilized, and mounted, after which the sections were observed by a light microscope (BX51, Olympus, Tokyo, Japan). The ratio of integrated optical density (IOD) was adopted to determine protein expression. The formula for IOD is as follows: IOD = average optical density × positive area.
2.7. Western blotting
Renal cortex tissues were lysed on ice for 10 min using radio immunoprecipitation assay lysis buffer, after which the tissues were sonicated and the crude extracts were centrifuged at 12 000 × g for 10 min at 4 ℃. Then, the concentration of protein was determined with a Bicinchoninic Acid Protein Assay Kit. Briefly, 50 μg of protein was loaded onto a sodium dodecyl sulfate polyacrylamide gel electrophoresis gel and transferred to polyvinylidene fluoride membranes (Merck Millipore, Billerica, MA, USA). The membranes were blocked with Tris-buffered saline/Tween-20 (TBST) at 25 ℃ for 1 h, followed by incubation with the primary antibodies at 4 ℃ overnight. After the membranes were washed with TBST, they were incubated with the corresponding secondary antibodies, horseradish peroxidase-conjugated goat anti-rabbit antibodies, at 25 ℃ for 2 h. The bands were visualized using an enhanced chemiluminescent kit. ImageJ software (Version 4.0; National Institutes of Health, Bethesda, MD, USA) was used for densitometry analysis, and recombinant glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference.
2.8. qPCR
Total RNA was extracted from renal cortex tissues using TRIzol extraction, then 4 μg RNA was reverse-transcribed into cDNA using a reverse transcription kit, and 50 ng cDNA was used for amplification using an ABI7900HT machine (Applied Biosystems, Carlsbad, CA, USA) according to the manufacturer’s instructions finally. The experimental conditions were as follows: pre-denaturing at 95 ℃ for 15 s, followed by 40 cycles of denaturation at 95 ℃ for 5 s, and the last was a combined annealing/extension at 61 ℃ for 30 s. The comparative quantification method (2-ΔΔCt) was adopted to evaluate semi-log amplification curves, and GAPDH was used as an internal control. The primer sequences used in this study are shown as follows: TLR4, forward: GGCATCATCTTCATTGTCCTTG, reverse: AGCA-TTGTCCTCCCACTCG; MyD88, forward: AGAGT-GGAGAGCAGTGTC, reverse: GGCAGTAGCAGA-TGAAGG; NF-κB, forward: TGCAGGCTCCTGTG-CGAGTG, reverse: TCCGGTGGCGATCTGCTGTGT; IL-6, forward: ATGGGTCTCACCTCCCAACTGCT, reverse: CGAACACTTTGAATATTTCTCTCTCAT; MCP-1, forward: AGGTCTCTGTCACGCTTCTG, reverse: CTGGTGATTCTTGTAGTCTCC; TGF-β1, forward: GAGTCAACGGATTTGGTCGT, reverse: TTGATTTTGGAGGGATCTCG; GAPDH, forward: ATGGTGAAGTCGGTGTGAAGG, reverse: CGCTC-TGGAAGATGTGATGG.
2.9. Statistical analysis
Data were expressed as the mean ± standard deviation. Statistical analysis was performed by one-way analysis of variance (ANOVA) to compare differences between groups using SPSS software 22.0 (IBM Corp., Armonk, NY, USA). P < 0.05 indicated a statistically significant difference, and all P-values were two-sided.
3. RESULTS
3.1. MHCD reduced proteinuria
As shown in Figure 1A, at the stage of model building, the 24-h urine protein level in the model group significantly was higher than that of the control group at week 6, and worsen from then on (P < 0.01). As shown in Figure 1B, after the IgAN model establishment, rats in the model group developed higher level of proteinuria at the 12th week compared to the control group (P < 0.01), and from then on this condition continued to worsen. From the 14th week, proteinuria significantly decreased in three doses of MHCD groups and the telmisartan group compared with that of the model group (P < 0.05). Meanwhile, the 24 h urine protein in the MHCD-L group was higher than that of the MHCD-H group, MHCD-M group, and telmisartan group (P < 0.05).
Figure 1. MHCD reduced proteinuria.
