Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2024 Jan 31;92(3):e00494-23. doi: 10.1128/iai.00494-23

Caffeic acid activates mitochondrial UPR to resist pathogen infection in Caenorhabditis elegans via the transcription factor ATFS-1

Yi Xiao 1,2,3,✉,#, Cao-an Hong 1,3,4,#, Fang Liu 1,2,#, Dandan Shi 1, Xinting Zhu 1,2, Changyan Yu 1,2,3, Nian Jiang 1,2,3, Sanhua Li 1,2,3, Yun Liu 1,2,4,
Editor: De'Broski R Herbert5
PMCID: PMC10929418  PMID: 38294242

ABSTRACT

Mitochondria play roles in the resistance of Caenorhabditis elegans against pathogenic bacteria by regulating mitochondrial unfolded protein response (UPRmt). Caffeic acid (CA) (3,4-dihydroxy cinnamic acid) is a major phenolic compound present in several plant species, which exhibits biological activities such as antioxidant, anti-fibrosis, anti-inflammatory, and anti-tumor properties. However, whether caffeic acid influences the innate immune response and the underlying molecular mechanisms remains unknown. In this study, we find that 20 µM caffeic acid enhances innate immunity to resist the Gram-negative pathogen Pseudomonas aeruginosa infection in C. elegans. Meanwhile, caffeic acid also inhibits the growth of pathogenic bacteria. Furthermore, caffeic acid promotes host immune response by reducing the bacterial burden in the intestine. Through genetic screening in C. elegans, we find that caffeic acid promotes innate immunity via the transcription factor ATFS-1. In addition, caffeic acid activates the UPRmt and immune response genes for innate immune response through ATFS-1. Our work suggests that caffeic acid has the potential to protect patients from pathogen infection.

KEYWORDS: caffeic acid, innate immunity, mitochondrial unfolded protein response (UPRmt), Caenorhabditis elegans

INTRODUCTION

The innate immune system represents the first line of our defense system against invading microorganisms, and it is evolutionarily conserved from worms to mammals (1, 2). During infection, the innate immune system is activated, resulting in antimicrobial responses to invading pathogens (1, 36). Caenorhabditis elegans has been developed as a valuable genetic model to study organismal innate immunity against pathogenic microbes. Through this tractable model, researchers reveal several signaling pathways that have important roles in controlling the innate immunity, such as the PMK-1/p38 MAPK pathway (7, 8), the DAF-2/DAF-16 pathway (9), the mitochondrial unfolded protein response (UPRmt) ATFS-1 (10), and the endoplasmic reticulum unfolded protein response XBP-1 (11).

Plant-derived natural compounds are considered pharmacologically active compounds, and their application in the treatment of infectious diseases is increasingly growing (12, 13). When we drink coffee or red wine, we are ingesting a molecule that has a variety of interesting effects on our health: a natural polyphenol compound called caffeic acid. Caffeic acid (3,4-dihydroxy cinnamic acid) is a major phenolic compound present in several plant species such as fruits, wine, coffee, olive oil, and legumes (14, 15). It possesses a wide variety of biological activities, including anti-oxidative (16), anti-fibrosis (17), anti-inflammatory (18), anti-tumor (19), and anti-neurodegenerative diseases like Alzheimer’s or Parkinson’s (20, 21). However, the molecular mechanisms by which it extends innate immunity have never been examined.

Mitochondria play key roles in antibacterial innate immunity by regulating UPRmt, ROS production, and mitophagy (10, 2224). In general, UPRmt sends signals to the nucleus through the mitochondrial peptide exporter HAF-1 and up-regulates transcription factor ATFS-1 (25). A previous study showed that, during pathogen exposure, ATFS-1 induced not only mitochondrial protective genes but also innate immune genes, including a secreted lysozyme and antimicrobial peptides in C. elegans (10). A recent study has reported that mitochondrial chaperone HSP-60 regulates antibacterial innate immunity via p38 MAP kinase signaling (26).

Our study investigated the role of caffeic acid in the host defenses of C. elegans. Via genetic screening, we found that caffeic acid protected the host against pathogen infections through the transcription factor ATFS-1. Furthermore, caffeic acid promoted innate immunity through activation of UPRmt and immune response genes in C. elegans in an ATFS-1-dependent manner. The evolutionary conservation of the UPRmt ATFS-1 suggests that the role of caffeic acid in antibacterial innate immunity is highly conserved from worms to mammals.

