Skip to main content
PMC home page
Journal of Central South University Medical Sciences logoLink to Journal of Central South University Medical Sciences
. 2021 Sep 28;46(9):932–941. doi: 10.11817/j.issn.1672-7347.2021.210413

CYP2J2-produced epoxyeicosatrienoic acids contribute to the ferroptosis resistance of pancreatic ductal adenocarcinoma in a PPARγ-dependent manner

CYP2J2介导生成的EETs通过PPARγ促进胰腺导管腺癌铁死亡抵抗

TAO Pengzuo 1,2,3,2, JIANG Yu'e 3, WANG Hai 1,2, GAO Ge 1,2,✉
Editor: CHEN Liwen
PMCID: PMC10930169  PMID: 34707002

Abstract

Objective

Pancreatic ductal adenocarcinoma (PDAC) is one of the most malignant digestive tract tumors with a poor prognosis and high recurrence rate. Recently, ferroptosis resistance has been found in PDAC. However, the underlying mechanism of ferroptosis resistance has not been fully elucidated. Cytochrome P450 2J2 (CYP2J2) is the main enzyme which mediates arachidonic acid to produce epoxyeicosatrienoic acids (EETs) in human tissues. It has been reported that EETs involve in the development of cancer, while the roles of EETs in PDAC and ferroptosis remain unclear.This study aims to explore the effect of CYP2J2/EETs on ferroptosis of human pancreatic ductal adenocarcinoma cells PANC-1 cells and the underlying mechanisms.

Methods

The tumor tissues and para-carcinoma tissues of 9 patients with PDAC were collected and the expression of CYP2J2 was detected with real-time PCR and Western blotting. Enzyme-linked immunosorbent assay (ELISA) was used to detect the level of 8,9-dihydroxyeicosatrienoic acid (8,9-DHET), and the degradation product of 8,9-epoxyeicosa-trienoic acid (8,9-EET). PANC-1 cells were used in this study. The ferroptosis inducer erastin was used to induce ferroptosis. The intracellular long-chain acyl-CoA synthetase 4 (ACSL4) protein level, lactate dehydrogenase (LDH) activity, malondialdehyde (MDA) content, Fe2+ concentration, and cell survival were detected. The 8,9-EET was pretreated to observe its effect on erastin-induced ferroptosis in PANC-1 cells. Lentivirus was used to construct a CYP2J2 knockdown cell line to observe its effect on the ferroptosis of PANC-1 cells induced by erastin. A peroxisome proliferation-activated receptor γ (PPARγ) blocker was used to observe the effect of 8,9-EET on erastin-induced glutathione peroxidase 4 (GPX4) and MDA content in PANC-1 cells.

Results

High expression of CYP2J2 was found in PDAC, accompanied by an increased level of 8,9-DHET. The 8,9-EET pretreatment significantly attenuated the PANC-1 cell death induced by erastin. The 8,9-EET reduced the Fe2+ concentration, LDH activity and MDA content, and ACSL4 protein expression in erastin-treated PANC-1 cells. The 8,9-EET also restored the ferroportin (FPN) and ferroptosis suppressor protein 1 (FSP1) mRNA expressions in erastin-treated PANC-1 cells. But CYP2J2 knockdown exacerbated the erastin-induced ferroptosis in PANC-1 cells. Besides, CYP2J2 knockdown furtherly down-regulated the gene expression of FPN and FSP1. The 8,9-EET increased the expression of GPX4 in the erastin-treated PANC-1 cells, which was eliminated by a PPARγ blocker GW9662. And GW9662 abolished the anti-ferroptosis effects of 8,9-EET.

Conclusion

CYP2J2/EETs are highly expressed in PDAC tissues. EETs inhibit the ferroptosis via up-regulation of GPX4 in a PPARγ-dependent manner, which contributes to the ferroptosis resistance of PDAC.

