Direct aromatic nitration by bacterial P450 enzymes

Abstract

Nitro aromatics have broad applications in industry, agriculture, and pharmaceutics. However, their industrial production is faced with many challenges including poor selectivity, heavy pollution and safety concerns. Nature provides multiple strategies for aromatic nitration, which opens the door for the development of green and efficient biocatalysts. Our group’s efforts focused on a unique bacterial cytochrome P450 TxtE that originates from the biosynthetic pathway of phytotoxin thaxtomins, which can install a nitro group at C4 of l-Trp indole ring. TxtE is a Class I P450 and its reaction relies on a pair of redox partners ferredoxin and ferredoxin reductase for essential electron transfer. To develop TxtE as an efficient nitration biocatalyst, we created artificial self-sufficient P450 chimeras by fusing TxtE with the reductase domain of the bacterial P450BM3 (BM3R). We evaluated the catalytic performance of the chimeras with different lengths of the linker connecting TxtE and BM3R domains and identified one with a 14-amino-acid linker (TB14) to give the best activity. In addition, we demonstrated the broad substrate scope of the engineered biocatalyst by screening diverse l-Trp analogs. In this chapter, we provide a detailed procedure for the development of aromatic nitration biocatalysts, including the construction of P450 fusion chimeras, biochemical characterization, determination of catalytic parameters, and testing of enzyme-substrate scope. These protocols can be followed to engineer other P450 enzymes and illustrate the processes of biocatalytic development for the synthesis of nitro chemicals.

1. Introduction

1.1. Chemical methods for aromatic nitration

Aromatic compounds containing the nitro (-NO₂) group are of great significance in many fields. They are recognized as the active ingredients of numerous pharmaceuticals, dyes, polymers, fragrances, insecticides, and explosives (Ju & Parales, 2010). Some nitro compounds are also important for disease treatment such as tolcapone, nilutamide, delamanid and chloramphenicol for Parkinson’s disease, prostate cancer, multidrug-resistant and infections, respectively(Antonini et al., 2008; Ryan & Lo, 2014). Additionally, nitrogen-containing aromatic molecules are considered useful synthons that can be utilized to prepare valuable entities, such as amines, amides, sulfonamides and a wide range of heterocycles (Martincorena et al., 2015; Fang et al., 2013). The broad applications of nitro-aromatic compounds make them attractive targets for synthetic communities. Indeed, nitration, in particular the synthesis of nitroaromatics, is one of the most investigated organic reactions (Yan & Yang, 2013).

The most conventional nitration approach requires a strong mixed acid (HNO₃/H₂SO₄) and relies on the electrophilic addition of nitronium ion (NO₂⁺) to the aromatic moieties (Figure 1). The use of harsh reaction conditions, the formation of multiple side products, as well as the production of hazardous nitrogen oxide (NO_x) fumes, are the major limitations of this approach. To overcome these challenges, transition metal-catalyzed nitration has evolved in the last few decades (Figure 1). For example, electrophilic nitration of aromatic compounds based on the replacement of the leaving group (boronic acids, triflate, chloride) at the ipso-position with the nitro group has been studied extensively (Murray et al., 2022). A superacid medium and low temperature favor the formation of a long-lived nitrosonium ion, which facilitates the ipso-nitration (Prakash et al., 2004). Furthermore, the Liu group disclosed the Pd-catalyzed ortho nitration of a wide range of aromatic substrates, utilizing nitrogen-containing heterocycles as a directing group (DG) via the activation of the C-H bond to trigger the reaction (Liu et al., 2010). Under optimized conditions, several common DGs, such as pyridine, pyrimidine, pyrazole, and thiazole, were also effective for this ortho-nitration process (Zhang et al., 2014). Transition metal-based nitration using DGs was further expanded to nitration at the meta and para positions of aromatic substrates (Fan et al., 2016; Wan et al., 2017). Additionally, solvent-free microwave-aided nitration (Kamatala, 2018) and nitrous acid-catalyzed aromatic nitration methods were found to control the regioselectivity as well as the reaction rate (Figure 1) (Wiuiams, 2004). These advanced nitration methods have addressed the aforementioned problems to some extent, but they also carry significant drawbacks, such as high costs, prolonged times for substrate synthesis, and potential damage to the environment. The lasting challenges of chemical nitration highlight the growing importance of the development of ecologically friendly, selective direct aromatic nitration methods.

Figure 1.

Different approaches towards the synthesis of nitro aromatics.

1.2. Natural nitration strategies

Biocatalysis can be a plausible solution to the problems associated with chemical nitration methods. Enzymes as biocatalysts offer unique advantages such as high regio-, stereo-, and chemo-selectivity that avoids lengthy protection and deprotection processes and the generation of toxic impurities. Importantly, while the majority of nitro aromatics are man-made, nature has evolved at least three biological strategies to produce hundreds of nitrated natural products with a great degree of structural diversity (Figure 2) (Barry et al., 2012; Winkler & Hertweck, 2007). Enzymatic N-oxidation is the dominant natural nitration mechanism (Kersten & Dorrestein, 2010), in which a preinstalled substrate amine group is converted into the nitro group. Multiple types of N-oxidases with diverse cofactors have been identified to enable this conversion on the sugar or aromatic ring systems (H. D. Johnson & Thorson, 2008; Winkler et al., 2007). Another strategy has been observed only in the biosynthesis of nitropyrroles pyrrolomycins in Streptomyces sp. (Figure 2) (X. Zhang & Parry, 2007). The N-oxidases are missing in the biosynthesis gene cluster of pyrrolomycins, but feeding studies have shown that exogenous nitrite could be utilized as the nitro source (Ratnayake et al., 2008). It was suggested that the use of nitrite in the formation of nitropyrrole might resemble the chemical electrophilic nitration (X. Zhang & Parry, 2007), and the exact reaction mechanism still awaits further study. The third mechanism was uncovered during an investigation of the biosynthesis of thaxtomins produced by several pathogenic Streptomyces species (Figure 2) (E. G. Johnson et al., 2009; Krasnoff et al., 2005). During the thaxtomin biosynthesis, the nitro donor nitric oxide (NO) is biologically produced from the amino acid l-Arg by an NO synthase TxtD. Then a unique P450 enzyme TxtE catalyzes the direct nitration reaction on the C4 of the l-Trp indole ring with oxygen (O₂) and NO as co-substrates (Barry et al., 2012). The aromatic nitration reaction catalyzed by TxtE is distinct from all other known P450 reactions as it involves an iron(III)-peroxynitrite that splits homolytically to form an iron(IV)-oxo heme (Compound II) and a free NO₂ radical via small free energy of activation (Louka et al., 2020; Martin et al., 2021). Direct nitration on the free amino acid was also reported in the rufomycin and ilamycin biosynthesis (Ma et al., 2017; Tomita et al., 2017). The P450 enzyme, RufO or IlaM, catalyzes the installation of a nitro group on the C3 of l-Tyr. However, recent structural and mechanistic studies suggested that RufO does not take free l-Tyr as substrate, and instead modifies l-Tyr tethered to a thiolation (T) domain (Dratch et al., 2023; Jordan et al., 2023). Despite the importance of nitration reaction in chemical synthesis and the availability of many nitration enzymes, this reaction has not been widely explored from the biocatalysis standpoint yet.

