Skip to main content
Journal of Traditional Chinese Medicine logoLink to Journal of Traditional Chinese Medicine
. 2023 May 10;44(2):303–314. doi: 10.19852/j.cnki.jtcm.20230510.001

Yemazhui (Herba Eupatorii Lindleyani) ameliorates lipopolysaccharide-induced acute lung injury via modulation of the toll-like receptor 4/nuclear factor kappa-B/nod-like receptor family pyrin domain-containing 3 protein signaling pathway and intestinal flora in rats

Li REN 1, Yang HAI 2, Xue YANG 1, Xianqin LUO 1,✉
PMCID: PMC10927412  PMID: 38504536

Abstract

OBJECTIVE:

To investigate the impact of Yemazhui (Herba Eupatorii Lindleyani, HEL) against lipopolysaccharide (LPS)-induced acute lung injury (ALI) and explore its underlying mechanism in vivo.

METHODS:

The chemical constituents of HEL were analyzed by ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry method. Then, HEL was found to suppress LPS-induced ALI in vivo. Six-week-old male Sprague-Dawley rats were randomly divided into 6 groups: control, LPS, Dexamethasone (Dex), HEL low dose 6 g/kg (HEL-L), HEL medium dose 18 g/kg (HEL-M) and HEL high dose 54 g/kg (HEL-H) groups. The model rats were intratracheally injected with 3 mg/kg LPS to establish an ALI model. Leukocyte counts, lung wet/dry weight ratio, as well as myeloperoxidase (MPO) activity were determined followed by the detection with hematoxylin and eosin staining, enzyme linked immunosorbent assay, quantitative real time polymerase chain reaction, western blotting, immunohistochemistry, and immunofluorescence. Besides, to explore the effect of HEL on ALI-mediated intestinal flora, we performed 16s rRNA sequencing analysis of intestinal contents.

RESULTS:

HEL attenuated LPS-induced inflammation in lung tissue and intestinal flora disturbance. Mechanism study indicated that HEL suppressed the lung coefficient and wet/dry weight ratio of LPS-induced ALI in rats, inhibited leukocytes exudation and MPO activity, and improved the pathological injury of lung tissue. In addition, HEL reduced the expression of tumor necrosis factor-alpha, interleukin-1beta (IL-1β) and interleukin-6 (IL-6) in bronchoalveolar lavage fluid and serum, and inhibited nuclear displacement of nuclear factor kappa-B p65 (NF-κBp65). And 18 g/kg HEL also reduced the expression levels of toll-like receptor 4 (TLR4), myeloid differentiation factor 88, NF-κBp65, phosphorylated inhibitor kappa B alpha (phospho-IκBα), nod-like receptor family pyrin domain-containing 3 protein (NLRP3), IL-1β, and interleukin-18 (IL-18) in lung tissue, and regulated intestinal flora disturbance.

CONCLUSIONS:

In summary, our findings revealed that HEL has a protective effect on LPS-induced ALI in rats, and its mechanism may be related to inhibiting TLR4/ NF-κB/NLRP3 signaling pathway and improving intestinal flora disturbance.

Keywords: Yemazhui (Herba Eupatorii Lindleyani) , acute lung injury, anti-inflammation, toll-like receptor 4, nuclear factor kappa-B, nod-like receptor family pyrin domain-containing 3 protein, signal transduction, gastrointestinal microbiome

1. INTRODUCTION

Acute lung injury (ALI) is a critical respiratory disease, and its high morbidity and mortality pose a serious threat to public health.1,2 ALI is characterized by pulmonary edema, neutrophil activation, inflammatory cell infiltration, pulmonary interstitial thickening and pulmonary hemorrhage.3 Excessive activation of neutrophils can promote inflammation and aggravate lung injury.4 At present, the main treatment methods involve mechanical ventilation, coupled with the use of anti-inflammatory drugs. In spite of this, patient quality of life and mortality have not improved significantly.5,⇓-7 In this study, we attempted to investigate alternative treatment modalities utilizing Traditional Chinese Medicine (TCM).

Inflammation plays a significant role in the development of lung lesions in ALI. Instillation of lipopolysaccharide (LPS) via the trachea is considered a common treatment method in ALI animal models.8 A toll-like receptor 4 (TLR4)/myeloid differentiation primary response protein 88 (MyD88)/nuclear factor kappa-B (NF-κB) signaling pathway is activated by LPS to release several cytokines, including tumor necrosis factor-alpha (TNF-α), interleukin-1beta (IL-1β), and interleukin-1 (IL-6). Nod-like receptor family pyrin domain-containing 3 protein (NLRP3) is an intracellular pattern recognition receptor whose activation is closely linked to inflammation.9 The activation of NF-κB signaling leads to NLRP3 deubiquitylation.10 Activated NLRP3 is involved in the occurrence of inflammation by inducing the synthesis of related proinflammatory factors, such as pro-interleukin 18 and pro-interleukin 1β, and activating macrophages and lymphocytes.11 These can promote inflammatory reactions in LPS-induced ALI.12

In the book Huang Di Nei Jing, there is a theory that “the lung and large intestine are interior-exterior related”. In other words, the lung and large intestine influence and depend on each other.13 In keeping with this, pulmonary inflammation can cause intestinal flora disturbance. Some studies have shown that in the bronchoalveolar lavage fluid (BALF) of patients with adult respiratory distress syndrome (ARDS), the level of intestinal-specific bacteria related to systemic inflammation is higher.14 As such, gut microbiota may be future targets for the treatment of lung diseases,15 and improving the structure of intestinal flora is also an important way to prevent and treat ALI.

Yemazhui (Herba Eupatorii Lindleyani, HEL) is an herbaceous perennial plant commonly used in Chinese medicine to treat chronic bronchitis. Dozens of chemical components have been identified in HEL, including flavonoids, sesquiterpene lactones, diterpenoids, and other chemical components.16 ALI is believed to be caused by loss the dispersing and descending of lung Qi, which can cause respiratory abnormalities, coughing and asthma.17 Modern pharmacological studies have shown that HEL has various pharmacological effects, such as relieving cough, expectorant, relieving asthma, anti-inflammation, and anti-microbial action to name a few.18,⇓-20 A novel sesquiterpene lactone from HEL has been predicted to be effective in treating viral pneumonia due to a combination of network pharmacology and molecular docking.21 In in vitro assays, sesquiterpene lactones from HEL can lower TNF-α and IL-6 levels in LPS-stimulated murine macrophage RAW 264.7.20 However, the effects and mechanisms of HEL against LPS-induced ALI process still remain unclear. This study aimed to investigate the effects and mechanisms of HEL in LPS-induced ALI in vivo. Our study found that HEL protected against LPS-induced ALI through the TLR4/NF-κB/NLRP3 signalling pathway and intestinal flora, providing evidence for the therapeutic potential of HEL in ALI.

