Skip to main content
NCBI home page
Journal of Central South University Medical Sciences logoLink to Journal of Central South University Medical Sciences
. 2022 Dec 28;47(12):1629–1636. doi: 10.11817/j.issn.1672-7347.2022.210560

Effect of hypoxia on HIF-1α/MDR1/VEGF expression in gastric cancer cells treated with 5-fluorouracil

缺氧对5-氟尿嘧啶干预的胃癌细胞中HIF-1α/MDR1/VEGF表达的影响（英文）

WANG Lu 1,2, XING Wei 2, QI Jin 3, LU Yongyan 4, XIANG Linbiao 5, ZHOU Yali 2,✉
Editor: TIAN Pu
PMCID: PMC10930280  PMID: 36748372

Abstract

Objective

Fluorouracil chemotherapeutic drugs are the classic treatment drugs of gastric cancer. But the problem of drug resistance severely limits their clinical application. This study aims to investigate whether hypoxia microenvironment affects gastric cancer resistance to 5-fluorouracil (5-FU) and discuss the changes of gene and proteins directly related to drug resistance under hypoxia condition.

Methods

Gastric cancer cells were treated with 5-FU in hypoxia/normoxic environment, and were divided into a Normoxic+5-FU group and a Hypoxia+5-FU group. The apoptosis assay was conducted by flow cytometry Annexin V/PI double staining. The real-time reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting were used to detect the expression level of hypoxia inducible factor-1α (HIF-1α), multidrug resistance (MDR1) gene, P-glycoprotein (P-gp), and vascular endothelial growth factor (VEGF) which were related to 5-FU drug-resistance. We analyzed the effect of hypoxia on the treatment of gastric cancer with 5-FU.

Results

Compared with the Normoxic+5-FU group, the apoptosis of gastric cancer cells treated with 5-FU in the Hypoxia+5-FU group was significantly reduced (P<0.05), and the expression of apoptosis promoter protein caspase 8 was also decreased. Compared with the the Normoxic+5-FU group, HIF-1α mRNA expression in the Hypoxia+5-FU group was significantly increased (P<0.05), and the mRNA and protein expression levels of MDR1, P-gp and VEGF were also significantly increased (all P<0.05). The increased expression of MDR1, P-gp and VEGF had the same trend with the expression of HIF-1α.

Conclusion

Hypoxia is a direct influencing factor in gastric cancer resistance to 5-FU chemotherapy. Improvement of the local hypoxia microenvironment of gastric cancer may be a new idea for overcoming the resistance to 5-FU in gastric cancer.

Keywords: 5-fluorouracil, drug resistance, hypoxia, P-glycoprotein, vascular endothelial growth factor

Gastric cancer is one of the three main causes of cancer-related deaths with a high incidence[1]. At present, the main treatment of gastric cancer in China is the combination of surgery and chemotherapy/radiotherapy. Advanced gastric cancer still relies heavily on chemotherapy. However, previous chemotherapy-based treatment can only improve the median survival time of patients with advanced gastric cancer by 7 to 11 months[2]. Chemotherapy resistance is the main reason for treatment failure. There are 3 main reasons of chemotherapy resistance: pharmacokinetic resistance, tumor cell internal resistance, and tumor microenvironment[3]. Hypoxia is a classic characteristic of the solid tumor microenvironment[4]. The reason for the formation of hypoxia in solid tumors is that the rapid growth of tumors exceeds the rate of blood vessel formation, and the chaotic angiogenesis promotes tumor growth and metastasis. Therefore it forms a vicious circle. Gastric cancer as a classic solid tumor, local tissue grows fast and hypoxia gradually appears[5]. 5-fluorouracil (5-FU) is the classic fluorouracil chemotherapy drug, which is widely used in the chemotherapy of gastric cancer, its main advantage is economic and practical. However, increasingly serious drug resistance causes difficulties in the clinical application of this drug, so it is of great significance to explore the mechanism of 5-FU chemotherapy resistance in gastric cancer.