Figure 2.

Natural aromatic nitration strategies with representative examples.

1.3. Engineering of TxtE

Natural nitration strategies offer great opportunities for engineering nitration biocatalysts. TxtE is particularly attractive due to its direct nitration mechanism that avoids pre-installation of amine or tethered substrate. In addition, TxtE demonstrates considerable substrate flexibility and controllable regio-selectivity, which we revealed previously (Zuo et al., 2016, 2017; Zuo & Ding, 2019).

TxtE belongs to the class I cytochrome P450 (CYP) family whose catalytic activity depends on a small redox 2Fe-2S containing ferredoxin (Fer) and a flavin adenine dinucleotide containing reductase (Fdr) (Barry et al., 2012). Among the different types of CYPs, the class III CYPs have a unique structural fold, in which their heme domain is fused with a reductase domain as a single polypeptide (De Mot & Parret, 2002). This fusion nature enhances the catalytic activities of the class III enzymes and significantly eases their applications (E. M. J. Gillam, 2008; Urlacher & Girhard, 2012). Inspired by the self-sufficient CYPs, researchers have been developing artificially reconstituted fusion proteins by fusing the P450s to their native or non-native redox partners (E. Gillam & Hayes, 2013; McIntosh et al., 2014; Sadeghi & Gilardi, 2013). As it is often difficult to identify the native redox partner for a given P450, non-native redox partners are generally employed. In this regard, the CPR-like reductase of CYP102A1 P450BM3 from Bacillus megaterium (Narhi & Fulco, 1986) and the PFOR-like reductase of P450RhF from Rhodococcus species (Roberts et al., 2003) are commonly used in the fusion design (Sadeghi & Gilardi, 2013).

To develop TxtE for producing nitro aromatics in an efficient, selective and environmentally friendly manner, our group generated self-sufficient TxtEs as the nitration biocatalysts. We evaluated the catalytic efficiency of TxtE fused with the reductase domain of P450BM3 and that of P450RhF, and TxtEBM3R showed a higher catalytic efficiency (Zuo et al., 2016). We also demonstrated the use of TxtEBM3R to nitrate fluoro-tryptophan analogs in vitro. Moreover, we created 15 new chimeric TxtEBM3R variants with different linker lengths and determined that TB14 (a linker comprising 14 amino acids) had the highest catalytic efficiency (TTN = 707 ± 16) in nitrating l-Trp (Zuo et al., 2017). These studies have yielded TxtEBM3R biocatalysts with improved catalytic turnover and coupling efficiency compared with the three-protein system comprising TxtE, Fer and Fdr. Furthermore, we observed broad substrate specificity of TxtE toward l-Trp analogs (Zuo et al., 2017), while the Challis group recently created a TxtE R59C mutant that nitrates tryptamine and several analogs (Saroay et al., 2021).

This chapter provides detailed experimental procedures for constructing the TxtEBM3R fusion variants and their biochemical characterization in direct aromatic nitration. These protocols can facilitate the engineering of other Class I P450 enzymes as biocatalysts.

2. Creation of self-sufficient TxtE chimeras

To use TxtE as a biocatalyst for aromatic nitration, we designed an artificial self-sufficient TxtE fusion enzyme (TxtEBM3R) by appending the reductase domain of P450BM3 and of P450RhF to the C-terminus of TxtE. Chimeric TxtEBM3R variants with linker lengths of 3, 6, 9, 11, 12, 13, 14, 15, 16, 17, 19, 22, 24, and 27 amino acids (AA) were constructed to assess potential influences of linker length on enzyme nitration performance (Figure 3). All constructs were expressed in E. coli and purified to homogeneity by a single Ni²⁺-NTA affinity chromatography. All chimeras were similarly soluble, indicating the minimal effect of variable linker length on protein solubility.

Figure 3.

Schematic depiction of chimeric TxtEBM3R constructs with variable linker lengths. The structure of human NADPH-cytochrome P450 reductase (PDB: 3QE2, right) represented the BM3R structure along with that of TxtE (PDB: 4TPO, left).

2.1. Construction of TxtEBM3R expression vectors

We followed a stepwise cloning approach to design our TxtEBM3R chimeras. Initially, we amplified the TxtE gene from the genomic DNA of S. scabies 87.22 (NRRL B-24449) and BM3R with different linker lengths at its 5’-end (GenBank: J04832.1) from the genome of Bacillus megaterium ATCC 14581. Primers, PCR reaction conditions and thermocycling conditions are shown in Tables 1–3. The linkers of TxtEBM3R are derived from the natural linker connecting the heme and reductase domain of P450BM3, as predicted by Domcu (M. Suyama et al., 2013). The linkers of different lengths are shown in Table 4. The construction of TxtEBM3R expression vector is depicted in Figure 4. Briefly, we first clone the TxtE gene into pET28a via NcoI and SacI restriction enzyme digestion sites. Subsequently, the BM3R with various linker lengths are cloned into the above pET28a-TxtE construct via SacI and XhoI sites to generate the pET28a-TxtEBM3R expression vector (Figure 4).

Table 1.

Primers used to amplify TxtE and BM3R with various linker lengths.

Name	Sequence (5’→3’)	Function
SELKnco-F	ATACCATGGTGACCGTCCCCTCGCCG	TxtE cloning
SELKsac-R	ATAGAGCTCGCGGAGGCTGAGCGGCAG	TxtE cloning
BM3R-F	CTACATATGTCTGCTAAAAAAGTACGCAA	BM3R forward primer
BM3LKsac3-F	TCTGAGCTCAACGCTCATAATACGCCGCTG	BM3R with 3aa linker
BM3LKsac6-F	TCTGAGCTCAAGGCAGAAAACGCTCATAATACG	BM3R with 6aa linker
BM3LKsac9-F	TCTGAGCTCGTACGCAAAAAGGCAGAAAACG	BM3R with 9aa linker
BM3LKsac11-F	TCTGAGCTCAAAAAAGTACGCAAAAAGGCAG	BM3R with 11aa linker
BM3LKsac12-F	TCTGAGCTCGCTAAAAAAGTACGCAAAAAGGCAG	BM3R with 12aa linker
BM3LKsac13-F	TCTGAGCTCTCTGCTAAAAAAGTACGCAAAAAGGCAG	BM3R with 13aa linker
BM3LKsac14-F	TCTGAGCTCCAGTCTGCTAAAAAAGTACGCAAAAAG	BM3R with 14aa linker
BM3LKsac15-F	TCTGAGCTCGAACAGTCTGCTAAAAAAGTAC	BM3R with 15aa linker
BM3LKsac16-F	TCTGAGCTCACTGAACAGTCTGCTAAAAAAG	BM3R with 16aa linker
BM3LKsac17-F	TCTGAGCTCAGCACTGAACAGTCTGCTAAAAAAG	BM3R with 17aa linker
BM3LKsac19-F	TCTGAGCTCTCACCTAGCACTGAACAGTCTGC	BM3R with 19aa linker
BM3LKsac22-F	TCTGAGCTCGGTATTCCTTCACCTAGCACTGAAC	BM3R with 22aa linker
BM3LKsac24-F	TCTGAGCTCCTTGGCGGTATTCCTTCACCTAG	BM3R with 24aa linker
BM3LKsac27-F	TCTGAGCTCAAAATTCCGCTTGGCGGTATTC	BM3R with 27aa linker
BM3LKxho-R	ATCCTCGAGCCCAGCCCACACGTCTTTTGC	BM3R reverse primer

Table 3.