2. MATERIALS AND METHODS

2.1. Materials

LPS (Escherichia coli 055: B5) was purchased from Sigma-Aldrich Co., Ltd. (St. Louis, MO, USA). Dexamethasone acetate tablets (No. 200923) were purchased from Zhejiang Xianju Pharmaceutical Co., Ltd. (Hangzhou, China). P-65 antibody (#8284), MyD88 antibody (#4283), inhibitor kappa B alpha (IκBα) antibody (#9242), phospho-IκBα antibody (#2859), and β-actin antibody (#4970) were purchased from Cell Signaling Technology (CST, Danfoss, MA, USA). Anti-NLRP3 antibody (ab263899), anti-IL-18 antibody (ab191860) and anti-IL-1β antibody (ab9722) were purchased from Abcam (Cambridge, UK). NF-κBp65 antibody (310013) was purchased from zen-bioscience Co., Ltd. (Chengdu, China). TLR4 antibody (19811-1-AP) was purchased from proteintech Co., Ltd. (Wuhan, China). Methanol (No.146503) and acetonitrile (No. 155753) of UPLC were purchased from Merck (Darmstadt, Germany).

2.2. Extraction of HEL

HEL sample used in this study was collected from Xuyi Defeng Traditional Chinese Medicine Planting Co., Ltd. (Huai'an, China). It was identified by Professor HE Xianyuan of the College of Traditional Chinese Medicine of Chongqing Medical University.

HEL crude extract was obtained by refluxing twice with 8 times 70% ethanol. Then it was transformed into alcohol extract, filtered, and combined with the filtrate. After that, the alcohol containing the sample was recovered under reduced pressure and dissolved in 20-fold water. The supernatant was washed through the polyamide resin column and then through the D101 macroporous resin column with 10 times water until it was nearly colorless. The column liquid and aqueous solution were discarded and then eluted with 8 times 70% ethanol to collect 70% ethanol eluate and recover ethanol under reduced pressure. After concentration, freeze-drying, adding an appropriate amount of silica gel and 0.5 times of absolute ethanol as entrainment agent, the ethanol extract was extracted by supercritical carbon dioxide for 2 h under pressure 35MPa and temperature 45 ℃ to obtain 5 g /mL crude drug concentration of HEL. HEL was stored at 4 ℃ until use.

2.3. Ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF/MS) analysis of HEL

An ultra fast liquid chromatography-30AT ultra-high-performance liquid chromatography (Shimadzu Corporation, Shimadzu, Japan) and TripleTOFTM 5600 LC/MS (AB SCIEX, Framingham, MA, USA) were used to determine the components of HEL. For chromatographic analysis, a Kinetex C18 column (Ф2.1 mm × 100 mm; 2.6 μm) was used at 30 ℃. The mobile phase was a mixture of acetonitrile (A) and water (B), both containing 0.1% formic acid, using gradient elution (1 min: 90% A, 7 min: 15% A, 11 min: 15% A, 11.5 min: 90% A, 15.1 min stop), the flow rate was 0.3 mL/min. Combined with mass spectrometry, we used EFI ion source ESI_ Positive and ESI_ Under the Negative two modes, and the dynamic background subtraction to trigger the information association acquisition mode. Then we got the UPLC-Q-TOF/MS data; and analyzed it using Analyst1.6 software and Peakview 1.2TM.

2.4. Animal grouping and treatment protocols

Sixty male Sprague-Dawley (SD) rats [specific pathogen free grade] were purchased from the Experimental Animal Center of Chongqing Medical University (Number of qualitative qualification: 0011269). The study was approved by the Ethics Committee of Chongqing Medical University (Certificate No. 2022072). All animals were kept in an animal room at 23-27 ℃, with humidity 50 % ± 10%, regular ventilation, and a 12 h/12 h light/dark cycle (lights on at 8:00, lights off at 20:00), food and water ad libitum. The adaptive feeding lasted one week.

Dexamethasone is currently a commonly used drug for the clinical treatment of ALI/ARDS, so this study used it as a positive control drug22 After a week, 60 SD rats were randomly divided into 6 groups (10 rats per group) by random number table method: control group, LPS group, Dexamethasone (Dex) group, low (6 g/kg), medium (18 g/kg) and high (54 g/kg) dose of HEL groups (HEL-L/HEL-M/HEL-H). The Dex group was treated with 5 mg/kg intragastrically, and the HEL groups were treated with a corresponding dose by gavage, once a day, for 7 consecutive days. ALI model was induced by instilling intratracheal of 3 mg/kg LPS (40 mg of LPS dissolved in 20 mL normal saline and the injection volume as 1.5 mL/kg). After 24 h, BALF, serum, lung tissue, and cecal contents were collected.

2.5. Pulmonary edema analysis

After LPS treatment for 24 h, the rats’ weight was weighed. After the end of the alveolar lavage, the lungs were blotted dry with filter paper, and weighed to obtain the weight. Then, we calculated the lung coefficient (lung/ body weight × 100%). The upper lobe of the left lung was weighed as wet weight (W) and then dried in an oven at 60 ℃ for 48 h to obtain the dry weight (D). The lung W/D ratio was calculated as wet weight/dry weight.

2.6. Histopathologic evaluation of lung tissues

The inferior lobe of left lung tissue was collected, fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin, and sliced into 5 µm sections. The tissue sections were then stained with hematoxylin and eosin (HE) and visualized under a light microscope. The entire surface of the lung was analyzed for inflammation and damage, and was scored as follows: normal lung (0), haemorrhage (on a 0-1 scale), peribronchial infiltration (on a 0-1 scale), interstitial oedema (on a 0-2 scale), pneumocyte hyperplasia (on a 0-3 scale) and intra-alveolar infiltration (on a 0-3 scale).23

2.7. Leukocyte counts

The abdominal aorta blood was added with EDTA-2Na anticoagulant to obtain plasma samples, and the leucocyte count analysis was carried out using the SYSMEX XT-2000iV five-classification animal blood analyzer.

2.8. Myeloperoxidase (MPO) activity assay

MPO is the marker of neutrophils infiltration in tissues. According to the instructions of the MPO test kit (A044-11, Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), the samples were assayed for MPO activity. Briefly, the lung tissue was weighed 100 mg, homogenized, and prepared to 10% lung tissue homogenate. Then, 0.09 mL homogenate was mixed with 0.09 mL buffer solution. The MPO activity was measured in absorbance at 460 nm.

