Full-length TprK of Treponema pallidum subsp. pallidum in lipid nanodiscs is a monomeric porin

Abstract

TprK is a key virulence factor of Treponema pallidum subsp. pallidum (T. pallidum) due to its ability to undergo intra-strain antigenic variation through gene conversion. This mechanism can generate millions of tprK gene and protein variants to allow immune evasion and pathogen persistence during infection. In silico structural modeling supports that TprK is an outer membrane β-barrel with porin function and with several surface-exposed loops, seven of which corresponding to the variable regions. No definitive structural of functional data, however, exist for this protein aside from its role in immune evasion. Studies to elucidate TprK biological function as a porin, are hindered by the evidence that TprK is not abundant on T. pallidum outer membrane, and by the fragility of T. pallidum envelope. To gain insight onto TprK structure and possible function as a porin, we used an Escherichia coli - based expression system that yielded highly pure full-length TprK without any intermediate denaturation step, and proceeded to reconstitute it in detergents and lipid nanodiscs. Visualization of TprK in nanodiscs using negative staining electron microscopy supported that TprK is a monomeric porin in an artificial lipid environment mimicking T. pallidum membrane. Our work provided evidence that TprK is a possible porin transporter of T. pallidum, a biological function compatible with its structural models. These results bring us closer to a comprehensive understanding of the function of this important virulence factor in syphilis pathogenesis and T. pallidum biology.

1. Introduction

Syphilis caused by the spirochete Treponema pallidum subsp. pallidum (T. pallidum), is a sexually transmitted infection that is still a serious public health problem worldwide despite being easily treatable with penicillin [1]. This disease is, still endemic in low-and middle-income countries and has been resurgent for over two decades now in high-income nations, including the United States, China, Australia, several European nations, and the United Kingdom [2-6]. According to WHO, the global burden of syphilis in 2012 was of approximately of 17.7 million infected adults, while syphilis incidence was estimated to be of 5.6 million new cases every year [7]. In China alone, 494,867 new syphilis cases were reported in 2018, corresponding to an incidence of 35.6 cases per 100,000 population [8]. Due to the number of reported cases, syphilis ranked in China among the top five infectious diseases in the country [8].

Current syphilis epidemiology advocates for better strategies for disease control and prevention, and a renewed effort to deepen our knowledge of syphilis pathogenesis and the complex host-pathogen interplay during infection. The latter goal, however, requires a better understanding of the structure and function of T. pallidum outer membrane proteins (OMPs). Progress in that direction is hindered by significant limitations of working with the syphilis agent, including a fragile outer membrane (OM), kown to contain very few integral membrane proteins, a characteristic that earned T. pallidum the appellative of stealth pathogen [9]. In comparison, E. coli OM contains approximately 100-fold more OMPs than T. pallidum OM [10]. Furthermore, genetic tools for this pathogen are being developed only now [11]. Altogether, such limitations contribute to make the functional and structural characterization of this pathogen’s OMPs very difficult and have also contributed to ongoing controversies concerning the structure of a group of T. pallidum OMPs known as the T. pallidum repeat (Tpr) proteins [12]. The Tprs are a group of 12 paralog proteins divided into three subfamilies according to sequence homology [13], and for the most part predicted to be OMPs [14]. With regard to the Tpr structure, it is currently uncertain whether these proteins contain a periplasmic NH2-terminal domain [15,16]. The availability of functional/structural data would be very useful for one of the members of this paralog family, called TprK. TprK has been repeatedly shown to have a pivotal role in syphilis pathogenesis and is currently evaluated as a promising vaccine candidate [17,18]. The gene encoding the TprK protein is, in fact, capable of intra- and inter-strain antigenic variation in seven discrete variable (V) regions [19], a feature demonstrated to contribute to immune evasion and pathogen persistence during syphilis infection [20]. Structural predictions support TprK as a β-barrel OMP [21], with the seven V regions corresponding to as many surface-exposed loops, and the conserved sequences mostly mapping to the antiparallel β-sheets composing the protein scaffolding, even though four conserved surface loops are also predicted. Interestingly, immunization with the NH2-terminal portion of TprK attenuates syphilitic lesion development in the rabbit model, thus suggesting that this portion of the protein is surface-exposed, rather than buried into the periplasmic space. Only if surface-exposed, in fact, this portion of the protein could be targeted by immunization-induced opsonic antibodies that during infection mediate clearance of T. pallidum by macrophages [22,23]. Because reliable structural data on TprK are still lacking, in this work we aimed at expressing and reconstituting TprK in a suitable lipid environment to provide preliminary evidence of its structure and to pave the way for more accurate structural/functional studies on this protein. Due to their amphipathic nature, production and isolation of integral membrane proteins is significantly more challenging than the corresponding preparative approaches for hydrophilic proteins, which can generally be obtained as soluble antigens. Because structural studies of membrane proteins are not possible in their native membrane environment, structural characterization of integral OMPs must rely on isolation from exogenous membranes and reconstitution into a suitable membrane-mimicking system [24]. The most commonly used membrane mimetic systems include detergent micelles, mixed detergent/lipid micelles, bicelles, nanodiscs, and liposomes [25]. In micelles, the hydrophobic external surface of the OMP is embedded in a spere-like structure where the hydrophobic tails of the detergent molecules form the core of the sphere, while the hydrophilic headgroups occupy the interface to the aqueous solution, allowing however the hydrophilic extension of the OMP to protrude. Nanodiscs, on the contrary, use amphiphilic membrane scaffold protein (MSP) to stabilize phospholipid molecules in the water phase, thereby forming a of phospholipid bilayer carrying the OMP [26]. Nanodiscs, therefore, provide a detergent-free environment, enabling biochemical and biophysical characterization of membrane proteins in a physiologically relevant environment [27].