General thermocycling conditions.

Step	Temperature	Time
Initial Denaturation	98 °C	3 minutes
30–35 Cycles	98 °C	10 seconds
	55 °C	20 seconds
	72 °C	30 seconds/kb
Final Extension	72 °C	5 minutes
Hold	4 °C

Table 4.

List of linker sequences of TxtEBM3R chimeras.

Variant name	Linker length	Linker sequence
TB27	27	EL KIPLGGIPSPSTEQSAKKVRKKAEN
TB24	24	EL LGGIPSPSTEQSAKKVRKKAEN
TB22	22	EL GIPSPSTEQSAKKVRKKAEN
TB19	19	EL SPSTEQSAKKVRKKAEN
TB17	17	EL STEQSAKKVRKKAEN
TB16	16	EL TEQSAKKVRKKAEN
TB15	15	EL EQSAKKVRKKAEN
TB14	14	EL QSAKKVRKKAEN
TB13	13	EL SAKKVRKKAEN
TB12	12	EL AKKVRKKAEN
TB11	11	EL KKVRKKAEN
TB9	9	EL VRKKAEN
TB6	6	EL KAEN
TB3	3	EL N

Figure 4.

Schematic depiction of the construction of the expression vector of TxtEBM3R chimeras.

2.1.1. Equipment

• PCR thermocycler

• Gel Electrophoresis equipment and supplies

• NanoDrop spectrophotometer

• Thermomixer or water bath

• Benchtop microcentrifuge

• Benchtop incubator shaker

2.1.2. Materials and reagents

• Primers (Sigma-Aldrich)

• dNTP (Thermo)

• Nuclease-free water

• GeneJET gel extraction kit (Thermo)

• Q5 high fidelity DNA polymerase (New England Biolabs)

• Genomic DNA of Bacillus megaterium ATCC 14581 (Note 1)

• Genomic DNA of Streptomyces scabies 87.22 (NRRL B-24449) (Note 1)

• Escherichia coli DH5α

• E. coli BL21-GOLD (DE3)

• Luria-Bertani (LB) broth

• Super optimal broth (SOB)

• Kanamycin

2.1.3. Protocol

1. Design and order the oligonucleotides (Table 1). For all the constructs with different linker lengths, the same reverse primer is used along with different forward primers.

2. Prepare the PCR reaction (50 μL) to amplify the TxtE gene (Genbank: FN554889 REGION: 3613916..3615136) following the Q5 high fidelity DNA polymerase protocol for high GC content materials (Note 2). General PCR reaction mixture components and conditions are included in Tables 2 and 3.

3. Analyze the PCR reaction mixtures on 0.7 % agarose gel and extract the products of proper sizes with the GeneJET gel extraction kit (Thermo), following the manufacturer’s protocol.

4. Digest 200 to 1000 ng of purified TxtE and pET28a with NcoI and SacI restriction enzymes (Thermo), following the manufacturer’s protocol. Incubate the reactions at 37 °C for 1 hour.

5. Purify the digested products with the GeneJET PCR purification kit (Thermo), following the manufacturer’s protocol.

6. Ligate the digested TxtE into the digested pET28a vector using T4 DNA ligase (Thermo, 5 U/μL) after determining DNA concentration with a NanoDrop spectrophotometer. Use a molar ratio of 1:3 for vector: insert in a 20 μL reaction (Note 3) containing 1 × T4 DNA ligase buffer and 1 μL T4 DNA ligase. Incubate the reaction at 16 °C overnight.

7. Transform 50 μL commercially available E. coli DH5α competent cells (Thermo) with 1 to 5 μL of ligation mixture that is pretreated at 70 °C for 5 min and then cooled on ice (Note 4).

8. Incubate the mixture on ice for 30 min after gently mixing, and then at 42 °C for 45 s in the water bath or thermomixer (Note 5). Immediately place the mixture back on ice.

9. Add 800 μL of SOB media to the tube and incubate the culture at 37 °C, 250 rpm for 1 hour.

10. Plate 100 μL of transformed cells onto an LB agar plate containing 50 μg/mL kanamycin and incubate the plate at 37 °C overnight.

11. Inoculate 2–3 colonies from the plate in 3 ml LB containing 50 μg/mL kanamycin and grow the culture at 37 °C, 250 rpm overnight.

12. Extract the plasmid from the 2 mL culture of positive colonies following the protocol of the GeneJET Plasmid Miniprep kit (Thermo).

13. Verify the inserted gene by sequencing (Note 5).

14. Follow the same procedure as those for TxtE to amplify and purify the BM3R gene with different linker lengths at its 5’-end (GenBank: J04832.1, Tables 1 and 4) and to generate and verify pET28a-TxtEBM3R expression vectors.

Table 2.

General PCR reaction conditions.

Component	50 μl Reaction	Final Concentration
5 X Q5 Reaction Buffer	10 μl	1 X
10 mM dNTPs	1 μl	200 μM
10 μM Forward Primer	2.5 μl	0.5 μM
10 μM Reverse Primer	2.5 μl	0.5 μM
Template DNA	1 μl	< 1,000 ng
Q5 High-Fidelity DNA polymerase	0.5 μl	0.02 U/μl
5 X Q5 High GC Enhancer	10 μl	1 X
Nuclease-Free Water	22.5 μl

2.1.4. Notes

1. The genomic DNA can be isolated with commercial kits. We used the MasterPure^™ Gram Positive DNA Purification Kit (LGC Biosearch Technologies).

2. The TxtE gene has a high GC content and we recommend using the high GC enhancer in the PCR reaction. In addition, the annealing temperature may be modified to achieve a high yield. For example, annealing temperatures ranging from 50 to 72 °C can be tested. Alternatively, the codon-optimized TxtE gene can be synthesized from a vendor.

3. It is critical to have a sufficient amount of digested vector in the ligation mixture. We recommend using 100 ng of digested vector in the 20 μL reaction.

