Mycoplasma DnaK expression increases cancer development in vivo upon DNA damage

Significance

Several bacteria, including Mycoplasmas, have been linked to various cancers, though so far a clear causative role has been only demonstrated for Helicobacter pylori. In this study, we investigate in vivo the role of Mycoplasma fermentans DnaK, a chaperone protein known to hamper in vitro eukaryotic pathways important for maintaining genomic stability. By using a DnaK knock-in mouse model generated in our laboratory, we report here that DnaK expression was associated with a marked increase in inflammation, DNA instability, and incidence of tumors following DNA damage. Our findings advance our understanding of the intricate relationship between microbiota, eukaryotic genomic instability, DNA repair, and cancer, with implications for the development of preventative, diagnostics, and therapeutic tools.

Abstract

Well-controlled repair mechanisms are involved in the maintenance of genomic stability, and their failure can precipitate DNA abnormalities and elevate tumor risk. In addition, the tumor microenvironment, enriched with factors inducing oxidative stress and affecting cell cycle checkpoints, intensifies DNA damage when repair pathways falter. Recent research has unveiled associations between certain bacteria, including Mycoplasmas, and various cancers, and the causative mechanism(s) are under active investigation. We previously showed that Mycoplasma fermentans DnaK, an HSP70 family chaperone protein, hampers the activity of proteins like PARP1 and p53, crucial for genomic integrity. Moreover, our analysis of its interactome in human cancer cell lines revealed DnaK’s engagement with several components of DNA-repair machinery. Finally, in vivo experiments performed in our laboratory using a DnaK knock-in mouse model generated by our group demonstrated that DnaK exposure led to increased DNA copy number variants, indicative of genomic instability. We present here evidence that expression of DnaK is linked to increased i) incidence of tumors in vivo upon exposure to urethane, a DNA damaging agent; ii) spontaneous DNA damage ex vivo; and iii) expression of proinflammatory cytokines ex vivo, variations in reactive oxygen species levels, and increased β-galactosidase activity across tissues. Moreover, DnaK was associated with increased centromeric instability. Overall, these findings highlight the significance of Mycoplasma DnaK in the etiology of cancer and other genetic disorders providing a promising target for prevention, diagnostics, and therapeutics.

DNA’s continuous exposure to harmful agents necessitates complex repair systems to preserve genome integrity (1, 2), and failure to timely and effectively repair DNA damages can lead to various genomic abnormalities, ranging from minor mutations to the loss of whole chromosomes (3–5). These changes in turn can trigger tumor initiation (5–7). Moreover, the tumor microenvironment (TME) can exacerbate DNA damage (8), especially if DNA repair pathways are compromised (9). Studies of the human microbiome, critical component of the TME, have elucidated an array of complex interactions between prokaryotes and their hosts (10, 11). In this regard, several bacteria can stimulate the production of inflammatory mediators, and some of their proteins are known to interfere with DNA repair, cell cycle, and apoptotic pathways, specifically the ones that cause persistent intracellular infections, potentially resulting in DNA damage, abnormal cell growth, and even transformation (12–15).

Recent studies have shown that several cancers, including stomach, liver, and colorectal, are the most reported bacterial-associated cancers, with high prevalence and mortality rates (16–18). More in detail, recent clinical data have highlighted associations between Fusobacterium nucleatum and colorectal cancer (11, 19–25), Chlamydia trachomatis and cervical cancer (26–30), Mycoplasmas and non-Hodgkin’s lymphoma in HIV-seropositive subjects (31), prostate cancer (32), and oral carcinoma (33). In addition, in vitro studies highlighted the oncogenic properties of these bacteria (34–36), strongly supporting them as promising oncogenic candidates, though the exact molecular mechanism(s) responsible for these properties are not fully understood.

In this regard, we showed that SCID (severe combined immunodeficiency disease) mice infected with Mycoplasma fermentans develop T cell lymphoma in a manner consistent with p53 inhibition (37). We also demonstrated that M. fermentans DnaK, a chaperone protein belonging to the HSP70 family, reduces the activity of crucial cellular proteins involved in maintaining genomic integrity, such as PARP1 and p53 (37–39). We also established that M. fermentans DnaK sequence is very similar to other cancer-associated bacteria (37), can be taken up by uninfected cells, (37, 39) and upon infection, it localizes in different cellular compartments (38), where it interacts with proteins implicated in the DNA-repair machinery, as well as the pathways involved in cellular proliferation and apoptosis (40). Finally, we showed that exogenous DnaK is able to trigger abnormal cellular activation in vitro by activating protein kinases (41). All these data strongly indicate the potential role of DnaK in cellular transformation.

