Draft genome sequence of Limosilactobacillus fermentum isolated from subgingival biofilm

ABSTRACT

Limosilactobacillus fermentum is generally considered beneficial for vaginal and digestive health. However, strains isolated from the oral cavity, especially from periodontitis lesions, have not been thoroughly studied. Here, we report the draft genome sequence of strain KHUD_007 isolated from the subgingival biofilm of a Korean patient with periodontitis.

ANNOUNCEMENT

Limosilactobacillus fermentum is a Gram-positive, non-spore-forming rod-shaped bacterium (1). While some strains from food have beneficial effects (2, 3), not all L. fermentum strains are probiotic. Some strains have been associated with diseases, such as dental caries (4, 5) and colon inflammation (1), which suggest that L. fermentum, typically considered mutualistic, can become pathogenic due to factors such as habitat, sub-species variation, and host interactions (6). Out of the 183 L. fermentum genomes in GenBank, the majority are derived from strains isolated from food or feces. There are fewer than 15 genomes of oral-derived strains, and none are derived from periodontitis lesions.

This study performed genome sequencing of strain KHUD_007 to address the lack of studies on oral-derived L. fermentum. The strain was obtained from the subgingival biofilm of a Korean patient with periodontitis in 2016, approved by the Institutional Review Board (IRB) at the Dental Hospital of Kyung Hee University (KHD IRB 1606-5). Before genome sequencing, we obtained the 16S rRNA gene sequence of KHUD_007 using universal eubacteria primers (Table 1) (7). The obtained sequence was then compared using the standard BLAST against the nucleotide collection database with default parameters for bacterial species identification. For genome sequencing, KHUD_007 was anaerobically cultured in Difco Lactobacilli MRS broth at 37°C overnight. The genomic DNA extracted utilizing GenElute Bacterial Genomic DNA Kits (Sigma-Aldrich) was used for library construction using TruSeq DNA PCR-Free kit. Briefly, genomic DNA was mechanically sheared to 400–500 bp, and the resulting overhangs were converted to blunt ends. After a cleaning step using the AMPure XP Beads, the 3′ ends of the fragmented genomic DNA were first adenylated and then ligated to the index adapters. DNA fragments containing adapter sequences (500–600 bp) were extracted from a 2% agarose gel and then enhanced via PCR using adapter-specific primers. The resulting library was sequenced in paired-end mode on the Illumina Hi-Seq X platform. Default parameters were used for all bioinformatic analysis tools unless otherwise specified. We obtained 9,635,801 pairs of raw sequencing reads (2 × 151 bp). All the high-quality reads were used for genome assembly after assessing the quality of the raw sequencing reads using FASTQC (v0.12.1) (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). The adapter sequences in the raw reads were trimmed using cutadapt software (v1.18) with “-a AGATCGGAAGAGC-A AGATCGGAAGAGC -m 1” parameters (8). We constructed the genome of L. fermentum KHUD_007 using SPAdes (v3.15.3) (9). The NCBI Prokaryotic Genome Annotation Pipeline (v6.2) (10) was used for gene annotation of the genome.

TABLE 1.

Information of 16S rRNA gene and genome assembly of Limosilactobacillus fermentum KHUD_007

16S rRNA gene sequencing
GenBank accession	PP106247
Forword primer (5′–3′)	AGAGTTTGATCCTGGCTCAG
Reverse primer (5′–3′)	GGTTACCTTGTTACGACTT
Reaction mixture (20 µL)	0.5 µg DNA template, 200 µM each primer, 250 µM each dNTPs, and AccuPower HotStart Pfu PCR PreMix (Cat. K-2301, Bioneer, Korea)
Amplification condition	95°C 5 min and 30 cycles of 95°C 20 s, 53°C 20 s, and 72°C 60 s
Sequencing kit and system	BigDye Terminator v3.1 and ABI3730XL (Applied Biosystems, USA)

L. fermentum KHUD_007 genome is 1,993,541 bp with G + C content of 52.21% (Table 1). A total of 124 contigs (≥500 bp), 1,910 protein-coding genes, 6 rRNAs, and 54 tRNAs were identified. The genome coverage is 1411.0×, and the contig N50 value for the genome is 44,326. The genome completeness is 92.76% based on CheckM analysis (v1.2.2) (11). The genomic information of L. fermentum KHUD_007 presented here can be utilized in future studies to investigate the subspecies-level variation of L. lactobacillus in various habitats, including the oral cavity, and its potential relationship with diseases.

DATA AVAILABILITY

The draft genome sequence was deposited at DDBJ/ENA/GenBank under the accession JANFGS000000000.1 via BioProject PRJNA860016 (with BioSample accession SAMN29815206, SRA accession SRX20733841, and GenBank assembly accession GCA_024385625.1).