Skip to main content
NCBI home page
Journal of Central South University Medical Sciences logoLink to Journal of Central South University Medical Sciences
. 2023 Jan 28;48(1):1–14. doi: 10.11817/j.issn.1672-7347.2023.220082

Ozonated oil alleviates dinitrochlorobenzene-induced allergic contact dermatitis via inhibiting the FcεRI/Syk signaling pathway

医用臭氧油通过抑制FcεRI/Syk信号通路缓解DNCB诱导的变应性接触性皮炎（英文）

FU Zhibing 1,2,1, XIE Yajie 1,2, ZENG Liyue 3, GAO Lihua 1,2, YU Xiaochun 1,2, TAN Lina 1,2, ZHOU Lu 1,2, ZENG Jinrong 1,2,✉, LU Jianyun 1,2,✉
Editor: TIAN Pu
PMCID: PMC10930564  PMID: 36935172

Abstract

Objective

Ozone is widely applied to treat allergic skin diseases such as eczema, atopic dermatitis, and contact dermatitis. However, the specific mechanism remains unclear. This study aims to investigate the effects of ozonated oil on treating 2,4-dinitrochlorobenzene (DNCB)-induced allergic contact dermatitis (ACD) and the underling mechanisms.

Methods

Besides the blank control (Ctrl) group, all other mice were treated with DNCB to establish an ACD-like mouse model and were randomized into following groups: a model group, a basal oil group, an ozonated oil group, a FcεRI-overexpressed plasmid (FcεRI-OE) group, and a FcεRI empty plasmid (FcεRI-NC) group. The basal oil group and the ozonated oil group were treated with basal oil and ozonated oil, respectively. The FcεRI-OE group and the FcεRI-NC group were intradermally injected 25 µg FcεRI overexpression plasmid and 25 µg FcεRI empty plasmid when treating with ozonated oil, respectively. We recorded skin lesions daily and used reflectance confocal microscope (RCM) to evaluate thickness and inflammatory changes of skin lesions. Hematoxylin-eosin (HE) staining, real-time PCR, RNA-sequencing (RNA-seq), and immunohistochemistry were performed to detct and analyze the skin lesions.

Results

Ozonated oil significantly alleviated DNCB-induced ACD-like dermatitis and reduced the expressions of IFN-γ, IL-17A, IL-1β, TNF-α, and other related inflammatory factors (all P<0.05). RNA-seq analysis revealed that ozonated oil significantly inhibited the activation of the DNCB-induced FcεRI/Syk signaling pathway, confirmed by real-time PCR and immunohistochemistry (all P<0.05). Compared with the ozonated oil group and the FcεRI-NC group, the mRNA expression levels of IFN-γ, IL-17A, IL-1β, IL-6, TNF-α, and other inflammatory genes in the FcεRI-OE group were significantly increased (all P<0.05), and the mRNA and protein expression levels of FcεRI and Syk were significantly elevated in the FcεRI-OE group as well (all P<0.05).

Conclusion

Ozonated oil significantly improves ACD-like dermatitis and alleviated DNCB-induced ACD-like dermatitis via inhibiting the FcεRI/Syk signaling pathway.

Keywords: ozonated oil; 2,4-dinitrochlorobenzene; allergic contact dermatitis; FcεRI/Syk signaling pathway

Allergic contact dermatitis (ACD) is an eczema-like inflammatory skin disease caused by re-exposure to the same chemical substance after exposure to certain exogenous substances. ACD has a reported incidence as high as 20%, and its occurrence is mainly related to genetic susceptibility and environmental exposure[1]. The clinical manifestations of ACD include erythema with clear boundaries, papules, blisters, exudation, erosion, and/or scabs, the scope of which is consistent with the contact site, and often accompanied by itching, typically involving the hands and face[2-3]. The pathogenesis of ACD is a classic delayed-type hypersensitivity reaction, with 3 stages: sensitization, challenge, and resolution. Immune cells play a role in all 3 stages[4]. The involvement of Th1, Th2, and Th17 cells in the pathogenesis of ACD is well documented, but some of their specific mechanisms remain unclear. Therefore, it is crucial to clarify the role of immune response in ACD. Meanwhile, there has been a research[5] suggesting that the cross-linking of a multivalent FcεRI antigen can cause the skin immune response.

FcεRI is a cell surface receptor composed of polymer proteins that bind to the Fc fragment of IgE with high affinity. FcεRI consists of an α chain containing 2 extracellular immunoglobulin domains, a signal-enhanced β chain containing an immunoreceptor tyrosine-based activation motif (ITAM), and 2 identical disulfide-linked γ chains[6]. FcεRI is considered a key regulator of IgE-mediated immediate and late allergic reactions. Crosslinking of FcεRI by IgE and antigen results in the downstream signal cascade that releases pre-formed mediators (such as histamine, protease) and synthesizes lipid mediators within a few minutes[7-8]. In turn, these events produce immediate allergic reactions characterized by vasodilation, increased vascular permeability, upregulation of vascular adhesion molecules, and bronchial contraction[7, 9]. In addition, long-term stimulation can promote the production of cytokines and chemokines and induce neutrophils, eosinophils, and basophils to aggregate at local inflammatory sites and activate T cells, resulting in delayed allergic reactions[6]. Once FcεRI is crosslinked with an antigen, it triggers intracellular cascade reactions such as phosphorylation of spleen tyrosine kinase (Syk), Ca2+ influx, activation of protein kinase C, and nuclear factor-κB (NF-κB) transcription, resulting in immune cell activation[10]. The binding of IgE and FcεRI is pivotal for triggering allergic reactions[11], and Syk is a key signaling protein that activates downstream signal transduction[12]. The β and γ subunits of FcεRI contain ITAM in the cytoplasmic tail[13], and binding of antigens and antibodies or simple aggregation of FcεRI facilitates the phosphorylation of ITAM tyrosine residues by Lyn or other Src family members[14-15]. The combination of the SH2 domain of Syk with phosphorylated ITAM allows Syk to maintain an open conformation with increased Syk enzyme activity and autophosphorylation, resulting in the direct binding of Syk to diverse molecules, eventually activating downstream signaling pathways and leading to various cellular responses[16].

In our previous studies[17-19] assessing ozone, we have observed that ozonides possess potent oxidation properties, which can destroy microorganisms, reduce IgE, regulate inflammatory mediators, and promote wound healing without marked toxicity and side effects. Ozonated oil can provide reactive oxygen species, as well as maintain therapeutically active ozone derivatives for a prolonged period[19]. This study aims to investigate the effects and mechanism of ozonated oil during the treatment of 2,4-dinitrochlorobenzene (DNCB)-induced ACD.

1. Materials and methods

1.1. Animal modeling

Eight-week-old male BALB/c mice were purchased from Hunan SJA Laboratory Animal Co., Ltd. and were reared in a specific pathogen-free environment at the Animal Experiment Center of Central South University. All experimental protocols were reviewed and approved by the Experimental Animal Welfare Ethics Committee of the Central South University (20203ydw0900).

Each group was composed of 5 mice. In addition to the Ctrl (Ctrl) group (no intervention), all other mice were treated with DNCB to establish an ACD-like mouse model and were randomized into the following groups: 1) Model group: only DNCB administered for modeling; 2) Basal oil group: basal oil was applied after successful modeling; 3) Ozonated oil group: ozonated oil was applied after successful modeling; 4) FcεRI- overexpression plasmid (FcεRI-OE) group: ozonated oil and intradermal injection of FcεRI-OE after successful modeling; 5) FcεRI empty plasmid (FcεRI-NC) group: ozonated oil was applied and FcεRI-NC was injected intradermally.

The model was established in 2 stages. Sensitization period: An approximate 2 cm × 2 cm area of abdominal hair was removed. On the first day of the experiment, 30 μL of 7% DNCB solution (acetone solution was used to dissolve DNCB) was applied to the depilated abdominal area of the mice in the experimental group for sensitization. Intensification was performed on day 2. On Day 7, an area of approximately 2 cm × 3 cm on the dorsal surface of each mouse was depilated. Provocation period: On Day 8, 30 μL of 1% DNCB solution was smeared on the depilated dorsal surface of mice, once every 48 h. The mouse model was successfully established when ACD-like dermatitis symptoms, including erythema, exudation, erosion, and scabs, were observed on the dorsal surface.

1.2. Intervention therapy using ozonated oil

After establishing ACD mice, the Ctrl group and the model group received no intervention. The basal oil group and the ozonated oil group were applied the same amount of basal oil and ozonated oil, respectively; both basal oil and ozonated oil (20160522, with an approximate peroxide value of 2 000 to 2 200 mmol/kg; Hunan Health Care Technology, Changsha, China) were provided by Hunan Haizhi Medical Technology and applied once daily (30 µL each time, for 4 consecutive days). Changes in skin lesions were observed and photographed daily. After treatment, the mice were weighed and the thickness of skin lesions and inflammatory changes in target areas of mice were evaluated by reflectance confocal microscope (RCM). In addition, cervical dislocation was used to euthanize mice, and their spleens were aseptically removed, and the weight of the spleen was measured using a small electronic weighing device. Digital photographs were then taken. Subsequently, skin lesions were employed for hematoxylin-eosin (HE) staining, real-time PCR, RNA-sequencing (RNA-seq), and immunohistochemical experiments.

1.3. Intervention using FcεRI overexpression plasmid

The ozonated oil group, the FcεRI-OE group, and the FcεRI-NC group were treated with ozonated oil once daily, 30 µL each time, for 4 consecutive days. The FcεRI-OE group and the FcεRI-NC group were intradermally administered 25 µg FcεRI-overexpression plasmid and 25 µg FcεRI empty plasmid (constructed by Nanjing Jinsrui Biotechnology Co., Ltd.), in addition to ozonated oil once daily for 3 consecutive days. Changes in skin lesions were observed and photographed daily. After ozonated oil treatment, mice were weighed and skin lesions were harvested for HE staining, real-time PCR, and immunohistochemistry experiments; the spleen was photographed and weighed.

1.4. RNA isolation and real-time RT-PCR

Each mouse was subjected to a biopsy under general anesthesia, and skin tissue samples were taken. The skin tissue samples were collected perpendicular to the surface of the skin, so there was epidermis, dermis, and hypodermis in the tissues.Total RNA was isolated from skin tissues using TRIzol reagent (Thermo Fisher Scientific, MA, USA). Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using a miScript II RT Kit (Qiagen, CA, USA). DNA was synthesized from cDNA using the miScript SYBR Green PCR Kit (Qiagen). Real-time PCR was performed in triplicate using an ABI Prism 7500 instrument (Thermo Fisher Scientific). The expression of target mRNA was normalized to that of GAPDH mRNA. Fold-changes were calculated using the 2-ΔΔCt method, using the following formula: ΔΔCt=(Cttarget gene-Ctinternal control)sample-(Cttarget gene-Ctinternal control)control. The primers were purchased from Bio-Rad. The primer sequences used to amplify the mRNAs are listed in Table 1.

Table 1.

Primer sequences used for real-time PCR

Gene Forward (5'-3') Reverse (5'-3')
GAPDH ATGGTGAAGGTCGGTGTGA AATCTCCACTTTGCCACTGC
IL-1β GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG
IL-6 GCTACCAAACTGGATATAATCAGGA CCAGGTAGCTATGGTACTCCAGAA
TNF-α CTGTAGCCCACGTCGTAGC TTGAGATCCATGCCGTTG
COX2 ATTCCAAACCAGCAGACTCATA CTTGAGTTTGAAGTGGTAACCG
IL-17A ATGCTGTTGCTGCTGCTGAG GGAAGTCCTTGGCCTCAGTG
IFN-γ ACTGGCAAAAGGATGGTG GTTGCTGATGGCCTGATT
FcεRI TGTCTACACGGGCCTGA TGAAGCTACTGGGGTGGT
Syk GACTCACCCTCACAACAGG AGCGAAGACCACACAGATG
Vav2 GCCACATTCAGAGCACCA CCCTCCCTAGCCACCAT
IL-4 TTTTGAACGAGGTCACAGG GGCACATCCATCTCCGT
Open in a new tab

1.5. mRNA sequencing

Total RNA was used for library construction, and the total amount was not less than 1 µg. The library was built using the NEBNext ® UltraTM RNA Library Prep Kit. The purified double-stranded cDNA was subjected to various modifications and screenings, followed by PCR amplification; the PCR product was purified again to obtain the library. After construction, the library was tested following preliminary quantification and diluted to 1.5 mg/L. If test results met expectations, real-time reverse transcription PCR (real-time RT-PCR) was used to accurately quantify the effective concentration of the library (higher than 2 nmol/L) and ensure the quality of the library. Finally, sequencing was performed using a computer program.

1.6. Histological analysis

Mouse skin tissues were fixed in formalin and embedded in paraffin. Sections (6 μm) were stained with HE and stored at room temperature. Epidermal thickness was evaluated as a histological feature. The epidermal area was outlined for measuring epidermal thickness, and its pixel size was measured using the lasso tool in Adobe Photoshop CS4. The relative epidermal area was calculated using the following formula: area=pixels/ (horizontal resolution × vertical resolution).

1.7. Immunohistochemical staining

Skin tissues were fixed overnight in formalin at room temperature and embedded in paraffin. After deparaffinization and antigen retrieval, the tissues were incubated for 1 h at 37 ℃ with primary antibodies, rabbit anti-Syk (1꞉200; AiFang biological, catalog AF03584), and rabbit anti-FcεRI (1꞉100; Affinity, catalog DF6650). Then, samples were washed and incubated for 20 min with the appropriate conjugated secondary antibodies and Opal 690 Fluorophore (NEL821001KT, PerkinElmer, USA), respectively. After washing with PBST, the slides were counterstained with DAPI. Finally, image analysis was performed using a fluorescent microscope DMI 4000B (Leica Microsystems, Germany) and Leica Qwin Std analysis software.

1.8. Statistical analysis

All diagrams and graphs of related data were generated using GraphPad Prism 8.0, and the data values were presented as the mean±standard deviation. Data analysis was performed using one-way ANOVA followed by Tukey’s multiple comparison test or independent sample t-test. P<0.05 was considered statistically significant.

2. Results

2.1. Ozonated oil significantly ameliorates DNCB-induced ACD-like dermatitis

Following DNCB-induced activation after an interval of 48 h, the experimental groups mice showed varying degrees of erythema, edge edema, and scabs on the dorsal surface when compared with the Ctrl group, indicating that the ACD-like dermatitis mouse model was successfully established (Figure 1A). After 5 days of treatment, erythema, edema, and scabs in the dorsal lesion area of mice in the ozonated oil group were significantly improved when compared with the model group and the basal oil group (Figure 1A). Compared with the Ctrl group, the model group showed obvious epidermal scabs, thickening of the spinous layer, and marked dermal inflammatory cell infiltration. However, following ozonated oil treatment, no obvious epidermal scabs were observed, the spinous layer was significantly thinner, and the degree of intradermal inflammatory cell infiltration was significantly reduced when compared with the model group and the basal oil group (Figure 1B). Simultaneously, we employed RCM to compare changes in skin lesions in the 4 groups following 5 days of treatment, and the results were consistent with pathological manifestations of the skin lesions (Figure 1C). The epidermis of the model group was significantly thicker than that of the Ctrl group (P<0.001, Figure 1D). Compared with the model group and the basal oil group, the epidermal thickness decreased significantly after ozonated oil treatment (P<0.001, Figure 1D). In addition, compared with the Ctrl group, mice in the model group showed significant splenomegaly and an increased spleen index [spleen/body weight (mg/g)]; compared with the model group and the basal oil group, the ozonated oil group revealed significantly improved splenomegaly (Figure 1E) and a significantly decreased spleen index (P<0.001, Figure 1F). Real-time PCR analysis revealed that ozonated oil therapy significantly inhibited the expression of various ACD-related inflammatory genes, including IFN-γ related to Th1 cells, IL-17A related to Th17 cells, and genes related to the pro-inflammatory effects of diverse immune cells, such as IL-1β, IL-6, TNF-α, and COX-2 (all P<0.001, Figure 1G).

Figure 1. Ozone oil can significantly alleviate ACD-like dermatitis induced by DNCB in mice.

Figure 1

Open in a new tab

A: Phenotypic changes in dorsal skin lesions of mice in 4 groups after modeling and ozone intervention; B: Histopathological changes in dorsal skin lesions of mice in 4 groups evaluated by HE staining; C: Changes in dorsal skin lesions of mice in 4 groups evaluated by RCM (red arrows represent vasodilation and yellow arrows represent inflammatory cells); D: Statistical analysis of RCM analysis to compare the epidermal thickness of mice in 4 groups (n=3); E: Splenic size of mice in each group; F: Spleen index [spleen/body weight (mg/g)] of mice in each group (n=3); G: Ozonated oil inhibits the expression of related inflammatory mediators in ACD-like dermatitis (n=3). ***P<0.001. ACD: Allergic contact dermatitis; DNCB: 2,4-dinitrochlorobenzene; HE: Hematoxylin-eosin; RCM: Reflectance confocal microscopy.

2.2. RNA-seq analysis of the ozonated oil mechanism in the treatment of ACD-like dermatitis

We observed that 3 112 genes were upregulated and 2 281 genes were downregulated in the model group when compared with the Ctrl group (Figure 2A). Moreover, the RNA-seq results of the Kyoto encyclopedia of genes and genomes (KEGG) enrichment pathway revealed that some inflammation-related signaling pathways were significantly activated, including the NF-κB, FcεRI, and TNF signaling pathways (Figure 2B). Furthermore, compared with the basal oil group, ozonated oil treatment upregulated 873 genes and downregulated 714 genes (Figure 2C). The FcεRI signaling pathway was activated in the model group but was inhibited following ozonated oil treatment (Figure 2D).

Figure 2. Investigation and verification of ozonated oil therapy on ACD-related signaling pathways.

Figure 2

Open in a new tab

A: Based on transcriptional analysis, 3 112 genes are upregulated and 2 281 genes are downregulated in the model group when compared with the Ctrl group. B: Compared with the Ctrl group, the upregulated KEGG signaling pathway is enriched in the model group. C: Transcription analysis shows that compared with the basal oil group, 873 genes are upregulated and 714 genes are downregulated in the ozonated oil group. D: Compared with the model group, the downregulated KEGG signaling pathway is enriched in the ozonated oil group. KEGG: Kyoto Encyclopedia of Genes and Genomes.

2.3. Ozonated oil treatment inhibits FcεRI/Syk signaling pathway

The expression levels of FcεRI, Syk, and Vav2 in the FcεRI signaling pathway were upregulated in the model group when compared with the Ctrl group, but downregulated following ozonated treatment. Based on real-time PCR results, ozonated oil treatment reduced the DNCB-induced expression mRNA levels of FcεRI, Syk, and Vav2 (all P<0.05, Figure 3A-3C). Compared with the model group and the basal oil group, ozonated oil treatment significantly reduced the expression levels of DNCB-induced FcεRI and Syk in the immunohistochemical staining (Figure 3D).

Figure 3. Investigation and verification of ozonated oil therapy on ACD-related signaling pathways.

Figure 3

Open in a new tab

A: mRNA expression of FcεRI in skin lesions; B: mRNA expression of Syk in the skin lesions; C: mRNA expression of Vav2 in the skin lesions; D: Immunohistochemical staining of skin lesions. *P<0.05, **P<0.01, ***P<0.001. ACD: Allergic contact dermatitis.

2.4. Overexpression of FcεRI partially blocks the therapeutic effect of ozonated oil

2.4.1. Effect of intradermal injection of FcεRI- overexpression plasmid on ozonated oil treatment for ACD-like dermatitis

To further confirm that ozone oil can treat ACD via the FcεRI/Syk signaling pathway, we administered FcεRI-OE and FcεRI-NC plasmids to the DNCB-induced ACD model with the simultaneous application of ozonated oil (Figure 4A). As expected, clinical and histopathological features showed that skin lesions in the FcεRI-OE group were significantly more severe than those in the ozonated oil group and the FcεRI-NC group, along with slower recovery of erythema, edema, and scabs; epidermal scabs, spinous layer thickness, and dermal inflammatory cell infiltration were also more evident (Figure 4B, 4C). Meanwhile, splenomegaly was more significant in the FcεRI-OE group than in the ozonated oil group and the FcεRI-NC group (Figure 4D, 4E).

Figure 4. Effect of intradermal injection of FcεRI overexpression plasmid on ozonated oil treatment of ACD.

Figure 4

Open in a new tab

A: Schematic diagram of subcutaneous administration of FcεRI-OE and FcεRI-NC plasmids in ACD mice on Day 1, 2, and 3 of treatment; B-E: Changes in skin lesion phenotype (B) and HE staining (C) on the dorsal surface of mice injected with FcεRI-OE or FcεRI-NC and mice in the ozonated oil group, as well as the mouse spleen size (D) and spleen index (E). ***P<0.001. ACD: Allergic contact dermatitis; HE: Hematoxylin-eosin; OE: Overexpression plasmid; NC: Empty plasmid.

2.4.2. Overexpression of FcεRI blocks the inhibitory effect of ozonated oil on FcεRI/Syk signaling pathway

Further real-time PCR assessment of skin lesions revealed the absence of significant differences in mRNA expression levels of FcεRI, Syk, and Vav2 between the ozonated oil group and the FcεRI-NC group. However, compared with the ozonated oil group and the FcεRI-NC group, the expression levels of FcεRI and Syk in the FcεRI-OE group were significantly increased (all P<0.05, Figure 5A-5C). In addition, immunohistochemical results showed that expression levels of FcεRI and Syk protein were significantly higher in the FcεRI-OE group than those in the ozonated oil group and the FcεRI-NC group (Figure 5D).

Figure 5. Evaluation of intradermal injection of FcεRI overexpression plasmid on ozonated oil treatment of ACD .

Figure 5

Open in a new tab

A-C: mRNA expression of FcεRI, Syk, and Vav2 in skin lesions of each group, treated with ozonated oil while receiving no plasmid intervention, intradermal injection of FcεRI-NC and FcεRI-OE plasmids (n=3); D: Immunohistochemical staining of skin lesions; E-J: mRNA expression levels of IFN-γ, IL-17A, IL-1β, IL-6, TNF-α, and COX2 in skin lesions of each group, treated with ozonated oil while receiving no plasmid intervention, FcεRI-NC, and FcεRI-OE intradermal injection (n=3). *P<0.05, **P<0.01. ACD: Allergic contact dermatitis; IFN-γ: Interferon-γ; IL: Interleukin; TNF-α: Tumor necrosis factor-α; COX2: Cyclooxygenase2; OE: Overexpression plasmid; NC: Empty plasmid.

2.4.3. FcεRI overexpression plasmid promotes the expression of ACD-related inflammatory mediators

We also verified the mRNA expression levels of ACD-related inflammatory mediators, revealing no significant difference in the mRNA expression levels of IFN-γ, IL-17A, IL-1β, IL-6, TNF-α, and COX-2 inflammatory genes between the 2 groups (all P>0.05). However, the expression levels of these inflammatory genes were significantly increased in the FcεRI-OE group when compared with the ozonated oil group and the FcεRI-NC group (P<0.05, Figure 5E-5J).

3. Discussion

Medical ozone therapy is a non-invasive, non-pharmacological, side-effect-free, and low-cost medical treatment. Topical ozone therapy for skin diseases can be used alone or in combination with existing conventional treatments. This therapeutic strategy possesses multiple functions, such as anti-inflammatory and bacteriostasis, tissue repair, and immune regulation, which can greatly reduce side effects induced by antibiotics and hormones and decrease the generation of drug-resistant strains. Clinical application of ozone can greatly reduce the social and family economic burden and confer superior ecological benefits, thus indicating its critical research value.

ACD is a classic type IV hypersensitivity, and its pathogenesis involves complex congenital and acquired immune responses. Traditionally, the classical effector cells of ACD are CD8+ T cells and Th1 cells that secrete IFN-γ. However, later study[21] has revealed that Th2, Th17, and Th22 cells may also be involved in the pathogenesis of ACD. Although ACD is a T-cell-mediated skin inflammatory state, immune cells such as Kupffer cells (KCs), dendritic cells (DCs), mast cells, and neutrophils are not only the main factors inducing inflammation during the induction phase[22], but also play an important role in the excitation phase. Accordingly, our results suggest that ozonated oil therapy could alleviate ACD by reducing the in vivo expression of inflammatory signaling molecules, such as IFN-γ, IL-17, IL-1β, IL-6, TNF-α, COX2, and other inflammatory mediators. Studies[23-24] have shown that, following skin stimulation by antigens, DCs and KCs are induced to secrete pro-inflammatory cytokines, including IL-1β, TNF-α, IL-6, TNF-α, IL-6, and COX2. These cytokines then activate neutrophils and mast cells, resulting in the upregulation of chemokines, matrix metalloproteinases (MMPs), and endothelial adhesion molecules, as well as the downregulation of epidermal adhesion factor (E-cadherin), facilitating the migration of DCs to the skin draining lymph nodes (dLN).

In this study, the results revealed that ozonated oil treatment could alleviate DNCB-induced ACD by inhibiting the FcεRI/Syk signaling pathway. IgE-dependent upregulation of FcεRI is a potentially important positive amplification loop that increases the IgE concentration in the circulation or tissues of patients with allergic diseases[7]. The ACD reaction can be reconstructed using different specific IgE molecules, indicating that IgE has an antigen-dependent effect through FcεRI in ACD, which could be attributed to the effect of monomer IgE on FcεRI expression or the production of cytokines by immune cells[6]. In patients with allergies, mast cells and other cell types link antigen-specific IgE with FcεRI. Re-exposure to bivalent or multivalent antigens of original or cross-reaction will induce the crosslinking of adjacent FcεRI-bound IgE, resulting in the surface aggregation of FcεRI. When FcεRI aggregates with sufficient intensity and duration, it triggers mast cells and basophils to initiate complex signaling events, eventually resulting in the secretion of a group of different bioactive products[25-27]. Based on different antigen-binding protein subtypes, signal transduction induced by FcεRI crosslinking can upregulate or downregulate the production of Th1 cell polarization factors[6]. For example, studies in mast cell-deficient mice have revealed that inflammatory cytokines released from mast cells after binding to FcεRI, such as TNF-α and macrophage inflammatory protein-2 (MIP-2), play a key role in leukocyte migration and infiltration, including T cell infiltration.

Antigen-induced activation of proximal FcεRI-related Scr kinases (such as Fyn and Lyn) leads to phosphorylation of Syk, which is the activated central tyrosine kinase of mast cells. Immunoelectron microscopy study[28] have shown that FcεRI crosslinking results in a marked increase in the number of Syk associated with plasma membrane receptors. In turn, Syk phosphorylation stimulates linker for activation of T cells (LAT) and phospholipase C (PLC) γ and activates several downstream signaling molecules, including mitogen-activated protein kinase (MAPK), protein kinase B (Akt), and IkB kinase (IKK)/NF-κB, which are essential for allergic reactions[29-30]. Syk plays an important role in FcεRI-mediated calcium influx and secretion, cytokine production, and cell degranulation[31-32]. Moreover, Syk-deficient mast cells fail to induce Ca2+ mobilization, degranulation, and activation of nuclear factor of activated T cells (NFAT) or NF-κB. However, Syk transfection of these cells can reconstruct their activation[33]. In the present study, we have observed that ozonated oil treatment could inhibit the FcεRI/Syk signaling pathway, which is located upstream of multiple signaling pathways in cells and plays an important role in sensitization.

Herein, we have investigated the possible mechanisms of ozonated oil in ACD. We have observed that ozonated oil inhibited the expression of ACD-related inflammatory factors and the activation of the FcεRI/Syk signaling pathway. Syk can be directly associated with VAV family members, PLCγ isomers, PI3K and SLP family members (SLP76 and SLP65), and activate downstream signal components, finally triggering various cellular reactions[16]. In addition, VAV protein is necessary for p38 MAPK activation and pro-inflammatory cytokine production. In a study assessing MyD88, the dependent oxidative burst mechanism, it was determined that VAV protein is the key activator of Rac, p38, and AKT and that the VAV family plays a key role in the production of MyD88-dependent reactive oxygen intermediate (ROI)[34]. We have examined Vav2, a member of the VAV family, which can directly interact with the downstream molecules of Syk, and observed that ozonated oil treatment reduced the expression of DNCB-induced Vav2 expression. The expression of Vav2 was higher in the FcεRI-OE group than in the ozonated oil and FcεRI-NC, but the difference was not statistically significant. This indicates that the regulation of Vav2 in ozonated oil treatment of ACD may not be completely mediated via the FcεRI/Syk signaling pathway, and other ways might play additional roles. The specific mechanism needs to be further investigated. Downstream molecules of the FcεRI/Syk signaling pathway may be related to various cell signaling molecules, including NF-κB. Combined with previous results, we can speculate that the inhibition of NF-κB by ozonated oil may be partly mediated through the inhibition of the FcεRI/Syk signaling pathway, but the correlation between the two has not been comprehensively investigated. In addition, liver kinase B (LKB)1/(AMPK) and Src homology 2 domain-containing protein tyrosine phosphatase (SHP)-1 can negatively regulate the FcεRI/Syk signaling pathway[35-37]. These negative regulators can be potential targets for treating allergic diseases. Whether ozonated oil can also inhibit the FcεRI/Syk signal by activating these negative regulators remains unclear, which can be verified in subsequent experimental studies.

As a new strategy in the medical field, ozone can afford remarkable clinical applications, accelerating its further development. However, basic research on potential mechanisms underlying ozone therapy remains scarce, and several clinical application mechanisms cannot be reasonably explained. The lack of basic mechanistic research renders the available laboratory evidence insufficient and restricts the clinical applications of ozone. Our study has confirmed that ozonated oil can alleviate DNCB-induced ACD-like dermatitis by inhibiting the FcεRI/Syk signaling pathway, providing a theoretical basis for ozonated oil treatment of ACD. Contact allergy is associated with 20%-50% of recognized occupational contact dermatitis. Despite attempts to improve working environments and avoid allergens, many patients with occupational contact dermatitis still experience contact allergies to chronic eczema[38], which seriously affects the quality of life. Therefore, it is necessary to identify new treatments for ACD. As a safe and effective treatment method, the external use of ozonated oil may play a role in preventing and treating ACD and has critical clinical significance.

To summarize, we have established a DNCB-induced ACD mouse model to explore the efficacy and possible molecular mechanism of ozonated oil for the external treatment of ACD. We have observed that ozonated oil could alleviate the DNCB-induced ACD-like inflammatory response in mice by inhibiting the FcεRI/Syk signaling pathway. Our results have demonstrated that ozonated oil is effective in treating ACD through the inhibition of the inflammatory pathway, warranting further clinical evaluation and application.

Acknowledgments

We would like to thank Wiley editing services for kindly reviewing and revising on English writing.

Funding Statement

This work was supported by the National Natural Science Foundation (81903219) and the Natural Science Foundation of Hunan Province (2018JJ6094), China.

Conflict of Interest

The authors declare that they have no conflicts of interest to disclose.

AUTHORS’CONTRIBUTIONS

FU Zhibing Research design, experimental operation, and paper writing; YU Xiaochun, TAN Lina, and ZHOU Lu Paper modification; XIE Yajie, ZENG Liyue, and GAO Lihua Data collecting and analysis; ZENG Jinrong, LU Jianyun Research design, paper supervision and revision. The final version of the manuscript has been approved and read by all authors.