To gain a better understanding of the oncogenic effect of DnaK in vivo, we recently generated a knock-in mouse model using CRISPR/Cas9-mediated genome editing to insert the Mycoplasma DnaK gene into the ROSA26 locus (42), a preferred choice of insertion because it minimizes insertion site side effects and ensures stable, ubiquitous expression of the introduced gene. In this DnaK knock-in mouse model, we demonstrated that exposure to DnaK was associated with a higher number of DNA copy number variants (CNVs) indicative of unbalanced chromosomal alterations, together with reduced fertility and high rate of fetal abnormalities (42). These findings provide additional evidence supporting the disruptive impact of DnaK on the preservation of DNA integrity.

Results

Effect of DnaK Expression on Levels of Proinflammatory Cytokines and ROS (Reactive Oxygen Species).

To assess the effect of DnaK on production of cytokines in vivo, we used our Mycoplasma DnaK knock-in mouse model which constitutively expressed DnaK in various tissues, including the brain, liver, spleen, and lymph nodes (42). We first measured their levels in the serum of animals expressing DnaK (DnaK positive) and compared them with age-matched controls (DnaK-negative) mice. In the DnaK-positive animals, we observed an increased amount of soluble proteins, chemokines, and cytokines, including IL-1α, IL-12, TNF-α, IL-15, M-CSF, CCL5/RANTES, and metalloproteinases (SI Appendix, Fig. S1 A–D), suggesting a potential proinflammatory activity mediated by DnaK and resulting from the activation of specific immune cell subset(s). The C-reactive protein, considered a biomarker for inflammatory conditions, was also increased. To better characterize and confirm these data, we determined by quantitative RT-PCR the expression of cytokines in CD4+ T cells and CD8+ T cells purified from the spleen of both groups of animals. We observed a significant increase of proinflammatory cytokines expression, including IL-6, IL-12, IL-1β, and TNF-α, both in T cell CD4+ (Fig. 1A) and cytotoxic CD8+ (Fig. 1B) purified from DnaK-positive animals compared to age-matched DnaK-negative controls. In addition, in the DnaK-positive group IL-10 expression was down-modulated in both immune subsets.

Fig. 1.

Cytokines, ROS levels, and β-galactosidase activity in DnaK-positive and DnaK-negative animals. (A and B) Analysis of the levels of cytokines in purified CD4⁺T and CD8⁺ T cells. Real time PCR assay was used to quantify IL-12, IL-10, IL-6, IL1β, TNFα and IFNγ mRNA levels in purified CD4⁺T cells (A) and CD8⁺ T cells (B) subpopulations isolated from a pool of spleens of mice DnaK negative (C57BL/6) (n = 10) and DnaK positive (DnaK^+/+) (n = 10) 12 to 14 wk old. Data are from a pool of two independent experiments, showing mean and SEM. Two-tailed Student’s t and nonparametric (Mann–Whitney) tests were used to assess statistical significance (*P < 0.05, **P < 0.01, and ****P < 0.0001). (C) Quantification of intracellular ROS production in four tissues: brain, liver, spleen, and heart. The DCFH-DA assay was employed to determine the levels of intracellular ROS in four distinct tissues collected from DnaK-positive mice (DnaK^+/+), compared to those measured in corresponding tissues in DnaK-negative controls (C57BL/6 mice). Cells obtained from three individual mice for each genotype were pooled together prior to running the assay. The data are representative of three independent experiments. Statistical significance was determined using a two-tailed Student’s t test, denoted as follows: *P < 0.05, **P < 0.01, and ***P < 0.001. (D) β-galactosidase stain in the liver and spleen of DnaK-positive and DnaK-negative mice. 40x (Scale bar, 20 µm) magnification. (1) Spleen, representative area from the DnaK-positive mouse; (2) Spleen, representative area from the DnaK-negative mouse; (3) Spleen, analysis of the β-galactosidase-positive area. Each dot represents the ratio of the positive area on the total area considered for each mouse. Two-tailed Student’s t test were used to assess statistical significance (*P < 0.05); (4) Liver, representative area from the DnaK-positive mouse; (5) Liver, representative area from the DnaK-negative mouse. (6) Liver, analysis of the β-galactosidase-positive area. Each dot represents the ratio of the positive area on the total area considered for each mouse. Two-tailed Student’s t test was used to assess statistical significance (*P < 0.05).

We next quantified the levels of intracellular ROS in four different tissues obtained from DnaK-positive mice and compared them to the levels measured in the same tissues obtained from DnaK-neg mice used as controls. ROS play a significant factor in DNA damage, potentially leading to oncogenesis (43). We observed significantly higher ROS levels in both the heart and the whole brain of the DnaK-positive animals, while the levels were significantly lower in both the liver and the spleen (Fig. 1C).

Finally, given the relationship between cellular senescence and inflammation, our objective was to assess the senescence status in cells from our groups of mice. β-galactosidase, a well-known marker of cellular senescence, was measured in both spleen and liver samples from both DnaK-positive and DnaK-negative mice. Our findings revealed elevated β-galactosidase activity in the spleens and livers of DnaK-positive mice, indicating a more marked senescent phenotype in these samples (Fig. 1D).