4. Keep the competent cells on ice before heat shock.

5. Stabilize the temperature of the water bath or thermomixer at 42 °C before heat shock.

6. The isolated vector can be digested by restriction enzymes to confirm the presence of the insert.

2.2. Expression and purification of TxtEBM3R chimeras

Biocatalysis involves the use of enzymes that are purified or still in the cellular milieu. This section intends to introduce basic procedures for the expression and purification of TxtEBM3R chimeras, which can be applied to other proteins. The protein expression level can be improved by optimizing culture conditions (e.g., culture temperature, medium, aeration, and inducer concentration), using different expression hosts, and testing various expression vector backbones. To support the expression of functional P450s, 1 X trace metal solution and aminolevulinic acid are added to the culture prior to the induction. After protein expression, soluble proteins can be released from cells commonly by liquid homogenization, sonication, or freeze/thaw cycles. Recombinant proteins carrying a His₆- tag are purified through immobilized metal affinity chromatography (IMAC) using HisPur^™ Ni-NTA Resin (Thermo) in a gravity flow column or with fast protein liquid chromatography (FPLC) in a cold room. To improve the purity, the recombinant protein can be further purified by other means, such as ion exchange chromatography and size exclusion chromatography. The purity of purified recombinant protein can then be assessed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

2.2.1. Equipment

• ÄKTA pure FPLC

• 500W Sonic sonicator

• Nanodrop spectrophotometer

• Shaker

• Electrophoresis system

2.2.2. Materials and reagents

• Kanamycin

• Escherichia coli BL21 (DE3)-GOLD

• Terrific broth

• 1 X Trace metal solution (1000 X stock solution: 50 mM FeCl₃, 20 mM CaCl₂, 10 mM MnSO₄, 10 mM ZnSO₄, 2 mM CoSO₄, 2 mM CuCl₂, 2 mM NiCl2, 2 mM Na₂MoO₄, and 2 mM H₃BO₃)

• Isopropyl-β-D-thiogalactopyranoside (IPTG)

• Lysis buffer (25 mM Tris-HCl, pH 8.0, 0.5 mg/mL lysozyme, 100 mM NaCl, 5 mM imidazole, 3 mM β-mercaptoethanol (BME) and 10 % glycerol)

• HisPur^™ Ni-NTA Resin (Thermo)

• Washing buffer (25 mM Tris-HCl, pH 8.0, 100 mM NaCl, 50 mM imidazole)

• Elution buffer (25 mM Tris-HCl, pH 8.0, 100 mM NaCl, 300 mM imidazole)

• Storage buffer (25 mM Tris-HCl, pH 8.0, 25 mM NaCl, 3 mM βME, and 10 % glycerol)

2.2.3. Protocol

1. Transform the verified pET28a-TxtEBM3R constructs (50 to 100 ng) into 50 μL E. coli BL21 (DE3)-GOLD (Agilent) competent cells for protein expression following the heat shock method described in Section 2.1.

2. Plate 100 μL of transformed cells onto an LB agar plate containing 50 μg/mL kanamycin and incubate the plate at 37 °C overnight.

3. Inoculate one colony from the plate in 3 mL LB containing 50 μg/mL kanamycin and culture it at 37°C, 250 rpm overnight (Note 1).

4. Inoculate the overnight culture at 1:1000 in 1 L TB medium supplemented with 50 μg/mL kanamycin and 1 X trace metal solution in a 2-L flask (Note 2). Put the flask at 37°C, 250 rpm until OD₆₀₀ reaches about 0.5, which takes about 2 hours.

5. Cool the flask on ice for 15 min and add 0.25 mM 5-aminolevulinic acid and 0.1 mM IPTG (final concentration) to induce the protein expression (Note 3). Grow the bacteria culture at 16 °C, 250 rpm for 16 hours.

6. Collect the cell pellets by centrifugation (5,000 g, 4 °C, 15 min) and discard the supernatant.

7. Resuspend cell pellets in suitable volumes of lysis buffer (typically, cell biomass (g): lysis buffer (mL) = 1:4, Note 4).

8. Sonicate the cell suspension on ice for 3 min at 30% amplitude, 5 sec on and 10 sec off (Note 5).

9. Centrifuge the sonicated mixture at 35,000 × g, 4 °C for 30 min and carefully collect the clear supernatants while avoiding solid debris (Note 6).

10. Transfer 1 to 2 mL of the nickel-sepharose resin to a microcentrifuge tube and carefully remove the supernatant by pipetting after centrifugation at 10,000 × g for 1 min. Add 1 mL of milli-Q grade water to resuspend the resin. Centrifuge the resin solution at 10,000 × g for 1 min and remove the supernatant. Repeat the washing two more times.

11. Transfer the washed resin in 5 to 10 mL of lysis buffer in a 50-mL centrifuge tube and incubate the resin solution at 4 °C in an orbital rotator for 10 to 30 min. Discard the supernatant after centrifugation at 5,000 × g, 4 °C for 3 min.

12. Incubate the protein supernatants with equilibrated Ni-NTA agarose resin in an orbital rotator at 4 °C for 2 hours (Note 7).

13. Transfer the sample into a gravity flow column and let the resin naturally precipitate for 2 min. Drain the supernatant and then wash the resin with at least 30 volumes of washing buffer (Note 8).

14. Add 0.5 mL of elution buffer to the column and incubate them for 1 min before draining and collecting the elution solution. Repeat this step 6 times or until the red color on the resin disappears (Note 9).

15. Analyze 1 to 2 μg of each fraction by SDS-PAGE to identify those with high concentration and purity.

16. Combine all desired elution fractions and concentrate it to 2.5 mL or less if needed.

17. Desalt the elution solution into the storage buffer using a PD-10 column at 4 °C according to the manufacturer’s protocol.

18. Determine protein concentration based on nanodrop analysis, and concentrate the desalted protein solution to 5 to 10 mg/mL. Prepare aliquots of 20 to 100 μL and store the aliquots at - 80 °C until use (Note 10).

2.2.4. Notes

1. The colony can be further verified by colony PCR or the digestion of the construct isolated from the colony culture.

2. Make sure that the trace metal stock solution is freshly prepared or less than 3 months when it is stored in a refrigerator.

3. The concentrations of both 5-aminolevulinic acid and IPTG can be further optimized.

4. The cell pellets can be stored at −80 °C for up to 3 months before cell lysis.

5. To facilitate the cell lysis, 0.2 mg/mL lysozyme and 20 μg/mL DNase can be included in the lysis buffer. After the resuspension, the solution is incubated at 4 °C for 30 min. Depending on the sonication equipment, the sonication amplitude and processing time can also be optimized to effectively release the soluble protein while avoiding excessive heating of the sample.

6. Make sure that the lysed cells, supernatant and protein solutions are kept on ice. To maintain the cold temperature, the purification process can be performed in a cold room (4 °C).

7. To improve the purity of recombinant protein, fast protein liquid chromatography (FPLC) can be used. However, FPLC can take a long time if multiple proteins need to be purified.

8. P450-bound resin should be red even when the protein concentration is not high. The imidazole concentration can be adjusted in the washing buffer to avoid eluting the P450 while removing the majority of bound contaminants.

9. The elution buffer may also be prepared with a range of imidazole concentrations, such as 50, 100, 150, 200, and 300 mM. Of note, the pH of the elution buffer with various imidazole concentrations should be adjusted properly.

10. Plan this experiment ahead of time. The protein purification and desalting process should be completed on the same day upon cell lysis.