RESULTS

Caffeic acid enhances innate immunity in C. elegans

To test whether caffeic acid promotes innate immunity, worms are exposed to the human opportunistic pathogen Pseudomonas aeruginosa (PA14). We find that wild-type (WT) animals treated with caffeic acid (0, 5, 10, and 20 µM) exhibit increased resistance to P. aeruginosa PA14 in a dose-dependent manner (Fig. 1A; Table S1). These results suggest that caffeic acid enhances the innate immunity in C. elegans. Meanwhile, we employ the bacterial growth assay to investigate if caffeine increases host immune responses by inhibiting the growth of pathogenic bacteria. The results show that 20 µM caffeine considerably suppresses P. aeruginosa PA14 to proliferate (Fig. 1B) because clearance of the bacterial load was part of host defense against pathogen infection (27, 28). Next, we test whether caffeic acid affects the bacteria accumulation. Caffeic acid-treated worms reduce the number of bacterial cells in the intestine to that in control animals (Fig. 1C). These results suggest that caffeic acid increases resistance to pathogenic infection.

Fig 1.

Fig 1

Caffeic acid enhances innate immunity in C. elegans. (A) Caffeic acid (CA) promotes innate immune response to P. aeruginosa PA14 compared to WT in a dose-dependent manner (*P < 0.05, log-rank test) (n > 40). See Table S1 for survival data. (B) 20 µM CA significantly inhibits the proliferation of P. aeruginosa PA14 (*P < 0.05, log-rank test). Error bars represent mean ± standard error of the mean (SEM) of three independent biological replicates. (C) 20 µM CA reduces the bacteria burden in WT worms after P. aeruginosa PA14 infection (n ≥ 10). These results are mean ± SEM of three independent experiments (*P < 0.05, unpaired t-test).

Caffeic acid promotes innate immunity through UPRmt ATFS-1

To investigate the molecular mechanisms by which caffeic acid confers protection against pathogen infection, we screen several signaling pathways that are involved in innate immunity in C. elegans, such as the p38 MAPK/PMK-1 pathway (8), the DAF-2/DAF-16 signaling pathway (9), the UPRmt ATFS-1 (10), and the endoplasmic reticulum unfolded protein response XBP-1 (11). We find that 20 µM caffeic acid increases the survival rates of pmk-1(km25), daf-2(e1370), and xbp-1(zc12) mutants after P. aeruginosa PA14 infection (Fig. 2A through D; Table S1). However, 20 µM caffeic acid fails to enhance the resistance to P. aeruginosa PA14 infection in atfs-1(gk3094) mutants, compared to WT animals (Fig. 2E; Table S1). These results suggest that caffeic acid enhances innate immunity in C. elegans via the UPRmt ATFS-1.

Fig 2.

Fig 2

Caffeic acid promotes innate immunity through UPRmt ATFS-1. (A–E) 20 µM CA enhances resistance to P. aeruginosa PA14 in WT (N2) (A), pmk-1(km25) (B), daf-2(e1370) (C), and xbp-1(zc12) (D) mutants, but not in atfs-1(gk3094) (E) mutants (log-rank test) (n > 40). See Table S1 for survival data.

Caffeic acid promotes innate immunity through activation of the UPRmt and immune response genes in C. elegans in an ATFS-1-dependent manner

Next, we ask if caffeic acid treatment induces mitochondrial stress capable of activating the UPRmt. Importantly, caffeic acid treatment leads to an atfs-1-dependent increase in mitochondrial chaperone reporter hsp-6::gfp activation in the intestine (Fig. 3A). Furthermore, quantitative real-time PCR analysis demonstrates that 20 µM caffeic acid increases the mRNA levels of atfs-1 compared with the control (Fig. 3B). To investigate whether caffeic acid activates the transcription factor ATFS-1, we test the cellular translocation of ATFS-1 using transgenic worms that express a functional ATFS-1::GFP fusion protein. We find that 20 µM caffeic acid significantly induces ATFS-1 nuclear localization in the intestine (Fig. 3C). Next, we tested the expression of ATFS-1-targeted immune response genes such as abf-2, lys-2, clec-4, and clec-65 (10). Quantitative real-time PCR analysis indicates that ATFS-1-targeted immune response genes are up-regulated in 20 µM caffeic acid-treated animals compared with the control (Fig. 3D). However, 20 µM caffeic acid fails to increase their expression in the atfs-1(gk3094) mutant worms (Fig. 3D). In conclusion, these findings indicate that caffeic acid promotes innate immunity through activation of the UPRmt and immune response genes in C. elegans in an ATFS-1-dependent manner.