A: proteinuria changes at the stage of model building (n of control group = 13, n of model group = 53). B: proteinuria changes during intervention (n = 10). The telmisartan group were intragastrically administered telmisartan at a dose of 8.33 mg·kg-1·d-1 for 8 weeks; The MHCD-H, MHCD-M, and MHCD-L groups were intragastrically administered MHCD at 25.0, 12.5, and 6.25 g·kg-1·d-1, respectively, for 8 weeks; The control group and model group were given the same volumes of normal saline for 8 weeks. MHCD: modified Huangqi Chifeng decoction; MHCD-L: low-dose modified Huangqi Chifeng decoction; MHCD-M: medium-dose modified Huangqi Chifeng decoction; MHCD-H: high-dose modified Huangqi Chifeng decoction. Data represent the mean ± standard deviation using one-way analysis of variance. aP < 0.01 vs control group; bP < 0.05 and cP < 0.01 vs model group; dP < 0.05 vs MHCD-M group, MHCD-H group and telmisartan group.
3.2. MHCD did not alter certain biochemical measurements of renal function
To evaluate whether MHCD affected renal function, serum BUN and CRE, the hallmarks of kidney dysfunction, levels were measured in all groups (supplementary Figure 1A-1B). The outcomes showed there were no differences among each groups (P > 0.05).
3.3. MHCD attenuated renal histopathological injury
Renal pathological changes were examined by HE, Masson and PASM staining (supplementary Figure 2A-2C). Compared with the control group, the model group showed proliferative mesangial cells, increased mesangial matrix, contractile capillary lumen, partial swollen renal tubular epithelial cells, and fibrotic changes in the renal interstitium. Compared with the model group, treatment with three doses of MHCD, as well as telmisartan, significantly ameliorated the renal pathological changes. Moreover, the improvement effect on pathological injury of renal tissue in the MHCD-H and MHCD-M groups were better than that of the MHCD-L group.
As shown in supplementary Figure 2D, the Katafuchi score in the model group significantly increased compared with the control group (P < 0.01). After treatment by telmisartan and three dose of MHCD, the score significantly decreased (P < 0.05), and the score in the MHCD-H and MHCD-M groups were lower than that of the MHCD-L group (P < 0.05). Simultaneously, to evaluate whether MHCD could alleviate renal fibrosis, the score of glomerular and interstitial fibrosis were calculated (supplementary Figure 2E). Results showed treatment of MHCD and telmisartan clearly decreased the scores of glomerular and interstitial fibrosis (P < 0.05). What's more, the score of renal fibrosis in the MHCD-L group was significantly worse than the MHCD-H and MHCD-M groups as Katafuchi score (P < 0.05).
In addition, the ultrastructure of the kidney was visualized by using a transmission electron microscope (supplementary Figure 2F). No abnormal morphology was observed in the control group. However, the renal ultrastructure in the model group exhibited proliferative mesangial cells, increased mesangial matrix, large electron-dense particles distributed in the mesangial region, a large fusion of foot processes, and both thick and thin basement membrane. The morphology of three doses of MHCD group were roughly the same as that of the telmisartan group and exhibited no obvious proliferation of mesangial cells, few electron-dense particles distributed in the mesangial region, a local fusion of foot processes, and uniform thickness of the basement membrane.
3.4. MHCD decreased IgA deposition
As shown in Figure 2A-2B, there was hardly any IgA deposited in the glomerular mesangial area of the control group. However, a large amount of IgA immune-ofluorescence was observed in the model group (P < 0.01). In the MHCD-H and MHCD-M group as well as telmisartan group, IgA deposition was less than that in the model group (P < 0.01). These results suggested that MHCD could reduce the deposits of IgA in the glomerular mesangial area.
Figure 2. MHCD decreased IgA deposition (n = 10, × 400).