2.9. Enzyme linked immunosorbent assay (ELISA)

BALF was obtained as follows. After 24 h of LPS treatment, the lungs were lavaged with 5 mL 0.9% NS by tracheal intubation and pumped back after 3 s. The same operation was repeated two times in a total volume of 7 mL NS, and the recovery rate was 70%. The BALF and serum were collected and the levels of TNF-α, IL-6, and IL-1β in the BALF and serum were measured by ELISA kits (EHJ-20039r, EHJ-20537r, EHJ-20063r, Xiamen Huijia Biotechnology Co., Ltd., Xiamen, China) according to the manufacturer's recommendations.

2.10. Quantitative real-time polymerase chain reaction (qRT-PCR) assay

The expressions of TNF-α, IL-6, and IL-1β mRNA were assessed in lung tissue. RNA was collected from lung tissue using RNA simple Total RNA Kit (DP419, Tiangen Biochemical Technology Co., Ltd., Beijing, China). After the concentration was determined, the RNA was reverse transcribed according to the instructions of RT Master Mix for qPCR (HY-K0510, MCE, Monmouth Junction, NJ, USA). The cDNA templates were amplified with primers with the sequences shown in Table 1.

Table 1.

Primer sequences used for qRT-PCR

Gene Forward primer (5’-3’) Reverse primer (5’-3’)
TNF-α ATGGGCTCCCTCTCATCAGTTCC CCTCCGCTTGGTGGTTTGCTAC
IL-1β AATCTCACAGCAGCATCTCGACAAG TCCACGGGCAAGACATAGGTAGC
IL-6 ACTTCCAGCCAGTTGCCTTCTTG TGGTCTGTTGTGGGTGGTATCCTC
GAPDH GACATGCCGCCTGGAGAAAC A GCCCAGGATGCCCTTTA GT

Notes: qRT-PCR: quantitative real-time polymerase chain reaction; TNF-α: tumor necrosis factor-alpha; IL-1β: interleukin-1beta; IL-6: interleukin-6; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

2.11. Immunohistochemistry staining

The paraffin sections of lung tissue were baked in an oven at 60 ℃ for 2 h, dewaxed with xylene, and dehydrated with gradient alcohol. Then they were incubated with EDTA antigen repair solution (ZLI-9071, Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., Beijing, China) for about 15 min for antigen repair, followed by 3% H2O2 to block endogenous peroxidase and 3% bovine serum albumin solutions. After the primary antibody (TLR4, NF-κBp65, NLRP3) were incubated overnight at 4 ℃, the sections were incubated with the secondary antibody at room temperature (RT) for 30 min. Following neutral resin sealing, the staining was photographed and observed under a microscope. DAB color development and hematoxylin back staining were conducted on the sections.

2.12. Immunofluorescence staining

Fluorescent single-label signal amplification kit (AFIHC022, AiFang Biological Co., Ltd., Changsha, China) was used to detect protein expression. The sections after antigen repair were soaked in 0.3% TritonX-10 for 20 min to rupture the membrane; and added with 200 μL of 5% BSA for the blocking step at RT for 2 h. Then they were dripped with 100 μL of primary antibody (TLR4, NF-κBp65, NLRP3) and overnight at 4 ℃. After phosphate buffer saline washing, 100 μL of fluorescent-labeled secondary antibody was added to the sections at RT for 20 min. After a sealing solution containing 4,6-diamino-2-phenyl indole, they were stored at 4 ℃ light-freely, and the fluorescence intensity was observed under a laser confocal microscope.

2.13. Western blotting

Total proteins of lung tissue were obtained using the whole protein extraction kit (BC3710, Solebao, Beijing, China); protein concentrations were assessed with Enhanced Bicinchoninic Acid Assay Protein Assay Kit (P0010, Beyotime, Shanghai, China). The 60 ng proteins were separated using sodium dodecyl sulfate- polyacrylamide gel electrophoresis, transferred to poly vinylidene fluoride membranes (Merck, Darmstadt, Germany), and incubated with primary antibodies against TLR4, MyD88, p65, NF-κBp65, IκBα, phospho- IκBα, NLRP3, IL-1β, IL-18 and β-actin overnight at 4 ℃. Then, the membranes were incubated with HRP-conjugated secondary antibodies. After that, the data were obtained using Odyssey Fc two-color infrared fluorescence imaging system and Image J software. The results were expressed as a ratio to the β-actin protein.

2.14. 16s rRNA High-throughput sequencing

The cecal contents were collected from anesthetizing rats. Then, V3 and V4 hypervariable regions of the prokaryotic 16s rRNA were amplified and classified. Next, 1% agarose gel electrophoresis was conducted to analyze the PCR products, followed by DNA purification and retrieval. Data were analyzed using the MiSeq control software (Majorbio, Shanghai, China).

2.15. Statistical analysis

Statistical analyses were performed using GraphPad Prism 8.4.2 (San Diego, CA, USA). The data are presented as the mean ± standard deviation. Multiple comparisons between groups were performed using one-way analysis with dunnett's multiple comparisons test. P < 0.05 was considered to be statistically significant.

3. RESULTS

3.1. Chemical composition of HEL

To determine the components of HEL, its composition was evaluated using UPLC-Q-TOF/MS. The main components in HEL are sesquiterpene lactones including eupalinilide A, eupalinilide B, eupalinilide E, eupalinolide F, eupalinolide H, eupalinolide J, eupalinolide K and eupalinilide M (Figure 1A, 1B). In addition, the following components were identified: flavonoids (hyperoside), coumarins (scopoletin), phenylpropanoids, diterpenoids, phenols, and other chemical components (zhepeiresinol) (supplementary Table 1).

Figure 1. Main chemical components of HEL and histopathological changes in lung tissue.

Figure 1

Base peak chromatogram from UPLC-Q-TOF/MS analysis of HEL under A: positive ion mode and B: negative ion mode. C: representative photomicrographs of HE staining of lung tissues in each group (magnification, × 100). C1: control group (distilled water by gavage for a week); C2: lipopolysaccharide group (distilled water by gavage for a week); C3: dexamethasone group (5 mg/kg by gavage for a week); C4: Yemazhui (Herba Eupatorii Lindleyani) low-dose group (6 g/kg by gavage for a week); C5: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group (18 g/kg by gavage for a week); C6: Yemazhui (Herba Eupatorii Lindleyani) high-dose group (54 g/kg by gavage for a week). HEL: Yemazhui (Herba Eupatorii Lindleyani); UPLC-Q-TOF/MS: ultra-performance liquid chromatography-quadrupole-time of flight-mass spectrometry; HE: hematoxylin and eosin staining.