Keywords: pancreatic ductal adenocarcinoma, epoxyeicosatrienoic acids, cytochrome P450 2J2, ferroptosis, PANC-1

http://xbyxb.csu.edu.cn/xbwk/fileup/PDF/202109932.pdf

Pancreatic ductal adenocarcinoma (PDAC) is one of the most malignant digestive tract tumors, among which 85% of pancreatic carcinoma are adenocarcinoma arising from the cells of ductulus[1]. Despite enormous work in pathological mechanisms and novel therapeutics, the poor prognosis and high recurrence rate still trouble medical staff[2]. So, an in-deep investigation into the malignant mechanism remains urgent.

Ferroptosis is a new type of programmed cell death [3]. Ferroptosis is characterized by a large amount of iron (Fe2+) accumulation and excessive lipid peroxidation[4]. Ferroptortin (FPN, encoded by SLC40A1) is a sole iron export protein, which participates in the regulation of [Fe2+]i [5]. Glutathione peroxidase 4 (GPX4) is a main negative regulator of ferroptosis through reducing intracellular lipid peroxidation[6]. In 2019, the CoQ oxidoreductase ferroptosis suppressor protein 1 (FSP1) had been reported as a glutathione-independent ferroptosis suppressor[7-8]. Accumulating evidence suggests that ferroptosis resistance participates in the development of various tumors, such as hepatocellular carcinoma[9], prostate tumor[10], and breast cancer[11]. Recently, ferroptosis also has been found in PDAC[12-13]. Drug-induced ferroptosis may be a potent therapy for PDAC[14]. In our previous studies, we found a high expression of mitochondrial Lon peptidase 1 (LONP1) in pancreatic cancer[15], and inhibition of LONP1 protects PDAC cells PANC-1 cells from erastin-induced ferroptosis[16]. However, the underlying mechanism of the ferroptosis resistance in PDAC remains unclear.

Epoxyeicosatrienoic acids (EETs) are eicosanoids synthesized by cytochrome P450 (CYP) from arachidonic acid (ARA). There are 4 isomerides: 5,6-EET, 8,9-EET, 11,12-EET, and 14,15-EET. CYP2J2 is the dominant EETs-productor in humans. EETs have multi-functions, such as anti-inflammation, vasodilation, anti-oxidant, and anti-fibrosis[17-19]. It has been reported that the peroxisome proliferation-activated receptor γ (PPARγ) is the intercellular receptor for EETs[20]. EETs exert an anti-oxidative effect via PPARγ[21]. EETs are hydrolyzed by soluble epoxide hydrolase (sEH) to their corresponding dihydroxyeicosatrienoic acids (DHETs)[22]. Recently, CYP2J2/EETs are found to participate in cancer[23]. For instance, inhibition of CYP2J2 induces apoptosis in human hepatocellular carcinoma cells[24]. Endogenous EETs stimulate multi-organ metastasis and tumor dormancy escape in mice[25]. However, the role of CYP2J2/EETs in PDAC remains unknown.

In this study, we put forward a hypothesis that the high expression of CYP2J2 protects PDAC cells from ferroptosis, contributing to the ferroptosis resistance.

1. Materials and Methods

1.1. Tissue specimens

Our study has been approved by the ethics committee of the Third Xiangya Hospital of Central South University (approval number: 2020-S235). Nine samples were included in this study from patients who were diagnosed with PDAC by pathological examination from May 2018 to January 2019. The corresponding para-carcinoma tissue was used as a control. None of the nine patients received any chemotherapy before surgery. The tissue was stored at -80 ℃ until used. All patients have signed the informed consent agreements.

1.2. Cells and cell treatment

Human PDAC cell line PANC-1 cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The cells were cultured with DMEM medium (Gibco, Grand Island, NY, USA) containing 10% bovine serum (Gibco, USA) and 100 U/mL penicillin/streptomycin at 37 ℃ in 5% CO2. According to our previous study[16], we treated cells with erastin (10 μmol/L) for 12 h to induce ferroptosis in PANC-1 cells. To detect the effects of 8,9-EET on the ferroptosis, we treated PANC-1 cells with erastin with/without 8,9-EET (1 μmol/L, Cayman Chemical, USA) pretreatment for 30 min. To detect the effects of CYP2J2 knockdown on ferroptosis, we used an shRNA system mediated by a lentivirus vector. A PPARγ inhibitor GW9662 (10 μmol/L, Merck, USA) was pretreated for 30 min, followed by 8,9-EET and/or erastin treatment.