A1-A6: images of Immunofluorescence staining. B: quantitative analysis of IgA deposition. A1, A2: selected from the control group (A1) and the model group (A2) were given the same volumes of normal saline for 8 weeks; A3: selected from the telmisartan group were intragastrically administered telmisartan at a dose of 8.33 mg·kg-1·d-1 for 8 weeks; A4: selected from the MHCD-L group were intragastrically administered MHCD at 6.25 g·kg-1·d-1 for 8 weeks; A5: selected from the MHCD-M group were intragastrically administered MHCD at 12.5 g·kg-1·d-1 for 8 weeks; A6: selected from the MHCD-H group were intragastrically administered MHCD at 25.0 g·kg-1·d-1 for 8 weeks. The Data represent the mean ± standard deviation using one-way analysis of variance. aP < 0.01 vs control group; bP < 0.05 vs model group. MHCD: modified Huangqi Chifeng decoction; MHCD-L: low-dose modified Huangqi Chifeng decoction; MHCD-M: medium-dose modified Huangqi Chifeng decoction; MHCD-H: high-dose modified Huangqi Chifeng decoction.
3.5. MHCD downregulated the expressions of MCP-1 and IL-6, and decreased the TGF-β1 level
The expression and distribution of MCP-1 and IL-6 were examined by immunohistochemistry (Figure 3A-3B, 3D-3E). MCP-1 and IL-6 were mainly expressed in kidney tubules. MCP-1 and IL-6 levels were increased in the model group compared with that of the control group (P < 0.05). Compared with the model group, in three doses of MHCD group and telmisartan group, MCP-1 and IL-6 levels were significantly decreased (P < 0.05). Meanwhile, MCP-1 and IL-6 mRNA was analyzed by qPCR (Figure 3G-3H). The levels of MCP-1 and IL-6 mRNA were significantly increased in the model group compared with that of the control group (P < 0.05). Compared with the model group, in three doses of MHCD group and telmisartan group, the levels of MCP-1 and IL-6 mRNA decreased significantly (P < 0.05).
Figure 3. MHCD downregulated the expressions of MCP-1, IL-6, and TGF-β1.
A1-A6: images of immunohistochemistry of MCP-1 (× 200); B1-B6: images of immunohistochemistry of IL-6 (× 200); C1-C6: images of immunohistochemistry of TGF-β1 (× 200); D: quantitation of MCP-1 measured by immunohistochemistry; E: quantitation of IL-6 measured by immunohistochemistry; F: quantitation of TGF-β1 measured by immunohistochemistry; G: MCP-1 was measured by qPCR; H: IL-6 was measured by qPCR; I: TGF-β1 was measured by qPCR. A1, A2, B1, B2, C1, C2: selected from the control group (A1, B1, C1) and the model group (A2, B2, C2) were given the same volumes of normal saline for 8 weeks; A3, B3, C3: selected from the telmisartan group were intragastrically administered telmisartan at a dose of 8.33 mg·kg-1·d-1 for 8 weeks; A4, B4, C4: selected from the MHCD-L group were intragastrically administered MHCD at 6.25 g·kg-1·d-1 for 8 weeks; A5, B5, C5: selected from the MHCD-M group were intragastrically administered MHCD at 12.5 g·kg-1·d-1 for 8 weeks; A6, B6, C6: selected from the MHCD-H group were intragastrically administered MHCD at 25.0 g·kg-1·d-1 for 8 weeks. MCP-1: monocyte chemotactic protein 1; IL-6: interleukin 6; TGF-β1: transforming growth factor-β 1; MHCD: modified Huangqi Chifeng decoction; MHCD-L: low-dose modified Huangqi Chifeng decoction; MHCD-M: medium-dose modified Huangqi Chifeng decoction; MHCD-H: high-dose modified Huangqi Chifeng decoction. The Data represent the mean ± standard deviation using one-way analysis of variance (n = 10). aP < 0.01 vs control group; bP < 0.05 and cP < 0.01 vs model group.
Meanwhile, the expression and distribution of TGF-β1 were examined by immunohistochemistry (Figure 3C, 3F). There was partial expression of TGF-β1 in the control group. The expression of TGF-β1 increased significantly in the model group compared with that in the control group (P < 0.05) and TGF-β1 was mainly expressed in kidney tubules. The expression of TGF-β1 decreased significantly in low-dose, medium-dose and high-dose MHCD groups, and telmisartan group compared with that in the model group (P < 0.05). Meanwhile, the expression levels of TGF-β1 were examined by Western blotting (Figure 3I). The expression of TGF-β1 increased significantly in the model group compared to that in the control group (P < 0.05). Compared with the model group, in low-dose, medium-dose and high-dose MHCD groups, and telmisartan group the expression of TGF-β1 decreased significantly (P < 0.05).