Here, we describe expression of a full-length TprK using an E. coli-based system and its reconstitution in nanodiscs and detergent, and its preliminary structural analysis using negative staining electron microscopy (NSEM) to gain preliminary data on the possible porin structure of TprK.

2. Materials and methods

2.1. T. pallidum propagation and DNA extraction

T. pallidum (Nichols strain) used in this study was provided by Dr. Qianqiu Wang (Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College, Nanjing, China) and was propagated in adult New Zealand white rabbits as previously described [28]. To obtain treponemal cells for DNA extraction and amplification, rabbit testis was removed following animal euthanasia and minced in sterile saline. Rabbit testicular debris were removed by slow speed centrifugation (500 × g for 10 min) and the supernatants were spun by centrifugation (12,000 × g for 30 min at 4 °C). Pellets were resuspended in 200 μL of 1 × lysis buffer (10 mmol/L Tris, pH 8.0; 0.1 mol/L EDTA; 0.5 % sodium dodecyl sulfate) for DNA isolation. DNA extraction was conducted using the QI-Aamp DNA Mini Kit (Qiagen Inc, USA). T. pallidum genomic DNA was stored at −20 °C until use.

2.2. tprK cloning

The tprK gene (accession number: AF250506) was amplified from the Nichols strain genomic DNA by PCR using Phanta Max DNA polymerase (Vazyme, China), using the following primers: sense 5′- ATGATTGACCCATCTGCCACTTCCCG -3′ and antisense 5′- CTACCAAATCAAGCGACATGCCCCTACG -3′. The resulting amplicon was cloned into the pET28a vector, kindly provided by Dr. Bing Zhang (ShanghaiTech University, Shanghai, China) between the NdeI and XhoI sites located downstream of the thrombin cleavage site and of the NH₂-terminal 6 × His tag. The cloning products was transformed into E. coli DH5α cells. After incubation for 12–16 h at 37 °C, several single colonies were selected for sequencing analysis.

The construction of pET28a vector with a NH₂-terminal 3 × FLAG tag was obtained by modifying pET28a vector with NH₂-terminal 6 × His tag. After the PCR reaction used the pET28a plasmid as the template, and the primers 5′- GATCATGACATCGACTACAAGGATGACGATGACAAGACGCGTCTGGAAGTTCTGTTCCAGGGGCCCGGAGCTGGATCCATGATTGAC -3′ (sense), and the 5′- CAGAACTTCCAGACGCGTCTTGTCATCGTCATCCTTGTAGTCGA TGTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCGCTGCTGCCCATGG -3′ (antisense). The resulting PCR product was digested with DpnI for 1 h at 37 °C, the construct containing the tprK gene downstream of the NH₂-terminal 3 × FLAG tag and the HRV 3C site was transformed into E. coli DH5α cells. After culture in an incubator at 37 °C for 12–16 h. Several single colonies were selected for sequencing verification. All cloning information in this study are in supplementary information.

2.3. Protein expression

For protein expression, vectors were transformed into E. coli BL21 (DE3) cells. A single colony picked from the plate was grown over-night in 5 mL LB medium supplemented with 100 μg/mL of kanamycin. The culture was then inoculated into 1 L of LB medium and grown at 37°C in a shaking incubator at 220 rpm until OD600 reached to 0.5–0.6. Cells were then induced with 0.5 mM IPTG (final concentration) for 16 h at 16°C. Subsequently cells harvested by centrifugation (30 min, 4000 × g, 4°C) and frozen at −80 °C until membrane isolation.

2.4. Membrane isolation

For membrane isolation, cell pellets were resuspended in buffer A (20 mM Tris–HCl, pH 7.5, 1 M NaCl, 10 % (v/v) glycerol), and lysed by passing through a French press at 800 bar. Intact cells and debris were removed by centrifugation at 12,000 × g for 15 min at 4 °C. The supernatant containing cell membranes was collected and centrifuged at 150,000 × g for 1 h at 4 °C, and the pelleted membranes were resuspended in buffer A, flash frozen in liquid nitrogen, and stored at −80 °C. Samples were analyzed by Coomassie blue staining after SDS-PAGE at each step of the purification process.

2.5. Western blot analysis

TprK expression was evaluated by SDS-PAGE analysis. To prepare samples, cells were spun at 12,000 × g for 5 min and then resuspended in SDS-PAGE sample buffer (50 mM Tris–HCl, pH 6.8, 2% (w/v) SDS, 10 % (v/v) glycerol, 2% (w/v) DTT, 1% (w/v) Bromophenol blue). After electrophoresis, separated proteins were transferred to a PVDF membrane and blocked for 2 h at room temperature with TBST buffer (20 mM Tris–HCl, pH 8.0, 150 mM NaCl, and 0.05 % (v/v) Tween 20) supplemented with 8% skim milk. The PVDF membrane was then incubated at 4 °C overnight with and HRP-conjugated anti-6×-histidine antibody (ABclonal, China) used at 1:5,000 dilution. PVDF membranes were subsequently washed with TBST buffer twice for 15 min immunoblot were developed using the enhanced chemiluminescence (ECL) detection reagents (EpiZyme, China).

Western blot analysis was be conducted for reaction of T. pallidum polyclonal antibodies with the purified TprK protein. Human serum samples, including primary syphilis and uninfected controls, were collected from patients tested by the RPR and the TP-PA, then evaluated clinically by physicians according to their signs and symptoms at Institute of Dermatology, Chinese Academy of Medical Sciences and Peking Union Medical College. Rabbit serum samples were from rabbits infected with T. pallidum Nichols strain and uninfected one. The dilutions of serum and anti-FLAG-tagged monoclonal antibody - HRP conjugated (ABclonal, China) were 1:1000, 1:5, 000 respectively. The dilutions of HRP - conjugated goat anti-human IgG (Abcam, UK), HRP-conjugated goat anti-rabbit IgG (Abcam, UK) were 1: 10, 000.

2.6. Mass spectrometry

In-gel digestion of Coomassie-stained bands close to ~ 55 kDa in size was be followed by LC–MS/MS analysis to identify tryptic peptides. The In-gel digestion was performed as previously published [29]. To destain gel fragments, 100 μL of 100 mM ammonium bicarbonate (1:1, vol/vol) were added and sample was incubated with occasional vortexing for 30 min. Subsequently, gel fragments were dried, and 100 μL of trypsin buffer was added to cover the fragments. Digestion was let proceed in ice for 2 h. If needed, a small volume 10–20 μL of ammonium bicarbonate buffer was added to cover the gel pieces during enzymatic cleavage. Digested gel fragments were then placed into an air circulation thermostat and incubated overnight at 37 °C. Subsequently 100 μL of extraction buffer (1:2 (vol/vol) 5% formic acid/acetonitrile) was added to each tube and sample were incubated for 15 min at 37 °C in a shaker. For further LC MS/MS analysis, 10–20 μL of 0.1 % (vol/vol) tri-fluoroacetic acid were added into the tube, vortexed and/or incubated for 2–5 min in a sonication bath. Samples were then centrifuged for 15 min at 10,000 rpm. at the bench-top centrifuge.

2.7. Protein purification

The membrane fraction isolated as described above was thawed and resuspended in buffer B containing 20 mM Tris–HCl, pH 7.5, 600 mM NaCl, 10 % (v/v) glycerol and incubated for 1.5 h with 1% (w/v) n-Dodecylphosphocholine (Fos-Choline-12; Anatrace, USA) at 4 °C. Insoluble material was eliminated by ultracentrifugation for 45 min at 18,000 × g at 4 °C. The supernatant was applied to Ni-NTA agarose beads (GE Healthcare, USA) with 10 mM imidazole for 2 h at 4 °C. The beads were then rinsed with buffer B containing 0.2 % (w/v) Fos-Choline-12 and 30 mM imidazole initially and then 50 mM imidazole to remove a specific binding to the agarose. The recombinant protein was eluted with 20 mM Tris–HCl, pH 7.5, 300 mM NaCl, 10 (v/v) glycerol, containing 300 mM imidazole and 0.2 % (w/v) Fos-Choline-12. The eluted sample was concentrated using a 50 kDa cut-off spin concentrator (Millipore, USA) and then applied to a size exclusion chromatography column (Superose-6 increase, GE Healthcare, USA) pre-equilibrated with 20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 10 % (v/v) glycerol and 0.1 % (w/v) Fos-Choline-12.

Anti-Flag affinity chromatography was also used for protein purification after the solubilization procedure described above. The supernatant was applied to Anti-DYKDDDDK beads (Gene-Script, China) for 2 h at 4 °C. The beads were washed three times with 12 mL three times of a wash buffer containing 20 mM Tris–HCl, pH 7.5, 600 mM NaCl, 10 % (v/v) glycerol, 0.2 % (w/v) Fos-Choline-12 and eluted with 15 mL elution buffer containing 20 mM Tris–HCl, pH 7.5, 300 mM NaCl, 10 % (v/v) glycerol, 0.2 % (w/v) Fos-Choline-12, 250 μg/mL Flag peptide. The eluted sample was concentrated using a 50 kDa cut-off spin concentrator and then applied to a size exclusion chromatography column (Superose-6 increase, GE Healthcare, USA) pre-equilibrated with 20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 10 % (v/v) glycerol and 0.1 % (w/v) Fos-Choline-12.

2.8. Detergent exchange

The sample eluted from the Anti-DYKDDDDK affinity resin was concentrated using a 50 kDa cut-off spin concentrator to final volume 500 μL and added to 15 mL buffer containing 20 mM TrisHCl, pH 7.5, 150 mM NaCl, 10 % (v/v) glycerol, 0.004 % (w/v) Lauryl Maltose Neopentyl Glycol (LMNG; Anatrace, USA), 20 μL at the time. After incubating at 4 °C overnight, the sample was concentrated as described above, then applied to a size-exclusion chromatography column (Superose-6 increase, GE Healthcare, USA) pre-equilibrated with 20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 10 % (v/v) glycerol, and 0.002 % (w/v) LMNG.

2.9. Nanodisc reconstitution

To insert TprK into POPC–POPG nanodiscs, 4 nM of TprK protein, 16 nM MSP1D1 and 800 nM lipids (POPC: POPG, 3:2; solubilized in sodium cholate) were incubated in ice for 1 h. After incubation, detergents were removed by the addition of Biobeads SM-2 (Bio-Rad, USA) and incubation for 1 h on ice followed by overnight incubation at 4 °C. The nanodisc preparation was centrifuged at 4000 × g for 10 min at 4 °C and then at 12,000 × g for 10 min at 4 °C to remove the Bio-beads. The reconstituted mixture was applied to a size exclusion chromatography column (Superose-6 increase, GE Healthcare, USA) in 20 mM Tris–HCl, pH 7.5, 150 mM NaCl. TprK reconstituted in nanodisc was analyzed by negative stain electron microscopy (NSEM).

2.10. Negative-stain electron microscopy

TprK reconstituted in nanodiscs (2.5 μL; 0.005 mg/mL) was applied to a glow discharged continuous carbon grid, which was then treated with 0.75 % (w/v) uranyl-formate. Grids were imaged on a Tecnai T12 microscope (FEI Company, USA) operated at 120 kV and at a nominal magnification of 73,000 × using an UltraScan 4000 camera (Gatan, USA), corresponding to a pixel size of 2.02 Å on the specimen. TprK in LMNG was observed by NSEM at a nominal magnification 57,000 × as described above.

3. Results and discussion

3.1. Expression of recombinant TprK

SDS-PAGE/Coomassie staining of isolated membrane samples revealed a prominent band at ~ 55 kDa (Fig. 1A), which is the expected TprK molecular size. Western immunoblot analysis using anti-6 × -histidine monoclonal antibodies showed reactive bands in whole E. coli lysates, membrane-containing supernatant after cell lysis, the pellet after cell lysis and the pellet after ultra-centrifugation (also containing membranes) (Fig. 1B). In all cases, sizes were approximately 55 kDa. Mass spectrometry analysis as shown in Table 1 confirmed that the protein from the most prominent brand of lane5 (Fig. 1A) in SDS-PAGE was TprK of T. pallidum. We performed additional experiments using T. Pallidum polyclonal antibodies to react with the purified TprK protein. The results showed that TprK protein could react with anti-FLAG-tagged monoclonal antibody, sera from rabbits infected with T. Pallidum Nichols strain and sera from syphilitic individuals in western blotting (Fig. 1C).

Fig. 1.

Expression of recombinant Tprk. (A), SDS-PAGE of TprK expression in E. coli. M: Marker (kDa); lane #1: whole cell lysate; lane #2: cell lysate supernatant; lane #3: pellet of the cell lysate; lane #4: supernatant after-ultra-centrifugation; lane #5: membrane fraction after ultra-centrifugation. (B), Western blot using anti-6 × His antibodies on E. coli fractions following TprK expression confirming protein presence in fractions #1 (whole cell lysate), #2 (cell lysate supernatant), #3 (pellet of cell lysate), and #5 (purified membranes). Samples are the same order as (Fig. 1A). (C), Western blotting analysis of recombinant TprK protein with sera from anti-FLAG monoclonal antibody (anti-FLAG), uninfected rabbit (C-R), rabbit sera infected with T. pallidum Nichols strain (R), uninfected human (C-S), and human syphilis sera (S).

Table 1.

Mass spectrometry results.

Accession	Description	Coverage [%]	AAs	MW [kDa]	Score Mascot
O83867	Tpr protein K (TprK)	78	505	55.4	16,365
	OS = Treponemapallidum(strainNichols)
E5FP50	Uncharacterized protein	45	107	12	1706
	OS = Treponemapallidum(strainNichols)
O83270	DNA-directed RNA polymerase subunit beta' OS = Treponema pallidum (strain Nichols)	1	1416	159.7	131
O83521	ATP-dependent Clp protease ATP-binding subunit ClpX	3	415	45.4	63
	OS = Treponemapallidum(strainNichols)
O83173	Uncharacterized protein TP_0137	16	45	4.8	52
	OS = Treponemapallidum(strainNichols)
O83217	Elongation factor Tu	2	395	43.2	48
	OS = Treponemapallidum(strainNichols)
O83901	Uncharacterized protein	2	476	55.4	46
	OS = Treponema pallidum (strainNichols)
O83207	Uncharacterized protein TP_0177	2	436	49.5	36
	OS = Treponema pallidum (strain Nichols)
O83395	DNA repair helicase, putative	1	606	67.6	33
	OS = Treponemapallidum(strainNichols)
O83121	DUF4015 domain-containing protein	2	426	48.4	31
	OS = Treponema pallidum (strain Nichols)
P96123	Chemotaxis protein CheA	1	812	87.6	29
	OS = Treponemapallidum(strainNichols)
Q56336	Cytoplasmic filament protein A	1	678	78.5	23
	OS = Treponema pallidum (strain Nichols)
O83946	Sensory transduction histidine kinase, putative OS = Treponema pallidum (strain Nichols)	2	387	43.3	21

3.2. Protein purification

6 × His-tagged TprK in DDPC, purified by Nickel affinity chromatography was detected in SDS-PAGEs as a band of ~55 kDa (Fig. 2A, lane #6). A chromatogram of the size-exclusion chromatography (SEC) purification of TprK indicated however a heterogeneous sample with multiple overlapping peaks (Fig. 2B). The elution fraction (Fig. 2A, lane #6) and the SEC fractions on SDS-PAGE showed a single prominent band of ~55 kDa (Fig. 2C), even though contaminant proteins were still present.

Fig. 2.

Full-length TprK purification by Nickel affinity chromatography. (A), SDS-PAGE analysis of fractions following Nickel affinity chromatography. M: MW markers (kDa); lane #1: supernatant of solubilizing membrane; lane #2: precipitate of solubilizing membrane; lane #3: flow through; lane #4: wash fraction using 30 mM imidazole; lane #5: wash fraction using 50 mM imidazole; lane #6: elution fraction using 300 mM imidazole; lane #7: concentrated TprK protein. (B), Size exclusion profile of TprK purified by Nickel affinity chromatography. (C), SDS-PAGE analysis of fractions obtained following SEC.

A modified pET28a-6 × His-tprK plasmid, where the 6 × His-tag replaced by an Anti-DYKDDDDK (FLAG-tag) was also used as an alternative to express TprK (Fig. 3A). Expression with this construct increased purity of recombinant TprK upon purification (Fig. 3B; lane #6). The SEC profile of TprK in DDPC revealed the presence of four main peaks, two small and two larger ones (Fig. 3C). The SDS-PAGE analysis of some of these fractions showed a prominent ~55 kDa band (Fig. 3D) in all samples.

Fig. 3.

Protein purification by Anti-DYKDDDDK affinity chromatography. (A), SDS-PAGE analysis of fractions following Nickel affinity chromatography. M: MW markers (kDa); lane #1: supernatant of solubilizing membrane; lane #2: precipitate of solubilized membranes; lan #3: flow through; lane 4: Anti-DYKDDDDK Affinity Resin; lane #5: wash fraction; lane #6: elution fraction using 250 μg/mL Flag peptide. (B), Size exclusion profile of TprK purified by Anti-DYKDDDDK affinity chromatography. (C), SDS-PAGE analysis of fractions obtained following SEC.

3.3. Detergent exchange

Although purified TprK relatively devoid of contaminants was obtained by anti-DYKDDDDK affinity purification and gel chromatography, TprK in Fos-Choline-12 yielded multiple peaks in SEC as shown in Figs. 2B and 3B. On the contrary, when Fos-Choline-12 was exchanged with LMNG, TprK SEC trace showed a single peak with a retention volume of about ~16.5 mL (Fig. 4A). Negative staining of TprK in LMNG revealed single particles which were dispersed as a monomer in accordance with the results of the SEC. However, the results of NSEM suggested that TprK in LMNG was heterogeneous, with some protein particles showing a circular ring structure (with TprK being the white ring and the black dot in the center being the uranyl-formate stained), while other some protein particles have showed a smaller central dots or shorter rods (Fig. 4B).

Fig. 4.

Results of detergent exchange. (A), Size exclusion profile of TprK in LMNG. (B), Negatively stained TprK in LMNG (magnification 57,000 ×).

The ability of T. pallidum to evade the host immune response is currently attributed to several key characteristics of the syphilis pathogen, including the scarcity of surface-exposed OMPs [30], and phase variation of genes encoding putative OMPs [18,31], which can randomly turn on/off transcription of these proteins. However, chief among the immune evasion strategies evolved by T. pallidum is its ability to generate intra-strain diversity within the OMP TprK through gene conversion [18,31]. Upon immunization of rabbits with recombinant NH₂-terminal fragment of TprK, in fact, cutaneous lesion development and progression to ulceration was found to be attenuated, and treponemal burden at challenge sites was significantly reduced compared to controls [22,33], which suggested that this region might be at least partially surface-exposed. It is worth noting that our initial attempt to obtain TprK in a lipid environment yielded results (Fig. 4) that were not compatible with a homogeneous preparation. Such results should be taken as a warning that not all reconstitution procedures might lead to properly folded TprK proteins, which, in turn, might lead to inaccurate conclusions on the protein structure.

3.4. Nanodisc reconstitution

Upon incubating TprK with MSP1D1 and lipids (POPC: POPG at 3:2 ratio), one narrow peak was obtained at an elution volume of ~16.5 mL in SEC (Fig. 5A). Negative staining of TprK in nanodiscs (Fig. 5B) showed that the protein sample was homogeneous and TprK was visible as single particles evenly dispersed and with no aggregation. These results suggest that TprK is a monomer in a membrane environment. In Fig. 5B, the white highlight ring structure is TprK, and the black dot in the center is uranyl-formate stained.

Fig. 5.

TprK reconstituted in nanodiscs. (A), Size exclusion profiles of TprK reconstituted in nanodiscs with lipids (POPC: POPG at 3:2 ratio). (B), Image of negatively stained TprK in nanodiscs (magnification 73,000 ×).

Recent studies by Addetia et al. performed using clinical specimens from syphilis patients estimated that the potential for sequence variability carried by TprK is comparable to that of the human adaptive immune system in generating antibody variants [14]. These data underscore the immune-evasive ability of TprK that allows T. pallidum to establish lifelong infection in absence of treatment. At pre-clinical level, several seminal studies conducted using the rabbit model clearly proved that TprK sequence diversity accumulates in response to immune pressure during experiment syphilis [17], and that Tprk antigenic variation facilitates development of secondary syphilis [20]. Altogether, the above results support a role for TprK in immune evasion and suggest that the ability of TprK variants to persist despite a robust immune response is instrumental in disease progression. Aside for its role in immune evasion, TprK might fulfill an additional biological function as an outer membrane porin transporter, based on in silico modeling that, however, until now have found limited supporting data [13].

Our work, therefore, is the first to provide evidence that TprK might indeed be a monomeric porin, even though no definitive conclusions could be drawn from our electron microscopy images on the size of the pore and, hence, its substrate selectivity. Another limitation of this study was that no conclusions could be obtained concerning the structure of the protein. Two main schools of thought exist in fact regarding TprK structure. One, based on extensive immunological and functional data accumulated since the discovery of this antigen, supports that the entire TprK protein sequence forms a β-barrel structure, that all the V regions of the protein are surface-exposed, and no periplasmic domain of this protein exists [13]. The second, on the contrary, is based on preliminary structural data obtained recently on the amino-terminal portion of the protein alone that suggests compatibility with a periplasmic domain [32]. Our data do not provide support to either theory, but clearly show that TprK structure is compatible with a porin once the protein is reconstituted in a lipid environment. Whether pore formation requires the whole TprK mature protein sequence or just a smaller portion remains to be ascertained. It is worth noting, however, that a subsurface localization of the amino-terminal portion, would avoid surface-exposure of three V regions, and would not be fully compatible with data supporting that this region is a target of opsonic antibodies and therefore a promising vaccine candidate, given that T. pallidum clearance by the host response is mediated by phagocytosis of opsonized pathogen cells by macrophages.

4. Conclusion

We described a protocol to express full-length TprK and reconstitute it into a lipid bilayer environment mimicking the protein natural environment. TprK visualization using NSEM suggests that TprK exists in T. pallidum membrane as a monomeric porin. By providing an effective protocol to obtain highly purified and homogeneous TprK in a lipid environment, our work paves the way to applying such techniques and might lead in the future to a clear and definitive understanding of the structure of this important antigen of the syphilis pathogen.

Data availability

All data associated with this study are included in the paper. All plasmids generated in the study are available from the corresponding author on reasonable request.