Fig 3.

Fig 3

Caffeic acid promotes innate immunity through activation of the UPRmt and immune response genes in C. elegans in an ATFS-1-dependent manner. (A) Expression of HSP-6p::GFP is up-regulated in WT worms but not in worms subjected to atfs-1(gk3094) mutants, exposed to 20 µM CA. The right panel shows the quantification of fluorescence intensity (n ≥ 30). Scale bars: 50 µm. These results are mean ± SEM of three independent experiments performed in triplicate [*P < 0.05, one-way analysis of variance (ANOVA)]. (B) The mRNA levels of atfs-1 in worms exposed to 20 µM CA. These results are mean ± SEM of three independent experiments performed in triplicate (*P < 0.05, one-way ANOVA). (C) 20 µM CA significantly induces ATFS-1 nuclear localization. The right panel shows the quantification of ATFS-1::GFP (n ≥ 30). These results are mean ± SEM of three independent experiments performed in triplicate (*P < 0.05, unpaired t-test). Scale bars: 50 µm. (D) The mRNA levels of ATFS-1-targeted immune response genes abf-2, lys-2, clec-4, and clec-65 in worms exposed to 20 µM CA. These results are mean ± SEM of three independent experiments performed in triplicate (*P < 0.05, one-way ANOVA).

Intestinal ATFS-1 increases the resistance to pathogen infection after caffeic acid treatment

To determine tissue-specific actions of ATFS-1 in response to P. aeruginosa PA14 infection after caffeic acid treatment, we perform tissue knockdown experiments by using TU3401 strains in neurons (29), NR222 strains in hypodermis (30), NR350 strains in muscles (30), and MGH170 strains in intestine (31). We find that knockdown of atfs-1 in neurons, hypodermis, and muscles, respectively, after caffeic acid treatment promotes host survival during P. aeruginosa PA14 infection (Fig. 4A through C; Table S1). However, RNAi of atfs-1 in the intestine completely abolishes the protection conferred by caffeic acid (Fig. 4D; Table S1). These results indicate that caffeic acid requires the intestinal activity of ATFS-1 to enhance innate immune response.

Fig 4.

Fig 4

Intestinal ATFS-1 increases the resistance to pathogen infection after caffeic acid treatment. Specific knockdown of atfs-1 in neurons (A), hypodermis (B), and muscles (C), respectively, after 20 µM CA treatment promotes host survival during P. aeruginosa PA14 infection. However, RNAi of atfs-1 in the intestine (D) after 20 µM CA treatment does not increase resistance to P. aeruginosa PA14 infection (log-rank test) (n > 40). See Table S1 for survival data. EV (empty vector).

DISCUSSION

With the development of resistance properties against conventional antibiotics and other identified antimicrobial drugs, treatment of microbial infection becomes a challenging task. Accumulating evidence has shown that natural products have become promising agents for pathogen resistance, such as luteolin (32), sanguinarine (33), brevilin A (13), and dioscin (34). Caffeic acid (3,4-dihydroxy cinnamic acid) is a major phenolic compound present in several plant species such as fruits, wine, coffee, olive oil, and legumes (14, 15), which exhibits a wide variety of biological activities, including anti-oxidative (16), anti-fibrosis (17), anti-inflammatory (18), anti-tumor (19), and anti-neurodegenerative diseases like Alzheimer’s or Parkinson’s properties (20, 21). However, the molecular mechanisms by which it enhances innate immunity have never been examined. Here, we find that the preventive application of caffeic acid protects C. elegans against the Gram-negative pathogen P. aeruginosa by reducing the bacterial burden in the intestine. In addition, our results indicate that caffeic acid inhibits the proliferation of Gram-negative pathogen P. aeruginosa. Through genetic screening in C. elegans, we find that caffeic acid promotes innate immunity via the transcription factor ATFS-1. These findings provide an alternative mechanism by which antibiotic action like caffeic acid protects the host from pathogen infection.