3.6. MHCD inhibited the TLR4/MyD88/NF-κB signaling pathway
Firstly, the expression levels of TLR4, MyD88, and NF-κB P65 were observed by immunohistochemistry (Figure 4A-4D). TLR4 was expressed in both glomerular mesangial cells and kidney tubular epithelial cells. However, MyD88 and NF-κB P65 were mainly expressed in kidney tubules. TLR4, MyD88, and NF-κB P65 levels increased significantly in the model group compared with that in the control group (P < 0.05). Compared with the model group, in low-dose, medium-dose and high-dose MHCD groups, and telmisartan group, the expression of TLR4, MyD88, and NF-κB P65 decreased significantly (P < 0.05). Secondly, the expression of TLR4, MyD88, and NF-κB P65 measured by Western blotting analysis, increased significantly in the model group compared with that of the control group (P < 0.05) (Figure 4E-4H). Compared with the model group, in low-dose, medium-dose and high-dose MHCD groups and telmisartan group, the expression of TLR4, MyD88, and NF-κB P65 decreased significantly (P < 0.05). Thirdly, the expression of TLR4, MyD88, and NF-κB mRNA increased significantly in the model group compared with that of the control group (P < 0.05) (Figure 4I-4K). Compared with the model group, in low-dose, medium-dose and high-dose MHCD groups, and telmisartan group, the expression of TLR4, MyD88, and NF-κB mRNA decreased significantly (P < 0.05).
Figure 4. MHCD inhibited the TLR4/MyD88/NF-κB signaling pathway.
A1-A6: images of immunohistochemistry of.TLR4 (× 200); B1-B6: images of immunohistochemistry of MyD88 (× 200); C1-C6: images of immunohistochemistry of NF-κB P65 (× 200); D: quantitation of TLR4 measured by immunohistochemistry; E: quantitation of MyD88 measured by immunohistochemistry; F: quantitation of NF-κB P65 measured by immunohistochemistry; G: images of TLR4, MyD88 and NF-κB P65 analyzed by Western blotting; H: TLR4 was analyzed by Western blotting; I: MyD88 was analyzed by Western blotting; J: NF-κB P65 was analyzed by Western blotting; K: TLR4 was analyzed by qPCR; L: MyD88 was analyzed by qPCR; M: NF-κB was analyzed by qPCR. A1, A2, B1, B2, C1, C2: selected from the control group (A1, B1, C1) and the model group (A2, B2, C2) were given the same volumes of normal saline for 8 weeks; A3, B3, C3: selected from the telmisartan group were intragastrically administered telmisartan at a dose of 8.33 mg·kg-1·d-1 for 8 weeks; A4, B4, C4: selected from the MHCD-L group were intragastrically administered MHCD at 6.25 g·kg-1·d-1 for 8 weeks; A5, B5, C5: selected from the MHCD-M group were intragastrically administered MHCD at 12.5 g·kg-1·d-1 for 8 weeks; A6, B6, C6: selected from the MHCD-H group were intragastrically administered MHCD at 25.0 g·kg-1·d-1 for 8 weeks. TLR4: toll-like receptor 4; MyD88: myeloid differentiation primary response 88; NF-κB: nuclear factor kappa-B; MHCD: modified Huangqi Chifeng decoction; MHCD-L: low-dose modified Huangqi Chifeng decoction; MHCD-M: medium-dose modified Huangqi Chifeng decoction; MHCD-H: high-dose modified Huangqi Chifeng decoction. The Data represent the mean ± standard deviation using one-way analysis of variance (n = 10). aP < 0.01 and dP < 0.05 vs control group; bP < 0.05 and cP < 0.01 vs model group.