Reduced DNA Repair Following Spontaneous DNA Damage in Cells Expressing DnaK.

We next assessed DNA repair functionality in the presence of DnaK expression. For this set of experiments, we utilized cells harvested from the liver of our DnaK-positive mice and compared them with liver cells from DnaK-negative controls. The selection of these cells was influenced by several factors, including their ease of handling, growth in suspension, and ready availability.

Liver cells obtained from both DnaK homozygous mice and DnaK-negative mice were cultured overnight in complete medium without growth factors. This would cause the cells to undergo a stress resulting in DNA damage, allowing us to evaluate the functionality of their repair system following this level of damage. We employed the alkaline comet assay (44), which allows analysis of both single- and double-stranded DNA breaks at the single-cell level. The extent of DNA damage was quantified before seeding the cells in culture (T = 0), and after culturing the cells for 20 h in vitro, and the results were expressed as a measure of the percentage of fragmented DNA (Fig. 2). This metric quantitatively reflects DNA damage by measuring the fraction of fragmented DNA migrating from the nucleus under an electric field, forming a comet-like tail. This parameter is thus directly correlated with the frequency of DNA breaks, with longer tails indicating more extensive DNA damage. In our experimental setup, cells derived from DnaK-positive animals exhibited a significant increase in comet tail formation over 20 h in vitro, indicating heightened DNA damage (Fig. 2A). Comparative analysis between the cells obtained from DnaK-positive and -negative animals emphasized the escalating DNA damage and the compromised functionality of the repair mechanisms in the cells from the DnaK-positive animals (Fig. 2B). These data obtained from our ex vivo experiments substantiate our earlier in vitro findings, which showed that DnaK reduces the functionality of key cellular proteins essential for maintaining genome integrity (12, 35, 36).

Fig. 2.

Spontaneous DNA damage in cultured cells expressing DnaK. (A) The alkaline comet assay was employed to detect both single- and double-stranded DNA breakage. Liver cells obtained from three individual mice for each genotype were pooled together and then cultured in complete medium in the absence of growth factors. The extent of DNA damage was assessed before culture (T = 0) and after 20 h in culture. The extent of DNA damage was expressed as a measure of the percentage of DNA in the tail. (B) DnaK-positive animals were composed of DnaK homozygous (DnaK^+/+) mice. DnaK-negative mice were composed of littermates (2nd generation or higher). The data are representative of three independent experiments (n = 3 animals for each genotype). Statistical significance was determined using the two-tailed Student’s t test and nonparametric test (Mann–Whitney) tests, denoted as follows: *P < 0.05 and ****P < 0.0001.

Increased Cancer Incidence in DnaK-Positive Animals Treated with a DNA-Damaging Agent.

We next assessed whether animals expressing DnaK exhibited increased incidence of cancer following induction of DNA damage. Animals 4 to 5 wk old were injected with urethane (ethyl carbamate), a known carcinogen that induces mutations by damaging DNA (45). Urethane is a “multipotential” carcinogen, commonly employed to induce in mice a broad variety of cancers in several different tissue sites (46), typically resulting in pulmonary adenomas and hepatic hemangiomas or hemangiosarcomas (47–50). Several crucial factors can impact the development of urethane-induced tumors in mice, including the genetic makeup of the mouse strain, the dosage of urethane administered, and the frequency at which it is given (51–54). Notably, C57BL/6 mice exhibit lower sensitivity to urethane-induced cancer (55), necessitating multiple injections to overcome this resistance (56, 57). When urethane-induced DNA damage occurs, several DNA repair mechanisms can be activated to repair the damage, including the base excision repair, nucleotide excision repair, and homologous recombination (53, 58–61). Based on our previously published data showing that DnaK interfered with DNA repair mechanisms, we hypothesized that DnaK-positive animals would demonstrate higher incidence of cancers when exposed to urethane compared to controls DnaK-negative animals.

To avoid any confounding effect, we first assessed the percentage and time of development of either spontaneous tumors (SI Appendix, Fig. S2) or spontaneous deaths (SI Appendix, Fig. S3) in our colony. Except for one case of 34 wk of age, we did not observe any clinical evidence of spontaneous cancer development in DnaK-positive animals younger than 49 wk of age (SI Appendix, Fig. S2), similarly to what is reported for wild-type C57BL/6 animals, where the likelihood of spontaneous tumor is relatively low (44) and it is extremely rare before the age of 60 to 72 wk (62–66). We also observed a very low percentage of spontaneous death in DnaK-positive animals (<3.0%) (SI Appendix, Fig. S3), like what was observed among both adult and neonatal CD57 mice (67). Both spontaneous tumors and spontaneous deaths seem to happen slightly earlier in life among DnaK-positive animals compared to controls DnaK negative (SI Appendix, Figs. S2 and S3), and further studies are ongoing to determine whether DnaK accelerates/triggers these phenomena.