Note

http://xbyxb.csu.edu.cn/xbwk/fileup/PDF/2023011.pdf

References

  • 1. Alinaghi F, Bennike NH, Egeberg A, et al. Prevalence of contact allergy in the general population: A systematic review and meta-analysis[J]. Contact Dermatitis, 2019, 80(2): 77-85. 10.1111/cod.13119. [DOI] [PubMed] [Google Scholar]
  • 2. Owen JL, Vakharia PP, Silverberg JI. The role and diagnosis of allergic contact dermatitis in patients with atopic dermatitis[J]. Am J Clin Dermatol, 2018, 19(3): 293-302. 10.1007/s40257-017-0340-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Nassau S, Fonacier L. Allergic contact dermatitis[J]. Med Clin North Am, 2020, 104(1): 61-76. 10.1016/j.mcna.2019.08.012. [DOI] [PubMed] [Google Scholar]
  • 4. Grimbaldeston MA, Nakae S, Kalesnikoff J, et al. Mast cell-derived interleukin 10 limits skin pathology in contact dermatitis and chronic irradiation with ultraviolet B[J]. Nat Immunol, 2007, 8(10): 1095-1104. 10.1038/ni1503. [DOI] [PubMed] [Google Scholar]
  • 5. Shin JS, Greer AM. The role of FcεRI expressed in dendritic cells and monocytes[J]. Cell Mol Life Sci, 2015, 72(12): 2349-2360. 10.1007/s00018-015-1870-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Gomez G. Current strategies to inhibit high affinity FcepsilonRI-mediated signaling for the treatment of allergic disease[J]. Front Immunol, 2019, 10: 175. 10.3390/ijms23020788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Kang BC, Kim MJ, Lee S, et al. Nothofagin suppresses mast cell-mediated allergic inflammation[J]. Chem Biol Interact, 2019, 298: 1-7. 10.1016/j.cbi.2018.10.025. [DOI] [PubMed] [Google Scholar]
  • 8. Gomez G. Current strategies to inhibit high affinity FcεRI-mediated signaling for the treatment of allergic disease[J]. Front Immunol, 2019, 10: 175. 10.3389/fimmu.2019.00175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Martin SF. Immunological mechanisms in allergic contact dermatitis[J]. Curr Opin Allergy Clin Immunol, 2015, 15(2): 124-130. 10.1097/ACI.0000000000000142. [DOI] [PubMed] [Google Scholar]
  • 10. Shao Y, Zhang S, Zhang Y, et al. Recent advance of spleen tyrosine kinase in diseases and drugs[J]. Int Immunopharmacol, 2021, 90: 107168. 10.1016/j.intimp.2020.107168. [DOI] [PubMed] [Google Scholar]
  • 11. Yang YL, Zhao LJ, Zhang S, et al. Structural optimization and anti-allergic activity of nucleotide aptamers target to Cε3-Cε4[J]. Biochem Pharmacol, 2019, 161: 121-135. 10.1016/j.bcp.2019.01.008. [DOI] [PubMed] [Google Scholar]
  • 12. MacGlashan D. Autoantibodies to IgE and FcεRI and the natural variability of spleen tyrosine kinase expression in basophils[J]. J Allergy Clin Immunol, 2019, 143(3): 1100-1107.e11. 10.1016/j.jaci.2018.05.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Draber P, Halova I, Polakovicova I, et al. Signal transduction and chemotaxis in mast cells[J]. Eur J Pharmacol, 2016, 778: 11-23. 10.1016/j.ejphar.2015.02.057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Yamashita Y, Yamashita T. Novel phospho-specific monoclonal antibodies reveal differential regulation of tyrosine phosphorylation within the immunoreceptor tyrosine-based activation motif of the Fc receptor gamma subunit leading to fine tuning of Syk activation[J]. Biochem Biophys Res Commun, 2021, 547: 89-95. 10.1016/j.bbrc.2021.02.042. [DOI] [PubMed] [Google Scholar]
  • 15. MacGlashan DW. IgE-dependent signaling as a therapeutic target for allergies[J]. Trends Pharmacol Sci, 2012, 33(9): 502-509. 10.1016/j.tips.2012.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Shao YX, Zhang S, Zhang YF, et al. Recent advance of spleen tyrosine kinase in diseases and drugs[J]. Int Immunopharmacol, 2021, 90: 107168. 10.1016/j.intimp.2020.107168. [DOI] [PubMed] [Google Scholar]
  • 17. Sen S, Sen S. Ozone therapy a new vista in dentistry: integrated review[J]. Med Gas Res, 2020, 10(4): 189-192. 10.4103/2045-9912.304226 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. WANG Xiaoqi. Emerging roles of ozone in skin diseases[J]. Journal of Central South University. Medical Science, 2018, 43(2): 114-123. 10.11817/j.issn.1672-7347.2018.02.002 [DOI] [PubMed] [Google Scholar]; 王晓琦. 医用臭氧在皮肤疾病中的创新性应用[J]. 中南大学学报(医学版), 2018, 43(2): 114-123. 10.11817/j.issn.1672-7347.2018.02.002 [DOI] [PubMed] [Google Scholar]