4. DISCUSSION
IgAN is one of the most common primary glomerulonephritis worldwide and one of the main causes leading to ESRD.2 Proteinuria is one of the main clinical manifestations of IgAN. It is confirmed that proteinuria is a key factor in determining the prognosis of IgAN and an independent predictor of glomerular filtration rate.20 Proteinuria is characterized by a long disease course, relapse, and difficult treatment. Moreover, side effects of long-term use of hormones and immunosuppressive agents as the treatment of proteinuria seriously affect patients' quality of life.21 Therefore, it is of great significance to explore Traditional Chinese Medicine for the treatment of proteinuria in IgAN. In this study, the results demonstrated that MHCD could reduce proteinuria and ameliorate renal pathological changes. In addition, CRE and BUN levels of the rats with IgA nephropathy in the model group were found to be no significant different from those in the control group in this study. This indicated that there was no significant decline in renal function during IgA modelling, although proteinuria and renal pathological injury occurred. It may be related to the great compensatory capacity of the kidneys, dosage and timing of administration of drugs used for modelling. Meanwhile, CRE and BUN levels were not altered after MHCD intervention, which suggesting that MHCD has a good safety profile in treating rats with IgAN. This is the same as our previous studies.17,18
The pathogenesis of IgAN involves multiple factors, among which inflammation is increasingly recognized as a key driving force. A Study showed that pro-inflammatory factors, such as TNF-α, IL-6, and IL-1β, resulted in alterations in glomerular permeability, subsequent proteinuria, and tubulointerstitial injury.22 IL-6 and MCP-1 are both powerful moderators of inflammation and play important roles in the pathogenesis of IgAN. A previous study reported that the expression of IL-6 mRNA in renal tissue correlated with the degree of mesangial cell proliferation and tubule interstitial changes in patients with IgAN, which suggested IL-6 played an important role in IgAN.23 MCP-1 is the major chemokine responsible for chemotaxis and activation of monocyte macrophages.8 Studie showed that tubular epithelial cells in IgAN patients can secrete a large number of MCP-1, inducing the infiltration of monocyte macrophages in the renal tubule and interstitium activating a variety of pro-inflammatory cytokines and pro-fibrokines, thus aggravating tubulointerstitial lesions and renal dysfunction in patients with IgAN.24,25 This study also showed increased expression levels of IL-6 and MCP-1 in renal tissues, and MHCD could downregulate the levels of IL-6 and MCP-1 protein and mRNA of IgAN rats. Thus, we concluded that MHCD attenuated renal inflammation.
To test the effect of MHCD on renal fibrosis, we examined the expression levels of TGF-β1. TGF-β1, a multifunctional cytokine, affects several biological processes, including extracellular matrix accumulation, and plays a determinant role in renal fibrosis.26 TGF-β1-dominated cytokine networks activated by a stimulus could transform renal resident cells into myofibroblasts, which exacerbated renal fibrosis.27 Clinical and experimental data have shown that the expression of TGF-β1 is increased in patients and animal models with IgAN.28,29 This study showed similar increased TGF-β1 level in renal tissues of IgAN rats and MHCD could downregulat it.
TLR4 signaling pathways play an important role in the development of renal inflammation and fibrosis.6,30 One of the main signal transduction pathways is TLR4/ MyD88/NF-κB. A recent study reported that upregulation of the TLR4/MyD88/NF-κB signaling pathway resulted in increased renal inflammation and fibrotic factor production in MyD88 inhibitor-treated mice with hypertension-associated kidney disease.31 Several studies have reported that upregulation of the TLR4/MyD88/NF-κB signalling pathway was associated with renal inflammation and fibrosis in rats or mice with diabetic nephropathy.32,⇓,⇓-35 In vitro, high glucose-induced injury, inflammation, and fibrosis in glomerular mesangial cells and tubular epithelial cells were associated with upregulation of the TLR4/MyD88/NF-κB signaling pathway.36,⇓-38 In a model of severe burn-induced acute kidney injury, the TLR4/MyD88/NF-κB signaling pathway was activated to regulate renal inflammation.39 Another study reported that activation of the TLR4/MyD88/NF-κB signalling pathway exacerbated inflammation and promoted kidney injury in LPS-induced sepsis-associated acute kidney injury.40
TLR4/MyD88/NF-κB is involved in the pathogenesis of IgAN. Researchers reported that the expression of TLR4, MyD88, and NF-κB mRNA in renal tissues was significantly increased in IgAN rats compared with those in the control group.41 A study reported that a combination of in vivo and in vitro experiment revealed that secretory IgA activated the TLR4/MyD88/NF-κB signalling pathway in glomerular mesangial cells, leading to increased secretion of TNF-α, IL-6 and MCP-1, and thereby mediated renal injury in IgAN patients.12 This study demonstrated that the expression of TLR4, MyD88, and NF-κB protein and mRNA increased significantly in IgAN rats and that MHCD alleviated the expression levels of TLR4, MyD88, and NF-κB protein and mRNA. These findings suggested that MHCD inhibited the TLR4/MyD88/NF-κB signaling pathway.