Considering these data, the experiments were terminated at 46 wk to minimize the incidence of spontaneous tumors and spontaneous death. Mice were euthanized according to the approved procedure by the University of Maryland School of Medicine Institutional Animal Care and Use Committee (IACUC). Complete necropsy with macroscopic postmortem examination was then performed, and any organ showing masses was sampled for histopathological examination. Histologically, these masses, mainly consisting of lymphomas in different tissues (i.e., liver, spleen, lymph nodes, and thymus). We observed a higher number of masses in the urethane-induced DnaK-positive animals (Fig. 3 and SI Appendix, Fig. S4), and these numbers were highly statistically significant when compared to C57BL/6. We note here that C57BL/6 mice were previously shown to exhibit lower sensitivity to urethane-induced cancer also by other groups (49, 55, 57). We also observed a comparable very low, and statistically significant, number of cancers in the DnaK-negative mice never exposed to DnaK injected with urethane, which rules out the possibility that some other unknown spontaneous mutations originated in the DnaK knock-in genetic background could increase their susceptibility to cancer induced by DNA damage. Finally, we note that DnaK inserted in mice with a different genetic background may impact differentially the carcinogenicity of urethane in these genotypes.

Fig. 3.

Increased incidence of cancer in DnaK-positive mice treated with urethane. DnaK-positive (n = 62) and DnaK-negative mice, i.e., littermate 2nd-generation DnaK-negative (n = 36) and C57BL/6 (n = 52) mice were IP injected with urethane and monitored for 46 wk and then sacrificed, according to the University of Maryland School of Medicine Institutional Animal Care and Use Committee (IACUC) guidelines. (A) Number of tumors over time following the injection(s) for the three distinct genotypes. The vertical axis represents the time in weeks after the injection(s). (B) Frequency and comparison of urethane-induced tumors among the mice included in the study across the three different genotypes. Statistical significance was assessed using the Fisher’s exact test, two tailed (*P < 0.05 and **P < 0.01).

DnaK Promotes Centromere Abnormalities.

We next determined whether DnaK knock-in mice and their progeny have centromere instability by quantitating the mouse centromere repeats major satellite (MaSat) (Fig. 4A), minor satellite (MiSat) (Fig. 4B), chromosome Y satellite (Ymin) (Fig. 4C) and the single copy number gene m36B4 (Fig. 4D). Centromeres are made of repetitive heterochromatic DNA sequences essential for proper chromosome segregation, as they provide a scaffold for the kinetochore during chromosome separation (68). Centromere abnormalities in turn can lead to errors and ultimately failure in chromosome segregation (69). We previously showed in DnaK knock-in mice that DnaK promotes altered DNA CNVs (42), which are variations in the genome where DNA segments are duplicated or deleted, potentially disrupting gene function and/or chromosome structure (70). Indeed, these structural alterations are a prevalent hallmark of cancer cells, contributing significantly to the initial stages of tumorigenesis and in cancer heterogeneity (69, 71).

Fig. 4.

DnaK increases centromeres abnormalities. Quantitation of the mouse centromere repeats MaSat (A), MiSat (B), and Ymin (C) in DnaK-positive mice compared to DnaK-negative mice. (D) Analysis of the single copy number m36B4. Centromere targets were quantitated by PCR using centromere-specific primers in a DnaK-positive breeding pair and their offspring (n = 7) and compared with a DnaK-negative control breading pair and their offspring (n = 10). (E) Increased number of centromere abnormalities in human primary prostate epithelial cells (957E/hTERT). Heatmap representation of the differences between cells treated with exogenous M. fermentans DnaK (eM-DnaK) and cells treated with eM-DnaK plus the specific ATPase activity inhibitor Telaprevir. Centromere fold differences were normalized against the h36B4 gene. (F) Centromere target fold changes in 957E/hTERT cells analyzed with Fisher t test, two tailed (*P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001).

We observed increased numbers of 36B4 copies in DnaK-positive mice, both in parents and their progeny, compared to DnaK-negative controls (Fig. 4D). Changes in the amounts of the centromere repeats Ymin, specific for chr Y, were not observed in male mice or offsprings, as expected (Fig. 4C). Ymin was absent (scarcely detected in the last amplification cycle) in the female population, confirming the gender of the mice (Fig. 4C). In DnaK-positive mice, we also observed centromere deletion or insertion of centromere repeats MaSat and MiSat in at least one of the parents and at least two of the offsprings (Fig. 4 A and B). Overall, these results indicate that DnaK expression in vivo is associated with centromere instability and changes in CNV or structural variation (SV).