Hypoxia is the normal local environment of gastric cancer. For solid tumors, does hypoxia affect the response of gastric cancer cells to 5-FU? Hypoxia could activate a series signal transduction in tumor cells through hypoxia inducible factor-1α (HIF-1α). HIF-1α is directly affected by the partial oxygen pressure of solid tumors. It is reported that the expression of HIF-1α is up-regulated under hypoxia microenvironment in many solid tumors, which could cause different changes to adapt the hypoxia environment and keep the tumor cells alive[6]. As the product of multidrug resistance (MDR1) gene, P-glycoprotein (P-gp) protein pumps out chemotherapeutics that enter the cells causing tumor chemotherapy resistance. Will the P-gp protein expression change following the change of HIF-1α when 5-FU is used to treat gastric cancer? Similarly, vascular endothelial growth factor (VEGF) is another important factor in 5-FU chemotherapy resistance of gastric cancer, which is directly related to intratumoral angiogenesis in gastric cancer. Is its expression affected by hypoxia and HIF-1α changes when 5-FU is used? This study aims to investigate whether hypoxia microenvironment affects gastric cancer resistance to 5-FU and to discuss the changes of gene and proteins directly related to drug resistance under hypoxia condition.

1. Materials and methods

1.1. Cell lines and treatment protocol

The cell lines MKN-45 and SGC-7901 were kept in Cuiying Biomedical Research Center of Lanzhou University Second Hospital. Cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (GIBCO, Gaithersberg, MD, USA) supplemented with 10% fetal bovine serum (FBS) (GIBCO, Gaithersberg, MD, USA) and 100 U/mL penicillin, 100 μg/mL streptomycin (Thermo Fisher Scientific, Waltham, MA, USA). Depending on different culture conditions, all the cells were divided into 2 groups: the Normoxic+5-FU group and the Hypoxia+5-FU group. Cells from different groups were collected 72 h later for follow-up experiments.

1.2. Apoptosis assay

1×105 cells of every group were collected for apoptosis detection. According to the manufacturer’s instructions, cells were treated with 500 μL binding buffer, then 5 μL of Annexin V-FITC and 5 μL propidium iodide were added to be incubated for 15 min at room temperature (Annexin V-FITC Apoptosis Detection Kit, SenBeiJia Biological Technology Co, Nanjing, China). Then the detection was conducted by a flow cytometer (Canto, BD, New jersey, USA).The apoptotic promoter protein caspase 8 was also detected as following Western blotting.

1.3. Real-time reverse transcription-polymerase chain reaction

Real-time reverse transcription-polymerase chain reaction (RT-PCR) was conducted to confirm the gene expressions of HIF-1α, MDR1, and VEGF. Total RNA was isolated from cells of different groups using the TRIzol reagent (Invitrogen, Carlsbad, USA). Then the cDNA was synthesized following the manufacturer’s instructions (Thermo Fisher, Carlsbad, USA). RT-PCR of HIF-1α, MDR1, and VEGF were performed using FastStart Universal SYBR Green Master reagent (Rox) (Roche, Basel, Switzerland). RT-PCR was performed using an ABI quantitative PCR model 7300 (Applied Biosystems, Carlsbad, USA). Primers for HIF-1α, MDR1, VEGF, GAPDH were designed as Table 1. The fold change in gene expression was calculated using the 2-ΔΔCt method based on the cycle threshold.

Table 1.

Sequences of primers used for real-time PCR

Genes Sequences (5'-3')
Forward Reverse
HIF-1α TTCCAGTTACGTTCCTTCGATCA TTTGAGGACTTGCGCTTTCA
MDR1 CCCATCATTGCAATAGCAGG TGTTCAAACTTCTGCTCC
VEGF AGGAGGAGGGCAGAATCATCA CTCGATTGGTGGCAGTAGCT
GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA
Open in a new tab

1.4. Western blotting

Cells from different groups were lysed by RIPA (CWBIO, Beijing, China) (100 μL/well) to extract total protein. Protein concentration was measured by a BCA kit(Beyotime, Shanghai, China), 50 μg protein per well was loaded on SDS gels (Life Technologies, Carlsbad, USA) and separated by electrophoresis with molecular weight standards (PR1910-20T, Solarbio, Beijing, China). Then they are transferred into PVDF membranes (Millipore, Chicago, USA), blocked with 5% Skim milk powder for 1 h at 37 ℃ and incubated with antibodies as follows: caspase 8 (1꞉1 000, AC056, Beyotime, Shanghai, China), HIF-1α (1꞉1 000, 13584-1-AP, Proteintech, Wuhan, China), VEGF(1꞉1 000, 19003-1-AP, Proteintech, Wuhan, China) or P-gp (1꞉1 000, ab39256, Abcam, England, UK) and β-actin (1꞉2 000, 60004-1-Ig, Proteintech, Wuhan, China) overnight at 4 ℃. The membrane was washed by TBST thrice and incubated with secondary antibodies (1꞉20 000, ab16284; Abcam, Cambridge, UK) for 1 h at 25 ℃ and detected with Lumigen ECL ultra chemiluminescent reagent (TMA-100, Lumigen, MI, USA), the immunoreactive bands were detected using a gel imager (Bio-Rad, California, USA).

1.5. Statistical analysis

Data were analyzed using SPSS 20.0 software. One-way ANOVA analysis of variance was used to analyze the difference of all statistics. All data were expressed as mean±standard deviation ( x¯ ±s). P<0.05 was considered statistically significant.

2. Results

2.1. Apoptosis of gastric cancer cells treated with 5-FU under hypoxia condition was reduced

For MKN-45 cells, compared with the the Normoxic+5-FU group, apoptosis rate was significantly decreased in the Hypoxia+5-FU group (14.41% vs 81.57%, P<0.05), but the difference was not statistically significant in SGC-7901 cells (51.39% vs 56.12%, Figure 1A-1B). The apoptosis promoter protein caspase 8 was also reduced in the Hypoxia+5-FU group, it was more difficult for gastric cells to enter the apoptotic process under hypoxia condition when treated with 5-FU (Figure 1C).

Figure 1. Effects of hypoxia on apoptosis rate of gastric cancer cells which were treated with 5-FU.

Figure 1

Open in a new tab

A-B: Apoptosis detected by flow cytometry; C: Expression of caspase 8 detected by Western blotting. *P<0.05.

2.2. Expression of HIF-1α mRNA was increased in gastric cancer cells treated with 5-FU under hypoxia condition

The amplification curve of HIF-1α gene had good amplification efficiency and curve fitting (Figure 2A). Compared with the Normoxic+5-FU group, both in MKN-45 (Figure 2B) and SGC-7901 cells (Figure 2C), the mRNA expressions of HIF-1α were significantly increased in the Hypoxia+5-FU group (both P<0.05).

Figure 2. Effects of hypoxia on the expression of HIF-1α mRNA in gastric cancer cells treated with 5-FU.

Figure 2

Open in a new tab

A: Amplification curve of HIF-1α by RT-PCR; B: Relative expression of HIF-1α mRNA in MKN-45 cells; C: Relative expression of HIF-1α mRNA in SGC-7901 cells. *P<0.05.

2.3. Expression of MDR1 mRNA was increased in gastric cancer cells treated with 5-FU under hypoxia condition

The amplification curve of MDR1 gene had good amplification efficiency and curve fitting (Figure 3A). Compared with the Normoxic+5-FU group, the mRNA expressions of MDR1 in MKN-45 cells (Figure 3B) and SGC-7901 cells (Figure 3C) in the Hypoxia+5-FU group were increased significantly (both P<0.05), and the protein expressions of P-gp in MKN-45 cells and SGC-7901 cells in the Hypoxia+5-FU group were also increased significantly (Figure 3D). The protein expressions of P-gp showed the same trend as MDR1 mRNA in MKN-45 and SGC-7901 cells.

Figure 3. Effects of hypoxia on the expression of MDR1 gene and P-gp protein in gastric cancer cells treated with 5-FU.

Figure 3

Open in a new tab

A: Amplification curve of MDR1 by RT-PCR; B: Relative expression of MDR1 mRNA in MKN-45 cells; C: Relative expression of MDR1 mRNA in SGC-7901 cells; D: Expression of P-gp protein in MKN-45 and SGC-7901 cells. *P<0.05.

2.4. Expression of VEGF mRNA was increased in gastric cancer cells treated with 5-FU under hypoxia condition

The amplification curve of VEGF gene had good amplification efficiency and curve fitting (Figure 4A). Compared with the Normoxic+5-FU group, the mRNA expressions of VEGF in MKN-45 (Figure 4B) and SGC-7901 cells (Figure 4C) in the Hypoxia+5-FU group were increased significantly (both P<0.05), and the protein expressions of VEGF in MKN-45 cells and SGC-7901 cells in the Hypoxia+5-FU group were also increased (Figure 4D).

Figure 4. Effects of hypoxia on the expression of VEGF in gastric cancer cells treated with 5-FU.

Figure 4

Open in a new tab

A: Amplification curve of VEGF by RT-PCR; B: Relative expression of VEGF mRNA in MKN-45 cells; C: Relative expression of VEGF mRNA in SGC-7901 cells; D: Expression of VEGF protein in MKN-45 and SGC-7901 cells. *P<0.05.

3. Discussion

The problem of drug resistance is becoming more serious and the treatment of patients with advanced gastric cancer is becoming more difficult[7]. The drug resistance of 5-FU is particularly prominent in the current limited clinical application[8]. Hypoxia is an important cause of chemotherapy resistance in solid tumors[9]. There are few in-depth researches about the effect of hypoxia on 5-FU drug resistance in gastric cancer. It is not clear which gene and protein changes are the main factors causing resistance to 5-FU chemotherapy in gastric cancer.

High expression of HIF-1 is a common phenomenon in solid tumors, which may be caused by hypoxia within the tumor[10]. HIF-1 was first discovered by Semenza, et al[11] in the nuclear extract of hypoxic early tumor cells in 1999. The α subunit is the functional subunit of HIF-1, it is continuously synthesized under normal oxygen condition and will soon be degraded by the ubiquitin protease system and that β subunit is continuously expressed, so the synthesis of HIF-1 mainly depends on α subunit. However, under hypoxic condition, the ubiquitin protease system is inhibited, HIF-1α degradation is reduced, and it forms a dimer with the β subunit. This dimer becomes a hypoxic transcription factor and combines with hypoxia response elements (HRE) to play an important role in regulating downstream genes. It helps tumor cells survive in a hypoxic environment and makes tumor cells adapt to the hypoxic microenvironment[12]. Clinically, the 5-year survival rate of HIF-1α positive patients is significantly lower than that of HIF-1α negative patients[13].

This study has explored if the hypoxic microenvironment affected the expression of HIF-1α and MDR1/VEGF during 5-FU chemotherapy in gastric cancer. We also have explored if there has some associations between changes of multidrug resistance-related genes/proteins and HIF-1α when gastric cancer is treated with 5-FU under hypoxia. Compared with the Normoxic+5-FU group, both the apoptosis rate of gastric cancer cells and the expression of apoptosis promoter protein caspase 8 are decreased in the Hypoxia+5-FU group, which indicated that hypoxia environment is indeed the cause of the resistance of gastric cancer cells during 5-FU chemotherapy. In the hypoxic environment, gastric cancer cells are less likely to initiate apoptosis when they received 5-FU intervention. The results of this study have suggested whether HIF-1α or MDR1/VEGF (including both mRNA and protein) are significantly increased in the Hypoxia+5-FU group, indicating that hypoxia affect the expression of HIF-1α/MDR1/VEGF when 5-FU is applied. This results also suggest that improving the hypoxia environment in solid tumors could improve the chemotherapy resistance of gastric cancer treated with 5-FU.

The “drug pump protein” theory is one of the more widely recognized theories in the study of multidrug resistance mechanisms[14]. P-gp is a transmembrane pump with ATPase activity. It is the encoded product of MDR1. When chemotherapeutic drugs enter the tumor cells, P-gp uses the energy of ATP enzyme to actively pumping drugs out of the cells, so the entering chemotherapeutic drugs are continuously ejected, resulting in drug resistance[15]. Overexpression of P-gp protein means that tumor cells develop inherent resistance. Many studies[16-17] devote to reverse MDR1-mediated drug resistance by inhibiting P-gp function, but the available methods are limited and the side effects of some methods are big. Therefore, this kind of solution is difficult in practical application, and the ideal effect cannot be obtained. Li, et al[18] have reported that HIF-1α silencing significantly reduce the expression of MDR1, suggesting that MDR1 is a response gene of HIF-1α. Our results have showed that when 5-FU is used for chemotherapy, there is a positive correlation between HIF-1α expression and MDR1/P-gp axis (including both mRNA and protein) in anoxic gastric cancer cells. There is a clear relationship between chemotherapy resistance of 5-FU and HIF-1α expression in gastric cancer, while hypoxia was the direct factor causing HIF-1α expression increased. Therefore, improving the hypoxia environment may be a new perspective to reduce 5-FU resistance of gastric cancer caused by P-gp pump.

VEGF, another important gene that affects the development of gastric cancer and the efficacy of chemotherapy, is also closely related to the expression of HIF-1α[19]. In this study, when 5-FU was used to treat gastric cancer under hypoxic condition, both HIF-1α and VEGF showed a significant upward trend than under normoxia condition, and they were positively correlated. Overexpressed HIF-1α binds to the β subunit to form a dimer, which is a powerful factor for activating downstream related genes. Since VEGF gene is directly related to the occurrence and development of tumor neovascularization, it is currently the strongest factor to promote vascular growth[20]. Anti-angiogenic therapy is one of the promising strategies for many types of solid cancers[21]. The up-regulation of VEGF results in increased angiogenesis and increased drug resistance[22]. Our study has showed that improving hypoxia can also reduce the expression of VEGF expression, which may be a new idea to improve the effect of 5-FU chemotherapy in gastric cancer.

In summary, hypoxia is a direct influencing factor in gastric cancer resistance to 5-FU chemotherapy. In order to overcome the resistance to 5-FU in gastric cancer, improving the local hypoxia microenvironment of gastric cancer maybe a new idea. But it needs to further explore in animal models.

Funding Statement

This work was supported by the National Natural Science Foundation (31801194) and the Scientific and Technological Innovation Program of Lanzhou University Second Hospital (CY2017-QN05), China.

Conflict of Interest

The authors declare that they have no conflicts of interest to disclose.

AUTHORS’CONTRIBUTIONS

WANG Lu Research design, experimental operation, and paper writing; XING Wei and QI Jin Image collection and statistical analysis; LU Yongyan and XIANG Linbiao Experimental operation and data analysis; ZHOU Yali Research design and paper revision. All authors have read and agreed to the final text.

Note

http://xbyxb.csu.edu.cn/xbwk/fileup/PDF/2022121629.pdf

References

  • 1. Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249. 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]
  • 2. Kim R, An M, Lee H, et al. Early tumor-immune microenvironmental remodeling and response to first-line fluoropyrimidine and platinum chemotherapy in advanced gastric cancer[J]. Cancer Discov, 2022, 12(4): 984-1001. 10.1158/2159-8290.CD-21-0888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Mazánková D, Bárková V, Mazánek P. Metronomic therapy in the treatment of cancer[J]. Ceska Slov Farm, 2022, 71(3): 91-97. [PubMed] [Google Scholar]
  • 4. Chen GQ, Wu KW, Li H, et al. Role of hypoxia in the tumor microenvironment and targeted therapy[J]. Front Oncol, 2022, 12: 961637. 10.3389/fonc.2022.961637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Han YL, Chen L, Qin R, et al. Lysyl oxidase and hypoxia-inducible factor 1α: biomarkers of gastric cancer[J]. World J Gastroenterol, 2019, 25(15): 1828-1839. 10.3748/wjg.v25.i15.1828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Choudhry H, Harris AL. Advances in hypoxia-inducible factor biology[J]. Cell Metab, 2018, 27(2): 281-298. 10.1016/j.cmet.2017.10.005. [DOI] [PubMed] [Google Scholar]
  • 7. Komatsu Y, Hironaka S, Tanizawa Y, et al. Treatment pattern for advanced gastric cancer in Japan and factors associated with sequential treatment: A retrospective administrative claims database study[J]. Adv Ther, 2022, 39(1): 296-313. 10.1007/s12325-021-01931-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Danesh Pouya F, Rasmi Y, Nemati M. Signaling pathways involved in 5-FU drug resistance in cancer[J]. Cancer Invest, 2022, 40(6): 516-543. 10.1080/07357907.2022.2055050. [DOI] [PubMed] [Google Scholar]
  • 9. Graham K, Unger E. Overcoming tumor hypoxia as a barrier to radiotherapy, chemotherapy and immunotherapy in cancer treatment[J]. Int J Nanomedicine, 2018, 13: 6049-6058. 10.2147/IJN.S140462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Singh D, Arora R, Kaur P, et al. Overexpression of hypoxia-inducible factor and metabolic pathways: possible targets of cancer[J]. Cell Biosci, 2017, 7: 62. 10.1186/s13578-017-0190-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Semenza GL. Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1[J]. Annu Rev Cell Dev Biol, 1999, 15: 551-578. 10.1146/annurev.cellbio.15.1.551. [DOI] [PubMed] [Google Scholar]
  • 12. Cowman SJ, Koh MY. Revisiting the HIF switch in the tumor and its immune microenvironment[J]. Trends Cancer, 2022, 8(1): 28-42. 10.1016/j.trecan.2021.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Bhattarai D, Xu XZ, Lee K. Hypoxia-inducible factor-1 (HIF-1) inhibitors from the last decade (2007 to 2016): A structure-activity relationship perspective[J]. Med Res Rev, 2018, 38(4): 1404-1442. 10.1002/med.21477. [DOI] [PubMed] [Google Scholar]
  • 14. Waghray D, Zhang QH. Inhibit or evade multidrug resistance P-glycoprotein in cancer treatment[J]. J Med Chem, 2018, 61(12): 5108-5121. 10.1021/acs.jmedchem.7b01457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Mollazadeh S, Sahebkar A, Hadizadeh F, et al. Structural and functional aspects of P-glycoprotein and its inhibitors[J]. Life Sci, 2018, 214: 118-123. 10.1016/j.lfs.2018.10.048. [DOI] [PubMed] [Google Scholar]
  • 16. Joshi P, Vishwakarma RA, Bharate SB. Natural alkaloids as P-gp inhibitors for multidrug resistance reversal in cancer[J]. Eur J Med Chem, 2017, 138: 273-292. 10.1016/j.ejmech.2017.06.047. [DOI] [PubMed] [Google Scholar]
  • 17. Halder J, Pradhan D, Kar B, et al. Nanotherapeutics approaches to overcome P-glycoprotein-mediated multi-drug resistance in cancer[J]. Nanomed-Nanotechnol Biol Med, 2022, 40: 102494. 10.1016/j.nano.2021.102494. [DOI] [PubMed] [Google Scholar]
  • 18. Li Z, Cheng GT, Zhang Q, et al. PX478-loaded silk fibroin nanoparticles reverse multidrug resistance by inhibiting the hypoxia-inducible factor[J]. Int J Biol Macromol, 2022, 222(Pt B): 2309-2317. 10.1016/j.ijbiomac.2022.10.018. [DOI] [PubMed] [Google Scholar]
  • 19. Lee LT, Wong YK, Chan MY, et al. The correlation between HIF-1 alpha and VEGF in oral squamous cell carcinomas: expression patterns and quantitative immunohistochemical analysis[J]. J Chin Med Assoc, 2018, 81(4): 370-375. 10.1016/j.jcma.2017.06.025. [DOI] [PubMed] [Google Scholar]
  • 20. Roskoski R. Vascular endothelial growth factor (VEGF) and VEGF receptor inhibitors in the treatment of renal cell carcinomas[J]. Pharmacol Res, 2017, 120: 116-132. 10.1016/j.phrs.2017.03.010. [DOI] [PubMed] [Google Scholar]
  • 21. Nienhüser H, Schmidt T. Angiogenesis and anti-angiogenic therapy in gastric cancer[J]. Int J Mol Sci, 2017, 19(1): 43. 10.3390/ijms19010043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Itatani Y, Kawada K, Yamamoto T, et al. Resistance to anti-angiogenic therapy in cancer-alterations to anti-VEGF pathway[J]. Int J Mol Sci, 2018, 19(4): 1232. 10.3390/ijms19041232. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Central South University Medical Sciences are provided here courtesy of Central South University

RESOURCES