UPRmt plays an important role in the resistance of C. elegans against pathogenic bacteria (10, 26). Previous study has shown that P. aeruginosa exposure results in mitochondrial stress capable of activating the UPRmt and increases nuclear accumulation of ATFS-1::GFP in the intestine in C. elegans (10). Furthermore, UPRmt also increases the expression of antimicrobial genes in C. elegans in an ATFS-1-dependent manner and contributes to antibacterial innate immunity (10, 26, 35). Here, our results suggest that caffeic acid promotes innate immunity in C. elegans through activation of the UPRmt and immune response genes in C. elegans in an ATFS-1-dependent manner. Furthermore, caffeic acid activates the transcription factor ATFS-1 in C. elegans to enhance pathogen resistance. Tissue-specific knockdown experiments show that caffeic acid requires the intestinal activity of ATFS-1 to enhance innate immune response. Importantly, increasing evidence indicates that UPRmt plays a key roles in antibacterial innate immunity in mammalian cells (36, 37). The evolutionary conservation of UPRmt suggests that the caffeic acid-induced innate immunity might be universal.

MATERIALS AND METHODS

Chemicals

Caffeic acid was obtained from Sigma Chemical Co. (St. Louis, MO) and dissolved in dimethyl sulfoxide as a stock solution at a 100-mM concentration and was stored in aliquots at −20°C.

Worm strains and cultivation

Worms were maintained and propagated under standard conditions as previously described (38, 39). The following nematode strains were obtained from the Caenorhabditis Genetics Center, which is funded by the National Institutes of Health (NIH) Office of Research Infrastructure Programs (P40 OD010440): N2 Bristol wild type, CB1370 daf-2(e1370), KU25 pmk-1(km25), SJ17 xbp-1(zc12), VC3201 atfs-1(gk3094), OP675 (ATFS-1::GFP), SJ4100 (hsp-6p::GFP), NR222 rde-1(ne219);kzIs9, NR350 rde-1(ne219);kzIs20, and TU3401 [sid-1(pk3321)V;uIs69V] for neuronal specific RNAi. The nematode strain MGH170 for intestinal specific RNAi (sid-1(qt9); Is [vha-6pr::sid-1]; Is [sur-5pr::GFPNLS]) was kindly provided by Dr. Gary Ruvkun (Massachusetts General Hospital, Harvard Medical School, Boston, MA). C. elegans mutants were backcrossed three times into the WT strain (N2) and used in the laboratory.

RNA interference

The strains of Escherichia coli used for RNAi were obtained from the Ahringer library (40). RNAi feeding experiments were performed on synchronized L1 to L2 larvae at 20°C. Briefly, E. coli strain HT115(DE3) expressing dsRNA was grown overnight in LB broth containing 100 µg/mL ampicillin at 37°C and then spread to NGM plates containing 100 µg/mL ampicillin and 5 mM isopropyl 1-thio-β-D-galactopyranoside. The RNAi-expressing bacteria were grown overnight at 25°C. Synchronized L1 to L2 larvae were placed on RNAi plates until they reached maturity at 20°C. Unc-22 RNAi was included as a positive control in all experiments to account for RNAi efficiency.

Quantification of intestinal bacterial loads

Synchronized populations of worms were cultivated on E. coli OP50 at 20°C until the young adult stage. P. aeruginosa/GFP were grown in LB liquid medium containing ampicillin (100 µg/mL) at 37°C overnight and plated onto NGM plates. Worms were then transferred to NGM agar plates (supplemented with or without 20 µM caffeic acid) containing P. aeruginosa/GFP for 48 h at 25°C (2, 27). To eliminate P. aeruginosa/GFP around the surface of worms, worms were transferred to an NGM agar plate seeded with E. coli OP50 for 30 min three times. Ten worms were transferred into 50 µL phosphate-buffered saline (PBS) plus 0.1% Triton and ground. The lysates were serially diluted 10-fold in sterilized water and spread onto LB agar plates/ampicillin at 37°C. After 1 day of incubation at 37°C, colonies of P. aeruginosa/GFP were counted. Five plates were tested per assay, and all experiments were performed three times independently.

Bacterial proliferation assay

Liquid bacterial growth was performed in microtiter plates containing bacterial strain (32) and supplemented with or without 20 µM caffeic acid of LB at pH 7.0. The absorbance (OD 600 nm) was measured every 3 h for an 18-h incubation period with regular shaking at 37°C and 180 rpm. Data analysis was performed on three replicates for each experiment.