To confirm that these differences in the number of centromere repeats in mice can be reproduced in humans, we studied the effect of DnaK exposure on centromere stability in human primary prostate epithelial cells because of the established association between Mycoplasma and prostate cancer (32). We note that bacterial DnaKs can be secreted upon expression (72, 73), contributing to the composition of the tissue microenvironment and we previously showed that exogenous DnaK is able to be taken up by uninfected cells and translocate to the nucleus (37, 39). To specifically demonstrate the effect of the protein, human primary prostate epithelial cells (957E/hTERT) were treated with exogenous Mycoplasma DnaK (eM-DnaK) in the presence of a specific inhibitor of its ATPase activity, namely Telaprevir (74), and compared to DnaK-treated cells in the absence the inhibitor (Fig. 4 E and F). Centromere sequences were then quantitated by PCR using centromere-specific primers (75). We observed several centromeric sequence abnormalities in cells treated with eM-DnaK in the form of deletions and amplifications, as compared with cells treated with eM-DnaK in the presence of Telaprevir (Fig. 4 E and F). Overall, these results indicate that exogenous DnaK was able to alter centromere stability in primary human cells, confirming and expanding our previous data.

Discussion

Host DNA faces daily damage from continuous exposure to harmful agents, including human microbiota components, and to preserve genomic integrity cells rely on fine-tuned repair mechanisms organized and coordinated in complex multi-protein pathways (2). Hence the requirement of fine-tuned repair mechanisms organized in complex multiprotein pathways coordinating to preserve genomic integrity. However, microbiota-derived proteins in the TME (5, 8) can compromise these protein functions. Consequently, unrepaired DNA damage may increase mutation rates, potentially leading to genomic instability and aberrant cellular behavior, thereby promoting the onset and progression of tumors (15). In this regard, while the oncogenic role of Helicobacter pylori is well established (16), several other bacteria including F. nucleatum, Chlamydia trachomatis, and M. fermentans (11, 20–22, 27, 30–33, 36) have been associated with cancer (76). To identify possible mechanisms of action and provide diagnostic and therapeutic targets, various bacterial proteins have been investigated by using in vitro studies linked to the transformation process (15, 76). However, in vivo studies supporting these in vitro findings are limited, and providing such evidence is essential to verify the oncogenic potential of specific bacterial proteins. In this context, our previous research showed that Mycoplasma DnaK, a bacterial chaperone protein belonging to the HSP70 family, binds to numerous cellular proteins (40), disrupts critical pathways involved in cell repair in vitro (37, 39) and leads to an increase in DNA CNVs in vivo (42). DNA CNVs are indicative of DNA instability, which is a hallmark of cellular transformation. Mycoplasmas are distributed among several human tissues, and their presence might make the host’s cells more vulnerable to transformation when exposed to secreted DnaK and other DNA-damaging agents. In our laboratory, we recently developed a knock-in transgenic mouse model that constitutively expressed Mycoplasma DnaK (42). We report here the results obtained by using this model to investigate in vivo the effect of DnaK on susceptibility to cancers induced by DNA damage.

We show here that DnaK-positive animals treated with urethane, a chemical known for causing DNA damage, exhibited an increased incidence of cancer. Additionally, cells from these animals cultured under stress showed reduced repair activity. Finally, we observed centromere abnormalities, in the form of CNVs and SV, in primary human prostate cells treated with exogenous, purified DnaK. This observation aligns with our data showing that exposure to DnaK in utero promotes CNVs in our animal model (42) and further establishes a connection between exposure to DnaK and DNA instability potentially leading to chromosomal instability and cellular transformation. We also previously showed that exogenous DnaK can be taken up by uninfected cells (37, 39) and can trigger abnormal cellular activation (41). This in turn may also intensify inflammation, and indeed our current results in the DnaK-positive animals showed a higher number of cells displaying a senescent phenotype and increased expression of proinflammatory cytokines, such as IL-1β, TNF-α, and IL-12, and decreased levels of IL-10, together with altered levels of ROS. This could lead to further DNA damage, and subsequently, the interference of DnaK with repair mechanisms might hinder effective DNA repair. This vicious cycle, over time, could culminate in the observed cellular transformation associated with DnaK. Several reasons may account for these disparities in ROS levels between DnaK-positive and DnaK-negative mice, including variations in DnaK expression influencing stress responses, tissue-specific sensitivities, metabolic activities, molecular pathways, and developmental antioxidant defenses. In addition, it is likely that distinct antioxidant mechanisms and metabolic needs in each tissue are implicated in these observed ROS differences. Further studies will assess DnaK’s role across tissues in the expression of ROS-related enzymes, cellular stress responses, and other environmental, and metabolic factors. Our data offer insights into bacterial-induced cellular transformation, presenting a comprehensive mechanism in which a bacterial protein, DnaK, compromises the essential cellular functions that maintain DNA integrity and ward off cancer. Moreover, our in vivo model may provide a valuable tool to delve deeper into the pathways influenced by DnaK. Finally, our results call for further investigations to accurately extrapolate these results to human subjects, potentially leading to innovative preventative, diagnostic, and therapeutic strategies. To this regard, it should be noted that both Mycoplasmas and F. nucleatum are present in the gastrointestinal tract (17, 21, 33) and Mycoplasmas have also been readily isolated from urine and linked to prostate cancer (32, 33). A diagnostic assay able to quantify DnaK expression and to link the levels of DnaK with increased probability of developing cancer could allow verification in patients of our in vivo data. Targeting and inactivating certain bacterial DnaK could thus result in prevention of cellular transformation.