1.3. Total RNA extraction and real-time PCR

Total RNA from tissue specimens or cells was extracted using RNAiso Plus (Takara, Kusatsu, Japan). RNA concentration and purity were determined using an ultraviolet spectrophotometer (Thermo Fisher Scientific, USA). The cDNA was synthesized from 1 μg RNA using Prime Script RT Kit (Takara, Japan). Bio-Rad real-time PCR (CFX96 TouchTM, Bio-Rad, USA) was used to detect mRNA expression levels. The relative expression of the target gene was calculated by the 2-ΔΔCt method. The sequences of specific primers are shown in Table 1.

Table 1.

Sequences of primers used in this study

Gene Sequence (5'→3') Product length/bp
CYP2J2

F: TTCCACAACTCTGCGATGGG

R: GACAGCATTGGTGTAGGGCA

 148
ACSL4

F: AATGCAGCCAAATGGAAAAG

R: CACAGAAGATGGCAATGGTG

 152
FSP1

F: GAGACGGGGTTTCACTGTGT

R: GGGGTAACCAGAAGAGCACA

 200
FPN

F: CGAGATGGATGGGTCTCCTA

R: GCTGATGCTCCCATCAAAAT

 164
GAPDH

F: AATGGGCAGCCGTTAGGAAA

R: GCGCCCAATACGACCAAATC

 168
Open in a new tab

1.4. Western blotting

Total protein from tissue or cells was extracted using the radio-immunoprecipitation buffer (SolarBio, China) containing a mixture of proteases and phosphatase inhibitors (SolarBio, China). The protein concentration was determined with the PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific, USA). Protein samples were dissolved in 2% sodium dodecyl sulfonate (SDS) and denatured at 95 ℃ for 10 min. The sample was mixed with the loading buffer, separated by SDS-polyacrylamide gel electrophoresis (PAGE) gels, and then electrically transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA). The membranes were blocked with 5% non-fat milk at room temperature for 1 h. The membranes were probed with primary antibody at 4 ℃ overnight. The antibodies used in the study are shown in Table 2. After washed with Tris Buffered Saline Tween (TBST) 3 times, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (1꞉5 000; Cell Signaling Technology, USA) at room temperature for 1 h. The image of protein brands was captured by ChemiDoc XRS (Bio-Rad, USA). Blot immunostainings were digitized and analyzed using the Image Lab Analyzer software (Bio-Rad, USA).

Table 2.

Information of antibodies used in this study

Antibody Company Dilution
CYP2J2 Abcam 1꞉1 500
ACSL4 Abcam 1꞉2 000
GPX4 Abcam 1꞉2 000
β-tubulin Servicebio 1꞉2 000
Open in a new tab

1.5. Detection of 8,9-DHET content

Tissue specimens or PANC-1 cells were collected and homogenized. After centrifugation, the supernatant was used to detect the concentration of 8,9-DHET by an enzyme-linked immunosorbent assay (ELISA) kit (Sigma-Aldrich, USA) according to the manufacturer's instruction.

1.6. Cell viability assay

Cell viability was determined by a Cell Counting Kit-8 (CCK-8) (Dojindo Laboratories, Japan). One thousand cells were seeded in each well of the 96-well plate. After the treatment mentioned above, CCK-8 was added to each well, and then cells were incubated at 37 ℃ for another 3 h. The absorbance was measured at 450 nm using an ultraviolet spectrophotometer (Thermo Fisher Scientific, USA).

1.7. Measurement of Fe2+ concentration in cells

PANC-1 cells were collected after designed treatments and immediately homogenized with phosphate-buffered saline. After centrifugation, the supernatant was used to detect the concentration of Fe2+ by an Iron Assay Kit (Sigma-Aldrich, USA) according to the manufacturer's instruction. The concentration of Fe2+ was adjusted by the total protein concentration of the supernatant.

1.8. Measurement of lactate dehydrogenase activity in the supernatant

After designed treatments, the cell-free supernatant was collected. Lactate dehydrogenase (LDH) activity was detected by an LDH Release Assay Kit according to the instruction (Beyotime Biotechnology, Shanghai, China).

1.9. Malondialdehyde content detection

After dividing the tissue, the tissue was homogenized with PBS in the ratio of 1꞉10 (weight: volume). Malondialdehyde (MDA) contents in tissues or cells were assessed according to the instruction of the kit (Jiancheng Bioengineering Institute, Nanjing, China).

1.10. Lentivirus vector transfection

Lentivirus-constructed short hairpin RNA (shRNA) interference for CYP2J2: control-shRNA and CYP2J2 shRNA were purchased from GenePharma (Suzhou, China). The cells were seeded in 6-well plates and infected with 108 TU/mL virus particles. Three days after infection, the cells were collected or treated for other treatments.

1.11. Statistical analysis

Statistical analysis was performed using SPSS19.0. All data are presented as mean ± standard deviation ( x¯ ±s) and normally distributed. Statistical difference between the 2 groups was analyzed using the Student t-test. ANOVA was used to analyze the statistical difference between multi-groups, followed by Tukey's post hoc test for repeated measures. A P<0.05 was considered significant.

2. Results

2.1. CYP2J2 was high-expressed in PDAC tissue

From the nine samples, we found 4.13-fold and 4.38-fold up-regulation in gene and protein expression of CYP2J2 in PDAC tissue, respectively, compared with the para-carcinoma tissue (Figure 1A-1C). DHETs are the steady hydrolysate of EETs with little activity. ELISA results showed that the content of 8,9-DHET in PDAC tissue was obviously higher than that of para-carcinoma tissue (Figure 1D).

Figure 1. CYP2J2 was high-expressed in PDAC tissue.

Figure 1

Open in a new tab

A: Gene expressions of CYP2J2 in PDAC and para-carcinoma tissue were detected with real-time PCR. B-C: Protein expressions of CYP2J2 in PDAC and para-carcinoma tissue were detected with Western blotting. D: ELISA was used to evaluate the levels of 8,9-DHET in PDAC and para-carcinoma tissues. n=9, **P<0.01 and ***P<0.001.

2.2. 8,9-EET inhibited the erastin-induced ferroptosis in PANC-1 cells

Results showed that exogenous 8,9-EET partly restored the cell viability impaired by erastin (Figure 2A). Erastin treatment significantly increased the [Fe2+], LDH activity, MDA content, and ACSL4 protein expression in PANC-1 cells, and they were effectively reduced by 8,9-EET pretreatment for 30 min (Figure 2B-2G). Besides, 8,9-EET restored the gene expression of FPN and FSP1 in erastin-treated PANC-1 cells (Figure 2H-2I).

Figure 2. 8,9-EET inhibited the erastin-induced ferroptosis in PANC-1 cells.

Figure 2

Open in a new tab

PANC-1 cells were treated by erastin (10 μmol/L) for 12 h with/without 8,9-EET (1 μmol/L) pretreatment for 30 min. A: Cell viability of PANC-1 cells was detected by CCK-8. B: Concentration of Fe2+ in PANC-1 cells was detected by a corresponding kit. C: LDH activity in the supernatant of PANC-1 cells was detected. D: MDA content in PANC-1 cells was detected. E-F: Expression of ACSL4 protein was detected with Western blotting. F-I: Gene expressions of ACSL4, FPN, and FSP1 were detected with real-time PCR. Data are presented as the mean±standard deviation, n=3, *P<0.05, **P<0.01, and ***P<0.001.

2.3. CYP2J2 knockdown exacerbated the erastin-induced ferroptosisin PANC-1 cells

CYP2J2 shRNA was used to knock-down the expression of CYP2J2. We found that CYP2J2 shRNA obviously reduced the CYP2J2 gene and protein expression and the 8,9-DHET content in PANC-1 cells (Figure 3A-3D). Compared with the erastin-treated PANC-1 cells, CYP2J2 shRNA furtherly reduced the viability of the cells (Figure 3E) and increased the Fe2+ concentration (Figure 3F), MDA content (Figure 3G), and ACSL4 expression (Figure 3H-3J). Besides, CYP2J2 shRNA furtherly down-regulated the gene expression of FPN and FSP1 (Figure 3K-3L).

Figure 3. CYP2J2 knockdown exacerbated the erastin-induced ferroptosis in PANC-1 cells.

Figure 3

Open in a new tab

PANC-1 cells were infected with CYP2J2 shRNA or control shRNA mediated by lentivirus vector. A: Three days later, the CYP2J2 gene expression was detected with real-time PCR. B-C: Protein level of CYP2J2 was evaluated with Western blotting. D: Concentration of 8,9-DHET in PANC-1 cells was detected by ELISA. Then PANC-1 cells were treated with erastin (10 μmol/L) for 12 h. E: Cell viability was detected with CCK-8. F: Concentration of Fe2+ in PANC-1 cells was detected. G: MDA content in PANC-1 cells was detected. H: Gene expression of ACSL4 was detected with real-time PCR. I-J: Expression of ACSL4 protein was detected with Western blotting. K-L: Gene expression of FPN and FSP1 was detected by real-time PCR. Data are presented as the mean ± standard deviation, n=3, *P<0.05, **P<0.01, and ***P<0.001.

2.4. 8,9-EET partly restored the GPX4 expression in a PPARγ-dependent manner

Erastin obviously reduced the expressions of GPX4 in PANC-1 cells, which was partly restored by 8,9-EET pretreatment (Figure 4A-4C). Compared with the 8,9-EET+erastin-treated PANC-1 cells, the PPARγ inhibitor GW9662 treatment significantly increased the Fe2+ concentration, LDH activity, and MDA content (Figure 4D-4F). We also found that GW9662 treatment could abolish the restoration of GPX4 of 8,9-EET (Figure 4G-4H).

Figure 4. 8,9-EET partly restored the GPX4 expression in a PPARγ-dependent manner.

Figure 4

Open in a new tab

PANC-1 cells were treated with erastin with/without 8,9-EET pretreatment. A: Gene expression of GPX4 was detected with real-time PCR. B-C: GPX4 protein expression was detected with Western blotting. D: Concentration of Fe2+ in PANC-1 cells was detected. E: LDH activity in the supernatant of PANC-1 cells was detected. F: MDA content in PANC-1 cells was detected. G-H: GPX4 protein expression was detected with Western blotting and the effects of GW9662 on 8,9-EET's regulation in erastin-treated PANC-1 cells were investigated. Data are presented as the mean ± standard deviation, n=3, *P<0.05, **P<0.01, and ***P<0.001.

3. Discussion

This study observed that the expression of CYP2J2 and its activity were significantly increased in PDAC patients. 8,9-EET inhibited erastin-induced ferroptosis in PANC-1 cells. The underlying mechanisms were related to the activation of PPARγ by EETs and up-regulation of the expression of GPX4. We provide an experimental basis for elucidating the molecular mechanism of ferroptosis resistance and for targeting CYP2J2 for the treatment of pancreatic cancer.

EETs are lipid molecules generated from ARA under the action of CYP. EETs have a variety of biological activities[26]. In non-neoplastic diseases, EETs mostly play positive protective roles, such as lowering blood pressure, reducing cardiac ischemia-reperfusion injury, reducing renal fibrosis, and inhibiting inflammatory responses[20, 27-29]. In recent years, the roles of EETs in tumors have gradually attracted people's attentions. For example, EETs can promote the multi-organ metastasis of tumor cells[25] and promote angiogenesis and tumor growth[30]. The results of our study indicate that CYP2J2 is highly expressed in pancreatic cancer tissue, suggesting that its downstream products EETs are also involved in the occurrence and development of pancreatic cancer. Then, we detected the content of 8,9-DHET, a hydrolysate of 8,9-EET, to reflect the catalytic activity of CYP2J2, suggesting that the CYP2J2/EETs pathway is significantly enhanced in pancreatic cancer. After a literature retrieval, no relevant reports have been found.

Erastin is a classic ferroptosis inductor[31]. Our previous study[16] has found that erastin induces ACSL4 expression and reduces GPX4 expression and cell survival rate in a dose-dependent manner in PANC-1 cells. Therefore, 10 μmol/L of erastin was used to induce ferroptosis in this study. It was observed that the expression of ACSL4, MDA content, LDH activity, and Fe2+ concentration in PANC-1 cells were increased. These results strongly indicate that the cell model in this study is credible. Other study[32] also reports that erastin can increase ACSL4 protein expression, MDA content, and Fe2+ concentration.

There is no report about the role of EETs in ferroptosis. In this study, it was observed that EETs inhibited the ferroptosis of PANC-1 cells. We believe that the mechanisms of EETs inhibiting ferroptosis are as follows. Firstly, EETs can up-regulate the expression of GPX4, which is an important enzyme that negatively regulates ferroptosis and exerts anti-lipid properties. Our study observed that the expression of GPX4 was down-regulated in erastin-treated PANC-1 cells, which is consistent with our previous report[16]. Secondly, EETs may reduce oxidative stress by up-regulating Nrf2, thereby reducing ferroptosis. Studies have shown that Nrf2 can inhibit cell ferroptosis. For example, activating the p62-Keap1-Nrf2 pathway can inhibit ferroptosis in hepatocellular carcinoma[33], and inhibiting Nrf2 can reverse the ferroptosis resistance of head and neck tumors induced by GPX4 inhibitors[34]. Study[35] has shown that EETs activate Nrf2. CYP2C8-mediated EETs can reduce endothelial cell apoptosis by activating Nrf2. 14,15-EET inhibits cigarette smoke-induced inflam-mation in alveolar epithelial cells via Nrf2[36]. Therefore, we believe that EETs may play an inhibitory role in ferroptosis by activating Nrf2. This mechanism will be discussed in-depth in subsequent studies.

There are some limitations in our study. First, the sample number of our clinical specimens is small. We will collect more samples to solid our conclusion. Second, only the effects of 8,9-EET on ferroptosis were investigated in this study. All EETs share the same receptor with petty different affinities. So, we think 8,9-EET could reflect the roles of EETs in the development of PDAC.

Collectively, we report for the first time that CYPs/EETs are highly expressed in PDAC and EETs inhibit the erastin-induced ferroptosis in a PPARγ-dependent manner in PANC-1 cells (Figure 5).

Figure 5. Schematic illustration.

Figure 5

Open in a new tab

CYPs/EETs are highly expressed in PDAC and EETs inhibit the erastin-induced ferroptosis in a PPARγ-dependent manner in PANC-1 cells. ARA: Arachidonic acid; CYP2J2: Cytochrome P4502J2; EETs: Epoxyeicosatrienoic acids; PPARγ: Peroxisome proliferation-activated receptor γ; GPX4: Glutathione peroxidase; PDAC: Pancreatic ductal adenocarcinoma.

Funding Statement

This work was supported by the Natrural Science Foundation of Hunan Province (2019JJ50975) and Science and Technology Planning Project of Yunnan Provincial Science and Technology Department (2019FE001), China.

Conflict of Interest

The authors declare no conflict of interest.

Note

http://xbyxb.csu.edu.cn/xbwk/fileup/PDF/202109932.pdf

References

  • 1. Ilic M, Ilic I. Epidemiology of pancreatic cancer[J]. World J Gastroenterol, 2016, 22(44): 9694-9705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Grossberg AJ, Chu LC, Deig CR, et al. . Multidisciplinary standards of care and recent progress in pancreatic ductal adenocarcinoma[J]. CA Cancer J Clin, 2020, 70(5): 375-403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Li J, Cao F, Yin HL, et al. . Ferroptosis: past, present and future[J]. Cell Death Dis, 2020, 11(2): 88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Hirschhorn T, Stockwell BR. The development of the concept of ferroptosis[J]. Free Radic Biol Med, 2019, 133: 130-143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bao WD, Pang P, Zhou XT, et al. . Loss of ferroportin induces memory impairment by promoting ferroptosis in Alzheimer's disease[J]. Cell Death Differ, 2021, 28(5): 1548-1562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Beatty A, Singh T, Tyurina YY, et al. . Ferroptotic cell death triggered by conjugated linolenic acids is mediated by ACSL1[J]. Nat Commun, 2021, 12(1): 2244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Doll S, Freitas FP, Shah R, et al. . FSP1 is a glutathione-independent ferroptosis suppressor[J]. Nature, 2019, 575(7784): 693-698. [DOI] [PubMed] [Google Scholar]
  • 8. Bersuker K, Hendricks JM, Li Z, et al. . The CoQ oxidoreductase FSP1 acts parallel to GPX4 to inhibit ferroptosis [J]. Nature, 2019, 575(7784): 688-692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Li ZJ, Dai HQ, Huang XW, et al. . Artesunate synergizes with sorafenib to induce ferroptosis in hepatocellular carcinoma[J]. Acta Pharmacol Sin, 2021, 42(2): 301-310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Nassar ZD, Mah CY, Dehairs J, et al. . DECR1 is an androgen-repressed survival factor that regulates PUFA oxidation to protect prostate tumor cells from ferroptosis[EB/OL]. 2019(2019-12-06)[2021-06-12]. https://www.biorxiv.org/content/10.1101/865626v1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Wu XH, Liu CL, Li Z, et al. . Regulation of GSK3β/Nrf2 signaling pathway modulated erastin-induced ferroptosis in breast cancer[J]. Mol Cell Biochem, 2020, 473(1): 217-228. [DOI] [PubMed] [Google Scholar]
  • 12. Badgley MA, Kremer DM, Maurer HC, et al. . Cysteine depletion induces pancreatic tumor ferroptosis in mice[J]. Science, 2020, 368(6486): 85-89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Chen G, Guo GQ, Zhou XD, et al. . Potential mechanism of ferroptosis in pancreatic cancer[J]. Oncol Lett, 2020, 19(1): 579-587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Liu J, Dai E, Kang R, et al. . The dark side of ferroptosis in pancreatic cancer[J]. Oncoimmunology, 2021, 10(1): 1868691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Liu C, Wang H, Li H, et al. . Inhibition of LONP1 suppresses pancreatic cancer progression via c-Jun N-terminal kinase pathway-meditated epithelial-mesenchymal transition[J]. Pancreas, 2019, 48(5): 629-635. [DOI] [PubMed] [Google Scholar]
  • 16. Wang H, Liu C, Zhao Y, et al. . Inhibition of LONP1 protects against erastin-induced ferroptosis in Pancreatic ductal adenocarcinoma PANC1 cells[J]. Biochem Biophys Res Commun, 2020, 522(4): 1063-1068. [DOI] [PubMed] [Google Scholar]
  • 17. Luo XQ, Duan JX, Yang HH, et al. . Epoxyeicosatrienoic acids inhibit the activation of NLRP3 inflammasome in murine macrophages[J]. J Cell Physiol, 2020, 235(12): 9910-9921. [DOI] [PubMed] [Google Scholar]
  • 18. Imig JD. Eicosanoid blood vessel regulation in physiological and pathological states[J]. Clin Sci (Lond), 2020, 134(20): 2707-2727. [DOI] [PubMed] [Google Scholar]
  • 19. Zhou Y, Yang J, Sun GY, et al. . Soluble epoxide hydrolase inhibitor 1-trifluoromethoxyphenyl-3-(1-propionylpiperidin-4-yl) urea attenuates bleomycin-induced pulmonary fibrosis in mice[J]. Cell Tissue Res, 2016, 363(2): 399-409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Li R, Xu XZ, Chen C, et al. . CYP2J2 attenuates metabolic dysfunction in diabetic mice by reducing hepatic inflammation via the PPARγ[J]. Am J Physiol Endocrinol Metab, 2015, 308(4): E270-E282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Zhang J, Qiu H, Huang J, et al. . EETs/PPARs activation together mediates the preventive effect of naringenin in high glucose-induced cardiomyocyte hypertrophy[J]. Biomed Pharmacother, 2019, 109: 1498-1505. [DOI] [PubMed] [Google Scholar]
  • 22. Yang HH, Duan JX, Liu SK, et al. . A COX-2/sEH dual inhibitor PTUPB alleviates lipopolysaccharide-induced acute lung injury in mice by inhibiting NLRP3 inflammasome activation[J]. Theranostics, 2020, 10(11): 4749-4761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Apaya MK, Shiau JY, Liao GS, et al. . Integrated omics-based pathway analyses uncover CYP epoxygenase-associated networks as theranostic targets for metastatic triple negative breast cancer[J]. J Exp Clin Cancer Res, 2019, 38(1): 187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Lee CM, Lee J, Jang SN, et al. . 6, 8-diprenylorobol induces apoptosis in human hepatocellular carcinoma cells via activation of FOXO3 and inhibition of CYP2J2[J]. Oxidative Med Cell Longev, 2020, 2020: 8887251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Panigrahy D, Edin ML, Lee CR, et al. . Epoxyeicosanoids stimulate multiorgan metastasis and tumor dormancy escape in mice[J]. J Clin Invest, 2012, 122(1): 178-191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Zhou C, Huang J, Li Q, et al. . CYP2J2-derived EETs attenuated ethanol-induced myocardial dysfunction through inducing autophagy and reducing apoptosis[J]. Free Radic Biol Med, 2018, 117: 168-179. [DOI] [PubMed] [Google Scholar]
  • 27. Das UN. Arachidonic acid in health and disease with focus on hypertension and diabetes mellitus: a review[J]. J Adv Res, 2018, 11: 43-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Sato M, Yokoyama U, Fujita T, et al. . The roles of cytochrome p450 in ischemic heart disease[J]. Curr Drug Metab, 2011, 12(6): 526-532. [DOI] [PubMed] [Google Scholar]
  • 29. Wang Q, Liang Y, Qiao Y, et al. . Expression of soluble epoxide hydrolase in renal tubular epithelial cells regulates macrophage infiltration and polarization in IgA nephropathy[J]. Am J Physiol Renal Physiol, 2018, 315(4): F915-F926. [DOI] [PubMed] [Google Scholar]
  • 30. Rand AA, Barnych B, Morisseau C, et al. . Cyclooxygenase-derived proangiogenic metabolites of epoxyeicosatrienoic acids[J]. Proc Natl Acad Sci USA, 2017, 114(17): 4370-4375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Zhou HH, Chen X, Cai LY, et al. . Erastin reverses ABCB1-mediated docetaxel resistance in ovarian cancer[J]. Front Oncol, 2019, 9: 1398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Luo M, Wu L, Zhang K, et al. . miR-137 regulates ferroptosis by targeting glutamine transporter SLC1A5 in melanoma[J]. Cell Death Differ, 2018, 25(8): 1457-1472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Sun X, Ou Z, Chen R, et al. . Activation of the p62-Keap1-NRF2 pathway protects against ferroptosis in hepatocellular carcinoma cells[J]. Hepatology, 2016, 63(1): 173-184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Shin D, Kim EH, Lee J, et al. . Nrf2 inhibition reverses resistance to GPX4 inhibitor-induced ferroptosis in head and neck cancer[J]. Free Radic Biol Med, 2018, 129: 454-462. [DOI] [PubMed] [Google Scholar]
  • 35. Liu WJ, Wang T, Wang B, et al. . CYP2C8-derived epoxyeicosatrienoic acids decrease oxidative stress-induced endothelial apoptosis in development of atherosclerosis: Role of Nrf2 activation[J]. J Huazhong Univ Sci Technolog Med Sci, 2015, 35(5): 640-645. [DOI] [PubMed] [Google Scholar]
  • 36. Li Y, Yu G, Yuan S, et al. . 14, 15-Epoxyeicosatrienoic acid suppresses cigarette smoke condensate-induced inflammation in lung epithelial cells by inhibiting autophagy[J]. Am J Physiol Lung Cell Mol Physiol, 2016, 311(5): L970-L980. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Central South University Medical Sciences are provided here courtesy of Central South University

RESOURCES