Infection assay

E. coli OP50 and P. aeruginosa PA14 were grown overnight in LB broth at 37°C and then spread to NGM plates. All infection assays were performed on NGM agar plates or NGM plates supplemented with or without caffeic acid (0, 5, 10, and 20 µM). Synchronized populations of worms were cultivated on E. coli OP50 at 20°C until the young adult stage. A total of 40–60 worms were transferred to NGM agar plates containing P. aeruginosa PA14 at 25°C. The number of living worms was counted at 12 h intervals. Immobile adult worms unresponsive to touch were scored as dead (33). Three plates were tested per assay, and all experiments were performed three times independently.

Fluorescence microscopy

Synchronized L1 worms of the HSP-6::GFP and ATFS-1::GFP strains were transferred to agar plates supplemented with or without 20 µM caffeic acid. The images were obtained using a Zeiss Axioskop 2 plus fluorescence microscope (Carl Zeiss, Jena, Germany) with a digital camera. Fluorescence intensity was quantified by using the Image J software (NIH). Three plates of about 30 animals per plate were tested per assay, and all experiments were performed three times independently.

Quantitative real-time PCR

Nematodes were synchronized and treated for 1 day with or without 20 µM caffeic acid starting at the L4 larvae stage. Total RNA was extracted from worms with TRIzol Reagent (Invitrogen) as previously described (41). Random-primed cDNAs were generated by reverse transcription of the total RNA samples with SuperScript II (Invitrogen) and qPCR analysis was conducted using SYBR Premix-Ex TagTM (Takara, Dalian, China) on an Applied Biosystems Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). Using pmp-3 for internal control as previously described (41), the following primers were used for this study:

pmp-3 primers:

pmp-3-F: TGGATTGTCATTGGCGTCG

pmp-3-R: GTTGTCGCAGAGTGGTGTTT

atfs-1 primers:

atfs-1-F: TGGTAGCAGTGTTGGACATCC

atfs-1-R: ATGGTGATTGGAAGAGCGGG

abf-2 primers:

abf-2-F: CGTGGCTGCCGACATCGACTT

abf-2-R: ATGCACAACCCCTGAGCCGC

lys-2 primers:

lys-2-F: ATCGACTCGAACCAAGCTGCG

lys-2-R: TCGACAGCATTTCCCATTGAAGCGT

clec-4 primers:

clec-4-F: GAGCGACACTGGTGACTGTG

clec-4-R: CCATCCAGAATAGGTTGGCG

clec-65 primers:

clec-65-F: CCCGGTGGTGACTGTGAATA

clec-65-R: AGCTCATATTGTCGCTGGCA.

Statistics

Data were presented as mean ± SEM. Graphs were generated with GraphPad Prism 7.0 software (GraphPad, San Diego, CA, USA). Statistical analyses for all data except for survival assays were carried out using Student’s t-test (unpaired, two-tailed) or analysis of variance after testing for equal distribution of the data and equal variances within the data set. Survival data were analyzed by using the log-rank (Mantel-Cox) test. P < 0.05 was considered significant.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (32160037) and the Innovation and Entrepreneurship Project for College Students (ZYDC2021013).

Y.X. and Y.L. conceptualized and designed the study, aided in acquiring and analyzing data, and drafted and critically revised the manuscript. Y.X., C.H., F.L., D.S., X.Z., C.Y., N.J., and S.L. participated in the experiments and the data analysis. Y.X. wrote the paper. All authors read and approved the final manuscript.

Contributor Information

Yi Xiao, Email: xiaoyizmu@126.com.

Yun Liu, Email: liuyunzmu@126.com.

De'Broski R. Herbert, University of Pennsylvania, Philadelphia, Pennsylvania, USA

DATA AVAILABILITY

The data sets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/iai.00494-23.

Table S1. iai.00494-23-s0001.doc.