Methods

DnaK Transgenic Mouse Model and Handling.

DnaK knock-in animals were generated in collaboration with Taconic Biosciences (Rensselaer, NY), and we previously published the sequence of DnaK and a characterization of the strain (37, 39). Our colony includes i) DnaK-positive knock-in (DnaK^+/+, DnaK^+/−), ii) DnaK-negative littermate controls second generations and higher, and iii) wild-type C57BL/6 mice. All experiments involving animals were granted ethical approval by the Institutional Animal Care and Use Committee at the University of Maryland School of Medicine. Throughout the study, mice were monitored on a daily basis to promptly identify any new phenotype and assess the presence of spontaneous solid tumor masses. Regular weighing of the mice was conducted, and any animal showing signs of illness or experiencing a weight loss exceeding 20% was euthanized, via carbon dioxide asphyxiation, following the predefined humane endpoints approved by the University of Maryland School of Medicine Institutional Animal Care and Use Committee (IACUC). Complete necropsy with macroscopic postmortem examination was performed for all animals. Organs showing masses at postmortem examination were sampled, fixed in 10% neutral buffered formalin, and routinely processed for paraffin embedding, sectioning, and hematoxylin and eosin staining. Images from the stained slides were captured using an Olympus BX53 microscope equipped with a DP72 camera and processed using the CellSens Standard software by Olympus.

Mouse Injection.

To study the increased susceptibility to cancer following exposure to urethane, DnaK knock-in and control animals (starting from 4 wk of age) were injected IP with 1 g/kg urethane (Sigma Aldrich, #94300). Given that the C57BL/6 genetic background is not sensitive to cancer-inducing agents, in particular to urethane, animals were subjected to two IP injections, 1 wk apart. The injection sites were alternated on different sides to reduce the pain and distress. Throughout the experiments, the animals were checked daily for the presence of masses or for any clinical sign that may constitute an end point, such as sudden and quick changes in weight, wasting and muscle loss, and labored respiration. We also conducted behavioral observations to detect decreased activity, reluctance to move, or social isolation. Animals that met early removal criteria were immediately euthanized via carbon dioxide asphyxiation. The experiment was terminated at 46 wk, before the development of spontaneous tumors due to aging, and the tissues were preserved for histopathological analysis. Postmortem examination and image acquisition was conducted as described above.

Mouse Cytokine Array.

The Proteome Profiler Mouse XL Cytokine Array Kit (ARY028, R&D Systems, Inc.) was used to detect the relative expression levels of 111 soluble proteins, according to the manufacturer’s instruction. Briefly, upon euthanization, according to the University of Maryland School of Medicine Institutional Animal Care and Use Committee (IACUC) guidelines, blood was also collected, and the serum was aliquoted and frozen. One hundred microliters of serum was diluted and incubated overnight with the membranes where the antibodies were spotted in duplicate. The membranes were then washed and incubated with a cocktail of biotinylated detection antibodies. Streptavidin–Horseradish Peroxidase Conjugate (HRP) and chemiluminescent detection reagents were then applied. The signal was acquired using the ChemiDoc MP digital image system (Bio-Rad). The spot signals were finally quantified using ImageJ software (77) and normalized to the internal reference spots. The signal produced is proportional to the amount of protein in the bound analyte.

CD4⁺ and CD8⁺ T Cell Isolation.

CD4⁺ and CD8⁺ T cells were isolated from the spleens under sterile conditions. Individual spleens were homogenized to release splenocytes, in 5 mL PBS on ice. The cell suspension was centrifuged (5 min at 400 g at room temperature), the supernatant was decanted, and the cells were resuspended in the residual volume (approximately 100 μL). Erythrocytes were lysed in red blood lysis buffer 1× (RBC Lysis Buffer 10×, BioLegend) for 2 min, before the addition of 5 mL of PBS to restore iso-osmolarity. The single-cell suspensions from individual spleens were then pooled and filtered through a 40-μm cell strainer (Stellar Scientific). CD8⁺T cells were isolated using magnetic cell sorting by negative selection (MojoSort Mouse CD8T cell isolation kit, BioLegend), and CD4⁺T cells were isolated using magnetic cell sorting by negative selection (MojoSort Mouse CD4T cell isolation kit, BioLegend) according to the manufacturer’s instructions.

