ABSTRACT
We sequenced the genome of Leuconostoc citreum strains BSMRAU-M1L6 and BSMRAU-M1L13 isolated from artisanal buffalo milk curd in Bangladesh. The draft genomes of BSMRAU-M1L6 and BSMRAU-M1L13 are 1,869,891 and 1,890,611 bp, respectively, with 50.0× coverage (both) and 65 and 75 contigs, respectively.
KEYWORDS: whole genome, multidrug resistance, Leuconostoc citreum, buffalo milk curd
ANNOUNCEMENT
The European Food Safety Authority and the World Health Organization have issued recommendations to exclude bacterial strains carrying mobile genetic elements with antibiotic-resistance genes from use in feeds, food fermentations, and probiotics (1). Leuconostoc species are generally used to produce aroma during milk fermentation (2). Research has shown the benefits of Leuconostoc strains (3), with Leuconostoc citreum considered the most significant species (4).
Thirty-five pure colonies of Leuconostoc species were isolated from naturally fermented buffalo milk curd available in Bhola (22.19° N, 90.76° E) and Noakhali (22.87° N, 91.27° E) districts of Bangladesh. The culture-dependent isolation was conducted using modified plate count agar media containing glucose as a carbon source, supplemented with vancomycin, and incubated at 22°C for 5 days according to a previously published method (5). After being grown overnight in MRS broth at 22°C for 48 h, the genomic DNA was extracted from each pure bacterial colony using QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) (6) and then amplified by PCR using the universal primers 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′). After performing partial 16S rRNA gene sequencing (7), 27 isolates were identified as Leuconostoc citreum. This study aimed to sequence the genomes of two Leuconostoc citreum strains, BSMRAU-M1L6 and BSMRAU-M1L13, and they were found to be multidrug-resistant (MDR; resistant to eight antibiotics) in disk diffusion tests according to CLSI 2021 (8). The Nextera DNA Flex Library Prep Kit (Illumina, USA) was used to generate libraries from 1 ng of DNA, extracted from BSMRAU-M1L6 and BSMRAU-M1L13 strains as described earlier. The whole-genome sequencing was performed using the Illumina MiSeq sequencer (Illumina, USA) with a 2 × 250 bp protocol (6, 9, 10).
Generated raw reads (BSMRAU-M1L6 = 9,552,456 bp, BSMRAU-M1L13 = 6,589,096 bp) were trimmed using Trimmomatic v0.39 to remove Illumina adapters, known Illumina artifacts, and phiX reads (11) and quality checked using FastQC v0.11.9 (12). Reads with Phred scores > 20 were assembled using SPAdes v.3.15.5 (13), and assembled genomes were quality checked through QUAST v.5.0.2 (14). Prokaryotic Genome Annotation Pipeline v6.4 (15) was used for genome annotation. We utilized ResFinder 4.0 (16), PlasmidFinder (17), PHASTER (https://phaster.ca/), and RAST FIGfams v.70 (18) databases to predict antimicrobial resistance genes, plasmid, prophages, and metabolic functions, respectively, in the draft genomes. Default parameters were used for all software unless otherwise stated.
Both BSMRAU-M1L6 and BSMRAU-M1L13 were MDR isolates, showing resistance against cephalexin, ciprofloxacin, gentamicin, nalidixic acid, nitrofurantoin, tetracycline, penicillin, and vancomycin. The draft assembly sizes of BSMRAU-M1L6 and BSMRAU-M1L13 were 1,869,891 bp and 1,890,611 bp, respectively. Further sequencing and assembly statistics of both genomes are given in Table 1. Both genomes had 206 metabolic features under different subsystem categories. The BSMRAU-M1L6 genome contained 1,803 protein-coding sequences (CDS) and 51 total RNA genes, while 1,811 CDS and 38 total RNA genes were predicted in the BSMRAU-M1L13 genome. Only two ARGs were predicted in both genomes conferring resistance to vancomycin (e.g., vanT and vanY). The BSMRAU-M1L6 genome contained three CRISPR arrays and five prophages, whereas two CRISPR arrays and four prophages were identified in the BSMRAU-M1L13 genome (with 95% identity and 60% coverage). These data will furnish valuable insights for researching the functions of these strains.
