Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Mar 1.
Published in final edited form as: J Physiol. 2024 Jan 31;602(5):967–987. doi: 10.1113/JP284041

Dietary sodium alters aldosterone’s effect on renal sodium transporter expression and distal convoluted tubule remodeling

Stephanie M Mutchler 1, Mahpara Hasan 4, Carolyn P Murphy 1, Catherine J Baty 1, Cary Boyd-Shiwarski 1, Annet Kirabo 5, Thomas R Kleyman 1,2,3
PMCID: PMC10939779  NIHMSID: NIHMS1959676  PMID: 38294810

Abstract

Aldosterone is responsible for maintaining volume and potassium homeostasis. While high salt consumption should suppress aldosterone production, individuals with hyperaldosteronism lose this regulation, leading to a state of high aldosterone despite dietary sodium consumption. This study examines the effects of elevated aldosterone, with or without high salt consumption, on expression of key Na+ transporters and remodeling in the distal nephron. Epithelial sodium channel (ENaC) α-subunit expression was increased with aldosterone regardless of Na+ intake. However, ENaC β- and γ-subunits surprisingly increased at both a transcript and protein level with aldosterone when high salt was present. Expression of total and phosphorylated Na+Cl− cotransporter (NCC) significantly increased with aldosterone, in association with decreased blood [K+], but the addition of high salt markedly attenuated the aldosterone-dependent NCC increase, despite equally severe hypokalemia. We hypothesized this was due to differences in distal convoluted tubule length when salt was given with aldosterone. Imaging and measurement of the entire pNCC-positive tubule revealed that aldosterone alone caused a shortening of this segment, although the tubule had a larger cross-sectional diameter. This was not true when salt was given with aldosterone, as the combination was associated with a lengthening of the tubule in addition to increased diameter, suggesting that differences in the pNCC-positive area are not responsible for differences in NCC expression. Together, our results suggest the actions of aldosterone, and the subsequent changes related to hypokalemia, are altered in the presence of high dietary Na+.

Keywords: ENaC, NCC, dietary sodium, aldosterone, distal nephron

Graphical Abstract

graphic file with name nihms-1959676-f0001.jpg

The effect of chronically elevated aldosterone in the presence of normal or high salt diet on Na+ transporters in the distal nephron was explored. Aldosterone lowered blood [K+] regardless of dietary Na+. Aldosterone (+/− high salt diet) increased α subunit and cleaved γ subunit ENaC expression, but an increase in β subunit expression was noted only with aldosterone + high salt diet. Surprisingly, the addition of a high salt diet to aldosterone reduced NCC expression, as compared to animals receiving aldosterone with a control diet. Changes in the architecture of the distal nephron were seen with aldosterone both with control diet and a high salt diet. However, these changes did not explain the differences in NCC expression. Overall, the results show that aldosterone with a high salt diet increases expression of all three ENaC subunits and that a high salt diet blunts the effects of hypokalemia and aldosterone on enhancing NCC expression and phosphorylation.

INTRODUCTION

Aldosterone is a steroid hormone that plays a key role in the maintenance of the volume and [K+] of extracellular fluids. Released as the final step in the renin-angiotensin-aldosterone (RAAS) cascade, it acts in the distal nephron to enhance Na+ reabsorption from the ultrafiltrate, as well as enhance K+ secretion into the tubular lumen (Palmer & Frindt, 2000). The epithelial Na+ channel (ENaC) is a primary target of aldosterone in principal cells (PC) of the aldosterone-sensitive distal nephron (ASDN). This heterotrimeric channel canonically consists of an α, β and γ subunit which assemble in the biosynthetic pathway and traffic to the surface. Aldosterone binds the mineralocorticoid receptor (MR) and causes its nuclear translocation which increases the transcription of SCNN1a, the gene encoding the α-subunit of ENaC. Aldosterone increases transcription of other proteins that act in concert to increase ENaC apical membrane expression and channel open probability (Masilamani et al., 1999), including the serum- and glucocorticoid-regulated kinase 1 (SGK1) (Chen et al., 1999), the scaffold protein connector enhancer of kinase suppressor of Ras isoform 3 (CNK3) (Ziera et al., 2009), the glucocorticoid-induced leucine zipper 1 (GILZ1) (Soundararajan et al., 2010), and the cytoskeletal protein ankyrin G (Klemens et al., 2017). Additionally, aldosterone increases the basolateral Na+-K+-ATPase, driving Na+ exit from and K+ entry into PCs (Summa et al., 2001).

Aldosterone also modulates activity of the Na+,Cl− cotransporter (NCC) in the distal convoluted tubule (DCT) via its secondary effect of enhancing renal K+ secretion and lowering blood [K+] (Chiga et al., 2008; Terker et al., 2016a; Terker et al., 2016b). This leads to a lower intracellular [Cl−], activation of with-no-lysine kinases (WNKs), and phosphorylation and activation of Ste20-related proline-alanine-rich kinase (SPAK) and oxidative stress-responsive gene 1 (OSR1) (Terker et al., 2015; Terker et al., 2016b). This cascade ultimately induces phosphorylation and activation of NCC at several serine and threonine residues that increases its activity and surface expression (Hossain Khan et al., 2012; Hadchouel et al., 2016; Chen et al., 2019). While some studies suggest [K+] is the major mediator of these alterations (Terker et al., 2016a; Kristensen et al., 2022), aldosterone may also directly influence NCC expression by increasing expression of the WNK-SPAK/OSR1 pathway (Roy et al., 2015). Acute effects of aldosterone on NCC activation through an EGFR-dependent pathway have also been reported (Cheng et al., 2019).

Aldosterone synthesis is tied to dietary Na+ intake, extracellular fluid volume and blood [K+]. A high Na+ diet suppresses aldosterone secretion, facilitating elimination of the excess Na+ load, whereas a low Na+ diet increases aldosterone with associated Na+ retention to help maintain volume. However, it is estimated that 5–10% of hypertensives have primary hyperaldosteronism, a condition in which aldosterone levels are elevated regardless of [K+] or extracellular fluid volume (Jaffe et al., 2020). Increased aldosterone is associated with poor health outcomes in patients, including a higher risk of major cardiovascular events when matched for blood pressure (Hundemer, 2019).

The majority of people in western societies chronically consume more than the recommended daily allowance for Na+, including individuals with hypertension (Dolmatova et al., 2018; Hu et al., 2020; Hunter et al., 2022). These numbers, coupled with the fact that hyperaldosteronism raises the NaCl taste recognition threshold, suggest there exists a population that has both high circulating aldosterone levels and high Na+ intake (Adolf et al., 2021; Zhou et al., 2023). Hence, it is important to understand how aldosterone’s chronic effects may be altered with variable dietary Na+. In this study, we examined the effects of aldosterone with or without a high Na+ diet on the expression of ENaC and NCC as well as distal tubule dimensions, as this segment is particularly prone to K+-mediated remodeling. Together, our data show the importance of dietary Na+ in modifying aldosterone’s effects on distal nephron Na+ transport. Our results show that high dietary Na+ modifies the effects of aldosterone on ENaC expression, and adds to the complexity of NCC regulation by whole blood [K+], as Na+ intake blunted aldosterone’s increase of total and phosphorylated NCC, despite similar levels of hypokalemia. These results were not explained by distal tubule remodeling.

MATERIALS AND METHODS:

Ethical Approval

All animal work was performed at the University of Pittsburgh and conformed to guidance given by the National Institutes of Health and the American Veterinary Medicine Association. Animal work was performed under University of Pittsburgh Animal Care and Use Committee (IACUC) protocol 20128471. All animals had free access to food and water, and details of experiments, including anesthesia and surgical manipulations, are listed below. All authors understood the ethical principles that The Journal of Physiology operates under and their work complied with these guidelines.

Animals

All animal protocols conform to the NIH Guide for the Care and Use of Laboratory Animals and were approved by the University of Pittsburgh IACUC. Male C57Bl/6 mice (aged 8–16 weeks, Jackson Laboratories, Bar Harbor, ME) were housed in a temperature-controlled facility on a 12h light/dark cycle. Mice utilized for each experiment were of the same age, meaning that all comparisons across the four treatments were made on data collected from animals of a similar starting size and weight. Animals were fed standard 0.4% NaCl chow (control) or 8% NaCl chow (HSD, Envigo TD.92012, Indianapolis, IN). Aldosterone was administered (240 μg/kg/day), via a subcutaneous minipump (DURECT Corporation, model 2002, Cupertino, CA). The pump was inserted while the mice were anesthetized with isoflurane administered through a nosecone under constant flow of oxygen. A small, 1–2 cm incision at the neck of the animal allowed for the creation of a subcutaneous pocket where the pump could reside on top of the animal’s left flank. The incision was closed with absorbable suture. At the experiment end, mice were anesthetized with isoflurane before blood was collected via cardiac puncture for iSTAT analysis (Abbott, Abbott Park, IL). After blood analysis, animals were euthanized by exsanguination. Kidneys were collected and flash frozen or fixed in 4% paraformaldehyde. Experimenters were not blinded during the analysis of tissues. A total of 71 animals were used for all experiments.