3. Spectral analysis of TxtE fusion variants

3.1. Determine the concentration of properly folded enzymes

An enzyme should be appropriately folded to execute its catalytic activity. All P450 enzymes are characterized by the presence of a heme cofactor, which allows the spectral analysis of properly folded enzymes. The ferrous CO vs ferrous difference spectrum is the main technique for measuring the folded P450 (Guengerich et al., 2009). Only the reduced ferrous of the heme binds with carbon monoxide (CO). This complexation shifts the UV absorbance of the enzyme from 420 nm to 450 nm, which allows measurement of the absorbance difference. With the help of the known extinction coefficient (91,000 M⁻¹ cm⁻¹ at 450 nm) (Omura & Sato, 1962, 1964), the absorbance difference at 450 nm and 490 nm gives the active enzyme concentration in a P450 solution following the equation of (ΔA450 − ΔA490)/0.091 = nmol of P450 per mL. The absorbance spectra (400–600 nm) of TxtE chimeras are recorded with a Shimadzu UV2700 dual beam UV-Vis spectrophotometer. CO-reduced difference spectra of all P450s are created by subtracting the CO binding spectra from the reduced spectra.

3.1.1. Equipment

• Shimadzu UV2700 dual beam UV-Vis spectrophotometer

• Plastic cuvettes,1 mL capacity, 1 cm length

3.1.2. Materials and reagents

• Purified TxtEBM3R chimeras.

• Tris-HCl buffer (25 mM, pH 8.0).

• Carbon monoxide (Airgas).

• Freshly prepared sodium dithionite solution (0.5 M) in Tris-HCl buffer (25 mM, pH 8.0).

3.1.3. Protocol

1. Dilute the TxtEBM3R solution in Tris-HCl buffer (25 mM, pH 8.0) to prepare a 1.5-mL solution in a 15-mL culture tube (Note 1).

2. Transfer the prepared P450 solution into a 1 mL cuvette and prepare a reference cuvette with 1 mL of Tris-HCl buffer (25 mM, pH 8.0).

3. Record the absorbance spectra of one TxtEBM3R chimera in Tris-HCl buffer (25 mM, pH 8.0) between 400 and 600 nm.

4. Pipette the P450 solution from the cuvette back to the 15-mL culture tube.

5. Attach a 200-μL or 1-mL pipette tip to a flexible tube that is further attached to a two-stage regulator equipped on the CO tank (Airgas, Note 2).

6. Put the end of the pipette tip close to the bottom of the culture tube, and slowly bubble CO gas through the P450 solution for about 1 min (Note 3).

7. Pipette 1 mL of CO-saturated P450 solution to a new 1-mL cuvette and record the spectra between 400 and 600 nm (Note 4).

8. Freshly prepare 0.5 M sodium dithionite solution by adding 87 mg sodium dithionite into 1 mL Milli-Q water (Note 5). Immediately add 30 μL of sodium dithionite solution to the CO-saturated P450 solution in the cuvette and mix the solution well by gently pipetting to reduce the ferric heme. Immediately record the reduced spectra between 400 and 600 nm (Note 6).

9. Generate the CO-reduced difference spectra of all enzymes by subtracting the CO binding spectra from the reduced spectra in Excel (Note 7).

10. Calculate the properly folded enzyme concentration by using the following equation (Note 8):

    $$(\mathrm{\Delta }\mathrm{A}450-\mathrm{\Delta }\mathrm{A}490)/0.091=\mathrm{n}\mathrm{m}\mathrm{o}\mathrm{l}\mathrm{o}\mathrm{f}\mathrm{P}450\mathrm{p}\mathrm{e}\mathrm{r}\mathrm{m}\mathrm{L}$$

3.1.4. Notes

1. The final P450 concentration is typically around 1 μM to give a reliable absorbance reading. A relatively large tube is used to facilitate CO bubbling.

2. CO is very toxic, and the operation should be performed in a well-ventilated fume hood.

3. The flow rate of CO is tuned to be about 1 bubble per second for about 1 minute.

4. The CO bubbling step can generate some bubbles on the top of the solution in the tube, but generally, more than 1 mL of the protein solution is still available.

5. Sodium dithionite (Na₂S₂O₄) solution must be prepared freshly. In addition, it is acceptable to directly add about 1 to 2 mg of sodium dithionite to the P450 solution cuvette.

6. The spectra can be taken a couple of times.

7. To determine differential spectra, the data of each spectrum are separately imported from Shimadzu software to Excel.

8. The dilution fold should be considered when calculating the protein stock concentration.

3.2. Determine the substrate binding affinity

The strength of the interactions between ligand and protein can be determined as the substrate binding affinities. An enzyme with a higher affinity binds its substrate more strongly than that with a lower affinity, which sometimes suggests a higher catalytic activity. In the resting form, the heme iron of P450 is axially coordinated by the cysteine thiolate and an H₂O molecule. Substrate binding displaces the H₂O, which converts the heme iron from a low-spin to a high-spin form. This conversion is reflected in the optical absorbance spectrum of the P450 solution as its Soret band for a high spin at around 390 nm is increased while that for a low spin at around 417 nm is decreased (Luthra et al., 2011). Importantly, the presence of Type I spectral changes after the addition of putative substrates to a given cytochrome P450 provides a crude means to estimate the ability of the enzyme to metabolize this compound. The spectral changes of the P450 solution after adding serial substrate concentrations also can be used to determine the substrate binding affinities (${\mathrm{K}}_{\mathrm{d}}$) by using the equation of $\mathrm{\Delta }\mathrm{A}=\mathrm{\Delta }{\mathrm{A}}_{\mathrm{m}\mathrm{a}\mathrm{x}}\bullet \left[\mathrm{L}\right]/\left({\mathrm{K}}_{\mathrm{d}}+\left[\mathrm{L}\right]\right)$.

3.2.1. Equipment

• Shimadzu UV2700 dual beam UV-Vis spectrophotometer

• Plastic cuvettes, 1 mL capacity.

3.2.2. Materials and reagents

• Purified TxtEBM3R chimeras.

• Stock solutions of l-Trp and its analogs dissolved in DMSO (20 mM).

• Tris buffer (25 mM, pH 8.0).

3.2.3. Protocol

1. Prepare 1 mL of 1.5 μM TxtEBM3R solution by diluting a proper volume of the TxtEBM3R stock solution in 25 mM Tris buffer (pH 8.0). Pipette the mixed solution into a 1 mL cuvette.

2. Pipette 1 mL of 25 mM Tris buffer (pH 8.0) to the reference cuvette.

3. Set Shimadzu UV2700 dual beam UV-Vis spectrophotometer with the absorbance range from 300 to 500 nm (Note 1).

4. Place both the sample cuvette and the reference cuvette in the spectrophotometer.

5. Measure the UV absorbance spectrum of the P450 sample and record the data file.

6. Add 1 μl of the substrate stock solution to the sample cuvette and mix it well by gently pipetting (Note 2). Repeat the spectrum recording with the same wavelength range.

7. Repeat Step 6 by nine more times (Note 3).

8. Repeat Steps 1 to 7 two more times.

9. Determine the ΔA value by subtracting the absorbance at 420 nm from that at 390 nm at each substrate concentration (Note 4).