3.2. Effects of HEL on LPS-induced lung pathological changes

To evaluate the effect of HEL on ALI-affected lung tissue, we analyzed the lung coefficient, wet/dry weight ratio, and histopathological changes of the specific lung tissue microscopically, using hematoxylin and eosin (HE) staining. We found that the lung coefficient and wet/dry weight ratio were significantly higher (P < 0.01) in the LPS group than in the control group. In the Dexamethasone, HEL-L, HEL-M, and HEL-H groups, the levels were significantly decreased (P < 0.05) (Table 2). Compared with the control group, the degree of inflammation and injury in the lungs of the LPS group was severe, with more severe hemorrhage, intra-alveolar infiltration, interstitial edema, and pneumocyte hyperplasia (Figure 1C). However, they were all improved by pre-treatment with HEL and Dexamethasone (P < 0.05). Both in HEL-M and HEL-H groups were more significant (Table 2). In summary, HEL had an obvious protective effect on LPS-induced lung injury in rats.

Table 2.

Changes in lung coefficient, wet/dry weight ratio of lung tissue and histopathological score in animals 24 h after induction of the injury ($\bar{x}±s$)

Group n Lung coefficient (%) Wet/dry weight ratio (%) Histopathological score
Control 9 1.13±0.18 11.14±2.58 1.00±0.50
LPS 9 1.36±0.18a 17.07±3.71a 8.05±0.69d
Dex 9 1.33±0.12b 11.36±1.94c 6.50±0.92c
HEL-L 9 1.21±0.20c 12.290±1.81b 7.20±0.68
HEL-M 9 1.24±0.14b 11.24±2.38c 6.05±1.23e
HEL-H 9 1.21±0.24c 11.66±3.78b 6.30±1.55c

Notes: control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); Dex: dexamethasone group (5 mg/kg by gavage for a week); HEL-L: Yemazhui (Herba Eupatorii Lindleyani) low-dose group (6 g/kg by gavage for a week); HEL-M: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group (18 g/kg by gavage for a week); HEL-H: Yemazhui (Herba Eupatorii Lindleyani) high-dose group (54 g/kg by gavage for a week). The data were expressed as the mean ± standard deviation. Compared with the control group, aP < 0.01, dP < 0.0001; compared with the LPS group, bP < 0.05, cP < 0.01, eP < 0.001.

3.3. Anti-inflammatory effect of HEL on LPS-induced ALI rats

To investigate the anti-inflammatory effect of HEL, we analyzed the number of leukocytes in the plasma and the expression levels of proinflammatory factors in the study rats’ serum and BALF. Leukocyte exudation is an important feature of inflammation. Plasma leukocytes of the rats in each group were counted. Compared with the control group, the number of leukocytes and lymphocytes in the LPS group was significantly higher (P < 0.01), and the number of neutrophils was higher (P = 0.08). Compared with the LPS group, the number was significantly decreased in the HEL groups, and the effect of the HEL-M and HEL-H groups was more obvious (P < 0.05). MPO, an important indicator of neutrophil infiltration, was used to detect activity in lung tissue. MPO activity in the HEL-M and HEL-H groups was significantly lower (P < 0.05) than in the LPS group, which was consistent with the leukocyte counts (Table 3). To evaluate the effect of HEL on inflammation in ALI rats, we determined TNF-α, IL-6, and IL-1β levels in BALF and serum samples using ELISA. The results showed that HEL significantly reduced their expression (P < 0.05) (Tables 4, 5). To sum up, HEL had an obvious anti-inflammatory effect, and this effect was related to the inhibition of leukocyte exudation and cytokine release. Moreover, medium, and high doses were more effective than the low doses.

Table 3.

Changes in leukocytes, neutrophils, lymphocytes count in plasma and MPO activity in lung tissue ($\bar{x}±s$)

Group n Leukocyte (%) Neutrophils (%) Lymphocytes (%) MPO activity (U/mg tissue)
Control 6 4.77±0.91 2.00±0.51 2.64±0.92 1.06±0.51
LPS 6 8.50±2.09a 3.11±1.55 5.41±1.32e 3.59±2.33a
Dex 6 4.14±2.15b 1.94±0.79 0.81±0.55f 1.46±0.24c
HEL-L 6 5.80±1.36c 1.30±0.35d 3.67±0.81c 1.92±0.30
HEL-M 6 5.03±2.35d 1.28±0.59d 3.65±1.85c 1.23±0.69d
HEL-H 6 4.90±1.06d 2.02±1.01 2.28±0.84f 1.70±0.16c

Notes: control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); Dex: dexamethasone group (5 mg/kg by gavage for a week); HEL-L: Yemazhui (Herba Eupatorii Lindleyani) low-dose group (6 g/kg by gavage for a week); HEL-M: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group (18 g/kg by gavage for a week); HEL-H: Yemazhui (Herba Eupatorii Lindleyani) high-dose group (54 g/kg by gavage for a week). The data were expressed as the mean ± standard deviation. MPO: myeloperoxidase. Compared with the control group, aP < 0.01, eP < 0.001; compared with the LPS group, bP < 0.001, cP < 0.05, dP < 0.01, fP < 0.0001.

Table 4.

Changes in TNF-α, IL-1β and IL-6 in BALF (ng/L, $\bar{x}±s$)

Group n TNF-α IL-1β IL-6
Control 6 129.8±6.4 14.0±1.0 58.1±2.5
LPS 6 185.9±14.4a 17.4±1.2c 77.5±4.1a
Dex 6 137.1±15.1b 13.4±1.2b 61.7±4.5d
HEL-L 6 138.5±13.2b 14.2±1.0d 65.2±4.9e
HEL-M 6 130.7±12.4b 14.2±1.1d 53.1±7.6b
HEL-H 6 130.3±20.6b 14.3±1.2d 66.3±8.1f

Notes: control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); Dex: dexamethasone group (5 mg/kg by gavage for a week); HEL-L: Yemazhui (Herba Eupatorii Lindleyani) low-dose group (6 g/kg by gavage for a week); HEL-M: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group (18 g/kg by gavage for a week); HEL-H: Yemazhui (Herba Eupatorii Lindleyani) high-dose group (54 g/kg by gavage for a week). The data were expressed as the mean ± standard deviation. HEL: Yemazhui (Herba Eupatorii Lindleyani); TNF-α: tumor necrosis factor-alpha; IL-1β: interleukin-1beta; IL-6: interleukin 6; BALF: bronchoalveolar lavage fluid. Compared with the control group, aP < 0.0001, cP < 0.001; compared with the LPS group, bP < 0.0001, dP < 0.001, eP < 0.01, fP < 0.05.

Table 5.