RNA Extraction, Reverse Transcription, and Real-Time PCR for Cytokines Analysis.

Total RNA was isolated using the RNeasy Mini kit or RNeasy Micro kit (QIAGEN). One hundred nanograms of RNA of each sample was used to retrotranscribe cDNA using Oligo(dT) primer and Superscript IV Reverse Transcriptase (Thermo Fisher Scientific). Real-time PCR was performed in duplicates with a CFX-connect real-time PCR system (Bio-Rad Laboratories) and SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories) according to the manufacturer’s instructions. Relative expression was normalized to the expression levels of the internal control (housekeeping gene) Actin. Primers for inflammatory cytokines as follows were previously designed and validated (78), where F stands for “forward primer” and R for “reverse primer”:

• - IL-6F: CTCTGCAAGAGACTTCCATC

• - IL-6R: TTCTGCAAGTGCATCATCGT

• - IL-12F: AAGCTCTGCATCCTGCTTCAC

• - IL-12R: GATAGCCCATCACCCTGTTGA

• - IL-1βF: TTTGACAGTGATGAGAATGACC

• - IL-1βR: AATGAGTGATACTGCCTGCC

• - TNFαF: TCTCAGCCTCTTCTCATTCCT

• - TNFαR: ACTTGGTGGTTTGCTACGAC

Quantification of Intracellular ROS.

The presence and quantity of ROS were tested in different murine tissues using the OxiSelect intracellular ROS assay kit from Cell Biolabs Inc. The heart, spleen, liver, and brain were carefully removed, submerged in Dulbecco’s phosphate-buffered saline (DPBS) at a concentration of 1 mL/1gr, and kept in ice. Pools of single-cell suspensions of cardiomyocytes, splenocytes, liver cells, and neuronal cells were subsequently obtained from the intact tissues of DnaK-positive (DnaK^+/+, n = 3) and DnaK-negative (C57BL/6, n = 3) mice, 12 to 18 wk old. Cells from each sample were then counted and resuspended at a concentration of 1 × 10⁶cells/mL. An aliquot (200 μL) of cells was then transferred to a new tube, washed 3 times in DPBS, and incubated with 1× DCFH-DA, previously diluted in RPMI without FBS, for 60 min at 37 °C. Cells were washed again and resuspended in medium (180 μL). The same amount of 1× Cell Lysis buffer was added to the cells, followed by a 5-min incubation. The mixture was then transferred in duplicate (150 μL each well) to a 96-well plate suitable for fluorescent measurement. A DCF standard curve was also added to the plate. The fluorescence intensity was read with the SpectraMax iD3 (Molecular Devices) plate reader at 480 nm/530 nm and was proportional to the ROS levels within the cell cytosol.

DNA Damage Analysis by Comet Assay.

We used the Comet Assay (79) to quantify the DNA damage in liver cells obtained from DnaK^+/+ and DnaK-negative animals. We performed alkaline electrophoresis to detect both single- and double-stranded DNA breaks by using the Trevigen Comet Assay kit (Trevigen Inc., Gaithersburg, MD), according to the manufacturer’s instructions. Briefly, portions of livers were removed from the animals and placed in ice. Single-cell suspension was obtained by mechanical force and kept at 4 °C. The cells were then counted and resuspended in PBS (Ca²⁺ and Mg²⁺ free) to a concentration of 350,000 cells/mL. An aliquot of the cells was combined with the LMAgarose (1% low-melting agarose) molten and cooled at 37 °C at a ratio 1:10 (v/v), and 50 µL of the agarose cell solution was immediately pipetted and evenly spread onto the Comet slides (T = 0). The remaining cells were cultured in complete RPMI medium +10% fetal bovine serum (Gibco) for the indicated time (T = 20) and then combined with LMAgarose. The slides were incubated at 4 °C in the dark for 30 min to accelerate gelling of the agarose disc. After this step, the slides were immersed overnight at 4 °C (T = 0 samples), or for 1 h at room temperature (T = 20 samples), in lysis solution. DMSO was added to the lysis solution, according to the manufacturer’s instructions. The addition of DMSO is required for samples containing heme, such as tissue samples. A denaturation step was performed in freshly prepared Alkaline Unwinding Solution (200 mM NaOH and 1 mM EDTA, pH > 13) for 20 min, at room temperature, in the dark. The slides were then subjected to electrophoresis at 21V, for 30 min. The electrophoresis unit was prechilled at 4 °C, as the Alkaline Electrophoresis Solution (200 mM NaOH and 1 mM EDTA, pH > 13). At the end of the electrophoresis, the slides were washed twice in dH₂O for 5 min and immersed in 70% ethanol for 5 min. The slides were then dried at 37 °C for 15 min. DNA was stained with 100 µL of diluted SYBR Gold (Invitrogen, 10,000×, in TE buffer) for 30 min in the dark, at room temperature, and then allowed to dry completely at 37 °C. Finally, images were acquired using the Zeiss LSM800 confocal system (Carl Zeiss Microscopy, Germany) and analyzed using ImageJ software plugin OpenComet (80). The extent of DNA damage was expressed as a measure of the percentage of DNA in the tail.