10. Use the following formula to determine the substrate binding affinities:

    $$\mathrm{\Delta }\mathrm{A}={\mathrm{\Delta }}_{\mathrm{A}\mathrm{m}\mathrm{a}\mathrm{x}}•\left[\mathrm{L}\right]/\left({\mathrm{K}}_{\mathrm{d}}+\left[\mathrm{L}\right]\right)$$

    ($\mathrm{\Delta }\mathrm{A}$ = Changes of absorbance, $\left[\mathrm{L}\right]$ = Ligand/substrate concentration, ${\mathrm{K}}_{\mathrm{d}}$ = Dissociation constant, $\mathrm{\Delta }{\mathrm{A}}_{\mathrm{m}\mathrm{a}\mathrm{x}}$ = Maximal change of absorbance)

11. The mentioned experiment yields a ${\mathrm{K}}_{\mathrm{d}}$ value of 17 (± 1) μM for the binding between l-Trp and TxtEBM3R (TB14).

3.2.4. Notes

1. The wavelength range can be set up from 350 to 500 nm.

2. Typically, a 1 mL pipette tip is used in gently mixing. Avoid the formation of air bubbles.

3. The organic solvent concentration is limited to up to 1 %. If needed, a higher concentration of stock solution can be prepared. In addition, the experiment can be stopped earlier if no further spectral changes are observed.

4. Three sets of data are analyzed by GraphPad Prism 4.

4. Evaluation of TxtEBM3R chimera nitration activity

Similar to other Class I P450s, TxtE requires redox partners for electron transfer, typically Fdr and Fer. The electron transfer process involves several steps: Fdr first receives two electrons from a reduced agent, often NADPH. Reduced Fdr then transfers one of two received electrons to the [2Fe-2S] containing Fer each time. Reduced Fer further transfers one electron to the TxtE heme for activating the bound dioxygen. The electron transfer is widely considered the rate-limiting step of the P450 reaction (Guengerich, 2002), and its efficiency is influenced by many factors, particularly the domain-domain interactions, redox potentials and distance between redox centers (W. Zhang et al., 2018). In this regard, many efforts have been devoted to improving the catalytic efficiency of P450s by creating self-sufficient chimeras through the fusion of the heme and reductase domains. Furthermore, the availability of Cryo-EM structures of two naturally available self-sufficient P450s P450BM3 (Su et al., 2020) and CYP116B46 (L. Zhang et al., 2020) can further support the engineering efforts. In addition, the coupling efficiency is a parameter to characterize the catalytic efficiency of different P450s, which quantitates the number of electrons donated from the reducing agent NAD(P)H actually used to transform a bound substrate. In this section, we will introduce basic procedures used to evaluate the catalytic activity of TxtEBM3R chimeras and determine their coupling efficiency and total turnover number (TTN). The nitrated products are detected and quantified using HPLC.

4.1. Nitration activity of TxtEBM3Rs

In this sub-section, we test the nitration activity of self-sufficient TxtEBM3R chimeras in vitro. TxtE coupled with spinach Fer and Fdr serves as the control. In addition to dioxygen, the nitration reaction requires NO as the other cosubstrate, which is donated from NOC-5. Except for the coupling efficiency study, a glucose dehydrogenase-based system is included to regenerate NADPH for the enzyme reaction. To quantify the reaction turnover, we analyze the reaction mixture by HPLC and determine the concentration of products based on the established standard curve. Additionally, a standard curve of NADPH is generated to quantify the consumption of NADPH in the reactions. Through these analyses, we determine the coupling efficiency and total turnover number (TTN) of TxtEBM3R chimeras.

4.1.1. Equipment

• Eppendorf Thermomixer

• Thermo Scientific micro 17R microcentrifuge

• Shimadzu Prominence UHPLC system (Kyoto, Japan) with a PDA detector

• Agilent Poroshell 120 EC-C18 column (2.7 μm, 3.0 × 50 mm)

4.1.2. Materials and reagents

• Tris-HCl buffer (1 M, pH 8.0)

• l-Trp (Sigma-Aldrich)

• NADPH (Cayman Chemical)

• NADP⁺ (Cayman Chemical)

• Glucose (Sigma-Aldrich)

• NOC-5 (EMD Millipore)

• Purified TxtE enzyme

• Purified TxtEBM3R chimeras

• Spinach Fer and Fdr (Sigma Aldrich)

• Methanol

4.1.3. Protocol

1. Take one protein aliquot from the −80°C freezer and keep it on ice until completely thawed.

2. Set up 100-μL enzyme reactions in a 1.7-mL microcentrifuge tube containing 100 mM Tris-Cl (pH 8.0), 0.5 mM l-Trp, NADPH regeneration system (1 mM NADP⁺, 20 mM glucose and ~10 units/mL self-prepared glucose dehydrogenase, Note 1) or 2 mM NADPH (Note 2), and 1 mM NOC-5 (Note 3). Briefly centrifuge the mixture.

3. Initiate the reaction by adding and mixing the TxtEBM3R solution to reach a final concentration of 1.5 μM (Note 4). Gently pipette the reaction mixture, followed by a brief centrifugation.

4. Prepare the positive control by adding 1.5 uM TxtE, 0.43 μM spinach Fer and 0.33 μM Fdr to the above mixture without TxtEBM3R.

5. Incubate the reactions at 20 °C (Note 5), 300 rpm using a thermomixer (Eppendorf).

6. Add 200 μL methanol to quench the reactions after 30 minutes (Note 4). Vortex the mixtures for 15 s.

7. Centrifuge the reaction mixtures at 20 000 × g for 15 min. Inject 10 uL of each sample for the HPLC analysis.

8. Analytes are separated with solvent A (water with 0.1 % formic acid) and solvent B (acetonitrile with 0.1 % formic acid) on an Agilent Poroshell 120 EC-C18 column (2.7 μm, 3.0 × 50 mm) kept at 40 °C and are detected at 211 nm. The column is washed at 1.5 mL/min with 1 % solvent B for 0.5 min, followed by a linear gradient of 1–20 % solvent B in 2 min and then another linear gradient of 20–99 % solvent B in 0.5 min. After 0.5 min, the column is re-equilibrated with 1 % solvent B for 2 min. Under this condition, l-Trp and 4-NO₂-l-Trp are eluted at 1.51 and 1.93 min, respectively.

9. Inject serial concentrations of 4-NO₂-l-Trp for the HPLC analysis under the above conditions. Each concentration is repeated three times. The standard 4-NO₂-l-Trp is synthesized in a large-scale enzymatic reaction (Note 6). Establish a standard curve of 4-NO₂-l-Trp by determining the areas under the peak of different compound concentrations in the HPLC traces.

10. Quantify the nitrated product in the enzyme reactions by analyzing the area under the peak in the HPLC traces.

11. Establish a standard curve of NADPH by measuring the absorbance of various concentrations at 340 nm using the Shimadzu UV2700 dual beam UV-Vis spectrophotometer. Each concentration is repeated three times.