  • 19. Machado AU, Contri RV. Effectiveness and Safety of Ozone Therapy for Dermatological Disorders: A Literature Review of Clinical Trials[J]. Indian J Dermatol, 2022, 67(4): 479. 10.4103/ijd.ijd_152_22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Yuan XY, Ma HM, Li RZ, et al. Topical application of aloperine improves 2, 4-dinitrofluorobenzene-induced atopic dermatitis-like skin lesions in NC/Nga mice[J]. Eur J Pharmacol, 2011, 658(2/3): 263-269. 10.1016/j.ejphar.2011.02.013. [DOI] [PubMed] [Google Scholar]
  • 21. Brar KK. A review of contact dermatitis[J]. Ann Allergy Asthma Immunol, 2021, 126(1): 32-39. 10.1016/j.anai.2020.10.003. [DOI] [PubMed] [Google Scholar]
  • 22. Vocanson M, Hennino A, Rozières A, et al. Effector and regulatory mechanisms in allergic contact dermatitis[J]. Allergy, 2009, 64(12): 1699-1714. 10.1111/j.1398-9995.2009.02082.x. [DOI] [PubMed] [Google Scholar]
  • 23. Najem MY, Couturaud F, Lemarie CA. Cytokine and chemokine regulation of venousthromboembolism[J]. J Thromb Haemost, 2020, 18(5): 1009-1019. 10.1111/jth.14759 [DOI] [PubMed] [Google Scholar]
  • 24. Enk AH, Katz SI. Early molecular events in the induction phase of contact sensitivity[J]. Proc Natl Acad Sci USA, 1992, 89(4): 1398-1402. 10.1073/pnas.89.4.1398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Nagata Y, Suzuki R. FcepsilonRI: A master regulator of mast cell functions[J]. Cells, 2022, 11(4): 622. 10.3390/cells11040622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Orsolic N. Allergic inflammation: Effect of propolis and its flavonoids[J]. Molecules, 2022, 27(19): . 10.3390/molecules27196694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Gilfillan AM, Tkaczyk C. Integrated signalling pathways for mast-cell activation[J]. Nat Rev Immunol, 2006, 6(3): 218-230. 10.1038/nri1782. [DOI] [PubMed] [Google Scholar]
  • 28. Blank U, Huang H, Kawakami T. The high affinity IgE receptor: a signaling update[J]. Curr Opin Immunol, 2021, 72: 51-58. 10.1016/j.coi.2021.03.015. [DOI] [PubMed] [Google Scholar]
  • 29. Sibilano R, Frossi B, Pucillo CE. Mast cell activation: a complex interplay of positive and negative signaling pathways[J]. Eur J Immunol, 2014, 44(9): 2558-2566. 10.1002/eji.201444546. [DOI] [PubMed] [Google Scholar]
  • 30. Kang YM, Lee M, An HJ. Oleanolic acid protects against mast cell-mediated allergic responses by suppressing Akt/NF-κB and STAT1 activation[J]. Phytomedicine, 2021, 80: 153340. 10.1016/j.phymed.2020.153340. [DOI] [PubMed] [Google Scholar]
  • 31. Piao Y, Jiang J, Wang Z, et al. Glaucocalyxin A attenuates allergic responses by inhibiting mast cell degranulation through p38MAPK/NrF2/HO-1 and HMGB1/TLR4/NF-kappaB signaling pathways[J]. Evid Based Complement Alternat Med, 2021, 2021: 6644751. 10.1155/2021/6644751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Arakawa S, Suzukawa M, Igarashi S, et al. Resveratrol inhibits IgE binding and down-regulates intracellular phosphorylation of Syk following IgE aggregation on human basophils[J]. Allergol Int, 2017, 66S: S53-S55. 10.1016/j.alit.2017.06.015. [DOI] [PubMed] [Google Scholar]
  • 33. Nam ST, Kim HW, Kim HS, et al. Furaltadone suppresses IgE-mediated allergic response through the inhibition of Lyn/Syk pathway in mast cells[J]. Eur J Pharmacol, 2018, 828: 119-125. 10.1016/j.ejphar.2018.03.035. [DOI] [PubMed] [Google Scholar]
  • 34. Miletic AV, Graham DB, Montgrain V, et al. Vav proteins control MyD88-dependent oxidative burst[J]. Blood, 2007, 109(8): 3360-3368. 10.1182/blood-2006-07-033662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Deng YF, Jin FS, Li X, et al. Sauchinone suppresses FcεRI-mediated mast cell signaling and anaphylaxis through regulation of LKB1/AMPK axis and SHP-1-Syk signaling module[J]. Int Immunopharmacol, 2019, 74: 105702. 10.1016/j.intimp.2019.105702. [DOI] [PubMed] [Google Scholar]
  • 36. Wang C, Li L, Jiang J, et al. Pterostilbene inhibits FcepsilonRI signaling through activation of the LKB1/AMPK pathway in allergic response[J]. J Agric Food Chem, 2020, 68(11): 3456-3465. 10.1021/acs.jafc.9b07126. [DOI] [PubMed] [Google Scholar]
  • 37. Hwang SL, Lu Y, Li X, et al. ERK1/2 antagonize AMPK-dependent regulation of FcεRI-mediated mast cell activation and anaphylaxis[J]. J Allergy Clin Immunol, 2014, 134(3): 714-721. 10.1016/j.jaci.2014.05.001. [DOI] [PubMed] [Google Scholar]
  • 38. Bains SN, Nash P, Fonacier L. Irritant contact dermatitis[J]. Clin Rev Allergy Immunol, 2019, 56(1): 99-109. 10.1007/s00420-002-0420-7. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Central South University Medical Sciences are provided here courtesy of Central South University

RESOURCES