Metabolic Cages

Mice were individually housed in wire-bottomed metabolic cages (Tecniplast, West Chester, PA). Acclimation lasted 48h followed by 2 days of measurement, analyzed per 24h period. Gel diets made from chow with 1–2% agar was given. These provided a portion of water, however, the animals also had free access to water. The mice were treated with amiloride (5 mg/kg) and urine collected at 3h and 12h post injection. These urines were compared to urines collected at the same time points following a sham saline injection. Ion-selective electrodes measured Na+, K+, and Cl− content (Medica Corp, Bedford, MA).

Glomerular Filtration Rate (GFR)

GFR was measured using a transcutaneous monitor as previously described (Schreiber et al., 2012). Briefly, animals were shaved and a depilatory cream applied to a small patch on the animal’s back. The GFR sensor (MediBeacon, Mannheim, Germany) was attached to the skin via a small sticker and FITC-sinistrin was administered at a dose of 7.5 mg/100 g body weight (bw) via retroorbital injection while the animals were lightly anesthetized with isoflurane. Curves were analyzed using the MB_Lab2 and Studio3 software available from MediBeacon. FITC-Sinistrin half-life values were plugged into the following equation for determination of GFR: GFR [μl • min • 100g bw] = 14616.8[μl/100g bw] / t1/2 FITC-sinstrin [min]

Immunoblotting

Kidneys were homogenized in CelLytic Lysis Buffer (Sigma, Saint Louis, MO). Immunoblots were run as previously reported (Mutchler et al., 2021). Wells were loaded with 60μg of protein. Membranes were incubated with primary antibody according to Table 1 followed by the corresponding secondary antibody (KPLaboratories) and developed using Clarity™ Western Blotting Substrate (BioRad). Blots were imaged on a ChemiDoc™ Imaging System (BioRad). Blot quantification was performed using densitometry in ImageJ software and normalized to total protein as determined by Coomassie. Antibodies were validated by blotting dilutions of the same kidney homogenate to ensure linearity of the detected signal. We previously reported these results for ENaC antibodies (Mutchler et al., 2023) and Figure 1 illustrates the validation of the other major antibodies utilized in this study.

Table 1:

Primary antibodies utilized for Western blotting and Immunofluorescent imaging.

Target Manufacturer Catalog Number and Lots Dilutions
ENaC, α-subunit StressMarq SPC-403, lot 130911 WB 1:1500
ENaC, β-subunit StressMarq SPC-404, lot 387434 WB 1:1500
IF 1:250
ENaC, γ-subunit StressMarq SPC-405, lot 1112 WB 1:1500
IF 1:250
Total NCC StressMarq SPC-402, lot MN188968 WB 1:2000
IF 1:500
pNCC PhosphoSolutions P1311–53 WB 1:2000
CK 1:150
NKCC2 StressMarq SPC-401, lot 1202 WB 1:2000
Total SPAK Cell Signaling 2281 WB 1:1000
pSPAK Millipore 07–2273 WB 1:1000
IF 1:200
AQP2 Santa Cruz SC9892 lot C0315 IF 1:700
CK 1:150
Calbindin BiCell 02401 CK 1:150
Parvalbumin Swant 6P72 IF 1:300

WB = Western blot, IF = immunofluorescence, and CK = cleared kidney imaging

Figure 1: NCC, pNCC, and NKCC2 antibodies demonstrate linearity of signal.

Figure 1:

Antibodies to NCC, pNCC, and NKCC2 were tested for signal linearity using dilutions of the same kidney homogenate. Multiples of 10 μg between 30–90 μg of total protein were blotted for each target. The signal for each amount was compared to the signal obtained for 60 μg. These results were plotted (solid line) for (A) NCC, (B) pNCC, and(C) NKCC2 along with the line expected for complete linearity (dotted line). Representative blots for each antibody are shown in D. Each point represents the average of the values obtained from 3 separate blots run on three different samples.

Quantitative Polymerase Chain Reaction (qPCR)

Frozen kidneys were homogenized in TRIzol™ (Thermo Fisher). cDNA was synthesized from 1 μg RNA with a one-step cDNA synthesis kit (iScript, Bio-Rad Laboratories). Reactions contained 10 μL SYBR mastermix (Bio-Rad), 8 μL water, 1 μL primer mix (forward and reverse primers at 10 μM), and 1 μL diluted cDNA. Plates were run on a BioRad CFX Connect Real-Time System with a protocol of 3 minutes at 95°C followed by 40 cycles of 95°C for 10s and 60°C for 45s. Data were analyzed using the 2−ΔΔCt method. 18s rRNA was utilized as the housekeeping gene, and all results are presented as normalized to the control group. Primer sequences are listed 5’→3’ in Table 2.

Table 2:

PCR primer pairs

Gene Forward Primer Reverse Primer
Scnn1a TGGATGCCGTGAGAGAATGG ATGGGGTGGTGGAACTGAGA
Scnn1b CACCACCTTAGCTGCCATCA CCCCTCACAGATGATGCGTT
Scnn1g GCCGTGACCCTTCAGTTCAG CTTAATGGTCGGTGCCTGGG
Slc12a3 CATGGTCTCCTTTGCCAACT TGCCAAAGAAGCTACCATCA
Slc12a1 TGTTAGGTGGCACAGAAGATACC CACGGTTACATTGCTTGTTTGTT
18s GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG

Immunofluorescence Staining

Kidneys were fixed in 4% PFA and embedded in OCT. Tissues were permeabilized with 0.1% Triton-X, blocked with 10% horse serum in PBS, and incubated in primary antibody overnight at 4°C (antibodies in Table S1). Fluorophore-labeled secondaries were applied for 1h at room temperature, nuclei labeled with DAPI, and coverslips applied with ProLong Gold mountant (Thermo Fisher). Images were captured on an Olympus Fluoview FV1000 microscope as stacks and images are presented as maximum projections. For images where staining was quantified, tubules were circled using the freehand selection tool in ImageJ and the measure of staining intensity collected for the proper channel.

Tissue Clearing

Kidneys fixed in 4% PFA were sectioned at 300 μm on a vibratome. The protocol was adapted from Saritas et al. (Saritas et al., 2018) Briefly, antigen retrieval was performed at 95°C for 1h, sections were washed, and primary antibody was applied with agitation for 4d at 37°C. Sections were again washed and then placed in secondary antibody for 4d at 37°C with agitation. After brief ethanol dehydration (2h in 70% followed by 2h in 100%), sections were placed in ethyl cinnamate (ECi) and agitated at room temperature for at least 24h prior to imaging. After being placed in fresh ECi, cleared samples were imaged using an inverted Leica SP8, 25× 0.95 N.A objective. Laser excitement for Cy3 was done sequentially to avoid bleed through. At least two large tilescans were imaged to generate large sections from cortex edge through inner medulla to provide ample full length distal tubules (i.e., not cut off as it left tissue section) for quantitation. Tilescan treatment groups were blinded prior to quantitation using LASX 3D viewer, measurement processing and depth coding to facilitate tubule tracing. To measure tubule diameters, 10 random stacks per sample were imaged at 4x zoom (1μm step size) and quantitated similarly.

Data Analysis

Data were analyzed using Graph Pad Prism software and are presented as means ± SD except where otherwise noted. All comparisons between the four conditions were analyzed using an ordinary two-way ANOVA followed by Tukey’s multiple comparisons test to look at significant differences between groups. Diet and aldosterone treatment were designated as the independent variables. Normality of the residuals was tested using the Anderson-Darling and Shapiro-Wilk test. For data that did not meet the assumption of normality of the residuals, data were log transformed and statistics were performed on the transformed set. This is noted within the figure legends and within the accompanying statistical analysis spreadsheet when utilized. Significance was assumed to be P≤0.05.

Linear regressions were performed to analyze the relationship between blood [K+] and protein expression levels. For each animal, blood [K+] was plotted on the X-axis and protein level as the corresponding Y-value. The protein level was determined from Western blots and was normalized to the average expression seen in control animals. Regressions were examined to determine correlation coefficients when all data were combined and when data were separated out by dietary intervention. For comparisons between groups given salt and those on standard diet, regressions were run for each subset and Prism was utilized to run a comparison of fits.

RESULTS

The effect of high salt diet (HSD) and aldosterone on blood and urine parameters

To study the effects of Na+ intake in the setting of abnormally elevated aldosterone, we utilized dietary manipulation with administration of exogenous aldosterone. Male C57Bl/6 mice were maintained on control chow or HSD (8% NaCl) for four weeks, with or without the addition of aldosterone at a dose of 240 μg/kg/day in the final two weeks (schematically summarized in Figure 2). Blood was assessed for electrolytes at the end of the treatment period (Table 3). Aldosterone administration with or without HSD led to decreased blood [K+] and increased total CO2 while only HSD + aldo led to a significant increase in blood [Na+]. Circulating levels of aldosterone were decreased in animals on HSD and elevated in both groups given aldosterone via minipump (Table 3). These levels were similar to those measured in mice maintained on a high KCl diet (Boyd-Shiwarski et al., 2020).

Figure 2: Schematic outlining treatment conditions across the four experimental groups.

Figure 2:

Control group was maintained on a 0.4% NaCl chow for the duration of the experiment. HSD group received 8% NaCl chow for 4 weeks. Animals receiving aldosterone alone were maintained on 0.4% NaCl chow and implanted with a minipump that delivered aldosterone (240 μg/kg/day) while the HSD+Aldo group was given 4 weeks of 8% NaCl chow and implanted with a minipump to deliver aldosterone for the final 2 weeks in tandem with the dietary manipulation.

Table 3: Blood analysis, urine output, water intake, and GFR.

Whole blood was collected via cardiac puncture for analysis via iSTAT. Mice were kept in metabolic cages to measure water intake and urine output, with values shown as total output and normalized to body weight. GFR was measured using a transdermal probe that monitors the elimination of an intravenous bolus of FITC-sinistrin. The wet weight of the heart tissue was measured at the time of sacrifice. Significance was calculated by 2-way ANOVA followed by multiple comparisons with P ≤ 0.05.

Control HSD Aldo HSD + Aldo
n value 12 15 11 11
Na+ (mmol/L) 145.6 ± 1.2 & 147.4 ± 2.9 & 148.4 ± 2.9 & 156.0 ± 5.1 @#$
K+ (mmol/L) 4.7 ± 0.4 $& 4.6 ± 0.3 $& 3.0 ± 0.3 @# 2.6 ± 0.3 @#
Cl− (mmol/L) 109.8 ± 1.3 $ 113.4 ± 3.2 $ 102 ± 2.1 @# 107.5 ± 7.0 #$
TCO2 (mmol/L) 24.7 ± 1.4 $& 23.7 ± 1.5 $& 31.7 ± 2.4 @# 33.4 ± 3.7 @#
n value 12 12 12 12
Aldosterone (pg/ml) 457 ± 241 #$& 49 ± 29 @$& 3295 ± 1237 @# 3554 ± 1713 @#
n value 6 6 6 6
Body Weight (g) 27.1 ± 1.9 & 26.6 ± 2.0 & 27.2 ± 1.7 & 24.2 ± 1.5 @#$
H2O intake (ml/24h) 3.6 ± 1.8 #$& 10.3 ± 1.3 @& 9.3 ± 3.2 @& 24.6 ± 5.4 @#$
H2O intake (ml/24h/g body weight) 0.12 ± 0.06 #$& 0.39 ± 0.04 @& 0.32 ± 0.09 @& 0.94 ± 0.2 @#$
Urine output (ml/24h) 3.6 ± 1.5 #$& 10.2 ± 2.1 @& 9.5 ± 4.2 @& 20.3 ± 6.1 @#$
Urine output (ml/24h/g body weight) 0.13 ± 0.05 #& 0.39 ± 0.07 @& 0.31 ± 0.13 & 0.77 ± 0.22 @#$
U Na V (mmol/24 hr) 0.12 ± 0.06 #& 4.37 ± 0.56 @$ 0.29 ± 0.09 #& 3.40 ± 1.15 @$
U Na V (mmol/24 hr/g body weight) 0.0043 ± 0.002 #& 0.17 ± 0.01 @$ 0.0095 ± 0.003 #& 0.14 ± 0.04 @$
U K V (mmol/24 hr) 0.53 ± 0.12 # 0.73 ± 0.11 @$& 0.47 ± 0.08 # 0.43 ± 0.12 #
U K V (mmol/24 hr/g body weight) 0.019 ± 0.004 # 0.028 ± 0.003 @$& 0.016 ± 0.003 # 0.017 ± 0.004 #
n value 6 6 6 6
GFR 980 ± 170 $& 823 ±278 $& 434 ± 216 @# 325 ± 167 @#
Heart weight (mg) 127 ± 13 132 ± 11 133 ± 12 138 ± 6
Heart weight (mg/g body weight) 4.8 ± 0.3 & 5.1 ± 0.3 & 5.1 ± 0.4 & 5.8 ± 0.4 @#$

Significance as compared to each group is denoted as follows: @ control, # HSD, $ Aldo, & HSD+Aldo

Animals were housed in metabolic cages to assess water intake, urinary volume, and electrolyte excretion. All treatments led to increased water consumption in tandem with increased urine volume, with mice receiving HSD+Aldo displaying the largest increase (Table 3). Urinary Na+ excretion (UNaV) was significantly increased in the groups receiving HSD (with or without aldosterone), compared to animals receiving control chow (Table 3). Urinary K+ excretion (UKV) was significantly higher in the HSD treated animals, likely reflecting increased Na+ delivery to the distal nephron. In contrast, an increase in UKV was not observed in the animals treated with aldosterone alone or in combination with HSD, likely due to compensatory mechanisms during hypokalemia.

GFR was assessed using a transdermal probe that tracked the signal from a bolus injection of FITC labeled sinistrin. The GFR was calculated from the half-life of the elimination curve. Both groups receiving aldosterone had a significant decrease in GFR as compared to the control and HSD groups (Table 3). Heart weight was also assessed as an indicator of hypertension. While the raw weights did not show differences between groups, normalizing heart weight to body weight revealed a significant increase in the HSD+aldo group (Table 3).

ENaC subunits are differentially regulated by aldosterone and HSD

Previous studies have shown aldosterone increases levels of renal α-subunit message and protein, while not significantly altering β- and γ-subunit expression (Masilamani et al., 1999). In our model, aldosterone increased both transcript (Figure 3A) and protein levels (Figure 3D and E) of the α-subunit in whole kidneys, regardless of whether the animals were on control or HSD, as expected. Expression of a ~95 kDa band, corresponding to the full length α-subunit, increased more than 4-fold in both groups (Figure 3E). Unexpectedly, transcript levels of the genes encoding the β- and γ-subunits, Scnn1b and Scnn1g, increased with the HSD+Aldo (Figure 3B and C). At a protein level, the β-subunit was increased only with HSD+Aldo (Figure 3D and F); however, γ-subunit protein expression was significantly higher with aldosterone regardless of dietary condition (Figure 3D and G).

Figure 3: Aldosterone increases ENaC α-subunit expression regardless of dietary Na+ content but requires the addition of HSD to increase β- and γ-subunit expression.

Figure 3:

Whole kidney transcript levels of (A) Scnn1a (α-subunit) (P values: C vs. A 0.0161, S vs. A 0.0165, C vs. SA 0.00810, S vs. SA 0.00527), (B) Scnn1b (β-subunit) (C vs. SA 0.00101, S vs. SA 0.00614) and (C) Scnn1g (γ-subunit) (C vs. SA <0.001, S vs. SA 0.00983) were quantified by qPCR across the four conditions. Immunoblotting was performed to assess protein expression. Representative immunoblots are shown in panel D. Quantification of the immunoblots are shown for the (E) α-subunit (C vs. A <0.001, C vs. SA <0.001, S vs. A <0.001, S vs. SA <0.001), (F) β-subunit (C vs. SA 0.00211, S vs. SA 0.0137, A vs. SA 0.0354) and (G) total expression of the γ-subunit (C vs. A <0.001, S vs. A 0.00115, C vs. SA <0.001, S vs. SA <0.001). All immunoblots were normalized to total protein, quantified by Coomassie staining of a gel run in tandem, with a representative image shown in panel D. The non-specific band that runs beneath the α-subunit is labeled. The γ-subunit runs as two distinct bands that can be quantified separately (H-J) as opposed to being quantified together as in G. The band representing the full-length γ-subunit runs just above the 75 kD marker and is quantified in H (C vs. S <0.001, S vs. A <0.001, S vs. SA <0.001, A vs. SA 0.00461), while the cleaved band runs slightly below, quantified in I (C vs. A, S vs. A, C vs. SA, S vs. SA all <0.001). The percentage of the γ-subunit that was cleaved in each condition (cleaved/total expression) is shown in panel J (C vs. S <0.001, C vs. A <0.001, C vs. SA 0.00179, S vs. A <0.001, S vs. SA <0.001). Individual mice are shown as separate points with error bars representing SD. N = 8 for qPCR and 12 for protein across 3 separate blots. Data were analyzed by two-way ANOVA with Tukey’s multiple comparisons and P values are denoted by * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001. For exact P values listed for each panel, the following abbreviations are used to denote groups being compared: C for control, S for high salt diet, A for aldosterone, and SA for high salt diet with aldosterone.

ENaC is activated by γ-subunit cleavage at two defined extracellular sites:

a proximal cleavage mediated by furin and a distal cleavage mediated by a group of serine or metaloproteases (Kleyman & Eaton, 2020). These C-terminal cleavage products appear as a broad band at ~70–75 kDa while a band corresponding to the full length γ-subunit migrates at ~80 kDa (Figure 3D). These bands were quantified separately (Figure 3H–J), showing that while the full-length subunit is the predominant form in HSD mice, the subunit was largely seen in its cleaved form in mice receiving aldosterone or HSD+Aldo.

For ENaC to be functionally active, it must traffic to the surface of the cell. To examine ENaC localization within PCs, we utilized immunofluorescent staining. In Figure 4A, the β-subunit (red) was co-stained with the PC marker aquaporin-2 (AQP2, green). Kidneys from mice on control or HSD showed diffuse cytoplasmic expression of the β-subunit while aldosterone and HSD+Aldo caused the majority of the signal to move toward the apical side of the cell, presumably toward the membrane, where it would be active. Immunolocalization of the γ-subunit was similar to the β-subunit, as control and HSD kidneys primarily exhibited intracellular staining, whereas aldosterone or HSD+Aldo led to movement toward the apical membrane (Figure 4B). Additionally, message levels of the ENaC regulator SGK1 were appropriately increased with aldosterone alone and further increased by its combination with HSD (Figure 4C).

Figure 4: β- and γ-subunit immunolocalization in kidney cortex and Sgk1 message levels in whole kidney.

Figure 4:

Immunofluorescent staining was performed on slices of kidney cortex to examine ENaC localization in mice subjected to aldosterone with or without HSD. Representative maximum projections from each group show the (A) β-subunit or (B) the γ-subunit in the red channel, the principal cell marker aquaporin 2 (AQP2) in the green channel, and a merge with nuclei in blue below. N=4 animals were examined from each condition with at least three separate tubules being imaged. Scale bar represents 25 μm. (C) Sgk1 mRNA was analyzed by qPCR, N=8 (P values: C vs. A 0.0135, C vs. SA <0.001, S vs. A 0.0227, S vs. SA <0.001, A vs. SA 0.0462). Data were analyzed by two-way ANOVA with Tukey’s multiple comparisons and P values are denoted by * < 0.05, **** < 0.0001. For exact P values listed for each panel, the following abbreviations are used to denote groups being compared: C for control, S for high salt diet, A for aldosterone, and SA for high salt diet with aldosterone.

Amiloride administration demonstrates ENaC-dependent K+ secretion in HSD+Aldo treated mice.

To test how these changes in ENaC expression altered function, mice were housed individually in metabolic cages and administered an acute injection of the ENaC inhibitor amiloride (5 mg/kg). Urine output and electrolyte excretion were measured and compared to values obtained during a sham saline injection in the same animal. Data are shown for the first three hours and collectively over the twelve-hour period following injection. These data are presented as fold change from the saline control (Figure 5A–C) and as raw values from both the saline sham injection (Figure 5E–G) and the amiloride injection (Figure 5I–K).

Figure 5: Amiloride challenge demonstrates ENaC-dependent Na+ absorption and K+ secretion.

Figure 5:

Mice were individually housed in metabolic cages that separated urine from feces. During the active, nighttime period, mice were given a sham IP saline injection one night followed by an IP amiloride injection two nights later (5 mg/kg, total injection ≈100 μL). Urine was collected over the first 3 hours and at 12 hours post-injection. Each graph shows values from the first collection (0–3 hours) and the entire 12-hour period (0–12 hours). The urines were analyzed for Na+ and K+ content using ion specific electrodes. Values obtained during the amiloride treatment (I-K) were divided by the values obtained during the sham injection (E-G) to calculate the fold change for (A) volume output, (B) Na+ output, and (C) K+ output. Data are presented as means ± SD. For statistical analyses, data were log transformed as shown in panels D, H, and L to ensure normality. Each time point was analyzed separately with a two-way ANOVA. Significance (P<0.05) is shown within the time of collection in comparison to the other treatments. @ significant compared to control, # significant compared to HSD, $ significant compared to aldosterone, & significant compared to HSD+aldo; n=5 or 6 for each condition.

Urine volume was significantly altered by amiloride only in control animals during the acute 3h phase (Figure 5A). Notably, urinary output was already significantly increased with any of the three treatments relative to controls (Table 3). Over the 12h period, no group showed significant changes in urinary volume, consistent with a fast-acting diuretic and a period of compensation following the initial action. The controls and aldosterone treated animals exhibited an amiloride-induced natriuresis that was not observed in mice receiving HSD (with or without aldosterone) (Figure 5B). Amiloride decreased kaliuresis in all conditions within the first 3h (Figure 5C). However, over the entire 12h period, the HSD group lacked a reduction in kaliuresis compared to the control, aldosterone alone, and HSD+Aldo treated animals. This decreased response in HSD treated animals was likely due to lower ENaC activity and other compensatory changes such as differences in ASDN K+ secretory channels (Kir1.1 (ROMK) and KCa1.1 (BK)) or distal Na+ delivery.

Aldosterone-induced increase in NCC is diminished in the presence of HSD despite similar levels of hypokalemia

We next analyzed changes in NCC expression, as this more proximal ASDN Na+ transporter can affect ENaC-dependent Na+ transport and kaliuresis through modulation of distal Na+ delivery. Aldosterone alone and in combination with HSD induced a significant increase in transcript levels of Slc12a3, the gene that encodes for NCC (Figure 6A). At a protein level, aldosterone alone caused the greatest increase in total NCC (Figure 6B and E). HSD+Aldo also caused a significant increase in NCC, as compared to control. However, this increase in NCC was significantly less than that seen with aldosterone alone. HSD by itself caused no change in NCC levels as compared to control animals.

Figure 6: Aldosterone-induced increases in NCC and pNCC are blunted by HSD.

Figure 6:

(A) Whole kidney transcript levels of Slc12a3 (NCC) were measured by qPCR (P values: C vs. A <0.001, C vs. SA 0.00132). (B) Protein expression of total NCC (tNCC) (C vs. A <0.001, C vs. SA 0.0104, S vs. A <0.001, S vs. SA 0.00113, A vs. SA 0.0239), (C) Thr53 phospho-NCC (pNCC) (C vs. A <0.001, C vs. SA 0.00433, S vs. A <0.001, S vs. SA 0.00125, A vs. SA 0.0373) and (D) the ratio of pNCC to tNCC (C-A 0.0457) were assessed by immunoblot with representative blots show in panel E. Immunofluorescent staining was performed on kidney sections to assess NCC localization, with representative maximum projections shown in panel F. NCC is shown in red, parvalbumin, a marker of the distal tubule, is shown in green, and nuclei are included in blue in the merged image. N=4 animals were imaged from each condition with three separate tubules from each slice being examined. Scale bar represents 25 μm. On graphs, points represent individual mice and errors bars are SD with n=8 for qPCR and n=12 for protein analysis across 3 blots. Protein expression of (G) total SPAK (C vs. A, C vs. SA, S vs. A, S vs. SA all <0.001, A vs. SA 0.0228) and (H) Ser373 phospho-SPAK (C vs. A, C vs. SA, S vs. A, S vs. SA all <0.001) were assessed by immunoblot with representative blots show in panel I. Points represent individual mice and errors bars are SD with n=8 across 2 blots. pSPAK expression in NCC positive cells was also analyzed by immunofluorescence. (J) Representative maximum projections of z-stacks from each condition show pSPAK in red and NCC in white. (K) Tubules expressing both NCC and pSPAK had pSPAK expression quantified, graphed as relative fluorescent intensity (RFU)/μm2 (C vs. A <0.001). Each point represents one tubule, with measurements taken from 3 separate sections of n=4 mice. Data were analyzed by two-way ANOVA with Tukey’s multiple comparisons. Statistics for total and pNCC protein (B-D) were performed on log transformed data. P values are denoted by *<0.05, **<0.01, ***<0.001, ****<0.0001. For exact P values listed for each panel, the following abbreviations are used to denote groups being compared: C for control, S for high salt diet, A for aldosterone, and SA for high salt diet with aldosterone.

Phosphorylation of NCC at Thr53 (pNCC) is an activating event for the transporter and was also assessed by immunoblot (Fig. 6C–E). Aldosterone both with and without HSD caused a significant increase in pNCC as compared to control or HSD fed animals. However, the increase in pNCC in mice treated with HSD+Aldo was again significantly less than the increase in pNCC expression in mice treated with aldosterone alone. Immunofluorescent staining demonstrated a similar localization across all conditions, as it appeared at the apical surface in parvalbumin positive cells, a marker of DCT1 (Figure 6F).

Given the reduced level of pNCC in mice on HSD+Aldo as compared to aldosterone alone, we examined whether there were parallel changes in the NCC-activating kinase SPAK and its phosphorylated (active) form, pSPAK. Levels of both pSPAK and SPAK increased in response to aldosterone when examined in whole kidney lysates (Figure 6G–I). However, instead of mimicking the expression changes of NCC, total and phosphorylated SPAK levels were increased similarly in the HSD+Aldo kidneys. Given that SPAK expression extends beyond the DCT (McCormick et al., 2011) and the antibodies used to detect SPAK and pSPAK also detect OSR1 and pOSR1 in other nephron segments, we used immunofluorescent staining to quantify expression of pSPAK in NCC+ cells (Figure 6 J and K). These results revealed that despite higher levels in total kidney lysate, the pSPAK signal in NCC+ cells was significantly decreased in aldosterone treated animals as compared to both control and HSD+Aldo animals.

NCC differences are not explained by variability in NCC-positive tubule length

Because expression of the upstream kinase SPAK did not provide an answer as to why NCC expression and phosphorylation varied between groups, we examined whether these changes reflected a reduction in the length of the DCT in aldosterone treated animals given HSD versus control diet. We hypothesized that our animals given aldosterone alone would have longer DCTs as compared to control animals and the addition of HSD would attenuate the remodeling response, keeping NCC levels lower.

To test this, we measured the length of the DCT using ethyl cinnamate cleared kidney slices stained with an antibody against pNCC (in red), as it is expressed along the length of both DCT1 and DCT2 (Figure 7A). We quantified the pNCC positive tubule (pNCC+) length and surprisingly found aldosterone alone caused a reduction in the average length of the DCT, but giving HSD+Aldo led to a significantly longer pNCC+ DCT (Figure 7B). Cross-sections of higher magnification 3D stacks were utilized to measure tubule diameter of the DCT2, where calbindin staining was used to define the edges of the cells (Figure 7C–D). Aldosterone alone led to a significantly larger diameter, and a further increase in diameter was noted in the HSD+Aldo group (Figure 7C). These data together suggest that while aldosterone does cause hypertrophy of the individual cells within the DCT, the volume of the DCT is most significantly changed in the HSD+Aldo group.

Figure 7: DCT length decreases with aldosterone alone but increases with HSD + Aldosterone.

Figure 7:

Following optical clearing, kidney slices from the four conditions were stained to examine DCT remodeling. Antibodies were used against pNCC (red), calbindin (blue) and AQP2 (green). Panel A (top) shows a representative 3D rendering of an imaged kidney slice where it can be observed that the antibodies penetrated into the tissue far enough to trace tubules from DCTs to collecting ducts. The bottom panel is the same image colored for depth within the kidney slice, as defined by the scale bar in the upper right corner. This coloration was utilized to facilitate measurements as it better separated individual tubules. (B) Length of individual DCTs, as defined by continuous pNCC+ staining, was analyzed in each condition (P values: C vs. A <0.001, C vs. SA 0.00465, S vs. A 0.00369, S vs. SA 0.0111, A vs. SA <0.001). (C) The diameter of the tubule was obtained by measuring the width, as defined by calbindin staining (C vs. A, C vs. SA, S vs. A, S vs. SA, A vs. SA all <0.001). (D) Representative images show calbindin in blue and pNCC in red. Measurements were made across straight parts of the tubule that were within the same plane as determined by moving within a z-stack (yellow line demonstrates representative measurement). White scale bars equal 25 μm. (E) The length of the tubule that was both pNCC+ and calbindin+ was measured as a marker of DCT2 (C vs. SA <0.001). (F) This value was divided by the total length of the pNCC+ tubule to determine the percentage of tubule that could be identified as DCT2 (C vs. A <0.001, C vs. SA <0.001, S vs. A 0.00146). Each point represents an individual measurement, with an N=4 animals for each condition being examined. Tubules that stained up to the edge of the tissue were excluded given the uncertainty of whether they continued. Error bars represent SD. Data were analyzed by two-way ANOVA with Tukey’s multiple comparisons and P values are denoted by *<0.05, **<0.01, ***<0.001, ****<0.0001. For exact P values listed for each panel, the following abbreviations are used to denote groups being compared: C for control, S for high salt diet, A for aldosterone, and SA for high salt diet with aldosterone.

To further characterize these changes, we stained with the DCT2 marker calbindin (in blue, Figure 7A). Fewer measurements were obtained as compared to the pNCC+ tubules alone as the calbindin antibody did not penetrate the tissue as deeply as the pNCC antibody. Measuring the length of the pNCC+-calbindin+ tubule demonstrated that the raw measurement of length of the DCT2 in aldosterone treated animals was not significantly different from either controls or HSD+Aldo treated animals (Figure 7D). However, when this was calculated as a percentage of the total pNCC+ tubule, it revealed aldosterone treated animals had a greater percentage of DCT2 as the total pNCC+ length had decreased in these animals (Figure 7E). These data suggest that chronic aldosterone administration led to shorter DCT1 segments in these animals without affecting the total length of the calbindin+ DCT2 segment.

Relationship between blood [K+] and NCC expression

The difference in NCC levels between aldosterone treated animals on control diet versus HSD was surprising given their similar level of hypokalemia (Table 3). To understand the relationship of blood [K+] to protein expression, we plotted the fold change in protein expression relative to the average control value, versus whole blood [K+] for each animal. Figure 8 shows results for NCC (Figure 8A) and pNCC (Figure 8B), with the coefficient of determination for each relationship (r2). When all animals were graphed together, total NCC had an r2=0.48. However, separation by dietary intervention revealed those receiving control chow had a significantly higher correlation (r2=0.75, Figure 8C) compared to those receiving HSD (r2=0.35, Figure 8D) despite a similar spread in blood [K+]. When compared to each other, the slopes of these correlations were significantly different from one another (P=0.032). The data were similar for pNCC where animals on control diet had higher correlation (r2=0.55) than those receiving HSD (r2=0.33) with a significant difference between their slopes (P=0.018), reflecting a HSD-dependent blunting of the relationship between NCC and blood [K+].

Figure 8: Relationship between NCC (or pNCC) and blood [K+] is altered by HSD.

Figure 8:

Whole blood [K+] as measured by iSTAT, and whole kidney (A) NCC or (B) pNCC expression as assessed by immunoblot and normalized to control kidneys were plotted against each other. A simple linear regression was used for analysis with a coefficient of determination (r2) as a measure of fit. Treatment is shown as filled green circles = control, open yellow circles = HSD, filled blue squares = aldosterone, open red triangles = HSD + aldosterone with N=8 for each condition. Significant correlations (defined as P<0.05 when compared to a slope of zero) between NCC and blood [K+] ((A) r2=0.48), and pNCC and blood [K+] ((B) r2=0.36) were observed when combining all four treatments. For NCC, when mice receiving a control diet were separated from mice receiving HSD, those receiving control chow had a significantly higher correlation ((C) r2=0.75) compared to those receiving HSD ((D) r2=0.35). When a comparison of fits was performed between these two curves, a significant difference was observed (P=0.032). For pNCC, mice on control diet had a significantly higher correlation ((E) r2=0.55) than those receiving HSD ((F) r2=0.33, P=0.018).

NKCC2 expression is not altered by HSD or aldosterone administration

Next, we looked outside of the ASDN to determine if the effect of HSD and aldosterone extended beyond the DCT. The Na+-K+-Cl− co-transporter (NKCC2) in the thick ascending limb of the loop of Henle was examined given its role in Na+ transport within this segment. We found NKCC2 transcript and protein levels were not significantly altered by aldosterone and/or HSD (Figure 9).

Figure 9: NKCC2 expression is not changed with HSD or aldosterone.

Figure 9:

Whole kidney transcript levels of the gene encoding NKCC2, Slc12a1, were assessed by qPCR (A) and protein levels assessed by immunoblot (B and C). No significant differences were observed when data were analyzed by two-way ANOVA with Tukey’s multiple comparisons with P≤0.05. N=8 mice for both experiments across 2 blots.

DISCUSSION

We sought to define the changes that occur in the distal nephron with both increased aldosterone and dietary Na+ intake alone or in combination. While rodent models have used this combination (or other mineralocorticoid/glucocorticoid agonists such as DOCA) to induce hypertension and end organ damage, the analyses contained here include full factorial experiments that display unique changes with HSD+Aldo as opposed to either stimulus alone. Our studies examine chronic administration rather than treatment with HSD or aldosterone acutely, to more closely mimic the patient population of interest. Our results suggest that dietary Na+ status modifies aldosterone’s effects on ASDN.

Aldosterone in the kidney has long been though to only induce expression of the α-subunit while mediating trafficking of the β- and γ-subunits from an intracellular pool to the apical surface22. The increase we observed in mRNA and protein of the α-subunit of ENaC in response to aldosterone, regardless of dietary Na+ status, was therefore expected based on this model, but our β- and γ-subunit results were not (Asher et al., 1996; Loffing et al., 2000). We observed an increase in γ-subunit protein in the aldosterone-alone treated group, which, while against the commonly accepted role of aldosterone regulation in the kidney, does support recently published studies showing changes in γ-ENaC expression with aldosterone, suggested to be caused by increased cell proliferation (Terker et al., 2016a; Kristensen et al., 2022). Furthermore, we observed an increase in both β- and γ-subunit message and protein in mice receiving HSD+Aldo. While we were not able to measure the length of the ENaC+ tubule within our cleared kidneys due to poor antibody penetration, the referenced study by Kristensen et al (Kristensen et al., 2022), coupled with our finding of increased DCT length in HSD+Aldo treated animals suggests that proliferation of the late DCT could help explain our results.

Aldosterone’s role in the regulation of ENaC is multifaceted and tissue specific. In the kidney, it increases levels of SGK1 which phosphorylates the ubiquitin ligase neural precursor cell expressed developmentally down-regulated 4–2 (Nedd4-2) (Debonneville et al., 2001). Phosphorylation of Nedd4-2 limits its ability to ubiquitinate ENaC subunits which targets ENaC for internalization and degradation (Zhou et al., 2007). Aldosterone also acts through the MR to promote α-subunit expression through histone modifications. Activated MR disrupts the binding of disruption of telomeric silencing 1 (Dot1a) and ALL1-fused gene from chromosome 9 protein (Af9) that form a repression complex that binds to or near the α-subunit promoter (Zhang et al., 2013). The addition of HSD with aldosterone could not only cause changes in the architecture of the tubule, but it could also amplify these known mechanisms or act through a novel transcriptional pathway. Further studies are necessary determine whether chronic aldosterone with or without HSD affects Scnn1b and Scnn1g transcription directly, stabilizes ENaC mRNAs, and/or stabilizes or enhances recycling of already formed subunits.

To the extent of ENaC activation, we examined responses to the ENaC inhibitor amiloride. When challenged acutely, control animals experienced diuresis with increased natriuresis and reduced kaliuresis, as expected. Animals given aldosterone alone had enhanced natriuresis and decreased kaliuresis but no accompanying volume change with amiloride. This was likely due to the fact the aldosterone treated animals were already excreting a significantly higher amount of urine than their control counterparts. Animals on HSD had almost no effects of amiloride, consistent with the large baseline excretion of Na+ and a downregulation of ENaC activity. The animals on HSD+Aldo did not show a significant natriuresis with amiloride treatment. However, they did have significantly decreased kaliuresis, similar to that experienced by the control and aldosterone alone treated animals. These results suggest that ENaCs in kidneys of mice treated with HSD+Aldo are active. The natriuresis may not have been detectable in this group given the high dietary Na+ intake and associated high urinary Na+ output. ENaC fine-tunes only a small percentage of the filtered load of Na+, therefore any changes in Na+ output may have been too small to detect with the large background Na+ excretion in this group.

ENaC open probability (Po) is decreased in response to increased extracellular (urinary) [Na+], a process termed Na+-self inhibition (Kleyman & Eaton, 2020). However, ENaC activation by aldosterone is accompanied by proteolytic processing of the α- and γ-subunits, with a subsequent loss of this Na+-self inhibition response (Frindt & Palmer, 2015; Kleyman & Eaton, 2020). Consistent with a loss of Na+-self inhibition, we observed a response to amiloride in mice receiving HSD+Aldo, despite a likely high intraluminal [Na+]. This loss of Na+-self inhibition coupled with increased ENaC expression likely drives increased Na+ reabsorption, potentially explaining the increase in blood [Na+] in these animals. While cleavage has an important role in ENaC regulation, other factors such as extracellular Cl−, H+, shear stress, acidic phospholipids and subunit palmitoylation also influence ENaC gating and activity (Kleyman & Eaton, 2020).

NCC in part determines the distal delivery of Na+ and thus influences K+ excretion. When blood [K+] is low, DCT cells hyperpolarize with an associated increase in Cl− efflux and a reduction in intracellular [Cl−]. This activates the WNK kinases, as WNK1 and WNK4 have Cl− binding sites that inhibit their autophosphorylation and activation (Piala et al., 2014). Low blood [K+] is associated with clustering of WNKs in cellular condensates that may facilitate phosphorylation and activation of downstream effectors, including SPAK/OSR1, and ultimately NCC (Terker et al., 2015; Boyd-Shiwarski et al., 2018). Previous studies have shown that lowering blood [K+] has a key role in activating NCC (Terker et al., 2016b), and we observed this trend in mice receiving aldosterone alone. However, when mice received HSD+Aldo, NCC and pNCC expression was blunted despite these mice having similarly low blood [K+] (2.6 ± 0.3mmol/l) as compared to mice receiving aldosterone alone (3.0 ± 0.3mmol/l). These effects were not simply additive, as mice receiving HSD alone had no significant change in total or phosphorylated NCC.

The coefficient of correlation between NCC (and pNCC) expression and blood [K+] was significantly reduced with HSD, when compared to mice on a control diet, reflecting a flattening of the correlation between blood [K+] and NCC (and pNCC). Our results are surprising given that previous studies have shown that blood [K+] has the primary role in regulating pNCC levels, even when other factors such as volume are accounted for (van der Lubbe et al., 2013a; Vitzthum et al., 2014; Boscardin et al., 2018). The dampening of NCC activation is not due to a downregulation of the upstream kinase signaling cascade, as changes in expression of both phosphorylated and total SPAK in both whole kidney lysate and NCC+ tubules did not correlate with changes in pNCC across the conditions. Our results suggest that HSD modulates pathways, in addition to WNK-SPAK/OSR1, which affect pNCC expression. While enhanced phosphatase activity could explain the lower pNCC in the HSD+Aldo group (Carbajal-Contreras et al., 2023; Grimm et al., 2023), it would not explain the lower total NCC. This possibility still remains to be investigated. While angiotensin II effects both NCC and ENaC expression, angiotensin II levels should be suppressed in mice receiving aldosterone and/or a HSD (Beutler et al., 2003; van der Lubbe et al., 2011; Mamenko et al., 2012; van der Lubbe et al., 2013b).

Both aldosterone and blood K+ have been shown to drive changes in the architecture of the distal tubule. Aldosterone remodeling of the renal tubule is associated with cellular hypertrophy (Wade et al., 1990; Komarynets et al., 2020) and increased proliferation (Hao et al., 2021). Low blood [K+] in the setting of a low K+ diet leads to lengthening of the DCT and is a mechanism by which total NCC expression increases under conditions of hypokalemia to help limit K+ efflux (Saritas et al., 2018). We utilized tissue clearing with ethyl cinnamate to examine the changes in DCT architecture that occurred in our cohort. We hypothesized aldosterone would lengthen the DCT, which would allow for greater NCC expression and limit ENaC-dependent K+ secretion. Instead, while the diameter of the pNCC+-tubule increased with aldosterone, the length was significantly shorter. However, in animals given HSD+Aldo, the length and diameter were both significantly increased as compared to control animals. In contrast to previous work which found DCT lengthening in the setting of low K+ diet-induced hypokalemia (Saritas et al., 2018), our animals that had aldosterone-induced hypokalemia and increases in NCC and pNCC had decreased DCT length (primarily DCT1) and an increase in tubular diameter. Surprisingly, HSD+Aldo led to an increase in the length of the DCT despite a reduction in the levels of both NCC and pNCC. Therefore, tubular remodeling does not explain differences in NCC and pNCC expression in these animals. Our results add to the growing idea that hypo/hyperkalemia due to hormonal changes may differ mechanistically from dietary K+ manipulations (Sorensen et al., 2013).

Our studies have several limitations that should be noted. Given that both HSD and aldosterone, alone and in combination, led to increased water intake/urine excretion in the mice, hemodynamic changes likely occurred in our model. While the GFR was depressed in both groups receiving aldosterone, other changes such as proximal tubule Na+ reabsorption, tubular glomerular feedback, and blood pressure could be altered in such a way as to affect NCC and ENaC expression as well as tubular remodeling. Both groups that received an aldosterone infusion may experience aldosterone escape, a well described phenomenon that prevents animals from experiencing unrelenting volume expansion when exposed to elevated aldosterone levels over a long period of time, such as in hyperaldosteronism. Numerous mechanisms have been described in both rodents and humans to have a role in aldosterone escape, including increases in atrial natriuretic peptide, GFR, and UNaV (Hall et al., 1984; Kelly & Nelson, 1987; Nakamura et al., 1987; Bae et al., 2010). Reductions in proximal Na+ absorption have been reported (Gonzalez-Campoy et al., 1989) although a NO-dependent increase in NHE3 expression has also been observed (Turban et al., 2003). Aldosterone-dependent reductions in ENaC due to P2Y2 receptor signaling (Stockand et al., 2010) and a decrease in total NCC have also been observed in association with aldosterone escape (Wang et al., 2001). While our aldosterone alone treated mice have higher total and phosphorylated NCC levels, the addition of high salt diet dampened these levels, potentially as an “escape” mechanism. However, the increase in ENaC expression with HSD and aldosterone and the depressed GFR in both groups receiving aldosterone, demonstrates that the chronic conditions studied here may not fully recapitulate mechanisms of aldosterone escape observed within shorter study periods.

We examined transporter expression and tubular remodeling with chronic treatments and fixed doses of aldosterone and salt. Future studies should examine whether these changes are seen with acute treatment of HSD+Aldo, as aldosterone alone has been shown to have differences in its effects on NCC phosphorylation at acute versus chronic time points (Cheng et al., 2019; Kristensen et al., 2022). In addition, the amount of sodium in the diet and the time over which it is given may cause variable effects, as a study with 4% NaCl diet given for two weeks found a reduction in total and phosphorylated NCC in mice (Torres-Pinzon et al., 2021), whereas our protocol revealed no differences in animals given HSD alone.

Supplementary Material

Supinfo2
Supinfo1

KEY POINTS SUMMARY.

  • Aldosterone regulates volume and potassium homeostasis through effects on transporters in the kidney; its production can be dysregulated, preventing its suppression by high dietary sodium intake

  • Here we examined how chronic high sodium consumption affects aldosterone’s regulation of sodium transporters in the distal nephron

  • Our results suggest that high sodium consumption with aldosterone is associated with increased expression of all three epithelial sodium channel (ENaC) subunits, rather than just the alpha subunit

  • Aldosterone and its associated decrease in blood [K+] lead to an increased expression of Na-Cl cotransporter (NCC); the addition of high sodium consumption with aldosterone partially attenuates this NCC expression, despite similarly low blood [K+]

  • Upstream kinase regulators and tubule remodeling do not explain these results

FUNDING

This work was supported by NIH grants R01HL147818 (to TRK), P30DK079307 and U54DK137329 (the Pittsburgh Center for Kidney Research) and K08DK118211 (CRB). SMM was supported by T32DK061296, T32 DK007052, and a grant from Relypsa. Confocal microscopy was performed at a core facility supported by the Pittsburgh Center for Kidney Research and funding from an NIH Shared Instrumentation Grant (S10OD021627).

Biography

graphic file with name nihms-1959676-b0002.gif

Stephanie Mutchler received her PhD from the University of Pittsburgh where she was also a postdoctoral fellow in the laboratory of Dr. Thomas Kleyman. Here, her projects explored questions that were focused on kidney and vascular physiology. She hopes to continue addressing issues in kidney physiology and disease pathogenesis, by both increasing our understanding of mechanistic processes in the kidney and promoting evidence-informed policy through her work as an AAAS Science and Technology Policy Fellow at NIDDK.

Footnotes

COMPETING INTERESTS

None

DATA AVAILABILITY

All original blots have been provided to the journal. All original micrographs used to generate data presented in the manuscript are archived and are fully available to the journal upon reasonable request. All raw data used to generate Figures 1 and 5 are available to the journal upon reasonable request.

REFERENCES

  1. Adolf C, Gorge V, Heinrich DA, Hoster E, Schneider H, Handgriff L, Kunzel H, Sturm L, Beuschlein F & Reincke M. (2021). Altered Taste Perception for Sodium Chloride in Patients With Primary Aldosteronism: A Prospective Cohort Study. Hypertension 77, 1332–1340. [DOI] [PubMed] [Google Scholar]
  2. Asher C, Wald H, Rossier BC & Garty H. (1996). Aldosterone-induced increase in the abundance of Na+ channel subunits. Am J Physiol 271, C605–611. [DOI] [PubMed] [Google Scholar]
  3. Bae EH, Cho HJ, Kim IJ, Joo SY, Shin JH, Ma SK, Lee J & Kim SW. (2010). Altered regulation of renal nitric oxide, atrial natriuretic peptide and cyclooxygenase systems in aldosterone escape in rats. Regul Pept 159, 117–122. [DOI] [PubMed] [Google Scholar]
  4. Beutler KT, Masilamani S, Turban S, Nielsen J, Brooks HL, Ageloff S, Fenton RA, Packer RK & Knepper MA. (2003). Long-term regulation of ENaC expression in kidney by angiotensin II. Hypertension 41, 1143–1150. [DOI] [PubMed] [Google Scholar]
  5. Boscardin E, Perrier R, Sergi C, Maillard MP, Loffing J, Loffing-Cueni D, Koesters R, Rossier BC & Hummler E. (2018). Plasma Potassium Determines NCC Abundance in Adult Kidney-Specific gammaENaC Knockout. J Am Soc Nephrol 29, 977–990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Boyd-Shiwarski CR, Shiwarski DJ, Roy A, Namboodiri HN, Nkashama LJ, Xie J, McClain KL, Marciszyn A, Kleyman TR, Tan RJ, Stolz DB, Puthenveedu MA, Huang CL & Subramanya AR. (2018). Potassium-regulated distal tubule WNK bodies are kidney-specific WNK1 dependent. Mol Biol Cell 29, 499–509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Boyd-Shiwarski CR, Weaver CJ, Beacham RT, Shiwarski DJ, Connolly KA, Nkashama LJ, Mutchler SM, Griffiths SE, Knoell SA, Sebastiani RS, Ray EC, Marciszyn AL & Subramanya AR. (2020). Effects of extreme potassium stress on blood pressure and renal tubular sodium transport. Am J Physiol Renal Physiol 318, F1341–F1356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Carbajal-Contreras H, Gamba G & Castaneda-Bueno M. (2023). The serine-threonine protein phosphatases that regulate the thiazide-sensitive NaCl cotransporter. Front Physiol 14, 1100522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen JC, Lo YF, Lin YW, Lin SH, Huang CL & Cheng CJ. (2019). WNK4 kinase is a physiological intracellular chloride sensor. Proc Natl Acad Sci U S A 116, 4502–4507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F & Pearce D. (1999). Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci U S A 96, 2514–2519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cheng L, Poulsen SB, Wu Q, Esteva-Font C, Olesen ETB, Peng L, Olde B, Leeb-Lundberg LMF, Pisitkun T, Rieg T, Dimke H & Fenton RA. (2019). Rapid Aldosterone-Mediated Signaling in the DCT Increases Activity of the Thiazide-Sensitive NaCl Cotransporter. J Am Soc Nephrol 30, 1454–1470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chiga M, Rai T, Yang SS, Ohta A, Takizawa T, Sasaki S & Uchida S. (2008). Dietary salt regulates the phosphorylation of OSR1/SPAK kinases and the sodium chloride cotransporter through aldosterone. Kidney Int 74, 1403–1409. [DOI] [PubMed] [Google Scholar]
  13. Debonneville C, Flores SY, Kamynina E, Plant PJ, Tauxe C, Thomas MA, Munster C, Chraibi A, Pratt JH, Horisberger JD, Pearce D, Loffing J & Staub O. (2001). Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial Na(+) channel cell surface expression. EMBO J 20, 7052–7059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dolmatova EV, Moazzami K & Bansilal S. (2018). Dietary sodium intake among US adults with hypertension, 1999–2012. J Hypertens 36, 237–242. [DOI] [PubMed] [Google Scholar]
  15. Frindt G & Palmer LG. (2015). Acute effects of aldosterone on the epithelial Na channel in rat kidney. Am J Physiol Renal Physiol 308, F572–578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gonzalez-Campoy JM, Kachelski J, Burnett JC Jr., Romero JC, Granger JP & Knox FG. (1989). Proximal tubule response in aldosterone escape. Am J Physiol 256, R86–90. [DOI] [PubMed] [Google Scholar]
  17. Grimm PR, Tatomir A, Rosenbaek LL, Kim BY, Li D, Delpire EJ, Fenton RA & Welling PA. (2023). Dietary potassium stimulates Ppp1Ca-Ppp1r1a dephosphorylation of kidney NaCl co-transporter and reduces blood pressure. J Clin Invest. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hadchouel J, Ellison DH & Gamba G. (2016). Regulation of Renal Electrolyte Transport by WNK and SPAK-OSR1 Kinases. Annu Rev Physiol 78, 367–389. [DOI] [PubMed] [Google Scholar]
  19. Hall JE, Granger JP, Smith MJ Jr. & Premen AJ. (1984). Role of renal hemodynamics and arterial pressure in aldosterone “escape”. Hypertension 6, I183–192. [DOI] [PubMed] [Google Scholar]
  20. Hao J, Liu L, Liu Z, Chen G, Xiong Y, Wang X, Ma X & Xu Q. (2021). Aldosterone Induces the Proliferation of Renal Tubular Epithelial Cells In Vivo but Not In Vitro. J Renin Angiotensin Aldosterone Syst 2021, 9943848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hossain Khan MZ, Sohara E, Ohta A, Chiga M, Inoue Y, Isobe K, Wakabayashi M, Oi K, Rai T, Sasaki S & Uchida S. (2012). Phosphorylation of Na-Cl cotransporter by OSR1 and SPAK kinases regulates its ubiquitination. Biochem Biophys Res Commun 425, 456–461. [DOI] [PubMed] [Google Scholar]
  22. Hu JR, Sahni S, Mukamal KJ, Millar CL, Wu Y, Appel LJ & Juraschek SP. (2020). Dietary Sodium Intake and Sodium Density in the United States: Estimates From NHANES 2005–2006 and 2015–2016. Am J Hypertens 33, 825–830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hundemer GL. (2019). Primary Aldosteronism: Cardiovascular Outcomes Pre- and Post-treatment. Curr Cardiol Rep 21, 93. [DOI] [PubMed] [Google Scholar]
  24. Hunter RW, Dhaun N & Bailey MA. (2022). The impact of excessive salt intake on human health. Nat Rev Nephrol 18, 321–335. [DOI] [PubMed] [Google Scholar]
  25. Jaffe G, Gray Z, Krishnan G, Stedman M, Zheng Y, Han J, Chertow GM, Leppert JT & Bhalla V. (2020). Screening Rates for Primary Aldosteronism in Resistant Hypertension: A Cohort Study. Hypertension 75, 650–659. [DOI] [PubMed] [Google Scholar]
  26. Kelly TM & Nelson DH. (1987). Sodium excretion and atrial natriuretic peptide levels during mineralocorticoid administration. A mechanism for the escape from hyperaldosteronism. Endocr Res 13, 363–383. [DOI] [PubMed] [Google Scholar]
  27. Klemens CA, Edinger RS, Kightlinger L, Liu X & Butterworth MB. (2017). Ankyrin G Expression Regulates Apical Delivery of the Epithelial Sodium Channel (ENaC). J Biol Chem 292, 375–385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kleyman TR & Eaton DC. (2020). Regulating ENaC’s gate. Am J Physiol Cell Physiol 318, C150–C162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Komarynets O, Chassot A, Bernabeu E, Czogalla J, Roth I, Liaudet N, Prodon F, Loffing J & Feraille E. (2020). Aldosterone controls primary cilium length and cell size in renal collecting duct principal cells. FASEB J 34, 2625–2640. [DOI] [PubMed] [Google Scholar]
  30. Kristensen M, Fenton RA & Poulsen SB. (2022). Dissecting the Effects of Aldosterone and Hypokalemia on the Epithelial Na(+) Channel and the NaCl Cotransporter. Front Physiol 13, 800055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Loffing J, Pietri L, Aregger F, Bloch-Faure M, Ziegler U, Meneton P, Rossier BC & Kaissling B. (2000). Differential subcellular localization of ENaC subunits in mouse kidney in response to high- and low-Na diets. Am J Physiol Renal Physiol 279, F252–258. [DOI] [PubMed] [Google Scholar]
  32. Mamenko M, Zaika O, Ilatovskaya DV, Staruschenko A & Pochynyuk O. (2012). Angiotensin II increases activity of the epithelial Na+ channel (ENaC) in distal nephron additively to aldosterone. J Biol Chem 287, 660–671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Masilamani S, Kim GH, Mitchell C, Wade JB & Knepper MA. (1999). Aldosterone-mediated regulation of ENaC alpha, beta, and gamma subunit proteins in rat kidney. J Clin Invest 104, R19–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. McCormick JA, Mutig K, Nelson JH, Saritas T, Hoorn EJ, Yang CL, Rogers S, Curry J, Delpire E, Bachmann S & Ellison DH. (2011). A SPAK isoform switch modulates renal salt transport and blood pressure. Cell Metab 14, 352–364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mutchler SM, Hasan M, Kohan DE, Kleyman TR & Tan RJ. (2021). Deletion of the Gamma Subunit of ENaC in Endothelial Cells Does Not Protect against Renal Ischemia Reperfusion Injury. Int J Mol Sci 22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Mutchler SM, Shi S, Whelan SCM & Kleyman TR. (2023). Validation of commercially available antibodies directed against subunits of the epithelial Na(+) channel. Physiol Rep 11, e15554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Nakamura T, Ichikawa S, Sakamaki T, Sato K, Kogure M, Tajima Y, Kato T & Murata K. (1987). Role of atrial natriuretic peptide in mineralocorticoid escape phenomenon in patients with primary aldosteronism. Proc Soc Exp Biol Med 185, 448–454. [DOI] [PubMed] [Google Scholar]
  38. Palmer LG & Frindt G. (2000). Aldosterone and potassium secretion by the cortical collecting duct. Kidney Int 57, 1324–1328. [DOI] [PubMed] [Google Scholar]
  39. Piala AT, Moon TM, Akella R, He H, Cobb MH & Goldsmith EJ. (2014). Chloride sensing by WNK1 involves inhibition of autophosphorylation. Sci Signal 7, ra41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Roy A, Al-Qusairi L, Donnelly BF, Ronzaud C, Marciszyn AL, Gong F, Chang YP, Butterworth MB, Pastor-Soler NM, Hallows KR, Staub O & Subramanya AR. (2015). Alternatively spliced proline-rich cassettes link WNK1 to aldosterone action. J Clin Invest 125, 3433–3448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Saritas T, Puelles VG, Su XT, McCormick JA, Welling PA & Ellison DH. (2018). Optical Clearing in the Kidney Reveals Potassium-Mediated Tubule Remodeling. Cell Rep 25, 2668–2675 e2663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Schreiber A, Shulhevich Y, Geraci S, Hesser J, Stsepankou D, Neudecker S, Koenig S, Heinrich R, Hoecklin F, Pill J, Friedemann J, Schweda F, Gretz N & Schock-Kusch D. (2012). Transcutaneous measurement of renal function in conscious mice. Am J Physiol Renal Physiol 303, F783–788. [DOI] [PubMed] [Google Scholar]
  43. Sorensen MV, Grossmann S, Roesinger M, Gresko N, Todkar AP, Barmettler G, Ziegler U, Odermatt A, Loffing-Cueni D & Loffing J. (2013). Rapid dephosphorylation of the renal sodium chloride cotransporter in response to oral potassium intake in mice. Kidney Int 83, 811–824. [DOI] [PubMed] [Google Scholar]
  44. Soundararajan R, Wang J, Melters D & Pearce D. (2010). Glucocorticoid-induced Leucine zipper 1 stimulates the epithelial sodium channel by regulating serum- and glucocorticoid-induced kinase 1 stability and subcellular localization. J Biol Chem 285, 39905–39913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Stockand JD, Mironova E, Bugaj V, Rieg T, Insel PA, Vallon V, Peti-Peterdi J & Pochynyuk O. (2010). Purinergic inhibition of ENaC produces aldosterone escape. J Am Soc Nephrol 21, 1903–1911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Summa V, Mordasini D, Roger F, Bens M, Martin PY, Vandewalle A, Verrey F & Feraille E. (2001). Short term effect of aldosterone on Na,K-ATPase cell surface expression in kidney collecting duct cells. J Biol Chem 276, 47087–47093. [DOI] [PubMed] [Google Scholar]
  47. Terker AS, Yarbrough B, Ferdaus MZ, Lazelle RA, Erspamer KJ, Meermeier NP, Park HJ, McCormick JA, Yang CL & Ellison DH. (2016a). Direct and Indirect Mineralocorticoid Effects Determine Distal Salt Transport. J Am Soc Nephrol 27, 2436–2445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Terker AS, Zhang C, Erspamer KJ, Gamba G, Yang CL & Ellison DH. (2016b). Unique chloride-sensing properties of WNK4 permit the distal nephron to modulate potassium homeostasis. Kidney Int 89, 127–134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Terker AS, Zhang C, McCormick JA, Lazelle RA, Zhang C, Meermeier NP, Siler DA, Park HJ, Fu Y, Cohen DM, Weinstein AM, Wang WH, Yang CL & Ellison DH. (2015). Potassium modulates electrolyte balance and blood pressure through effects on distal cell voltage and chloride. Cell Metab 21, 39–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Torres-Pinzon DL, Ralph DL, Veiras LC & McDonough AA. (2021). Sex-specific adaptations to high-salt diet preserve electrolyte homeostasis with distinct sodium transporter profiles. Am J Physiol Cell Physiol 321, C897–C909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Turban S, Wang XY & Knepper MA. (2003). Regulation of NHE3, NKCC2, and NCC abundance in kidney during aldosterone escape phenomenon: role of NO. Am J Physiol Renal Physiol 285, F843–851. [DOI] [PubMed] [Google Scholar]
  52. van der Lubbe N, Lim CH, Fenton RA, Meima ME, Jan Danser AH, Zietse R & Hoorn EJ. (2011). Angiotensin II induces phosphorylation of the thiazide-sensitive sodium chloride cotransporter independent of aldosterone. Kidney Int 79, 66–76. [DOI] [PubMed] [Google Scholar]
  53. van der Lubbe N, Moes AD, Rosenbaek LL, Schoep S, Meima ME, Danser AH, Fenton RA, Zietse R & Hoorn EJ. (2013a). K+-induced natriuresis is preserved during Na+ depletion and accompanied by inhibition of the Na+-Cl− cotransporter. Am J Physiol Renal Physiol 305, F1177–1188. [DOI] [PubMed] [Google Scholar]
  54. van der Lubbe N, Zietse R & Hoorn EJ. (2013b). Effects of angiotensin II on kinase-mediated sodium and potassium transport in the distal nephron. Curr Opin Nephrol Hypertens 22, 120–126. [DOI] [PubMed] [Google Scholar]
  55. Vitzthum H, Seniuk A, Schulte LH, Muller ML, Hetz H & Ehmke H. (2014). Functional coupling of renal K+ and Na+ handling causes high blood pressure in Na+ replete mice. J Physiol 592, 1139–1157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Wade JB, Stanton BA, Field MJ, Kashgarian M & Giebisch G. (1990). Morphological and physiological responses to aldosterone: time course and sodium dependence. Am J Physiol 259, F88–94. [DOI] [PubMed] [Google Scholar]
  57. Wang XY, Masilamani S, Nielsen J, Kwon TH, Brooks HL, Nielsen S & Knepper MA. (2001). The renal thiazide-sensitive Na-Cl cotransporter as mediator of the aldosterone-escape phenomenon. J Clin Invest 108, 215–222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zhang X, Zhou Q, Chen L, Berger S, Wu H, Xiao Z, Pearce D, Zhou X & Zhang W. (2013). Mineralocorticoid receptor antagonizes Dot1a-Af9 complex to increase alphaENaC transcription. Am J Physiol Renal Physiol 305, F1436–1444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhou L, Jiang Y, Zhang C, Su T, Jiang L, Zhou W, Zhong X, Wu L & Wang W. (2023). Effects of a low-sodium diet in patients with idiopathic hyperaldosteronism: a randomized controlled trial. Front Endocrinol (Lausanne) 14, 1124479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zhou R, Patel SV & Snyder PM. (2007). Nedd4-2 catalyzes ubiquitination and degradation of cell surface ENaC. J Biol Chem 282, 20207–20212. [DOI] [PubMed] [Google Scholar]
  61. Ziera T, Irlbacher H, Fromm A, Latouche C, Krug SM, Fromm M, Jaisser F & Borden SA. (2009). Cnksr3 is a direct mineralocorticoid receptor target gene and plays a key role in the regulation of the epithelial sodium channel. FASEB J 23, 3936–3946. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supinfo2
Supinfo1

Data Availability Statement

All original blots have been provided to the journal. All original micrographs used to generate data presented in the manuscript are archived and are fully available to the journal upon reasonable request. All raw data used to generate Figures 1 and 5 are available to the journal upon reasonable request.

RESOURCES