12. To calculate the coupling efficiency, quantify the consumption of NADPH in the same enzyme reactions by detecting the absorbance change at 340 nm using the Shimadzu UV2700 dual beam UV-Vis spectrophotometer (Note 7).

13. Calculate the coupling efficiency and TTN for each TxtEBM3R chimera (Table 5), using the following equations:

    $$\mathrm{C}\mathrm{o}\mathrm{u}\mathrm{p}\mathrm{l}\mathrm{i}\mathrm{n}\mathrm{g}\mathrm{e}\mathrm{f}\mathrm{f}\mathrm{i}\mathrm{c}\mathrm{i}\mathrm{e}\mathrm{n}\mathrm{c}\mathrm{y}\left(\mathrm{\%}\right)=\left(\mathrm{P}\mathrm{r}\mathrm{o}\mathrm{d}\mathrm{u}\mathrm{c}\mathrm{t}\right(\mathrm{n}\mathrm{m}\mathrm{o}\mathrm{l})/\mathrm{C}\mathrm{o}\mathrm{n}\mathrm{s}\mathrm{u}\mathrm{m}\mathrm{e}\mathrm{d}\mathrm{N}\mathrm{A}\mathrm{D}\mathrm{P}\mathrm{H}(\mathrm{n}\mathrm{m}\mathrm{o}\mathrm{l}\left)\right)\times 100$$

    $$\mathrm{T}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l}\mathrm{T}\mathrm{u}\mathrm{r}\mathrm{n}\mathrm{o}\mathrm{v}\mathrm{e}\mathrm{r}\mathrm{N}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r}\left(\mathrm{T}\mathrm{T}\mathrm{N}\right)=\mathrm{P}\mathrm{r}\mathrm{o}\mathrm{d}\mathrm{u}\mathrm{c}\mathrm{t}\left(\mathrm{n}\mathrm{m}\mathrm{o}\mathrm{l}\right)/\mathrm{P}450\left(\mathrm{n}\mathrm{m}\mathrm{o}\mathrm{l}\right)$$

Table 5.

Coupling efficiency and TTN of select TxtEBM3R chimeras

Chimeras	Coupling (%)	TTN
TxtE	2.4 ± 0.3	378 ± 17
TB11	5.2 ± 0.5	535 ± 28
TB12	1.8 ± 0.2	332 ± 40
TB13	2.2 ± 0.3	342 ± 29
TB14	5.3 ± 0.5	707 ± 16
TB15	3.9 ± 0.4	658 ± 33
TB16	2.7 ± 0.2	351 ± 39
TB17	2.1 ± 0.3	348 ± 24
TB19	2.4 ± 0.5	464 ± 21
TB22	2.4 ± 0.5	408 ± 32
TB24	2.3 ± 0.1	381 ± 15
TB27	2.0 ± 0.6	548 ± 17

4.1.4. Notes

1. The glucose dehydrogenase was prepared by heterologous expression in E. coli. We cloned the codon-optimized gene of glucose 1-dehydrogenase from Bacillus megaterium into a pET22b vector for the expression (Jiang et al., 2018).

2. It is recommended to use freshly prepared NADP⁺ and NADPH solutions. The NADPH re-generation system can produce one NADPH from one NADP⁺ while generating one H⁺. Sufficient buffer strength is needed to keep the reaction pH stable.

3. NOC-5 is a highly reactive molecule and should be stored and handled according to the manufacturer’s instruction. Its half-life in PBS (pH 7.4) is about 90 minutes at 22°C.

4. The enzyme concentration (e.g., 0.5 to 1.5 μM) and reaction time (15 min to 120 min) can be adjusted according to experimental needs.

5. A relatively low temperature is used to avoid releasing NO from NOC-5 too quickly.

6. A sufficient amount of 4-NO₂-l-Trp is needed to ensure the accurate concentration of its stock solution. If needed, other commercially available nitroaromatics such as 3-NO₂-l-Tyr can also be used to generate a standard curve for qualifying the level of 4-NO₂-l-Trp in the reactions.

7. A control reaction without substrate l-Trp is used to determine the automatic oxidation rate of NADPH under the same conditions.

4.2. Characterization of the substrate scope of TB14

Among all the TxtEBM3R chimeras that we create, TB14 stands out due to its highest coupling efficiency and TTN (Zuo et al., 2017) (Table 5). To further assess its biocatalytic application, TB14 is evaluated with a library of l-Trp analogs that carry modifications on the amine, carboxylate, or indole moieties of l-Trp (Zuo et al., 2017). Compared with TxtE coupled with Fdr and Fer, TB14 demonstrates a higher activity towards seven Trp analogs that carry substitutions on the C4, C5, C6, and C7 positions of the indole ring (except for 4-F-dl-Trp, Figure 5). Furthermore, the same as TxtE, TB14 is inactive toward d-Trp (Zuo et al., 2016, 2017). Very interestingly, TB14 can nitrate both C5 and C7 positions of 4-Me-l-Trp indole, whose structures are elucidated via NMR analysis. This result presents an example of substrate-tuned regioselectivity.

Figure 5.

Selected l-Trp analogs used to evaluate the substrate scope of TB14.

4.2.1. Equipment

• Thermomixer (Eppendorf)

• FreeZone benchtop freeze dryer

• SHIMADZU Prominence UPLC system with a PDA detector

• Linear Ion Trap Quadrupole LC/MS/MS mass spectrometer (Applied Biosystem)

• Agilent Poroshell 120 EC-C18 column (2.7 μm, 3.0 × 50 mm)

• YMC-Pack Ph column (5 μm, 4.6 × 250 mm)

• Thermo Scientific Q Exactive Focus mass spectrometer with a Dionex Ultimate RSLC 3000 RSLC system, equipped with the H-ESI II probe on an Ion Max API Source

• Bruker NMR 500M (¹H and ¹³C NMR)

4.2.2. Materials and reagents

• Tris-HCl buffer (1 M, pH 8.0)

• l-Trp analogs (TCI America, Sigma-Aldrich)

• NADP⁺ (Cayman Chemical)

• Glucose (Sigma-Aldrich)

• NOC-5 (EMD Millipore)

• Purified TxtE enzyme

• Purified TB14

• DCl

• D₂O

4.2.3. Protocol

1. Determine the binding affinity between each substrate and TB14 following protocols described in Section 3.2 (Note 1).

2. Prepare the TB14 reactions using different Trp analogs as substrates according to the protocol in Section 4.1 (Note 2).

3. Inject 10 μL of each sample for LC-MS analysis to detect nitrated products. HPLC conditions are described in Section 4.1. MS analysis is performed on Applied Biosystem 3200 Linear Ion Trap Quadrupole LC/MS/MS mass spectrometer with conditions of Curtain gas at 30 psi, ion spray voltage at 5500 V, temperature at 750 °C, ion source gas 1 at 60 psi, and ion source gas 2 at 70 psi (Note 3).

4. Identify the product peak based on the calculated m/z value of the parent ion.

5. Determine the area under the peak of nitrated products in the LC traces and calculate their concentrations based on the standard curve of 4-NO₂-l-Trp (Section 4.1, Note 4).