Supplemental results related to Fig. 1, 2, and 4.

iai.00494-23-s0001.doc (110.5KB, doc)
DOI: 10.1128/iai.00494-23.SuF1

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

  • 1. Aballay A, Ausubel FM. 2002. Caenorhabditis elegans as a host for the study of host-pathogen interactions. Curr Opin Microbiol 5:97–101. doi: 10.1016/s1369-5274(02)00293-x [DOI] [PubMed] [Google Scholar]
  • 2. Xiao Y, Liu F, Li S, Jiang N, Yu C, Zhu X, Qin Y, Hui J, Meng L, Song C, Li X-F, Liu Y. 2020. Metformin promotes innate immunity through a conserved PMK-1/P38 MAPK pathway. Virulence 11:39–48. doi: 10.1080/21505594.2019.1706305 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Xiao Y, Liu F, Zhao P-J, Zou C-G, Zhang K-Q. 2017. PKA/KIN-1 mediates innate immune responses to bacterial pathogens in Caenorhabditis elegans. Innate Immun 23:656–666. doi: 10.1177/1753425917732822 [DOI] [PubMed] [Google Scholar]
  • 4. Irazoqui JE, Urbach JM, Ausubel FM. 2010. Evolution of host innate defence: insights from Caenorhabditis elegans and primitive invertebrates. Nat Rev Immunol 10:47–58. doi: 10.1038/nri2689 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Kim D. 2008. Studying host-pathogen interactions and innate immunity in Caenorhabditis elegans. Dis Model Mech 1:205–208. doi: 10.1242/dmm.000265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Kurz CL, Ewbank JJ. 2003. Caenorhabditis elegans: an emerging genetic model for the study of innate immunity. Nat Rev Genet 4:380–390. doi: 10.1038/nrg1067 [DOI] [PubMed] [Google Scholar]
  • 7. Aballay A, Drenkard E, Hilbun LR, Ausubel FM. 2003. Caenorhabditis elegans innate immune response triggered by Salmonella enterica requires intact LPS and is mediated by a MAPK signaling pathway. Curr Biol 13:47–52. doi: 10.1016/s0960-9822(02)01396-9 [DOI] [PubMed] [Google Scholar]
  • 8. Kim DH, Feinbaum R, Alloing G, Emerson FE, Garsin DA, Inoue H, Tanaka-Hino M, Hisamoto N, Matsumoto K, Tan M-W, Ausubel FM. 2002. A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science 297:623–626. doi: 10.1126/science.1073759 [DOI] [PubMed] [Google Scholar]
  • 9. Garsin DA, Villanueva JM, Begun J, Kim DH, Sifri CD, Calderwood SB, Ruvkun G, Ausubel FM. 2003. Long-lived C. elegans daf-2 mutants are resistant to bacterial pathogens. Science 300:1921. doi: 10.1126/science.1080147 [DOI] [PubMed] [Google Scholar]
  • 10. Pellegrino MW, Nargund AM, Kirienko NV, Gillis R, Fiorese CJ, Haynes CM. 2014. Mitochondrial UPR-regulated innate immunity provides resistance to pathogen infection. Nature 516:414–417. doi: 10.1038/nature13818 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Richardson CE, Kooistra T, Kim DH. 2010. An essential role for XBP-1 in host protection against immune activation in C. elegans. Nature 463:1092–1095. doi: 10.1038/nature08762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Mirzaei S, Gholami MH, Zabolian A, Saleki H, Farahani MV, Hamzehlou S, Far FB, Sharifzadeh SO, Samarghandian S, Khan H, Aref AR, Ashrafizadeh M, Zarrabi A, Sethi G. 2021. Caffeic acid and its derivatives as potential modulators of oncogenic molecular pathways: new hope in the fight against cancer. Pharmacol Res 171:105759. doi: 10.1016/j.phrs.2021.105759 [DOI] [PubMed] [Google Scholar]
  • 13. Zhu X, Liu F, Wu Q, Li S, Ruan G, Yang J, Yu C, Jiang N, Xiao Y, Liu Y. 2022. Brevilin A enhances innate immunity and the resistance of oxidative stress in Caenorhabditis elegans via p38 MAPK pathway. Int Immunopharmacol 113:109385. doi: 10.1016/j.intimp.2022.109385 [DOI] [PubMed] [Google Scholar]
  • 14. Stojković D, Petrović J, Soković M, Glamočlija J, Kukić-Marković J, Petrović S. 2013. In situ antioxidant and antimicrobial activities of naturally occurring caffeic acid, p-coumaric acid and rutin, using food systems. J Sci Food Agric 93:3205–3208. doi: 10.1002/jsfa.6156 [DOI] [PubMed] [Google Scholar]