Changes in TNF-α, IL-1β and IL-6 in serum (ng/L, $\bar{x}±s$)

Group n TNF-α IL-1β IL-6
Control 6 223.9±13.6 13.6±1.4 58.5±6.6
LPS 6 262.5±14.3a 20.1±3.2d 98.5±14.4d
Dex 6 235.1±11.3b 14.4±1.5e 67.6±6.4c
HEL-L 6 204.6±8.4c 16.1±1.5b 83.6±5.8b
HEL-M 6 214.0±23.6c 12.3±1.8c 73.9±9.1e
HEL-H 6 196.9±11.9c 10.9±1.9c 60.9±7.2c

Notes: control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); Dex: dexamethasone group (5 mg/kg by gavage for a week); HEL-L: Yemazhui (Herba Eupatorii Lindleyani) low-dose group (6 g/kg by gavage for a week); HEL-M: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group (18 g/kg by gavage for a week); HEL-H: Yemazhui (Herba Eupatorii Lindleyani) high-dose group (54 g/kg by gavage for a week). The data were expressed as the mean ± standard deviation. HEL: Yemazhui (Herba Eupatorii Lindleyani); TNF-α: tumor necrosis factor-alpha; IL-1β: interleukin-1beta; IL-6: interleukin 6. Compared with the control group, aP < 0.01, dP < 0.0001; compared with the LPS group, bP < 0.01, cP < 0.0001, eP < 0.001.

3.4. Effect on the expression of TLR4, NF-κBp65, NLRP3 in LPS-induced lung tissue

LPS can activate TLR4 on the surface of immune cells in lung tissue and activate the NF-κB signaling pathway. Nucleation of NF-κBp65 can further activate NLRP3. Both NF-κB and NLRP3 activation are closely related to the production of inflammatory factors. We used immuneohistochemical and immunofluorescence methods to detect the expression of TLR4, NF-κBp65, and NLRP3 in rat lung tissue. Immunohistochemistry results showed that TLR4 and NLRP3 were mainly distributed in the cytoplasm of alveolar macrophages, NF-κBp65 was present in the nucleus, and they were all darkly stained and highly expressed in the LPS group (P < 0.0001). However, they became lighter, and their expression decreased significantly in the other groups (P < 0.05) (Figure 2A, Table 6). We also verified these findings using immunofluorescence, and found that HEL significantly reduced the nuclear displacement of NF-κBp65 (Figure 2B, supplementary Figure 1). The effect was strongest in the HEL-M group.

Figure 2. Immunohistochemical and immunofluorescent results visualizing TLR4, NF-κBp65, NLRP3 in lung tissue.

Figure 2

A: A1-A6: microscopic images of TLR4 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunohistochemical assays. A7-A12: microscopic images of NF-κBp65 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunohistochemical assays. A13-A18: microscopic images of NLRP3 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunohistochemical assays. Scale bar: 50 μm. B: B1-B6: confocal merge images of TLR4 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunofluorescence assays. B7-B12: confocal merge images of NF-κBp65 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunofluorescence assays. B13-B18: confocal merge images of NLRP3 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunofluorescence assays. Scale bar: 50 μm. Control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); Dex: dexamethasone group (5 mg/kg by gavage for a week); HEL-L: Yemazhui (Herba Eupatorii Lindleyani) low-dose group (6 g/kg by gavage for a week); HEL-M: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group rats (18 g/kg by gavage for a week); HEL-H: Yemazhui (Herba Eupatorii Lindleyani) high-dose group rats (54 g/kg by gavage for a week). HEL: Yemazhui (Herba Eupatorii Lindleyani); TLR4: toll-like receptor 4; NFκBp65: nuclear factor kappa-B p65; NLRP3: nod-like receptor family pyrin domain-containing 3 protein; LPS: lipopolysaccharide.

Table 6.

Average integrated optical density of TLR4, NF-κBp65 and NLRP3 in lung tissue (Area%, $\bar{x}±s$)

Group n TLR4 NF-κBp65 NLRP3
Control 6 5.1±0.8 1.4±0.2 1.9±0.3
LPS 6 9.4±0.8a 4.7±0.3a 4.6±0.4a
Dex 6 6.0±0.5b 1.9±0.2b 3.1±0.6c
HEL-L 6 7.1±0.5b 3.2±0.2b 3.7±0.2d
HEL-M 6 5.9±0.2b 2.2±0.2b 2.9±0.4b
HEL-H 6 6.4±0.5b 2.4±0.4b 3.4±0.4e

Notes: control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); Dex: dexamethasone group (5 mg/kg by gavage for a week); HEL-L: Yemazhui (Herba Eupatorii Lindleyani) low-dose group (6 g/kg by gavage for a week); HEL-M: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group (18 g/kg by gavage for a week); HEL-H: Yemazhui (Herba Eupatorii Lindleyani) high-dose group (54 g/kg by gavage for a week). The data were expressed as the mean ± standard deviation. HEL: Yemazhui (Herba Eupatorii Lindleyani); TLR4: Toll-like receptor 4; NF-κBp65: nuclear factor kappa-B p65; NLRP3: nod-like receptor family pyrin domain-containing 3 protein. Compared with the control group, aP < 0.0001; compared with the LPS group, bP < 0.0001, cP < 0.001, dP < 0.05, eP < 0.01.

3.5. Inhibition of TLR4/NF-κB/NLRP3 signaling pathway by HEL in LPS-induced ALI rats

Based on the results of HE pathological analysis, leukocyte counts, ELISA, immunohistochemistry, and immunofluorescence results, we determined that a medium dose of 18 g/kg was the optimal dose for HEL to protect against ALI. Therefore, follow-up experiments were conducted on the control, LPS, and HEL-M groups.

To explore the potential protective mechanism of HEL against ALI, western blotting was used to detect the expressions of proteins involved in the TLR4/NF-κB/ NLRP3 signaling pathway. In the LPS group, the protein expression of TLR4, MyD88, NF-κBp65, phospho-IκBα, NLRP3, IL-1β, and IL-18 was higher (P < 0.01) than that in the control group, which was significantly inhibited by HEL (Figure 3A, 3B). We also determined the mRNA levels of TNF-α, IL-6, and IL-1β in lung tissue by qRT-PCR. At a gene level, expression in the LPS group was significantly higher (P < 0.05) than that in the HEL-M and control groups (Table 7). According to these experimental results, HEL had a preventive and therapeutic effect on LPS-induced ALI by inhibiting the activation of TLR4/NF-κB/NLRP3 signaling pathway (supplementary Figure 2).

Figure 3. HEL inhibited the TLR4/NF-κB/NLRP3 signaling pathway in vivo.