6. Calculate the conversion ratio of each substrate by TB14 using the following equation (Note 5):

   $$\mathrm{C}\mathrm{o}\mathrm{n}\mathrm{v}\mathrm{e}\mathrm{r}\mathrm{s}\mathrm{i}\mathrm{o}\mathrm{n}\mathrm{r}\mathrm{a}\mathrm{t}\mathrm{i}\mathrm{o}\left(\mathrm{\%}\right)=\left(\right(\mathrm{P}\mathrm{r}\mathrm{o}\mathrm{d}\mathrm{u}\mathrm{c}\mathrm{t}\mathrm{i}\mathrm{n}\mathrm{n}\mathrm{m}\mathrm{o}\mathrm{l})/(\mathrm{o}\mathrm{r}\mathrm{i}\mathrm{g}\mathrm{i}\mathrm{n}\mathrm{a}\mathrm{l}\mathrm{s}\mathrm{u}\mathrm{b}\mathrm{s}\mathrm{t}\mathrm{r}\mathrm{a}\mathrm{t}\mathrm{e}\mathrm{i}\mathrm{n}\mathrm{n}\mathrm{m}\mathrm{o}\mathrm{l}\left)\right)\times 100$$

7. Prepare a large-scale TB14 reaction with 4-Me-dl-Trp as substrate.

   1. Add 18 μM TB14 into a 10-mL reaction mixture in a 200-mL flask containing 1.5 mM 4-Me-dl-Trp, 3 mM NADP⁺, 30 mM glucose, ∼30 units/mL self-prepared glucose dehydrogenase, 3 mM NOC-5 in 100 mM Tris-HCl buffer (pH 8.0).

   2. Completely wrap the flask with aluminum foil and incubate the reaction at 20°C, 250 rpm overnight.

   3. Terminate the reaction with 20 mL methanol or acidification to pH 1.0 with 6 M HCl (Note 6). Mix well.

   4. Transfer the mixture into a centrifuge tube and pellet any precipitates by centrifugation at 14,000 rpm for 30 min.

   5. Collect the supernatant, remove the organic solvent in vacuo and then lyophilize the aqueous solution.

8. Re-dissolve the dried sample in 1 mL methanol (Note 7) for semi-preparative HPLC isolation to obtain a sufficient amount of nitrated products for elucidating the regioselectivity of TB14 in the nitration reaction.

   1. Solvent A is 80% triethylammonium acetate (0.05 M, pH 3.0) and 20% water and solvent B is acetonitrile with 0.1% formic acid.

   2. Analytes are separated on a YMC-Pack Ph column (5 μm, 4.6 × 250 mm) and the nitrated products are detected at 211 nm and 380 nm using a PDA detector (Note 8).

   3. The column is first equilibrated with 20 % solvent B for 20 min at 3 mL/min. Methanolic solution (0.5 mL) is then injected into the HPLC system for the separation with 20% solvent B for 3 minutes, followed by a linear gradient from 20% to 54% solvent B over 3 minutes and then another linear gradient from 54% to 77% solvent B over 6 minutes. Clean the column with 99% solvent B for 1 minute, which is then re-equilibrated with 20% solvent B for 1 minute.

9. Collect fractions containing nitrated products based on the maximal wavelengths and retention times. Concentrate collected fractions using rotary evaporation or freeze-drying (Note 9). Weigh dried products to determine the isolation yield.

10. Redissolve a tiny amount of dried products in 20 μL methanol and perform LC-MS as described above to validate the identity and purity of the isolated product.

11. Determine the exact molecular masses of isolated products by high-resolution mass spectrometry (HRMS) analysis (Note 10).

12. Dissolve the dried product in 100 mM DCl in D₂O and record ¹H and ¹³C nuclear magnetic resonance (NMR) spectra (Note 11).

13. Perform 2D NMR experiments, such as correlation spectroscopy (COSY), heteronuclear single-quantum correlation (HSQC), and heteronuclear multiple-bond correlation (HMBC), to further confirm the connectivity and interactions between different atoms in the molecule (Note 12).

4.2.4. Notes

1. Different concentrations of stock solutions may be prepared to provide a large range of substrate concentrations in the binding analysis. Three independent replicates are required for each substrate.

2. To achieve an appropriate conversion ratio of different substrates, the TB14 reaction may be terminated at different time points.

3. MS conditions may be further optimized to achieve a higher ionization efficiency for different products.

4. The standard curve of 4-NO₂-l-Trp is used to calculate the concentration of nitrated Trp analogs as the majority of functional groups are shared.

5. The TB14 reaction may run a longer time for a poor substrate.

6. Prior to the reaction termination, 100 μL of the reaction mixture can be taken out to assess the conversion ratio by HPLC analysis. Accordingly, the reaction could be incubated for a longer time, or more TB14 can be added.

7. Avoid using too much methanol to dissolve the dried sample.

8. A small volume of the dissolved sample should first be injected into the HPLC to set up and validate the HPLC conditions.

9. The putative nitrated compound should be isolated as a light beige solid.

10. HRMS analysis can be performed in core facilities.

11. For the NMR analysis, we recommend isolating at least 0.5 mg sample with over 95% purity. Depending on the sample amount, NMR recording time should be adjusted to obtain high-quality spectra.

12. To determine the absolute stereochemistry of the nitrated product generated from the racemic substrate, Marfey’s reagent can be used for chiral amino acid analysis (Bhushan & Brückner, 2004).

Summary and conclusions

Biocatalysis has been explored for a number of chemical reactions and impacted many fields. However, limited progress has been made in aromatic nitration. TxtE can directly nitrate the indole ring of l-Trp using dioxygen and NO during the thaxtomin biosynthesis. The distinguishing reactivity of TxtE renders it an attractive candidate for biocatalysis use. To further assist the application of this Class I P450, this chapter demonstrates the development and characterization of self-sufficient TxtEBM3R chimeras (Zuo et al., 2016, 2017), improving biocatalyst preparation and reducing cost.

A total of fifteen chimeras with different lengths of linkers between the TxtE and BM3R domains were created (Zuo et al., 2017). This chapter provides detailed procedures for the construction of the expression vectors of these fusion enzymes. We also describe procedures for protein purification and spectral analysis to detect the properly folded P450 enzymes. Substrate binding and nitration activity studies reveal TB14 to be the most active TxtEBM3R chimera, which shows a higher coupling efficiency and TTN than TxtE supplemented with spinach Fer and Fdr in nitrating l-Trp. In addition, TB14 demonstrates considerable substrate flexibility, particularly towards small modifications on the indole ring. The high nitration efficiency and substrate flexibility of TB14 are also observed when Trp analogs are fed to engineered TB14-expressing E. coli cells (Zuo & Ding, 2019). These studies represent the first practice in developing biocatalytic nitration approaches and set a basis for the use of P450 TxtE to produce valuable nitroaromatic compounds. The protocols provided in this chapter are useful to characterize the reactions of underexplored P450s and generate other Class I P450 chimeras that are fused with a reductase domain with different linker lengths.