  • 15. Khan F, Bamunuarachchi NI, Tabassum N, Kim Y-M. 2021. Caffeic acid and its derivatives: antimicrobial drugs toward microbial pathogens. J Agric Food Chem 69:2979–3004. doi: 10.1021/acs.jafc.0c07579 [DOI] [PubMed] [Google Scholar]
  • 16. Khan FA, Maalik A, Murtaza G. 2016. Inhibitory mechanism against oxidative stress of caffeic acid. J Food Drug Anal 24:695–702. doi: 10.1016/j.jfda.2016.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Tu L-H, Tseng N-H, Tsai Y-R, Lin T-W, Lo Y-W, Charng J-L, Hsu H-T, Chen Y-S, Chen R-J, Wu Y-T, Chan Y-T, Chen C-S, Fang J-M, Chen Y-R. 2018. Rationally designed divalent caffeic amides inhibit amyloid-beta fibrillization, induce fibril dissociation, and ameliorate cytotoxicity. Eur J Med Chem 158:393–404. doi: 10.1016/j.ejmech.2018.08.084 [DOI] [PubMed] [Google Scholar]
  • 18. Lu M, Dai Y, Xu M, Zhang C, Ma Y, Gao P, Teng M, Jiao K, Huang G, Zhang J, Yang Y, Chu Z. 2017. The attenuation of 14-3-3ζ is involved in the caffeic acid-blocked lipopolysaccharide-stimulated inflammatory response in RAW264.7 macrophages. Inflammation 40:1753–1760. doi: 10.1007/s10753-017-0618-1 [DOI] [PubMed] [Google Scholar]
  • 19. Tyszka-Czochara M, Konieczny P, Majka M. 2017. Caffeic acid expands anti-tumor effect of metformin in human metastatic cervical carcinoma HTB-34 cells: implications of AMPK activation and impairment of fatty acids de novo biosynthesis. Int J Mol Sci 18:462. doi: 10.3390/ijms18020462 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Zhang Y, Wu Q, Zhang L, Wang Q, Yang Z, Liu J, Feng L. 2019. Caffeic acid reduces A53T α-synuclein by activating JNK/Bcl-2-mediated autophagy in vitro and improves behaviour and protects dopaminergic neurons in a mouse model of Parkinson’s disease. Pharmacol Res 150:104538. doi: 10.1016/j.phrs.2019.104538 [DOI] [PubMed] [Google Scholar]
  • 21. Li H, Yu X, Li C, Ma L, Zhao Z, Guan S, Wang L. 2021. Caffeic acid protects against Aβ toxicity and prolongs lifespan in Caenorhabditis elegans models. Food Funct 12:1219–1231. doi: 10.1039/d0fo02784g [DOI] [PubMed] [Google Scholar]
  • 22. Hwang AB, Ryu E-A, Artan M, Chang H-W, Kabir MH, Nam H-J, Lee D, Yang J-S, Kim S, Mair WB, Lee C, Lee SS, Lee S-J. 2014. Feedback regulation via AMPK and HIF-1 mediates ROS-dependent longevity in Caenorhabditis elegans. Proc Natl Acad Sci U S A 111:E4458–67. doi: 10.1073/pnas.1411199111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Liu Y, Samuel BS, Breen PC, Ruvkun G. 2014. Caenorhabditis elegans pathways that surveil and defend mitochondria. Nature 508:406–410. doi: 10.1038/nature13204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Kirienko NV, Ausubel FM, Ruvkun G. 2015. Mitophagy confers resistance to siderophore-mediated killing by Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 112:1821–1826. doi: 10.1073/pnas.1424954112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Haynes CM, Yang Y, Blais SP, Neubert TA, Ron D. 2010. The matrix peptide exporter HAF-1 signals a mitochondrial UPR by activating the transcription factor ZC376.7 in C. elegans. Mol Cell 37:529–540. doi: 10.1016/j.molcel.2010.01.