In conclusion, MHCD exerted kidney protection effects in IgAN rats. The molecular mechanisms maybe that MHCD inhibited the TLR4/MyD88/NF-κB signaling pathway, thereby alleviating inflammation based on inhibiting MCP-1 and IL-6 levels, and ameliorating renal fibrosis based on suppressing TGF-β1 expression. This study suggests that MHCD could be a candidate for the treatment of IgAN.
5. SUPPORTING INFORMATION
Supporting data to this article can be found online at http://journaltcm.cn.
Contributor Information
Bin YANG, Email: yangbin555@126.com.
Yu ZHANG, Email: zhangyu8225@126.com.
REFERENCES
- 1. Roberts I. . Oxford classification of immunoglobulin A nephropathy: an update. Curr Opin Nephrol Hy 2013; 22: 281-6. [DOI] [PubMed] [Google Scholar]
- 2. Schena F, Nistor I. . Epidemiology of IgA nephropathy: a global perspective. Semin Nephrol 2018; 38: 435-42. [DOI] [PubMed] [Google Scholar]
- 3. Xu X, Ning Y, Shang WF, et al. . Analysis of 4931 renal biopsy data in central China from 1994 to 2014. Ren Fail 2016; 38: 1021-30. [DOI] [PubMed] [Google Scholar]
- 4. Novak J, Renfrow M, Gharavi A, Julian BA. . Pathogenesis of immunoglobulin A nephropathy. Curr Opin Nephrol Hy 2013; 22: 287-94. [DOI] [PubMed] [Google Scholar]
- 5. Lim BJ, Lee D, Hong SW, Jeong HJ. Toll-like receptor. 4 signaling is involved in IgA-stimulated mesangial cell activation. Yonsei Med J 2011; 52: 610-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Pulskens W, Rampanelli E, Teske G, et al. . TLR4 promotes fibrosis but attenuates tubular damage in progressive renal injury. JASN 2010; 21: 1299-308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Gluba A, Banach M, Hannam S, Mikhailidis DP, Sakowicz A, Rysz J. . The role of Toll-like receptors in renal diseases. Nat Rev Nephrol 2010; 6: 224-35. [DOI] [PubMed] [Google Scholar]
- 8. Lepenies J, Eardley KS, Kienitz T, et al. . Renal TLR4 mRNA expression correlates with inflammatory marker MCP-1 and profibrotic molecule TGF-beta (1) in patients with chronic kidney disease. Nephron Clin Pract 2011; 119: c97-104. [DOI] [PubMed] [Google Scholar]
- 9. Qiang S, Lyu XW, Sun YH, Ye ZL, Kong BH, Qin ZB. . Role of TLR4/MyD88/NF-κB signaling pathway in coronary microembolization-induced myocardial injury prevented and treated with nicorandil. Biomed Pharmacother 2018; 106: 776-84. [DOI] [PubMed] [Google Scholar]
- 10. Chen F, Zhu XG, Sun ZQ, Ma YL. . Astilbin inhibits high glucose-induced inflammation and extracellular matrix accumulation by suppressing the TLR4/MyD88/NF-κB pathway in rat glomerular mesangial cells. Front Pharmacol 2018; 9: 1187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Ding Y, Yang HL, Xiang W, He XJ, Liao W, Yi ZW. . CD200R1 agonist attenuates LPS-induced inflammatory response in human renal proximal tubular epithelial cells by regulating TLR4-MyD88-TAK1-mediated NF-κB and MAPK pathway. Biochem Bioph Res Co 2015; 460: 287-94. [DOI] [PubMed] [Google Scholar]
- 12. Zhang J, Mi Y, Zhou R, et al. . The TLR4-MyD88-NF-κB pathway is involved in sIgA-mediated IgA nephropathy. J Nephrol 2020; 33: 1251-61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Jiao ZN, Zhao MM, Zhang Y, Li LS, Si Y. . Single case randomized controlled research of Modified Huangqi Chifeng decoction in the treatment of proteinuria due to IgA nephropathy. Zhong Guo Yi Yao Dao Bao 2018; 15: 96-8. [Google Scholar]
- 14. Yu ZK, Li LS, Zhang Y, Zhao MM, Si Y, Zhang LM. . Efficacy study on modified Huangqi Chifeng decoction in treatment of IgA based on real world study. Shi Jie Zhong Yi Yao 2018; 13: 2819-22. [Google Scholar]
- 15. Yu ZK, Yang B, Zhang Y, Li LS, Zhao JN, Hao W. . Modified Huangqi Chifeng decoction inhibits excessive autophagy to protect against doxorubicin-induced nephrotic syndrome in rats via the PI3K/mTOR signaling pathway. Exp Ther Med 2018; 16: 2490-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Gao YH, Zhang Y, Li P, Liu HX, Li S, Yu ZK. . Anti-renal fibrosis mechanism of modified Huangqi Chifeng decoction based on TGF-β1/Smad signal pathway. Shi Jie Zhong Xi Yi Jie He Za Zhi 2016; 36: 1486-90. [PubMed] [Google Scholar]
- 17. Chang MY, Yang B, Li LS, et al. . Modified Huangqi Chifeng decoction attenuates proteinuria by reducing podocyte injury in a rat model of immunoglobulin a nephropathy. Front Pharmacol 2021; 12: 714584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Zhao MM, Yang B, Li LS, et al. . Efficacy of modified Huangqi Chifeng decoction in alleviating renal fibrosis in rats with IgA nephropathy by inhibiting the TGF-β1/Smad 3 signaling pathway through exosome regulation. J Ethnopharmacol 2022; 285: 114795. [DOI] [PubMed] [Google Scholar]
- 19. Katafuchi R, Kiyoshi Y, Oh Y, et al. . Glomerular score as a prognosticator in IgA nephropathy: its usefulness and limitation. Clin Nephrol 1998; 49: 1-8. [PubMed] [Google Scholar]
- 20. Le W, Liang S, Hu Y, et al. . Long-term renal survival and related risk factors in patients with IgA nephropathy: results from a cohort of 1155 cases in a Chinese adult population. Nephrol Dial Transplant 2012; 27: 1479-85. [DOI] [PubMed] [Google Scholar]
- 21. Lyu J, Zhang H, Wong MG, et al. . Effect of oral methylprednisolone on clinical outcomes in patients with IgA nephropathy: the TESTING randomized clinical trial. JAMA 2017; 327: 432-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Chan LY, Leung JC, Tsang AW, Tang SC, Lai KN. . Activation of tubular epithelial cells by mesangial-derived TNF-alpha: glomerulotubular communication in IgA nephropathy. Kidney Int 2005; 67: 602-12. [DOI] [PubMed] [Google Scholar]
- 23. Masanobu, Miyazaki, Daisuke, et al. . Intrarenal synthesis of IL-6 in IgA nephropathy. Nephrology 1997; 3: 421-30. [Google Scholar]
- 24. Lee YH, Song GG. . Urinary MCP-1 as a biomarker for lupus nephritis: a Meta-analysis. Z Rheumatol 2017; 76: 357-63. [DOI] [PubMed] [Google Scholar]
- 25. Zhao SA, Shen HJ, Gu WZ, Liu AM, Mao JH. . Evaluation of TGF-beta1 and MCP-1 expression and tubulointerstitial fibrosis in children with Henoch-Schonlein purpura nephritis and IgA nephropathy: a clinical correlation. Clinics 2017; 72: 95-102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Prud'homme GJ, Piccirillo CA. . The inhibitory effects of transforming growth factor-beta-1 (TGF-beta1) in autoimmune diseases. J Autoimmun 2000; 14: 23-42. [DOI] [PubMed] [Google Scholar]
- 27. Yang W, Wang J, Shi L, et al. . Podocyte injury and overexpression of vascular endothelial growth factor and transforming growth factor-beta 1 in adriamycin-induced nephropathy in rats. Cytokine 2012; 59: 370-6. [DOI] [PubMed] [Google Scholar]
- 28. Chihara Y, Ono H, Ishimitsu T, et al. . Roles of TGF-beta1 and apoptosis in the progression of glomerulosclerosis in human IgA nephropathy. Clin Nephrol 2006; 65: 385-92. [DOI] [PubMed] [Google Scholar]
- 29. Leung JC, Chan LY, Tsang AW, et al. . Anti-macrophage migration inhibitory factor reduces transforming growth factor-beta 1 expression in experimental IgA nephropathy. Nephrol Dial Transplant 2004; 19: 1976-85. [DOI] [PubMed] [Google Scholar]
- 30. Zou JN, Xiao J, Hu SS, et al. . Toll-like receptor 4 signaling pathway in the protective effect of pioglitazone on experimental immunoglobulin A nephropathy. Chin Med J (Engl) 2017; 130: 906-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Lin K, Luo W, Yang N, et al. . Inhibition of MyD88 attenuates angiotensin Ⅱ-induced hypertensive kidney disease via regulating renal inflammation. Int Immunopharmacol 2022; 112: 109218. [DOI] [PubMed] [Google Scholar]
- 32. Chen JJ, Peng H, Chen CJ, et al. . NAG-1/GDF15 inhibits diabetic nephropathy via inhibiting AGE/RAGE-mediated inflammation signaling pathways in C57BL/6 mice and HK-2 cells. Life Sci 2022; 311: 121142. [DOI] [PubMed] [Google Scholar]
- 33. Zhang QY, Xu SJ, Qian JC, et al. . Pharmacological inhibition of MyD88 suppresses inflammation in tubular epithelial cells and prevents diabetic nephropathy in experimental mice. Acta Pharmacol Sin 2022; 43: 354-66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Wang HQ, Wang SS, Chiufai K, Wang Q, Cheng XL. . Umbelliferone ameliorates renal function in diabetic nephropathy rats through regulating inflammation and TLR/NF-κB pathway. Chin J Nat Med 2019; 17: 346-54. [DOI] [PubMed] [Google Scholar]
- 35. Lu SY, Zhang HL, Wei XJ, et al. . 2-dodecyl-6-methoxycyclohexa-2,5-diene-1,4-dione isolated from Averrhoa carambola L. root ameliorates diabetic nephropathy by inhibiting the TLR4/MyD88/ NF-κB pathway. Diabetes Metab Syndr Obes 2019; 12: 1355-63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Kaur H, Chien A, Jialal I. . Hyperglycemia induces toll like receptor 4 expression and activity in mouse mesangial cells: relevance to diabetic nephropathy. Am J Physiol Renal Physiol 2012; 303: F1145-50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Wang MH, Liu XY, Wang ZL, Xu Q. . The extract of Polygala fallax Hemsl. slows the progression of diabetic nephropathy by targeting TLR4 anti-inflammation and MMP-2/9-mediated anti-fibrosis in vitro. Phytomedicine 2022; 104: 154251. [DOI] [PubMed] [Google Scholar]
- 38. Zhang QY, Xu SJ, Qian JC, et al. . Pharmacological inhibition of MyD88 suppresses inflammation in tubular epithelial cells and prevents diabetic nephropathy in experimental mice. Acta Pharmacol Sin 2022; 43: 354-66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Guo SX, Guo LS, Fang Q, et al. . Astaxanthin protects against early acute kidney injury in severely burned rats by inactivating the TLR4/MyD88/NF-κB axis and upregulating heme oxygenase-1. Sci Rep 2021; 11: 6679. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Zhong Y, Wu S, Yang Y, et al. . LIGHT aggravates sepsis-associated acute kidney injury via TLR4-MyD88-NF-κB pathway. J Cell Mol Med 2020; 24: 11936-48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Wang Y, Sun C, Li CY, et al. . Urinary MCP-1, HMGB1 increased in calcium nephrolithiasis patients and the influence of hypercalciuria on the production of the two cytokines. Urolithiasis 2017; 45: 159-75. [DOI] [PubMed] [Google Scholar]