TABLE 1.
Genomic features of the Leuconostoc citreum BSMRAU-M1L6 and BSMRAU-M1L13 strains
| Isolate | Genome coverage (×) | Genome size (bp) | No. of contigs | N50 value (bp) | GC content (%) | Genome accession no. | SRA accession no. |
|---|---|---|---|---|---|---|---|
| BSMRAU-M1L6 | 50.0 | 1,869,891 | 65 | 66,784 | 39.0 | JAVUPW000000000 | SRR25321897 |
| BSMRAU-M1L13 | 50.0 | 1,890,611 | 75 | 66,662 | 38.9 | JAVUPX000000000 | SRR25321896 |
ACKNOWLEDGMENTS
The Bangladesh Livestock Research Institute (BLRI), Savar, Dhaka, Ministry of Fisheries and Livestock, Government of the People’s Republic of Bangladesh, supported this work.
Contributor Information
Md. Morshedur Rahman, Email: morshed@bsmrau.edu.bd.
John J. Dennehy, Queens College Department of Biology, Queens, New York, USA
DATA AVAILABILITY
The whole genome shotgun project of the Leuconostoc citreum strains BSMRAU-M1L6 and BSMRAU-M1L13 has been deposited in GenBank and the NCBI Sequence Read Archive (SRA) under BioProject accession number PRJNA982305. Individual accession numbers are listed in Table 1. The versions described in this paper are version JAVUPW000000000.1 and JAVUPX000000000.1.
ETHICS APPROVAL
The experimental procedure was reviewed and approved by the Animal Research Ethics Committee (AREC) of the Bangabandhu Sheikh Mujibur Rahman Agricultural University, Bangladesh (Reference number: FVMAS/AREC/2022/06, Date: 04/12/2022).
REFERENCES
- 1. Duche RT, Singh A, Wandhare AG, Sangwan V, Sihag MK, Nwagu TNT, Panwar H, Ezeogu LI. 2023. Antibiotic resistance in potential probiotic lactic acid bacteria of fermented foods and human origin from Nigeria. BMC Microbiol 23:142. doi: 10.1186/s12866-023-02883-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Alegría Á, Delgado S, Flórez AB, Mayo B. 2013. Identification, typing, and functional characterization of Leuconostoc spp. strains from traditional, starter-free cheeses. Dairy Sci Technol 93:657–673. doi: 10.1007/s13594-013-0128-3 [DOI] [Google Scholar]
- 3. De Paula AT, Jeronymo-Ceneviva AB, Silva LF, Todorov SD, Franco BDGM, Penna ALB. 2015. Leuconostoc mesenteroides SJRP55: a potential probiotic strain isolated from Brazilian water buffalo mozzarella cheese. Ann Microbiol 65:899–910. doi: 10.1007/s13213-014-0933-9 [DOI] [PubMed] [Google Scholar]
- 4. Sharma A, Kaur J, Lee S, Park YS. 2018. Analysis of Leuconostoc citreum strains using multilocus sequence typing. Food Sci Biotechnol 27:1755–1760. doi: 10.1007/s10068-018-0417-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Frantzen CA, Kot W, Pedersen TB, Ardö YM, Broadbent JR, Neve H, Hansen LH, Dal Bello F, Østlie HM, Kleppen HP, Vogensen FK, Holo H. 2017. Genomic characterization of dairy associated Leuconostoc species and diversity of Leuconostocs in undefined mixed mesophilic starter cultures. Front Microbiol 8:132. doi: 10.3389/fmicb.2017.00132 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Hoque MN, Jerin S, Faisal GM, Das ZC, Islam T, Rahman ANMA. 2023. Whole-genome sequence of multidrug-resistant Escherichia coli strains isolated from mice with mastitis. Microbiol Resour Announc 12:e00320-23. doi: 10.1128/mra.00320-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Wang Y, Li A, Jiang X, Zhang H, Mehmood K, Zhang L, Jiang J, Waqas M, Iqbal M, Li J. 2018. Probiotic potential of Leuconostoc pseudomesenteroides and Lactobacillus strains isolated from yaks. Front Microbiol 9:2987. doi: 10.3389/fmicb.2018.02987 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Yoon J. 2022. Focused commentary; about revision of CLSI antimicrobial breakpoints, 2018-2021. J Bacteriol Virol 52:41–53. doi: 10.4167/jbv.2022.52.2.041 [DOI] [Google Scholar]
- 9. Ievy S, Hoque MN, Islam MS, Sobur MA, Ballah FM, Rahman MS, Rahman MB, Hassan J, Khan MFR, Rahman MT. 2022. Genomic characteristics, virulence, and antimicrobial resistance in avian pathogenic Escherichia coli MTR_BAU02 strain isolated from layer farm in Bangladesh. J Glob Antimicrob Resist 30:155–162. doi: 10.1016/j.jgar.2022.06.001 [DOI] [PubMed] [Google Scholar]
- 10. Hoque MN, Moyna Z, Faisal GM, Das ZC. 2023. Whole-genome sequence of the multidrug-resistant Staphylococcus warneri strain G1M1F isolated from mice with mastitis. Microbiol Resour Announc 12:e00275-23. doi: 10.1128/mra.00275-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for illumina sequence data. Bioinformatics 30:2114–2120. doi: 10.1093/bioinformatics/btu170 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Andrews S. 2017. FastQC: a quality control tool for high throughput sequence data .2010
- 13. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19:455–477. doi: 10.1089/cmb.2012.0021 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Gurevich A, Saveliev V, Vyahhi N, Tesler G. 2013. QUAST: quality assessment tool for genome assemblies. Bioinformatics 29:1072–1075. doi: 10.1093/bioinformatics/btt086 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Tatusova T, DiCuccio M, Badretdin A, Chetvernin V, Nawrocki EP, Zaslavsky L, Lomsadze A, Pruitt KD, Borodovsky M, Ostell J. 2016. NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res 44:6614–6624. doi: 10.1093/nar/gkw569 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Bortolaia V, Kaas RS, Ruppe E, Roberts MC, Schwarz S, Cattoir V, Philippon A, Allesoe RL, Rebelo AR, Florensa AF, et al. 2020. ResFinder 4.0 for predictions of phenotypes from genotypes. J Antimicrob Chemother 75:3491–3500. doi: 10.1093/jac/dkaa345 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Carattoli A, Zankari E, García-Fernández A, Voldby Larsen M, Lund O, Villa L, Møller Aarestrup F, Hasman H. 2014. In silico detection and typing of plasmids using plasmidfinder and plasmid multilocus sequence typing. Antimicrob Agents Chemother 58:3895–3903. doi: 10.1128/AAC.02412-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Overbeek R, Olson R, Pusch GD, Olsen GJ, Davis JJ, Disz T, Edwards RA, Gerdes S, Parrello B, Shukla M, Vonstein V, Wattam AR, Xia F, Stevens R. 2014. The SEED and the rapid annotation of microbial genomes using subsystems technology (RAST). Nucleic Acids Res 42:D206–14. doi: 10.1093/nar/gkt1226 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The whole genome shotgun project of the Leuconostoc citreum strains BSMRAU-M1L6 and BSMRAU-M1L13 has been deposited in GenBank and the NCBI Sequence Read Archive (SRA) under BioProject accession number PRJNA982305. Individual accession numbers are listed in Table 1. The versions described in this paper are version JAVUPW000000000.1 and JAVUPX000000000.1.