Centromere Analysis.

Primary prostate epithelial cells (957E/hTERT) were plated at a concentration of 300,000 cells/well in six-well plates in Keratinocyte-SFM serum-free medium with supplements (EGF and Bovine Pituitary Extract) (Thermo Fisher Scientific). After 24 h, cells were treated with exogenous Mycoplasma DnaK (eM-DnaK), obtained as previously described (37, 39). eM-DnaK was added to the culture at the concentration of 10 μg/mL and incubated for 72 h or pretreated with Telaprevir (a specific inhibitor of the DnaK ATP-ase function) (74). Parallel cultures of cells treated with the inhibitor alone, not complexed with eDnaK, were used as control. At the end of the experiment the cells were harvested, and genomic DNA was isolated using the Monarch Genomic DNA Purification Kit (New England BioLabs), following the manufacturer’s instructions. Centromere targets were then quantitated by PCR using centromere-specific primers as previously described (71, 75, 81).

The values obtained (ΔCT) were used to generate heatmaps for specific centromere change comparisons. One-way ANOVA Kruskal–Wallis test and Dunn’s multiple comparison test determined mean differences in the Log2 fold change of ΔCT values.

For the murine centromere analysis, genomic DNA was extracted from cells obtained from the tail. We compared a DnaK-positive breeding pair and its litter (n = 7 pups) to a DnaK-negative breeding pair and its litter (n = 10 pups). After digestion of the tissue overnight at 56 °C in a lysis buffer containing the Proteinase K, the gDNA was isolated using the Monarch Genomic DNA Purification Kit (New England BioLabs) following the manufacturer’s instructions. The estimated size of the centromere arrays (number of α-repeats in each array) and single copy genes were measured by quantitative PCR using the specific primers listed below, where F stands for “forward primer” and R for “reverse primer”:

• YminF: CACAGTGTAGAACACCGTACAT

• YminR: CTCCTGTGTGTGTTGCTTATTTC

• MaSatF: CATTCGTTGGAAACGGGATTTG

• MaSatR: CTCATCTAATATGTTCTACAGTGTGGT

• MiSatF: AACATCCACTTGACGACTTGA

• MISatR: TCGCCATATTCCAGGTCTTTC

• m36B4: FACTGGTCTAGGACCCGAGAAG

• m36B4: RTCAATGGTGCCTCTGGAGAT

PCR products were then confirmed by sequencing. The qPCR was carried out using the FastStart Universal SYBR Green Master mix (Rox) (Roche) with an initial enzyme activation step for 10 min at 95 °C and 32 cycles consisting of 15 s of denaturation at 95 °C and 30 s of annealing/extension/fluorescence collection at 60 °C.

Histochemical Staining for Senescence-Associated β-Galactosidase.

The liver and the spleen from both DnaK-positive (n = 4) and DnaK-negative (n = 4) age-matched mice were isolated and placed in OCT medium for immediate freezing. The fresh-frozen tissues were then cryocut at 10 µm thickness using the Cryostat Microm HM550 and directly adhered to super frost charged microscope slides. Subsequently, the tissue sections were stained using the Senescence β-galactosidase Staining Kit (Cell Signaling Technology). The tissues were initially fixed using the 1× Fixative Solution provided by the kit for 10 min at room temperature. After two rinses in PBS, they were incubated overnight at 37 °C in a dry incubator in β-galactosidase Staining solution, following the manufacturer’s instructions. The pH of the staining solution was carefully checked (pH = 6.0) prior to incubation. Following the incubation, the staining solution was removed, and the tissues were counterstained with Nuclear Fast Red staining for 8 min at room temperature. The β-galactosidase activity was quantitatively determined by detecting stained blue-green cells. Digital image analysis of the tissues was performed using FIJI/ImageJ open-source software (82–84). For this evaluation, five 40× obj fields randomly selected from each hepatic or splenic section were considered for each mouse. The values are presented as the ratio of the β-galactosidase-positive area to the total area considered for each sample.

Statistical Analysis and Visualization.

GraphPad Prism9 was used for the statistical analysis and to represent the data.

Supplementary Material

Appendix 01 (PDF)

Data, Materials, and Software Availability

All study data are included in the article and/or SI Appendix.