Figure 3

A: Western blotting representative images of TLR4, MyD88, NF-κBp65, NF-κB, phospho-IκBα, IκBα, NLRP3, IL-18 and IL-1β proteins. B: B1: Protein expression levels of TLR4; B2: protein expression levels of MyD88; B3: protein expression levels of NF-κBp65; B4: protein expression levels of phospho-IκBα; B5: protein expression levels of NLRP3; B6: protein expression levels of IL-18; B7: protein expression levels of IL-1β. The data were expressed as the mean ± standard deviation (n = 6). Control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week for a week); HEL: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group rats (18 g/kg by gavage for a week). HEL: Yemazhui (Herba Eupatorii Lindleyani); TLR4: toll-like receptor 4; MyD88: myeloid differentiation primary response protein 88; NF-κB: nuclear factor kappa-B; NF-κBp65: nuclear factor kappa-B p65; IκBα: inhibitor kappa B alpha; phospho-IκBα phosphorylated inhibitor kappa B alpha; NLRP3: nod-like receptor family pyrin domain-containing 3 protein; IL-18: interleukin 18; IL-1β: interleukin-1beta. Compared with the control group, aP < 0.01, cP < 0.001, eP < 0.0001; compared with the LPS group, bP < 0.0001, dP < 0.001, fP < 0.05, gP < 0.01.

Table 7.

Levels of TNF-α, IL-1β, and IL-6 mRNA in lung tissue ($\bar{x}±s$)

Group n TNF-α IL-1β IL-6
Control 6 1.19±0.25 1.14±0.38 0.53±0.19
LPS 6 5.89±2.37a 2.12±0.91c 2.19±1.25a
HEL 6 1.89±1.11b 1.20±0.17b 0.89±0.30b

Notes: control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); Dex: dexamethasone group (5 mg/kg by gavage for a week); HEL: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group (18 g/kg by gavage for a week). The data were expressed as the mean ± standard deviation. HEL: Yemazhui (Herba Eupatorii Lindleyani); TNF-α: tumor necrosis factor-alpha; IL-1β: interleukin-1beta; IL-6: interleukin 6. Compared with the control group, aP < 0.01, cP < 0.05; compared with the LPS group, bP < 0.05.

3.6. Changes in the gut microbes in LPS-induced ALI rats

Through the collection of rat feces and a 16s rRNA microbiological analysis using an Illumina MiSeq sequencer, we investigated the effect of HEL on the intestinal flora of LPS-induced ALI rats. We performed ASV analysis on the original data; pan/core species analysis showed a sufficient sample size (Figure 4A), and rarefaction curve analysis showed that the curve flattened when the sequencing depth reached 4000, indicating that the intestinal flora α diversity in this study was rich (Figure 4B, 4C). PCA principal component analysis results showed that the composition of intestinal flora in the control and LPS groups was significantly different, and the two groups were significantly separated, while the HEL-M group overlapped with them (Figure 4D).

Figure 4. Intestinal flora analysis of HEL on the cecal contents in vivo.

Figure 4

A: pan chart by ASV analysis. B: rank abundance chart. C: sobs index represents α diversity. D: PCA analysis of gut bacterial community based on the genus level. E1: venn chart based on OTU at the phylum levels; E2: venn chart based on OTU at the genus levels. F1: stacking diagram of community composition structure at the phylum levels; F2: stacking diagram of community composition structure at the genus levels. G: correlation between intestinal flora and lung injury index or Inflammatory cytokines. The above data were analyzed in control, LPS and HEL groups (n = 6). Control: control group (distilled water by gavage for a week for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); HEL: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group rats (18 g/kg by gavage for a week). HEL: Yemazhui (Herba Eupatorii Lindleyani), ASV: amplicon sequence variants, PCA: principal component analysis, OTU: operational taxonomic units.

The three groups produced a total of 1191 operational taxonomic unit (OTU), and the total number of OTU was 115 at the genus level (Figure 4E). We then analyzed the differences between the top ten flora at the phylum and genus levels. At the phylum level, Firmicutes, Spirochaetota, Patescibacteria, and Desulfobacterota were the dominant flora in the intestinal flora of the LPS groups, whereas Proteobacteria and Bacteroidota were the dominant flora in the control and HEL-M groups. At the genus level, Lactobacillus, Romboutsia, Treponema, and Clostridium_sensu_stricto_1 were the dominant bacteria in the LPS group (Figure 4F). Therefore, it could be inferred that HEL plays a role in the treatment of LPS-induced ALI by improving the number and composition of intestinal flora and restoring the diversity of intestinal flora.

4. DISCUSSION

In this study, we aimed to explore the protective effects of HEL in LPS-induced rats and its potential mechanisms of action. To observe the effects of HEL on rats effectively and conveniently, we chose the low dose (6 g/kg means 6 g of crude drug per kilogram of body weight), the medium dose (18 g/kg means 18 g of crude drug per kilogram of body weight) and high dose (54 g/kg means 54 g of crude drug per kilogram of body weight) of HEL for treatment based on the basal dose of HEL in human referenced by Chinese Pharmacopoeia.24 Surprisingly, HEL treatment at medium-dose (18 g/kg) showed a better effect against ALI symptoms. When compared to more traditional pharmaceuticals, some natural products (or TCM) do not provide better dosage-dependent effects. This is due to the diversity, complexity and non-linearity of the medicinal effects of Chinese medicine.25 Also, their pharmacokinetic parameters with oral absorption (nonlinear pharmacokinetics) may contribute to their drug selectivity.26 In experimental animal models of ALI, administration of intratracheal LPS for 24 h induced the production of inflammatory mediators.27 Our previous pre-experiments also verified this result. When ALI occurs, pathological changes in the lungs include accumulation of neutrophils in the lungs, interstitial edema, and injury of the lung tissue.28 In the LPS group, the lung coefficient, lung W/D ratio of rats, and MPO activity, were significantly increased. At the same time, the number of neutrophils and lymphocytes in the plasma was significantly higher than that in the control group. HE staining showed obvious damage, such as pulmonary edema and thickening of the alveolar wall. These results indicated that we successfully replicated the ALI model in rats. Total sesquiterpenoids from HEL can significantly reduce LPS-induced ALI in mice.29 In our study, we intervened with different doses of HEL with sesquiterpene lactones in ALI model rats. HEL and dexamethasone interventions improved histopathological ALI lung changes. In addition, HEL was shown to be superior to dexamethasone in improving pulmonary edema and neutrophil infiltration in this study. These changes are consistent with previous pharmacodynamic studies of HEL.29,30 Therefore, it can be hypothesized that HEL may play a protective role in LPS-induced lung injury.

LPS activates macrophages, and then the cells release various cytokines such as TNF-α, IL-1β, and IL-6, causing excessive and uncontrolled inflammatory response syndrome in the lung.28 Pro-inflammatory cytokines can be induced by activating the TLR4/ MyD88/NF-κB signaling pathway.31 After IκB kinase is activated, resulting in phosphorylation and rapid degradation of downstream IκB protein in the cytoplasm. Dissociated NF-κB was allowed to enter the nucleus to regulate the expression of genes involved in inflammation and promote the secretion of anti-inflammatory cytokines, such as TNF-α, IL-1β, and IL-6 by immune cells.9,12 Studies showed that inhibition of this NF-κB signaling pathway could attenuate LPS-induced ALI.28,32 Our study found that HEL can reduce the expression of NF-κB pathway-related proteins and downstream the level of pro-inflammatory factors, including TNF-α, IL-1β, and IL-6. Moreover, NLRP3 binds to the adaptor protein ASC after activation of the NF-κB pathway, which oligomerizes to recruit procaspase-1 in caspase-1.33,34 Eventually, pro-IL-18 and pro-IL-1β are processed into their mature forms, resulting in lung injury.35 In our study, the expression of NLRP3, IL-18, and IL-1β was reduced after HEL intervention. These results suggest that HEL attenuated the LPS-induced inflammatory response in lung tissue, possibly by inhibiting the TLR4/NF-κB/NLRP3 signaling pathway (supplementary Figure 2).

The connection between the lung and the large intestine is one of the most important theories of TCM.36 Consistent with this teaching, intestinal flora regulates lung diseases through the lung-intestinal axis,37 and intestinal flora disturbances induce bacterial migration to the lung and can aggravate lung damage.38 Alterations in gut microbial species have been linked to changes in inflammation as well as disease development in the lungs.15 When the organism undergoes intestinal flora disorders, LPS secreted by gram-negative bacteria can enter the organism with a damaged intestinal barrier, inducing the release of inflammatory factors in the central nervous system and peripheral organism, and the increase of inflammatory mediators produced by the organism itself, and the excessive inflammatory mediators enter the lung through blood circulation and aggravate lung inflammation.39 Collinsella is negatively associated with intestinal inflammation, Eubacterium_ siraeum_group can lead to lung disease, Family_XIII_ AD3011_group can induce an inflammatory response, and Lachnospiraceae_UCG-006 is related to inhibition of inflammation.40,⇓-42 In this study, we found that HEL administration could significantly change the richness, diversity, and balance of intestinal flora. In addition, HEL improved intestinal flora disturbance and inflammation in LPS-induced ALI by increasing the relative abundance of unclassified_f_Oscillospiraceae and Collinsella, while reducing the number of Clostridium_sensu_stricto_1. We also found that some intestinal microflorae were significantly correlated with the ALI phenotypes. Norank_f__norank_o__RF39, Eubacterium_siraeum_group, Family_XIII_AD3011_ group, and Clostridium_sensu_stricto_1 were positively correlated with inflammatory factors, while Lachnospiraceae_UCG-006 was negatively correlated with the number of leukocytes and inflammatory factors in ALI tissue samples (Figure 4G).

In conclusion, we verified that HEL can protect against LPS-induced ALI to a certain extent. The potential protective mechanism may be caused by the inhibition of the TLR4/NF- κB/NLRP3 signaling pathway and improved intestinal flora disturbance. This study provides new insights into the treatment of ALI using Chinese herbal medicines. But this study has some limitations. HEL consists of many chemical components, its molecular mechanism in cells has not yet been thoroughly studied. Therefore, in future studies, we need to isolate the main monomers and study their anti-inflammatory effects through cell experiments.

5. SUPPORTING INFORMATION

Supporting data to this article can be found online at http://journaltcm.cn.

REFERENCES

  • 1. Confalonieri M, Salton F, Fabiano F. . Acute respiratory distress syndrome. Eur Respir Rev 2017; 26: 160116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Thompson BT, Chambers RC, Liu KD. . Acute Respiratory Distress Syndrome. N Engl J Med 2017; 377: 562-72. [DOI] [PubMed] [Google Scholar]
  • 3. Zhang H, Wang H, Lu D, et al. . Berberine inhibits cytosolic phospholipase a2 and protects against LPS-induced lung injury and lethality independent of the α2-adrenergic receptor in mice. Shock 2008; 29: 617-22. [DOI] [PubMed] [Google Scholar]
  • 4. Mokra D, Kosutova P. . Biomarkers in acute lung injury. Resp Physiol Neurobi 2015; 209: 52-8. [DOI] [PubMed] [Google Scholar]
  • 5. Zheng J, Lu C, Yang M, et al. . Lung-targeted delivery of cepharanthine by an erythrocyte-anchoring strategy for the treatment of acute lung injury. Pharmaceutics 2022; 14: 1820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Mokra D. . Acute lung injury-from pathophysiology to treatment. Physiol Res 2020; 69: S353-66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Mokra D, Mikolka P, Kosutova P, Mokry J. . Corticosteroids in acute lung injury: the dilemma continues. Int J Mol Sci 2019; 20: 4765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Chen H, Bai C, Wang X. . The value of the lipopolysaccharide-induced acute lung injury model in respiratory medicine. Expert Rev Resp Med 2010; 4: 773-83. [DOI] [PubMed] [Google Scholar]
  • 9. Han X, Wu YC, Meng M, Sun QS, Gao SM, Sun H. . Linarin prevents LPS‑induced acute lung injury by suppressing oxidative stress and inflammation via inhibition of TXNIP/NLRP3 and NF‑κB pathways. Int J Mol Med 2018; 42: 1460-72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Yang X, An X, Wang C, et al. . Protective effect of oxytocin on ventilator-induced lung injury through NLRP3-mediated pathways. Front Pharmacol 2021; 12: 722907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Kelley N, Jeltema D, Duan Y, He Y. . The NLRP3 inflammasome: an overview of mechanisms of activation and regulation. Int J Mol Sci 2019; 20: 3328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Wu Y, Wang Y, Gong S, et al. . Ruscogenin alleviates LPS-induced pulmonary endothelial cell apoptosis by suppressing TLR4 signaling. Biomed Pharmacother 2020; 125: 109868. [DOI] [PubMed] [Google Scholar]
  • 13. Yin L, Zhang G, Yan X, Wang Y, Xu Y, Yang Y. . An in vivo and in vitro evaluation of the mutual interactions between the lung and the large intestine. Evid Based Complement Alternat Med 2013; 2013: 1-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Dickson RP, Singer BH, Newstead MW, et al. . Enrichment of the lung microbiome with gut bacteria in sepsis and the acute respiratory distress syndrome. Nat Microbiol 2016; 1: 16113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Zhang D, Li S, Wang N, Tan H, Zhang Z, Feng Y. . The cross-talk between gut microbiota and lungs in common lung diseases. Front Microbiol 2020; 11: 301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Wang X, Ma S, Lai F, Wang Y, Lou C. . Traditional applications, phytochemistry, and pharmacological activities of Eupatorium lindleyanum DC.: a comprehensive review. Front Pharmacol 2020; 8: 577124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Ding Z, Zhong R, Xia T, et al. . Advances in research into the mechanisms of Chinese Materia Medica against acute lung injury. Biomed Pharmacother 2020; 122: 109706. [DOI] [PubMed] [Google Scholar]
  • 18. Wang X, Xu J, Tao Y, Fan X, Shen X, Tian S. . Eupatorium lindleyanum DC. sesquiterpene fraction F1012-2 regulates p53/NF-κB signaling pathways in human breast cancer. Arch Biol Sci 2022; 74: 291-9. [Google Scholar]
  • 19. Li C, Chen S, Sha J, et al. . Extraction and purification of total flavonoids from Eupatorium lindleyanum DC. and evaluation of their antioxidant and enzyme inhibitory activities. Food Sci Nutr 2021; 9: 2349-63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Wang F, Zhong H, Fang S, et al. . Potential anti-inflammatory sesquiterpene lactones from Eupatorium lindleyanum. Planta Med 2018; 84: 123-8. [DOI] [PubMed] [Google Scholar]
  • 21. Shen X, Hu H, Xu J, Tian S. . Prediction targets of a novel sesquiterpene lactone from Eupatorium lindleyanum DC. against viral pneumonia using computational pharmacology. Nat Prod Commun 2022; 17: 1934578X-2211314X. [Google Scholar]
  • 22. Liu J, Huang X, Hu S, He H, Meng Z. . Dexmedetomidine attenuates lipopolysaccharide induced acute lung injury in rats by inhibition of caveolin-1 downstream signaling. Biomed Pharmacother 2019; 118: 109314. [DOI] [PubMed] [Google Scholar]
  • 23. Chimenti L, Camprubí-Rimblas M, Guillamat-Prats R, et al. . Nebulized Heparin attenuates pulmonary coagulopathy and inflammation through alveolar macrophages in a rat model of acute lung injury. Thromb Haemostasis 2017; 117: 2125-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Chinese Pharmacopoeia Commission. . Pharmacopoeia of the People's Republic of China. Beijing: China Medical Science Press, 2020: 326. [Google Scholar]
  • 25. Li Z, Liu J, Zhang D, et al. . Nuciferine and paeoniflorin can be quality markers of Tangzhiqing tablet, a Chinese traditional patent medicine, based on the qualitative, quantitative and dose-exposure-response analysis. Phytomedicine 2018; 44: 155-63. [DOI] [PubMed] [Google Scholar]
  • 26. Ludden TM. . Nonlinear pharmacokinetics: clinical implications. Clin Pharmacokinet 1991; 6: 429-46. [DOI] [PubMed] [Google Scholar]
  • 27. Matute-Bello G, Frevert CW, Martin TR. . Animal models of acute lung injury. Am J Physiol Lung Cell Mol Physiol 2008; 295: L379-99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Lei J, Wei Y, Song P, et al. . Cordycepin inhibits LPS-induced acute lung injury by inhibiting inflammation and oxidative stress. Eur J Pharmacol 2018; 818: 110-4. [DOI] [PubMed] [Google Scholar]
  • 29. Chu C, Ren H, Xu N, Xia L, Chen D, Zhang J. . Eupatorium lindleyanum DC. sesquiterpenes fraction attenuates lipopolysaccharide-induced acute lung injury in mice. J Ethnopharmacol 2016; 185: 263-71. [DOI] [PubMed] [Google Scholar]
  • 30. Chu C, Yao S, Chen J, et al. . Eupatorium lindleyanum DC. flavonoids fraction attenuates lipopolysaccharide-induced acute lung injury in mice. Int Immunopharmacol 2016; 39: 23-33. [DOI] [PubMed] [Google Scholar]
  • 31. Orecchioni M, Ghosheh Y, Pramod AB, Ley K. . Macrophage polarization: different gene signatures in M1 (LPS+) vs classically and M2 (LPS-) vs alternatively activated macrophages. Front Immunol 2019; 101084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Zhao K, Li X, Yang J, et al. . Protective effect of Amomum Roxb. essential oils in lipopolysaccharide-induced acute lung injury mice and its metabolomics. J Ethnopharmacol 2022; 290: 115119. [DOI] [PubMed] [Google Scholar]
  • 33. Wu J, Yan Z, Schwartz DE, Yu J, Malik AB, Hu G. . Activation of NLRP3 inflammasome in alveolar macrophages contributes to mechanical stretch-induced lung inflammation and injury. J Immunol 2013; 190: 3590-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Sharif H, Wang L, Wang WL, et al. . Structural mechanism for NEK7-licensed activation of NLRP3 inflammasome. Nature 2019; 570: 338-43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Patel MN, Carroll RG, Galván-Peña S, et al. . Inflammasome priming in sterile inflammatory disease. Trends Mol Med 2017; 23: 165-80. [DOI] [PubMed] [Google Scholar]
  • 36. Liu P, Wang P, Tian D, Liu J, Chen G, Liu S. . Study on Traditional Chinese Medicine theory of lung being con- nected with large intestine. J Tradit Chin Med 2012; 1: 1-2. [DOI] [PubMed] [Google Scholar]
  • 37. Wedgwood S, Gerard K, Halloran K, et al. . Intestinal dysbiosis and the developing lung: the role of toll-like receptor 4 in the gut-lung axis. Front Immunol 2020; 11: 357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Tang J, Xu L, Zeng Y, Gong F. . Effect of gut microbiota on LPS-induced acute lung injury by regulating the TLR4/NF-kB signaling pathway. Int Immunopharmacol 2021; 91: 107272. [DOI] [PubMed] [Google Scholar]
  • 39. Zhou B, Yuan Y, Zhang S, et al. . Intestinal flora and disease mutually shape the regional immune system in the intestinal tract. Front Immunol 2020; 11: 575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Yildirim E, Ilina L, Laptev G, et al. . The structure and functional profile of ruminal microbiota in young and adult reindeers (Rangifer tarandus) consuming natural winter-spring and summer-autumn seasonal diets. Peer J 2021; 9: e12389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Guo Y, Huang S, Zhao L, Zhang J, Ji C, Ma Q. . Pine (Pinus massoniana Lamb.) needle extract supplementation improves performance, egg quality, serum parameters, and the gut microbiome in laying hens. Front Nutr 2022; 9: 810462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Zhao Z, Fei K, Bai H, Wang Z, Duan J, Wang J. . Metagenome association study of the gut microbiome revealed biomarkers linked to chemotherapy outcomes in locally advanced and advanced lung cancer. Thorac Cancer 2021; 12: 66-78. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Traditional Chinese Medicine are provided here courtesy of Journal of Traditional Chinese Medicine

RESOURCES