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Jeong D-E, Lee D, Hwang S-Y, Lee Y, Lee J-E, Seo M, Hwang W, Seo K, Hwang AB, Artan M, Son HG, Jo J-H, Baek H, Oh YM, Ryu Y, Kim H-J, Ha CM, Yoo J-Y, Lee S-JV. 2017. Mitochondrial chaperone HSP-60 regulates anti-bacterial immunity via p38 MAP kinase signaling. EMBO J 36:1046–1065. doi: 10.15252/embj.201694781 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Sun J, Singh V, Kajino-Sakamoto R, Aballay A. 2011. Neuronal GPCR controls innate immunity by regulating noncanonical unfolded protein response genes. Science 332:729–732. doi: 10.1126/science.1203411 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Fuhrman LE, Goel AK, Smith J, Shianna KV, Aballay A. 2009. Nucleolar proteins suppress Caenorhabditis elegans innate immunity by inhibiting p53/CEP-1. PLoS Genet 5:e1000657. doi: 10.1371/journal.pgen.1000657 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Calixto A, Chelur D, Topalidou I, Chen X, Chalfie M. 2010. Enhanced neuronal RNAi in C. elegans using SID-1. Nat Methods 7:554–559. doi: 10.1038/nmeth.1463 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Qadota H, Inoue M, Hikita T, Köppen M, Hardin JD, Amano M, Moerman DG, Kaibuchi K. 2007. Establishment of a tissue-specific RNAi system in C. elegans. Gene 400:166–173. doi: 10.1016/j.gene.2007.06.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Melo JA, Ruvkun G. 2012. Inactivation of conserved C. elegans genes engages pathogen- and xenobiotic-associated defenses. Cell 149:452–466. doi: 10.1016/j.cell.2012.02.050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Xiao Y, Zhang L, Zhu X, Qin Y, Yu C, Jiang N, Li S, Liu F, Liu Y. 2023. Luteolin promotes pathogen resistance in Caenorhabditis elegans via DAF-2/DAF-16 insulin-like signaling pathway. Int Immunopharmacol 115:109679. doi: 10.1016/j.intimp.2023.109679 [DOI] [PubMed] [Google Scholar]
  • 33. Liu F, Wang H, Zhu X, Jiang N, Pan F, Song C, Yu C, Yu C, Qin Y, Hui J, Li S, Xiao Y, Liu Y. 2022. Sanguinarine promotes healthspan and innate immunity through a conserved mechanism of ROS-mediated PMK-1/SKN-1 activation. iScience 25:103874. doi: 10.1016/j.isci.2022.103874 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Xiao Y, Liu F, Wu Q, Zhu X, Yu C, Jiang N, Li S, Liu Y. 2023. Dioscin activates endoplasmic reticulum UPR for defense against pathogen bacteria in Caenorhabditis elegans via IRE-1/XBP-1 pathway. J Infect Dis:jiad294. doi: 10.1093/infdis/jiad294 [DOI] [PubMed] [Google Scholar]
  • 35. Nargund AM, Pellegrino MW, Fiorese CJ, Baker BM, Haynes CM. 2012. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science 337:587–590. doi: 10.1126/science.1223560 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. West AP, Shadel GS, Ghosh S. 2011. Mitochondria in innate immune responses. Nat Rev Immunol 11:389–402. doi: 10.1038/nri2975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Shao L-W, Peng Q, Dong M, Gao K, Li Y, Li Y, Li C-Y, Liu Y. 2020. Histone deacetylase HDA-1 modulates mitochondrial stress response and longevity. Nat Commun 11:4639. doi: 10.1038/s41467-020-18501-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77:71–94. doi: 10.1093/genetics/77.1.71 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Stiernagle T. 2006. Maintenance of C. elegans. WormBook:1–11. doi: 10.1895/wormbook.1.101.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Kamath RS, Ahringer J. 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30:313–321. doi: 10.1016/s1046-2023(03)00050-1 [DOI] [PubMed] [Google Scholar]
  • 41. Lapierre LR, De Magalhaes Filho CD, McQuary PR, Chu C-C, Visvikis O, Chang JT, Gelino S, Ong B, Davis AE, Irazoqui JE, Dillin A, Hansen M. 2013. The TFEB orthologue HLH-30 regulates autophagy and modulates longevity in Caenorhabditis elegans. Nat Commun 4:2267. doi: 10.1038/ncomms3267 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1. iai.00494-23-s0001.doc.

Supplemental results related to Fig. 1, 2, and 4.

iai.00494-23-s0001.doc (110.5KB, doc)
DOI: 10.1128/iai.00494-23.SuF1

Data Availability Statement

The data sets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.


Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES