Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Mar 7.
Published in final edited form as: Cell Stem Cell. 2024 Feb 20;31(3):421–432.e8. doi: 10.1016/j.stem.2024.01.010

Thalamocortical organoids enable in vitro modeling of 22q11.2 microdeletion associated with neuropsychiatric disorders

David Shin 1,2,3,4,5, Chang N Kim 1,2,3,4,5, Jayden Ross 1,2,3,4,5, Kelsey M Hennick 1,2,3,4,5, Sih-Rong Wu 1,2,3,4,5, Neha Paranjape 6, Rachel Leonard 1,2,3,4,5, Jerrick Wang 1,2,3,4,5, Matthew G Keefe 1,2,3,4,5, Bryan Pavlovic 5,7, Kevin C Donohue 2, Clara Moreau 8,9,10, Emilie M Wigdor 17,18, H Hanh Larson 3,19, Denise E Allen 1,2,3,4,5, Cathryn R Cadwell 3,19, Aparna Bhaduri 11, Galina Popova 1,2,3,4,5,20, Carrie E Bearden 12, Alex A Pollen 5,7, Sebastien Jacquemont 9, Stephan Sanders 17,18, David Haussler 13,14,15, Arun P Wiita 6, Nicholas A Frost 16, Vikaas Sohal 2, Tomasz J Nowakowski 1,2,3,4,5,21,*
PMCID: PMC10939828  NIHMSID: NIHMS1965367  PMID: 38382530

SUMMARY

Thalamic dysfunction has been implicated in multiple psychiatric disorders. We sought to study the mechanisms by which abnormalities emerge in the context of the 22q11.2 microdeletion, which confers significant genetic risk for psychiatric disorders. We investigated early stages of human thalamus development using human pluripotent stem cell-derived organoids and show that the 22q11.2 microdeletion underlies widespread transcriptional dysregulation associated with psychiatric disorders in thalamic neurons and glia, including elevated expression of FOXP2. Using an organoid co-culture model, we demonstrate that the 22q11.2 microdeletion mediates an overgrowth of thalamic axons in a FOXP2-dependent manner. Finally, we identify ROBO2 as a candidate molecular mediator of the effects of FOXP2 overexpression on thalamic axon overgrowth. Together, our study suggests that early steps in thalamic development are dysregulated in a model of genetic risk for schizophrenia and contribute to neural phenotypes in 22q11.2 Deletion Syndrome.

Graphical Abstract:

graphic file with name nihms-1965367-f0001.jpg

eTOC Blurb

The 22q11.2 microdeletion is a strong risk factor for neuropsychiatric disorders, such as schizophrenia and autism spectrum disorder. Nowakowski and colleagues identified that this copy number variant mediates abnormal axonal outgrowth in an organoid model of thalamocortical pathway development, in part by dysregulating a high conflidence autism risk gene, FOXP2.

INTRODUCTION

The thalamus is a subcortical structure that relays sensory information to the cortex via the thalamocortical pathway1,2. Dysfunction of this pathway has been implicated in sensory and cognitive deficits observed in neuropsychiatric disorders including schizophrenia, autism spectrum disorder (ASD), bipolar disorder, and attention deficit hyperactivity disorder (ADHD)3–11. While these disorders have a complex genetic risk architecture, copy number variation at the 22q11.2 locus represents a major risk factor12–15. The 22Q11 Deletion Syndrome (‘22q11DS’) is caused by a microdeletion of a 1.5–3 Mb part of chromosome 22 spanning 46 protein-coding genes, and affects approximately 1 in 4000 live births14. 22q11DS patients exhibit a 20-fold risk for developing psychosis14,16 and a 30–40% risk for developing ASD17. Imaging studies have identified increased connectivity between thalamic and sensory areas of the cortex in 22q11DS patients18,19, consistent with alterations observed in a broad range of psychiatric conditions3,19–21 and may contribute to disease phenotypes in 22q11DS. Clinical manifestations of 22q11DS can be detected in early life22,23, indicating that symptoms may originate from early neurodevelopmental alterations.

Brain organoids are three-dimensional in vitro models of developing brain tissue, and can be differentiated from pluripotent stem cells to study early phases of brain development24–27. Changes in neuronal excitability have been identified in 22q11DS cortical organoids28 and 2D neurons29, but subcortical structures have not been examined. The thalamocortical pathway develops when thalamic glutamatergic neurons send long-range projections to the cerebral cortex, and deep layer cortical glutamatergic neurons project to the thalamus1. Co-culture assays of thalamic and cortical tissue have been instrumental for identifying basic mechanisms of thalamocortical pathway development30. This experimental approach has recently been applied to regionalized brain organoids, demonstrating the feasibility of examining early steps in human thalamocortical pathway formation31,32.

To study how early human thalamus development might be influenced by the 22q11.2 microdeletion, we used thalamic organoid differentiations. We identified transcriptional differences between control and 22q11DS organoids using single-cell sequencing and found an enrichment for genes associated with neuropsychiatric disorders. To begin to understand how transcriptional changes in 22q11DS might influence normal thalamus development, we examined the role of elevated FOXP2 expression in 22q11DS thalamic glutamatergic neurons. We show that upregulated FOXP2 expression mediates thalamic axon overgrowth. To identify potential mechanisms of FOXP2-induced axonogenesis phenotypes, we profiled FOXP2 binding sites and identified several differentially expressed axon guidance cues. One of these genes, ROBO2, encodes for an axon repulsive receptor depleted in 22q11DS glutamatergic neurons. We demonstrate that ROBO2 knockdown in control thalamic organoids phenocopies FOXP2 overexpression. Together, this study identifies key molecular and cellular phenotypes during early human thalamocortical pathway development associated with 22q11DS and neurodevelopmental disorders, and uncover a molecular program controlled by FOXP2 that leads to thalamic axon overgrowth in 22q11DS.

RESULTS

Generation and Benchmarking of Human Thalamic Organoids

To assess the impact of 22q11.2 microdeletion on early development of human thalamic cell types, we utilized iPS lines from four 22q11DS patients and four karyotypically normal controls (Figure 1A, Figure S1A–S1D, Table S1) [STAR Methods]. We differentiated iPS lines into thalamic organoids31 and confirmed proper specification based on canonical marker expression (Figure 1B and 1C, Figure S1E) [STAR Methods]. To further benchmark thalamic organoids, we performed single-cell RNA sequencing (scRNAseq) at ten weeks of differentiation. This time point corresponds to the peak of neurogenesis in organoids33 which enables recovery of diverse cell states, including progenitor and neuronal populations. We obtained single-cell transcriptomes for 69,625 cells from three control and four patient lines across four batches of differentiation (Figure S1F–S1J) [STAR Methods]. Thalamic organoids strongly resembled primary thalamus based on Voxhunt spatial similarity mapping34 against E13.5 mouse brain and PCW15–24 human brain35 (Figure S1K–S1L). To further corroborate thalamic identity and guide interpretation of cell type classification, we mapped the data onto a scRNAseq reference dataset of the second trimester human thalamus33 (Figure 1D–1F and Figure S1M–S1P). Cells from all lines mapped to the major neuronal and progenitor populations in the human thalamus, although sampling biases associated with scRNAseq contributed to cell type proportion differences across iPS lines and batches (Figure 2A–2B and Figure S1H, S1I, S1N–S1P). We thus identified organoid cells that resembled glutamatergic neurons, GABAergic neurons, intermediate progenitors, astrocytes, glial progenitors, and dividing cells of the developing human thalamus (Figure 1F and 1G, Table S2).

Figure 1. Benchmarking of human thalamic organoids derived from 22q11DS and control iPS lines.

Figure 1.

(A) SNP array imaging results for chr22 of control and 22q11DS patient iPS lines. (B) Immunostaining against pan-neuronal marker HuC/D and thalamic neuron marker GBX2 (top), GABAergic neuron markers GAD65/67 and LHX1 (middle), and pan-thalamic marker TCF7L2 and progenitor marker PAX6 (bottom). Scale bar, low magnification: 500 μm, high magnification: 50 μm. (C) Quantification of immunostainings in (B). Mean ± SEM is shown. (D) Schematic of scRNAseq analysis strategy. (E, F) Uniform Manifold Approximation and Projection (UMAP) plots depicting cell types in the primary reference (E) and reference-mapped thalamic organoid (F) datasets. (G) Gene expression plot for major cell type markers in thalamic organoids.

See also Figure S1, Table S1, and Table S2.

Figure 2. Transcriptomic changes in 22q11DS thalamic and cortical organoids.

Figure 2.

(A) UMAPs by genotype. (B) Cell type proportions by genotype. (C) Number of 22q11DS-associated differentially expressed genes (DEGs) by cell type. (D, E) Overlap between ASD risk genes (SFARI, risk score = 1) and DEGs in at least one cell type (D) or per cell type (E). *** FDR < 0.0005; hypergeometric test. (F) Significance of differentially expressed transcription factors implicated in ASD (SFARI, risk score = 1). (G, H) Immunostaining for pan-neuronal marker HuC/D, pan-thalamic marker TCF7L2, and DEGs FOXP2 (G) or SOX2 (H) in week 10 thalamic organoids. Left: tilescan of the entire organoid, scale bar = 250 μm. Right: high magnification images represented by insets on the left. Scale bar = 50 μm. (I, J) Percentage of TCF7L2/HuC/D+ cells expressing FOXP2 (I) or SOX2 (J) in thalamic organoids. Mean ± SEM is shown (*** p < 0.0005; Wilcoxon rank-sum test; n = 9 organoids per genotype). (K, L) Immunostaining for TCF7L2, FOXP2 (K), and SOX2 (L) in mouse thalamus. Left: tilescan of the entire thalamus (dotted line). Scale bar = 1 mm. Right: Higher magnification images represented by insets on the left. Scale bar = 50 μm. (M) Percentage of TCF7L2+ cells expressing FOXP2. Mean ± SEM is shown (* p < 0.05; linear mixed model regression; N = 3 biological replicates per genotype) (N) Percentage of NeuN+ cells that express SOX2. Mean ± SEM is shown (* p < 0.05; linear mixed model regression; N = 3 biological replicates per genotype)

See also Figure S2 and Table S3.

Transcriptomic Changes in 22q11DS Cell Types

Transcriptomic changes associated with the 22q11.2 microdeletion have been profiled in cortical cells28,29,36, but not in cells of subcortical identity including the thalamus. We sought to identify dysregulated gene signatures associated with the 22q11.2 microdeletion in thalamic organoids and compare them to those in cortical organoids (Figure S1Q–S1V and Table S3). We identified 5835 and 4292 differentially expressed genes (DEGs) in thalamic and cortical organoids, respectively, in at least one cell type (Figure 2C, Figure S2A and S2B, and Table S3) [STAR Methods]. DEGs included protein-coding genes within the 22q11.2 deletion, many of which were shared across regional identities (thalamic: 19/43, cortical: 20/43, shared: 15) (Figure S2C and S2D). However, a minority of DEGs outside of the 22q11.2 locus were shared between thalamic and cortical organoids, suggesting that transcriptional dysregulation outside of the 22q11.2 locus is often region-dependent (Figure S2A and S2B; Table S3).

While the 22q11.2 microdeletion carries high risk for schizophrenia, genes within the 22q11.2 locus have not been implicated by recent exome sequencing studies37,38, suggesting complex contributions of this copy number variant to disease risk. We thus examined whether transcriptomic changes identified in patient-derived organoids converge upon pathways implicated in schizophrenia or other neurodevelopmental disorders (Figure 2D–2F and Figure S2E–S2M). We first compared DEGs to high confidence schizophrenia risk genes identified by the SCHEMA consortium37. Of the 32 genes identified, 15 and 14 genes were dysregulated in at least one cell type in thalamic and cortical organoids, respectively, seven of which were shared (Figure S2E–S2G). Notably, the directionality of differential expression was often the opposite: primarily upregulated in thalamic organoids and downregulated in cortical organoids (Figure S2G). We also considered ASD high-confidence risk genes (SFARI, risk score = 1, 326 genes) and identified 130 and 100 genes that overlapped with thalamic and cortical DEGs, of which 64 were shared (Figure 2D and S2E). These results suggest that the 22q11.2 microdeletion mediates transcriptomic changes that are strongly convergent with neurodevelopmental disorder risk genes. Many of these changes are distinct to each model (Figure S2A–S2M), highlighting the need for more nuanced brain region-specific modeling for the 22q11.2 microdeletion.

Elevated FOXP2 expression in 22q11DS thalamic neurons mediates axon overgrowth

Overconnectivity between thalamus and somatosensory cortex has previously been identified in 22q11DS patients3,18,19 (Figure S3A) [STAR Methods], including in infants39. Therefore, we closely examined transcriptional changes in 22q11DS thalamic glutamatergic neurons, the primary cell class that participates in the formation of the thalamocortical pathway40. We focused on differentially expressed transcription factors, because such genes orchestrate many developmental decisions in the mammalian brain, including patterning, differentiation, and axonogenesis41–44 (Figure 2F and Table S3). DEG analysis identified FOXP2 as the most upregulated, and SOX2 as one of the most downregulated transcription factors in 22q11DS glutamatergic neurons in thalamic, but not cortical organoids (Table S3). We confirmed dysregulation of FOXP2 and SOX2 by immunostaining in thalamic organoids (Figure 2G–2J; Figure 3F and 3G) and a mouse model of 22q11.2 microdeletion (Figure 2K–2N), indicating that our finding is not a culture artifact.

Figure 3. 22q11.2 microdeletion mediates thalamocortical axon overgrowth via elevated FOXP2 expression.

Figure 3.

(A) Thalamocortical organoid co-culture model for visualizing axon outgrowth. (B) Immunostaining against thalamus marker TCF7L2 and telencephalon marker FOXG1 in thalamocortical organoid co-cultures. Scale bar: 500 μm. (C) Visualization of thalamic (green) or cortical (magenta) axons crossing the fusion boundary after six days post-fusion (dpf). Scale bar: 500 μm. (D, E) Quantification of thalamocortical (D) or corticothalamic (E) axon outgrowth. *** adj. p < 0.0005, ns = not significant; Wilcoxon rank-sum test with Bonferroni-Holm correction. In (D), n = 21 control organoids, 9 CAG-FOXP2 organoids, and 29 patient organoids. In (E), n = 16 control organoids, 10 CAG-FOXP2 organoids, and 20 patient organoids. (F) Immunostaining against FOXP2, TCF7L2, and HuC/D in a CRISPR-engineered 22q11DS thalamic organoid and isogenic control. Scale bar, low magnification: 250 μm, high magnification: 50 μm. (G) Percentage of TCF7L2/HuC/D+ cells expressing FOXP2. * adj. p < 0.05; Wilcoxon Rank-sum test with Bonferroni-Holm correction; n = 5 control organoids and 6 CRISPR-engineered organoids. (H) Visualization of thalamic (green) or cortical (magenta) axons crossing the fusion boundary. Scale bar: 500 μm. (I, J) Quantification of thalamocortical (I) or corticothalamic (J) axon outgrowth. ** adj. p < 0.005, *** adj. p < 0.0005, ns = not significant; Wilcoxon rank-sum test with Bonferroni-Holm correction. In (I), n = 4 isogenic control organoids, 3 CAG-FOXP2 organoids, and 11 CRISPR-engineered organoids. In (J), n = 4 isogenic control organoids, 4 CAG-FOXP2 organoids, and 5 CRISPR-engineered organoids. (K) Immunostaining against thalamocortical axon marker PKCδ in parasagittal sections of P56 wildtype or Df(h22q11)/+ mouse brain. Scale bar, low magnification: 1 mm, high magnification: 500 μm. (L) Percent area in the striatum occupied by thalamocortical axons across eight sections per biological replicate, comparing wildtype (n = 3) or Df(h22q11)/+ mice (n = 3). (* adj. p < 0.05; linear mixed regression model).

See also Figure S3.

FOXP2 is a high-confidence ASD risk gene45,46 (Figure 2F and Table S3) implicated in thalamocortical pathway development in mice47. We therefore examined axonal projections in control versus FOXP2-overexpressing organoids using a line-matched co-culture assay (Figure 3A and 3B, Figure S3B–S3Z) [STAR Methods]. We chose one week of co-culture as our first time point, given prior descriptions indicating it as the earliest stage at which axonal outgrowth is apparent, and five weeks as a later time point by which axons have grown in31,32,48. FOXP2 overexpression led to a significant increase in thalamocortical axon outgrowth compared to mock transduced control co-cultures at both one and five weeks post-fusion (Figure 3C and 3D, Figure S3E–S3H). We examined whether this phenotype is consistent with the 22q11.2 microdeletion by comparing control and patient co-cultures, as well as co-cultures generated using isogenic iPS lines engineered to carry the 22q11.2 microdeletion using CRISPR49 (Figure S3L). We confirmed that co-cultures carrying the 22q11.2 microdeletion also displayed overgrowth of thalamocortical axons (Figure 3C and 3D, Figure S3E–S3H). Finally, we tested whether df(h22q11)/+ mice exhibit evidence of thalamocortical axon overgrowth, given that FOXP2 is elevated in the thalamus of mutant mice (Figure 2K–2N). We stained for PKCδ, a marker of thalamocortical axons50, and identified a striking increase in PKCδ+ axons in the striatum in df(h22q11)/+ mice compared to wildtype controls (Figure 3K and 3L). This data suggests that the 22q11.2 microdeletion mediates excessive outgrowth of thalamocortical projections as a result of elevated FOXP2 expression during prenatal development.

Thalamocortical axons in the developing forebrain can facilitate corticothalamic axon guidance through fasciculation51. Consequently, it is possible that the initial overgrowth of thalamic axons could influence the development of reciprocal axons from cortical organoids. In co-cultures where control thalamic organoids overexpressing FOXP2 were fused to cortical organoids, we detected a significant increase in the number of cortical axons by week 5 post-fusion, although not at week 1 (Figure 3C and 3E, Figure S3I–S3K). Similar findings were made using organoids generated from CRISPR-engineered 22q11DS iPS lines (Figure 3H and 3J, Figure S3I–S3K) and patient-derived lines (Figure 3C and 3E, Figure S3I–S3K). To test the hypothesis that thalamic axon overgrowth is the primary driver of cortical axon overgrowth, we generated a panel of ‘chimeric’ organoids where thalamic organoids of either genotype were fused with organoids of the opposing genotype (Figure S3L). Consistent with this hypothesis, fusion of control thalamus organoids with 22q11DS cortical organoids did not result in overgrowth of thalamic or cortical axons, whereas fusion of 22q11DS thalamus organoids with control cortical organoids did result in both thalamic and cortical axon overgrowth (Figure S3M–S3P). Furthermore, co-culture of thalamic organoids with slice cultures of human second trimester cortex also displayed thalamic axon overgrowth from 22q11DS organoids compared to control (Figure S3Q). These results suggest that FOXP2 overexpression in thalamic organoids is sufficient to induce thalamic axon overgrowth, which leads to overgrowth of reciprocal axons from cortical organoids.

ROBO2 is a putative downstream target of FOXP2 that mediates overgrowth of thalamic axons in 22q11DS organoids

We tested whether elevated FOXP2 expression is necessary for axonogenesis phenotypes in 22q11DS neurons by performing FOXP2 knockdown in 22q11DS thalamus organoids (Figure 4A) [STAR Methods]. Consistent with our model that upregulated FOXP2 expression is necessary for axon overgrowth, FOXP2 knockdown in 22q11DS patient and CRISPR-derived co-cultures restored axon outgrowth to control levels (Figure 4B–4F and Figure S3R–S3X). To determine the downstream mechanisms of FOXP2-mediated axon overgrowth, we profiled the DNA binding sites of FOXP2 in thalamic organoids using CUT&Tag52 (Figure 4G) [STAR Methods]. We identified 2023 consensus peaks that resided in annotated genomic regions, and 4572 genes that resided within 500 kilobases of peak coordinates (Figure 4H and Table S4). 184 genes overlapped with DEGs identified in 22q11DS thalamic glutamatergic neurons, 21 of which were implicated in axon development53,54 (Figure 4I and 4J, Figure S4A and S4B). One of these genes, ROBO2, was well-characterized for its role in regulating thalamocortical axon guidance55,56. ROBO2 encodes for an axon guidance receptor that mediates repulsion upon contact with SLIT ligands, and is robustly expressed in the second trimester thalamus and control thalamic organoids (Figure S4C). Genes encoding ROBO2 ligands, SLIT1 and SLIT2, were robustly expressed in cortical organoids (Figure S4D). The expression of ROBO2 was downregulated in 22q11DS thalamic neurons (Figure 4J, Figure S4D, Table S3), which we hypothesized may slow down the initial outgrowth of genotypic control thalamic axons into cortical organoids. To test this, we performed ROBO2 knockdown in control thalamic organoids, which led to thalamocortical axon overgrowth compared to non-targeting control (Figure 4M and 4N). This data suggests that elevated FOXP2 expression in 22q11DS thalamic organoids leads to axon overgrowth by downregulating ROBO2 (Figure 4O–4Q).

Figure 4. ROBO2 is a putative downstream target of FOXP2 whose downregulation mediates thalamic axon overgrowth.

Figure 4.

(A) FOXP2-targeting sgRNA validation. (* adj. p < 0.05; Wilcoxon rank-sum test with Bonferroni-Holm correction) (B) Schematic of FOXP2 knockdown in thalamic organoids followed by co-culture with cortical organoids. (C, D) Thalamocortical axon outgrowth with or without FOXP2 knockdown after six days post-fusion (dpf) in 22q11DS patient lines (C) and CRISPR-engineered lines (D). Scale bar: 500 μm. (E, F) Quantification of thalamocortical axon outgrowth after FOXP2 knockdown in patient (E) or CRISPR-engineered (F) lines. * adj. p < 0.05, ** adj. p < 0.005, *** adj. p < 0.0005, ns = not significant; Wilcoxon rank-sum test with Bonferroni-Holm correction. In (E): n = 12 control organoids with non-targeting sgRNA, 8 patient organoids with FOXP2 sgRNA #1, 11 patient organoids with FOXP2 sgRNA #2, and 11 patient organoids with non-targeting sgRNA. In (F): n = 4 control organoids with non-targeting sgRNA, 13 CRISPR-engineered organoids with FOXP2 sgRNA #2, and 13 CRISPR-engineered organoids with non-targeting sgRNA. (G) CUT&Tag was performed to identify FOXP2 binding sites in week 5 control thalamic organoids. (H) Number of detected CUT&Tag peaks by functional annotation. (I) Overlap between genes within 500 kb of CUT&Tag peaks and thalamic organoid DEGs. (J) Volcano plot visualizing DEGs implicated in axon outgrowth that overlap with genes within 500 kb of FOXP2 binding sites. (K) ROBO2-targeting sgRNA validation. (* p < 0.05; Wilcoxon rank-sum test). (L) Schematic of ROBO2 knockdown in thalamic organoids followed by co-culture with cortical organoids. (M) Visualization of thalamocortical axon outgrowth with or without ROBO2 knockdown in control organoids, compared to 22q11DS organoids. Scale bar: 500 μm. (N) Quantification of thalamocortical axon outgrowth after ROBO2 knockdown. (** adj. P < 0.005, *** adj. P < 0.0005; Wilcoxon rank-sum test with Bonferroni-Holm correction; n = 12 control organoids with non-targeting sgRNA, 5 control organoids with ROBO2 sgRNA, 11 patient organoids with non-targeting sgRNA, and 14 CRISPR-engineered organoids with non-targeting sgRNA). (O-Q) Working model for how 22q11.2 microdeletion mediates axon overgrowth phenotypes in thalamocortical organoid co-cultures.

See also Figure S4 and Table S4.

DISCUSSION

Thalamocortical pathway abnormalities have been strongly implicated in the etiology of several neuropsychiatric disorders based on patient neuroimaging studies3,19–21. However, prior investigations into the molecular and cellular basis of these disorders have predominantly centered on the cerebral cortex28,29,49,57,58.

This study addresses this gap by examining the impact of the 22q11.2 microdeletion – a mutation that confers strong risk for several neurodevelopmental psychiatric disorders – on the early development of the human thalamus and formation of the thalamocortical tract.

Overgrowth of thalamocortical axons is in line with a growing body of literature implicating elevated connectivity in the thalamocortical pathway in neuropsychiatric disorders, including idiopathic and genetic forms of schizophrenia and ASD3,11,18,19,59–69. Alterations in functional connectivity in the thalamocortical pathway can be observed in idiopathic cases of ASD as early as 6 months after birth39, and our study suggests that defects in this pathway may emerge during prenatal development. Interestingly, overgrowth of thalamocortical axon tracts has been observed in other neuropsychiatric disease models, including Tsc1 deletion in mice70, and CACNA1G loss-of-function in iPS-derived organoids32. While many circuit-level mechanisms can lead to thalamocortical overconnectivity4, our data suggests one caused by thalamocortical tract formation abnormalities mediated by 22q11.2 microdeletion.

Our study highlights how 22q11DS-associated phenotypes are not necessarily convergent across brain regions. We compared transcriptomic changes associated with the 22q11.2 microdeletion in thalamic and cortical organoids and observed that while some genes were differentially expressed in both models, many others were distinct, including genes implicated in neurodevelopmental disorders. One salient example is FOXP2, which is upregulated in 22q11DS thalamic glutamatergic neurons but not cortical organoids, and mediates excessive outgrowth of thalamocortical and corticothalamic axons. This study showcases how the modularity of organoids can be used to dissect region-specific contributions of disease-associated mutations.

FOXP2 is a high-confidence ASD risk gene best known for its importance in speech and language development45,46. This gene plays an important role in regulating the development of the cerebral cortex and striatum71–73, but its role in thalamus development is relatively understudied. Recently, FOXP2 was shown to regulate thalamocortical neuron specification and pathway development47. FOXP2 expression is enriched in posterior thalamic nuclei, including the pulvinar, which is involved in transthalamic cortico-cortical communication74 implicated in neuropsychiatric disorder pathobiology75–77. Our findings provide an example for how the 22q11.2 microdeletion can mediate phenotypes via trans effects on the expression of high confidence risk genes implicated in neuropsychiatric disorders.

In summary, our study exemplifies how copy number variants linked to neuropsychiatric disorders can give rise to disease-relevant phenotypes in the thalamus, at least in part by inducing dysregulation of high confidence risk genes for neurodevelopmental disorders located outside the deletion region.

Limitations of the study

Several questions remain regarding the effects of the 22q11.2 microdeletion on thalamocortical circuit development. For example, a previous study28 has reported that the 22q11.2 microdeletion mediates excitability in cortical organoids, and it remains unclear whether this phenotype is present in thalamic organoids and how thalamocortical axonal overgrowth might affect cortical circuit development. Additionally, future studies are needed to systematically interrogate the molecular mechanisms leading to FOXP2 overexpression in 22q11DS thalamus but not cortical neurons, the mechanism and degree to which FOXP2 regulates ROBO2 expression, and the relative contributions of other FOXP2 targets on axon outgrowth.

STAR★METHODS

RESOURCE AVAILABILITY

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Dr. Tomasz Nowakowski (tomasz.nowakowski@ucsf.edu) upon reasonable request.

Materials Availability

Plasmids and cell lines generated in this study are available upon request from the lead contact.

Data and Code Availability

scRNAseq data (GSE245719) from cortical and thalamic organoids is available through GEO. scRNAseq data from the second trimester human thalamus is available through NEMO (http://data.nemoarchive.org/biccn/lab/kriegstein/transcriptome/scell/processed/counts/). Genotyping data from deidentified iPS lines is available through dbGAP (phs002624.v3.p1). Processed data related to the figures are available through UCSC Cell Browser: https://cells-test.gi.ucsc.edu/?ds=organoid-22q11 for organoid data and https://dev-thal.cells.ucsc.edu/ for primary reference data. This paper does not report original code, but all code used for analysis has been deposited at Github and is publicly available as of the date of publication. DOIs are listed in the key resources table. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon reasonable request.

KEY RESOURCE TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
TCF7L2 (mouse IgG2a, 1:250) Millipore 05-511
TCF7L2 (rabbit, 1:100) Cell Signaling C48H11
FOXG1 (rabbit, 1:500) Abcam ab196868
GBX2 (rabbit, 1:250) Proteintech 21639-1-AP
PAX6 (rabbit, 1:300) Biolegend 901301
PAX6 (sheep, 1:500) R&D Systems AF8150
EOMES (sheep, 1:300) R&D Systems AF6166
EOMES (mouse IgG1k, 1:500) eBioscience 14-4877-82
TBR1 (rabbit, 1:200) Abcam ab31940
SATB2 (mouse, 1:250) Santa Cruz Biotechnology sc-81376
OTX2 (goat, 1:100) R&D Systems AF1979
FOXP2 (sheep, 1:1000) R&D Systems AF5647
FOXP2 (rabbit, 1:1000) Abcam ab16046
FOXP2 (mouse IgG1k, 1:250) Millipore MABE415
SOX2 (rat, 1:500) Invitrogen 14-9811-82
HuC/D (mouse IgG2b, 1:250) ThermoFisher A21271
NeuN (chicken, 1:500) Millipore ABN91
VGluT2 (mouse, 1:200) Millipore MAB5504
GFP (chicken, 1:1000) Aves 1020
dsRed (rabbit, 1:250) Takara 632496
H3K27me3 Cell Signaling Technologies 9733
IgG Epicypher 13-0042
Anti-IgG secondary antibody Antibodies-Online ABIN101961
Bacterial and Viral Strains
5-alpha Competent E. Coli New England BioLabs C2987H
NEB Stable Competent E. Coli New England Biolabs C3040H
Chemicals, Peptides, and Recombinant Proteins
FBS HyClone SH30071.03
Matrigel Fisher Scientific 354234
PBS-EDTA, pH 7.5 Lonza BE02-017F
Trans-Isrib Tocris 5284
Chroman 1 Medchem Express HY-15392
Emricasan Selleckchem S7775
Polyamine Supplement Sigma-Aldrich P8483
IWR1-ε Cayman Chemical 13659
SB431542 Tocris 1614
Dorsomorphin Sigma-Aldrich P5499
LDN193189 Sigma-Aldrich SML0559
Insulin Sigma-Aldrich I9278
PD0325901 Tocris 4192
BMP7 R&D Systems 354-BP-010
BDNF Alomone b250
Penicillin-Streptomycin Gibco 15070-063
Antibiotic-Antimycotic Gibco 15240-062
Glutamax Gibco 35050-061
N2 supplement Gibco 17502-048
B27 supplement w/o Vitamin A Gibco 12587-001
B27 w/ Vitamin A Gibco 17504-001
Neurobasal Gibco 21103049
DMEM/F12 with Glutamax Gibco 10565042
L-Ascorbic Acid 2-Phosphate Wako Chemicals USA 321-44823
Insulin Gibco A11382ij
Optiferrin Invitria 777TRF029
Sodium Selenite Sigma-Aldrich S5261
FGF2-G3 Northwestern Recombinant Protein Production Core FGF2-G3
NRG1 Shenandoah 100-46
TGFB3 Qkine Qk054-0100
DMEM/F12 Corning 10-092-CM
Donkey Serum Jackson Immuno 017-000-121
Prolong Gold ThermoFisher P36934
Glycine Millipore 410225
1M HEPES ThermoFisher H3537
5M NaCl Sigma-Aldrich 71386
Spermidine Sigma-Aldrich 85558
EDTA-free complete protease inhibitor tablet Millipore 11873580001
Concanavalin A-coated beads Fisher Scientific NC1526856
1M CaCl2 VWR B9000S
MnCl2 Sigma-Aldrich M5005
0.5M EDTA Fisher Scientific AM9261
BSA NEB B9000S
Digitonin, 5% Fisher Scientific BN2006
pA-Tn5 with Nextera Adapters Epicypher 15-1117
SDS, 10% Fisher Scientific AM9822
Proteinase K Fisher Scientific FEREO0492
Phenol:chloroform:isoamyl alcohol (25:24:1 v/v) ThermoFisher 15593031
Chloroform Fisher Scientific 60-047-878
NEBNext High Fidelity 2X Master Mix NEB M0541S
Critical Commercial Assays
10X Chromium V2 10X Genomics PN-120237
10X Chromium V3 10X Genomics PN-1000092
Deposited Data
iPS line high density genotyping data This study, dbGAP phs002624.v3.p1
Processed single cell RNA-seq data (Thalamic Organoids) This study, GEO GSE245719
Processed single cell RNA-seq data (Cortical Organoids) This study, GEO GSE245719
Experimental Models: Cell Lines
Human 22q11DS iPS cell line 3577-3 (male) This study N/A
Human 22q11DS iPS cell line 5401-35 (male) This study N/A
Human 22q11DS iPS cell line 7215-32 (female) This study N/A
Human 22q11DS iPS cell line 60C2 (male) Lachmann Lab78 N/A
Human 22q11DS iPS cell line WTC11-22q11AB Deletion Clone 1 (WTC11-CRISPR1; male) Wiita Lab79 N/A
Human 22q11DS iPS cell line WTC11-22q11AB Deletion Clone 2 (WTC11-CRISPR2; male) Wiita Lab79 N/A
Human 22q11DS iPS cell line WTC11-22q11AB Deletion Clone 3 (WTC11-CRISPR3; male) Wiita Lab79 N/A
Human Ctrl iPS cell line 28126 (male) Gilad Lab80 N/A
Human Ctrl iPS cell line 20961B (male) Gilad Lab80 N/A
Human Ctrl iPS cell line WTC-11 (male) Conklin Lab81,82 CVCL_Y803
Human Ctrl iPS cell line 1323-4 (female) Conklin Lab83 CVCL_0G84
Experimental Models: Organisms/strains
wt/+ mice, C57BL/6N (male, post-natal day 56) Taconic Biosciences B6-M
Df(h22q11/+) mice, C57BL/6N (male, post-natal day 56) Taconic Biosciences 11026-M
Oligonucleotides
FOXP2 qPCR fwd primer https://pga.mgh.harvard.edu/primerbank/ AATCTGCGACAGAGACAATAAGC
FOXP2 qPCR rev primer https://pga.mgh.harvard.edu/primerbank/ TCCACTTGTTTGCTGCTGTAAA
ROBO2 qPCR fwd primer https://pga.mgh.harvard.edu/primerbank/ CGAGCCCACGACTCTGAAC
ROBO2 qPCR rev primer https://pga.mgh.harvard.edu/primerbank/ ACACAAACGTAGCTTCCTTCATC
UBC qPCR fwd primer https://pga.mgh.harvard.edu/primerbank/ GGAGCCGAGTGACACCATTG
UBC qPCR rev primer https://pga.mgh.harvard.edu/primerbank/ CAGGGTACGACCATCTTCCAG
GAPDH qPCR fwd primer https://pga.mgh.harvard.edu/primerbank/ GGAGCGAGATCCCTCCAAAAT
GAPDH qPCR rev primer https://pga.mgh.harvard.edu/primerbank/ GGCTGTTGTCATACTTCTCATGG
Recombinant DNA
pMD2.G Addgene 12259
psPAX2 Addgene 12260
pcDNA 3.1 puro Nodamura B2 Addgene 17228
pSico-CAG::GFP Nowakowski Lab N/A
pSico-CAG::dTomato Nowakowski Lab N/A
pLV-U6::sgRNAFOXP2.1-UbC::dCas9-KRAB-2A-GFP Nowakowski Lab N/A
pLV-U6::sgRNAFOXP2.2-UbC::dCas9-KRAB-2A-GFP Nowakowski Lab N/A
pLV-U6::sgRNAROBO2-UbC::dCas9-KRAB-2A-GFP Nowakowski Lab N/A
pLV-U6::sgRNAnon-targeting-UbC::dCas9-KRAB-2A-GFP Nowakowski Lab N/A
pSico-CAG:: FOXP2-2A-GFP-WPRE Nowakowski Lab N/A
pSico-CAG:: DGCR8-2A-GFP-WPRE Nowakowski Lab N/A
Software and Algorithms
ImageJ (Fiji) ImageJ84 https://imagej.net/Fiji
CellRanger v3.0 10X Genomics https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger
Seurat v3.0 Satija Lab85 https://satijalab.org/seurat/
Signac Satija Lab86 https://github.com/timoast/signac
Affinity Designer Affinity https://affinity.serif.com/en-us/designer/
BioRender BioRender https://biorender.com/
Github This Study https://github.com/dmshin14/22q11DSProject
Other
6-well Ultralow Attachment Plates Corning 3471
Cell Culture Inserts, 0.4 μm pore size Millipore PICM03050
Lipofectamine 3000 ThermoFisher L3000015
Phase Lock Tube Qiagen 129046
SPRIselect beads Beckman Coulter B23317
PhiX Control v3 Illumina FC-110-3001
NextSeq 2000 P2 100 cycle Illumina 20046811
Neon Transfection System 100μL Kit ThermoFisher MPK10096

EXPERIMENTAL MODELS AND STUDY PARTICIPANT DETAILS

Derivation and Culture of Human Induced Pluripotent Stem Cells

All of the work related to human iPS cells has been approved by the UCSF Committee on Human Research and the UCSF GESCR (Gamete, Embryo, and Stem Cell Research) Committee. We have reprogrammed three iPS cell lines (3577–3, 5401–35, 7215–32) from fibroblasts derived from 22q11DS patients that were purchased from the Coriell Cell Repository (GM03577, GM05401, GM07215). 3 × 105 fibroblasts were electroporated with the Y4 mixture of episomal plasmids encoding the reprogramming factors OCT3/4, SOX2, KLF4, L-MYC, LIN28, and an shRNA for TP53 using the Neon Transfection System 100 μl kit. Electroporations were performed using three pulses of 1,650 V and pulse width of 10 ms. 10-cm dishes that contained a feeder layer of irradiated or mitomycin-C treated SNL cells were seeded with 1–3 × 105 electroporated fibroblasts, and cultured in primate ESC medium (Reprocell) containing FGF2. Colonies that resembled stem cells based on morphology were chosen for expansion and evaluation by immunostaining and karyotyping 25 days post-electroporation. We acquired an additional iPS cell line derived from 22q11DS patient fibroblasts from the lab of Dr. Herbert Lachmann (60c2), three CRISPR-engineered iPS cell lines derived from the WTC11 control line from the lab of Arun Wiita79, and four control iPS cell lines of typical karyotype (WTC11, 28126, 1323–4, 20961B) that had been similarly derived from fibroblasts using episomal plasmids from the labs of Dr. Bruce Conklin and Dr. Yoav Gilad. We have confirmed that all of the iPS cell lines stain positive for pluripotency markers and exhibit the expected genotype and karyotype (Figure S1, see also79). All of our experiments were performed using human iPS cell lines cultured at 37°C in a humidified incubator on Matrigel-coated plates in B8 media supplemented with 2.5% BSA and 1% EmbryoMax Nucleosides87 and passaged using Biowhittaker PBS-EDTA (Lonza). Sex and other relevant metadata is reported in Table S1.

Mice

All activities related to animal husbandry and mouse procedures were conducted at the Laboratory Animal Resource Center (LARC) facilities at UCSF Mission Bay, in compliance with the guidelines outlined by the Institutional Animal Care Use Committee (IACUC) protocol #AN192726–01G. df(h22q11)/+ and wt/+ male mice that were 8 weeks of age and on the C57BL/6N background were purchased from Taconic Biosciences. Upon arrival, mice were housed in a controlled environment (70°C, 50% rack humidity) in a barrier facility with 12-hour light and 12-hour dark cycles. Mice were anesthetized with 40mg/mL tribromoethanol (Avertin) diluted in saline and administered at 0.1mL/10g of body weight. After anesthetization, mice were transcardially perfused with ice-cold PBS followed by 10mL of ice-cold 4% PFA. Brains were dissected out of the skull and submerged in 4% PFA at 4C for 24 hours followed by sucrose dehydration and OCT embedding described in Method Details.

METHOD DETAILS

Genotyping Analysis of iPS Cells

High density genotyping was performed on iPS cells using the Infinium Global Screening Array at the UC Berkeley QB3 Genomics Core. Each sample’s B-allele frequency and probe-level log R ratio was calculated using the Illumina GenomeStudio software (version 2.0.4).

Polygenic Risk Score Analysis of iPS Cells

Pre-imputation marker quality control (QC):

Samples were genotyped on the Illumina Infinium Global Screening Array-24 v3.0. We used PLINK88 v1.9 [www.cog-genomics.org/plink/1.9/] and PLINK 2.0 [www.cog-genomics.org/plink/2.0/] to conduct QC. Across all 47 samples, single nucleotide variants (SNPs) were screened on the basis of call rate < 90%, out of Hardy-Weinberg Equilibrium (P < 0.0001), or with a minor allele frequency (MAF) < 0.01. We then subset to nine samples of interest for polygenic scoring, and further removed palindromic/ambiguous SNPs, small insertions and deletions, duplicate SNPs, multiallelic variants, and sex chromosomes. Given the small number of samples, SNPs with any differential missingness between four cases and four controls were removed (N=2,610).

Pre-imputation sample QC:

All samples had a genotype call rate > 99%. We identified and removed one duplicate sample. We merged the remaining eight samples with unrelated samples from the 1,000 Genomes Project (N=2,581)89 to conduct a principal component analysis (PCA) of genotypes, and assign ancestry. SNPs for PCA (N=196,642) were those overlapping between the eight samples and 1,000 Genomes samples and LD-pruned (----indep-pairwise 50 5 0.2), including for regions of long-range LD90. We identified and removed two samples with non-European ancestry, WTC11 and 5401–35 (Table S1).

SNPs were aligned to the TOPMED imputation panel91 using the imputation preparation and checking tool (v4.3.0) (https://www.well.ox.ac.uk/~wrayner/tools/). After QC and imputation preparation, 369,960 SNPs and six samples remained for imputation.

Post-imputation filtering:

Imputed SNPs were filtered to those with an R2 ≥ 0.8. SNPs were then subset to those in the 1,000 Genomes Project. SNPs were then lifted over to GRCh37 using liftOver92 to match GWAS summary statistics for polygenic scoring and filtered to those with a MAF > 5% (N=5,298,358 SNPs).

Scoring:

We conducted polygenic scoring of six samples and 525 unrelated 1,000 Genomes European super-population individuals using LD clumping and p-value thresholding, also known as C+T (PRSice 2.3.5)93. Summary statistics for autism spectrum disorder (ASD) and schizophrenia were taken from Grove et al., 201994 and Trubetskoy et al. 202238, respectively. Summary statistics were LD-pruned for independent sites (r2 < 0.1), and a GWAS p-value threshold of p < 0.1 for ASD and p < 0.05 for schizophrenia; these thresholds were previously identified as explaining the most variance in the respective traits38,94. This left 32,738 SNPs for the ASD PGS and 30,502 SNPs for the schizophrenia PGS. To control for differences in PGS due to differences in ancestry, we regressed the PGSs on the first 20 principal components from PCA. The residuals were then centered and scaled using the mean and standard deviation of the 1,000 Genome European-ancestry controls PGS distribution (N=525).

Cerebral Organoid Differentiation and Culture

Cortical and thalamic organoids were generated from iPS cells using recently published protocols31,95. To generate cortical organoids, iPS cells were dissociated with PBS-EDTA and plated in an ultra-low attachment 6-well plate containing a DMEM/F12-based induction media containing 15% KSR, 1% MEM-NEAA, 1% Glutamax, 1% Pen-Strep, 100 μM β-Mercaptoethanol, 5 μM Dorsomorphin, 5 μM SB-431542, 3 μM IWR1-endo, and 1X CEPT apoptosis inhibitor cocktail (50 nM chroman 1, 5 μM emricasan, 0.1% polyamine supplement, and 0.7 μM trans-ISRIB). Neural induction media was replaced every two days for eight days, and Y27632 was removed from the media on the fourth day. After neural induction, plates containing cortical organoids were transferred to a plate shaker rotating at 80 rpm. From Days 8–18, cortical organoids were cultured in an expansion media comprised of a 1:1 mixture of DMEM/F12 and Neurobasal medium containing 1% N2, 2% B27 without vitamin A, 1% Glutamax, 1% MEM-NEAA, 55 mM β-Mercaptoethanol, 1% Antibiotic-Antimycotic, 10 ng/mL FGF2, and 10 ng/mL EGF, with a media exchange every two days. After Day 18, cortical organoids were moved into a maintenance media comprised of a 1:1 mixture of DMEM/F12 and Neurobasal medium containing 1% N2, 2% B27 with vitamin A, 1% Glutamax, 1% MEM-NEAA, 55 mM β-Mercaptoethanol, 1% Antibiotic-Antimycotic, and 200 μM ascorbic acid.

To generate thalamic organoids, iPS cells were dissociated with PBS-EDTA and resuspended in a DMEM/F12-based induction media containing 15% KSR, 1% MEM-NEAA, 1% Glutamax, 1% Pen-Strep, 100 μM β-Mercaptoethanol, 100 nM LDN-193189, 10 μM SB-431542, 4 μg/mL Insulin, and 20 μM Y27632. Induction media was replaced every two days, and Y27632 was removed on the fourth day. After eight days of induction, plates containing thalamic organoids were transferred to a plate shaker rotating at 80 rpm. From Days 8–16, thalamic organoids were cultured in a patterning media comprised of a 1:1 mixture of DMEM/F12 and Neurobasal medium containing 1% N2, 2% B27 without vitamin A, 1% Glutamax, 1% MEM-NEAA, 55 mM β-Mercaptoethanol, 1% Antibiotic-Antimycotic, 30 ng/mL BMP7, and 1 μM PD325901, with a media exchange every two days. After Day 16, thalamic organoids were moved into the maintenance media described above for cortical organoids.

Molecular cloning of plasmid vectors

For knockdown experiments, CRISPRi sgRNAs were chosen based on their predicted specificity and efficacy. The sequences for sgRNAs are as follows: FOXP2 sgRNA #1 - GGAGCCGGGAGACCAGACAC; FOXP2 sgRNA #2 - GTCAGTCTGGGACGTGATCG; ROBO2 sgRNA - GCCGAACTCCTACGTGGTGA; Non-targeting control sgRNA from Horlbeck et al. 201696 - GCGCCAAACGTGCCCTGACGG. Oligonucleotides containing guide sequences were synthesized through a commercial source (IDT), annealed, and cloned into the plasmid pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP (Addgene Plasmid #71237) that was digested using the BsmBI restriction enzyme. Lentivirus was produced as described in the previous section. sgRNAs were validated for knockdown efficiency by transducing HEK293T cells at an MOI of 3 with lentivirus and performing qPCR to compare expression of the gene of interest between cultures transduced with FOXP2- or ROBO2-targeting sgRNAs versus non-targeting control.

Lentivirus Production

HEK293T cells cultured in DMEM containing 10% FBS and 1% Pen-Strep were transfected with the second generation lentiviral constructs pMD2.G, psPAX2, and a transfer vector of interest (1:1:2 molar ratio for plasmids less than 10 kb, and 1:1:3 molar ratio for plasmids greater than 10 kb) using Lipofectamine 3000 according to the manufacturer’s protocol. The next day, media was exchanged with Ultraculture media (Lonza) supplemented with 2% FBS, 1% Glutamax, 1% Pen-Strep, 5 mM Sodium Butyrate, and 110 μg/mL Sodium Pyruvate. Viral supernatant was collected 48 hours later and concentrated by ultracentrifugation with a 30% sucrose cushion using the Beckman Ultra SW32Ti rotor at 22,000 rpm for two hours at 4°C. Lentivirus was titered by transducing HEK293T cells using a limiting dilution and quantifying the number of fluorescent cells in wells transduced between 10–20% efficiency.

Viral Labeling and Generation of Thalamocortical Organoids

At day 30 of differentiation, cortical and thalamic organoids were sectioned on an automated vibrating microtome (Leica VT1200S) at 300 μm thickness and plated onto organotypic slice culture inserts. The resulting slices were injected with ~1 μl of lentivirus (1 × 108 TU/mL) using a glass micropipette and cultured with complete media exchange every 2–3 days. At day 35, thalamic and cortical organoid slices were rinsed three times in maintenance media, to ensure removal of residual virus. To generate thalamocortical organoids, thalamic and cortical organoid slices were cultured adjacent to each other on cell culture inserts (Millipore PICM03050) coated with rat tail collagen I (10 μg/cm2, 1 hour at room temperature).

In axon outgrowth experiments described in Figures 1 and 2, thalamic and cortical organoids were transduced with CAG∷EGFP-WPRE and CAG∷dTomato-WPRE lentivirus, respectively. Isogenic thalamocortical organoids were generated by plating thalamic and cortical slices derived from the same line. Chimeric thalamocortical organoids were generated by plating together thalamic and cortical slices derived from opposing genotypes. In knockdown experiments, thalamic organoids were transduced with hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP lentivirus expressing targeting or non-targeting sgRNA control. Given that GFP expression was not visible without immunostaining, sgRNA-labeled thalamic organoids were co-transduced with CAG∷dTomato-WPRE lentivirus to visualize axons. After transduction, thalamic organoids were fused to unlabeled cortical organoids derived from the same cell line. In FOXP2 overexpression experiments, thalamic organoids were transduced with CAG∷GFP-2A-FOXP2-WPRE or CAG∷GFP-WPRE mock control lentivirus and fused to unlabeled or CAG∷dTomato-labeled cortical organoids derived from the same cell line.

Generation of Co-cultures of Thalamic Organoids and Slice Cultures from Human Cortex

300-μm thick sections of human cortex (GW18–21) were generated using an automated vibrating microtome (Leica VT1200S) and plated onto organotypic slice culture inserts. Two thalamic organoids, one carrying the 22q11 deletion and labeled with EGFP and one control labeled dTomato, were plated in close proximity to the ventricular zone of the primary cortical slice. These co-cultures were maintained in organoid maintenance media described above and fixed one week later using 4% paraformaldehyde (PFA) for one hour at 4°C.

Quantification of Axon Outgrowth in Thalamocortical Organoids

Tilescans of thalamocortical organoids were collected using a Leica SP8 laser scanning confocal microscope with a 10X air objective, with optical sections collected at every 2.4 μm. Imaging was performed under physiological conditions (37°C, 5% CO2) using an environmental chamber. Confocal microscopy images of axon outgrowth in thalamocortical organoids were processed in ImageJ (Fiji). To visualize axons, z-stacks were projected by taking the sum of fluorescence intensity in ImageJ (Fiji). The brightness of grayscale images were adjusted until all of the thalamocortical projections were clearly visible, and the colors were inverted. We identified and marked the border between the cortical and thalamic organoids on the GFP or dTomato image, which was clearly visible based on brightfield images. Then, we defined a boundary in the organoid that the axons were migrating into that was 500 μm (fused for 1 week) or 1mm (fused for 5 weeks) away from the cortex-thalamus boundary and ran parallel to the border. We manually counted the number of axons that crossed this boundary in each of our co-cultures using the CellCounter plug-in in Fiji. Axon counts were normalized to the number of fluorescently labeled cells in the organoid from which the axons originated, which were quantified using QuPath software.

Single Cell mRNA Sequencing

Organoids were incubated in 10 U/mL papain (Worthington) containing 500 ng/mL DNAse I for 30 minutes at 37°C, and dissociated using manual trituration with a fire-polished glass pipette in 10% FBS containing DMEM. Dissociated cells were passed through a 40 μm nylon mesh filter. 5×105 cells were centrifuged at 300×g for four minutes at 4°C, washed once with 1mL ice-cold PBS without Calcium or Magnesium, and passed through a 40 μm nylon mesh filter. Barcoded samples were pooled and 5 × 104 cells total were loaded for each microfluidic lane for droplet-based single cell RNA sequencing using the 10X Genomics Chromium Single Cell 3’ Reagent Kits (v3) according to manufacturer instructions.

Sample Demultiplexing, Dataset Integration, and Clustering Analysis

Read alignment and generation of feature-barcode matrices were generated using CellRanger97. Pooled samples were demultiplexed using SNP genotype data following reference genotyping using the Vireo package98. Feature-barcode matrices were processed using the Seurat package99 in R for clustering. Prior to clustering, we first removed cells that contained fewer than 1000 genes or greater than 10% of reads that corresponded to mitochondrial genes. For each dataset corresponding to a single batch, which we define as scRNAseq experiments that were run on the same 10X Chromium chip, we performed principal components analysis to identify the major sources of variance, followed by nearest neighbor embedding in the space of significant principal components. Significant principal components were determined using the ElbowPlot method. To determine molecularly distinct clusters, we performed Louvain clustering for community detection based on Jaccard similarities between pairs of cells. To identify the top genes with enriched expression in every cluster, we performed differential gene expression analysis using Wilcoxon rank-sum test. We removed cells corresponding to clusters defined primarily by ribosomal or mitochondrial genes. In addition, we removed clusters associated with off-target brain regions, i.e. hindbrain, midbrain, and cell types that were not reproducibly generated across lines, i.e. endothelial cells, pericytes, OPCs. After this series of quality control filtering, we pooled data across multiple batches and performed dataset integration using the Harmony workflow100, or reference mapping using the Symphony workflow101. We also incorporated previously published scRNAseq data generated from cortical organoids28 (GSE145122) during dataset integration.

Differential Gene Expression Analysis and Gene Ontology Analysis

Differential gene expression analysis was performed to compare 22Q11DS and control cells within each cell type identified in the thalamic and cortical organoid datasets. Cells corresponding to the cell type of interest were subsetted from the rest of the data, and we identified differentially expressed genes in 22Q11DS cells using MAST102. We removed genes from the output of this analysis whose average log fold change was less than 0.1 and adjusted p-value was less than 0.05. Next, we performed a variancePartition103 analysis to identify the contribution of Batch effect or effect of a single individual for each differentially expressed gene using the VariancePartition package in R. We removed all genes whose differential expression was driven by greater than 25% batch effect and 25% individual effect. We performed gene ontology analysis on the remaining genes. To identify aberrant molecular pathways or biological processes, we performed gene ontology analysis using the clusterProfiler package104.

DEGs identified from our organoid scRNAseq datasets were compared with existing psychiatric disease genes. These include genes associated with rare coding variants from exome sequencing studies for schizophrenia37 and ASD46, GWAS variants for schizophrenia38, ASD94,105, and bipolar disorder106, postmortem genes previously identified using bulk RNAseq for schizophrenia, ASD, and bipolar disorder107, and genes identified in bulk RNAseq from an iPS-derived cortical neuron model of 22q11DS29. For bulk RNAseq datasets, we considered a gene to be differential expressed based on cutoff of adjusted p-value less than 0.05 and the absolute value of average log fold change greater than 0.25.

Tissue processing and Immunohistochemistry

Organoids, primary human thalamus, and hemisected mouse brain hemispheres were fixed using 4% paraformaldehyde (PFA) for one hour at room temperature (organoids) or for 24 hours at 4°C (tissue). Organoids and tissue were subsequently incubated in PBS containing 30% sucrose for 48 hours, and embedded in a 1:1 mixture of 30% sucrose and OCT (Tissue-Tek). Organoids were serially sectioned at 12 μm onto glass slides using a cryostat. Human thalamus tissue and the right hemisphere of mouse brains were serially sectioned at 12 μm and 25 μm, respectively, in the sagittal orientation onto glass slides. Mouse brain sections containing thalamus were manually aligned to the Allen Institute Brain Atlas for P56 sagittal mouse brain (http://mouse.brain-map.org/) using the position of the thalamus in relation to the hippocampus as a reference, which was visualized using a stereomicroscope. Mouse brain sections corresponding to slides 15 and 16 on the reference atlas were selected at random for analysis.

To perform antigen retrieval, slides were incubated for 15 minutes in 10 mM sodium citrate (pH 6) that had been heated to boiling temperature in a pressure cooker. After antigen retrieval, slides were washed briefly in 1X PBS and incubated for one hour in a blocking buffer comprising PBS containing 10% Donkey Serum, 2% Gelatin, and 0.1% Triton-X. Slides were subsequently incubated overnight at 4°C in primary antibodies diluted in the blocking buffer. The next day, slides were washed three times over the course of 30 minutes in PBS containing 0.1% Triton-X, incubated for one hour at room temperature in secondary antibodies diluted at 1:1000 in the blocking buffer, and washed again three times in PBS containing 0.1% Triton-X. Slides were treated with 300 nM DAPI for five minutes and mounted in a Prolong Gold antifade mounting medium. Primary antibodies and their concentrations are listed in the Key Resource Table.

Quantification of Immunohistochemistry Images

All images were collected on a Leica SP8 confocal microscope and processed in ImageJ (Fiji) using the CellCounter plug-in. For organoids, images were collected at 20X magnification from 2–3 cryosections per organoid, with three to five fields-of-view collected per cryosection, across two batches of differentiation. Quantifications per field-of-view were averaged by organoid. For FOXP2 and SOX2 staining in mouse brain, a tilescan was collected across three cryosections per brain, while keeping the anatomical locations and regions of interest consistent across biological replicates. For PKCδ staining, a tilescan was collected across eight cryosections per brain. The background was corrected by thresholding and a region of interest was manually drawn in the thalamus (FOXP2 and SOX2 stain) or along the perimeter of the dorsal striatum (PKCδ). The area fraction was quantified to represent the percentage coverage of of PKCδ+ thalamocortical axons.

CUT&Tag

CUT&Tag was performed on dissociated organoids as previously described52 with some modifications. Briefly, 200,000 cells per reaction were pelleted at 600g for 3 minutes at room temperature and resuspended and fixed in PBS with 0.1% formaldehyde for 2 minutes. 1.25M glycine was added to double the molar concentration of formaldehyde and stop cross linking, and cells were spun down at 1300g at 4C for 3 minutes. Cells were resuspended in wash buffer (20mM HEPES pH 7.5, 150mM NaCl, 0.5mM spermidine, and 1 EDTA-free complete protease inhibitor tablet). Concanavalin A-coated beads (Fisher Scientific #NC1526856) were prepared by adding 10μL beads per reaction to bead-binding buffer (20mM HEPES pH 7.9, 10mM KCl, 1mM CaCl2, and 1mM MnCl2). Using a magnetic rack, binding buffer was removed, and beads were resuspended in binding buffer once more before removing the binding buffer again and finally resuspending in enough binding buffer for 10μL per reaction. 10μL beads were then added to cells and incubated on an end over end rotator for 10 minutes at room temperature. Wash buffer was removed from cells using a magnetic rack, and cells were resuspended in enough antibody buffer (wash buffer with 2mM EDTA, 0.1% BSA, and 0.05% digitonin) for 50μL per reaction. Primary antibodies (FOXP2 Abcam ab16046, H3K27me3 Cell Signaling Technologies #9733, IgG Epicypher #13-0042) were added at 1:50 dilution and samples were nutated overnight at 4C. Using a magnetic rack, primary antibody was removed, and cells were resuspended in 100μL secondary antibody (Antibodies Online #ABIN101961) diluted in wash buffer with 0.05% digitonin. Cells were then nutated for one hour at room temperature. Secondary antibody mix was removed using a magnetic rack, and cells were washed with wash buffer with 0.05% digitonin three times. pA-Tn5 preloaded with Nextera adapters (Epicypher #15–1117) was diluted 1:20 in dig-300 buffer (20mM HEPES pH7.5, 300mM NaCl, 0.5mM spermidine, 0.015% digitonin with 1 EDTA-free complete protease inhibitor tablet) and cells were resuspended in 50μL of pA-Tn5 mix. Cells were nutated for one hour at room temperature. Using a magnetic rack, pA-Tn5 mix was removed, and cells were washed three times in dig-wash buffer. Cells were resuspended in 300μL of tagmentation buffer (dig-300 buffer with 10mM MgCl2) and incubated in a 37C water bath for one hour. Cells were released from beads with addition of 10μL 0.5M EDTA, 3μL 10% SDS, and 2.5μL 20mg/ml proteinase K. Samples were vortexed and incubated in a heat block at 55C for one hour. Fragments were purified by adding 300μL phenol:chloroform:isoamyl alcohol (25:24:1 v/v) and sample to a phase lock tube (Qiagen #129046), and spun down at 16,000g for 3 minutes. 300μL chloroform was added to each sample and spun down once more at 16,000g for 3 minutes. The aqueous layer was added to a 1.5ml lo-bind tube with 750μL 100% ethanol and mixed by pipetting. Samples were cooled on ice and spun down at 16,000g for 15 minutes at 4C. Supernatant was decanted, and samples were washed once more with 1ml 100% ethanol and spun down at 16,000g for 1 minute at 4C. Ethanol was decanted, the pellet was air dried, and resuspended in 22μL water. Libraries were amplified by mixing 21μL sample, 2μL each i5 and i7 primers (Illumina #FC-131–2001), and 25μL NEBNext High Fidelity 2X Master Mix (NEB #M0541S) and using the following PCR cycle settings: 72C for 5 minutes, 98C for 30 seconds, 98C for 10 seconds, 61C for 10 seconds, repeat steps 3–4 15x, and a final 72C incubation for 1 minute. Libraries were purified using SPRI Select Reagent (Beckman Coulter #B23317) and eluted in 20μL water. Libraries were pooled to 2nM and diluted to a final concentration of 750pM with 2% PhiX spike in for sequencing using the Illumina NextSeq 2000 with a targeted read depth of ~10 million reads per sample. 2 technical replicates were used per sample.

CUT&Tag analysis

Reads were trimmed using TrimGalore, aligned to reference genomes for hg38 and E. coli using bowtie2 with parameters “--end-to-end --very-sensitive --no-mixed --no-discordant --phred33 -I 10 -X 700.” Duplicates were marked and removed with picard. Peaks were called using MACS2 using the corresponding IgG sample as a control, with q = 0.01.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analysis was performed in RStudio. The statistical test, sample size, and p-value for each experiment are described in the figure legends and Results section of the manuscript. Statistical significance was defined as a p-value less than 0.05 after correction for multiple comparisons when warranted.

Supplementary Material

1
2

Table S2. Cell type markers for week 10 thalamic and cortical organoid scRNAseq data. Related to Figure 1 and Figure S1.

3

Table S3. Differentially expressed genes in 22q11DS thalamic and cortical organoid cell types with disease association annotations. Related to Figure 2 and Figure S2.

4

Table S4. Annotation of FOXP2 CUT&Tag peaks in week 5 thalamic organoids. Related to Figure 4.

Highlights:

  • Gene signatures in iPS-derived thalamic organoids resemble those in human thalamus

  • 22q11.2 deletion mediates transcriptomic changes linked to psychiatric disorders

  • 22q11.2 deletion promotes thalamocortical axon overgrowth in organoids and mice

  • Elevated FOXP2 in 22q11DS thalamic organoids causes thalamocortical axon overgrowth

ACKNOWLEDGEMENTS

The authors wish to thank Erika Pedrosa and Herbert Lachman (Albert Einstein College of Medicine) for generously sharing iPS lines. We thank Nawei Sun and Jeremy Willsey for sharing FOXP2-targeting sgRNAs. We thank Matthew State, Helen Willsey, and members of the Nowakowski and Bhaduri laboratories for their generous feedback on the project and for reading this manuscript. This work was supported by gifts from William K. Bowes Jr. Foundation and Schmidt Futures, and grants from NIH: R01NS123263, R01MH125516, U01MH115747, Klingenstein-Simons Award in Neuroscience, the Sontag Foundation Distinguished Scientist Award, and the Broad Foundation Innovation Award to T.J.N. This work was also supported by NIH grant R01MH085953 (C.E.B.). NSF Graduate Research Fellowship (D.S.), a grant from the Brain Canada Multi-Investigator initiative (S.J.) and a grant from The Canadian Institutes of Health Research (CIHR 400528, S.J.). This research was also supported by Compute Canada, Brain Canada Multi investigator research initiative (MIRI), Canada First Research Excellence Fund, Institute of Data Valorization, Healthy Brain Healthy Lives (S.J.).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

DECLARATION OF INTERESTS

The authors declare no competing interests.

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at

REFERENCES

  • 1.Halassa MM, and Sherman SM (2019). Thalamocortical Circuit Motifs: A General Framework. Neuron 103, 762–770. 10.1016/j.neuron.2019.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Roy DS, Zhang Y, Halassa MM, and Feng G (2022). Thalamic subnetworks as units of function. Nat. Neurosci 25, 140–153. 10.1038/s41593-021-00996-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Moreau CA, Kumar K, Harvey A, Huguet G, Urchs S, Douard EA, Schultz LM, Sharmarke H, Jizi K, Martin C-O, et al. (2021). Atlas of functional connectivity relationships across rare and common genetic variants, traits, and psychiatric conditions. bioRxiv. 10.1101/2021.05.21.21257604. [DOI] [Google Scholar]
  • 4.Roy DS, Zhang Y, Aida T, Choi S, Chen Q, Hou Y, Lea NE, Skaggs KM, Quay JC, Liew M, et al. (2021). Anterior thalamic dysfunction underlies cognitive deficits in a subset of neuropsychiatric disease models. Neuron 109, 2590–2603.e13. 10.1016/j.neuron.2021.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wells MF, Wimmer RD, Schmitt LI, Feng G, and Halassa MM (2016). Thalamic reticular impairment underlies attention deficit in Ptchd1(Y/-) mice. Nature 532, 58–63. 10.1038/nature17427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Tomasi D, and Volkow ND (2019). Reduced Local and Increased Long-Range Functional Connectivity of the Thalamus in Autism Spectrum Disorder. Cereb. Cortex 29, 573–585. 10.1093/cercor/bhx340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Tanigaki K (2020). Thalamocortical Circuit Dysfunctions in Schizophrenia: Insights From 22q11.2 Deletion Syndrome. Biol Psychiatry Cogn Neurosci Neuroimaging 5, 842–843. 10.1016/j.bpsc.2020.07.003. [DOI] [PubMed] [Google Scholar]
  • 8.Sukhodolsky DG, Leckman JF, Rothenberger A, and Scahill L (2007). The role of abnormal neural oscillations in the pathophysiology of co-occurring Tourette syndrome and attention-deficit/hyperactivity disorder. Eur. Child Adolesc. Psychiatry 16 Suppl 1, 51–59. 10.1007/s00787-007-1007-3. [DOI] [PubMed] [Google Scholar]
  • 9.Norra C, Waberski TD, Kawohl W, Kunert HJ, Hock D, Gobbelé R, Buchner H, and Hoff P (2004). High-frequency somatosensory thalamocortical oscillations and psychopathology in schizophrenia. Neuropsychobiology 49, 71–80. 10.1159/000076413. [DOI] [PubMed] [Google Scholar]
  • 10.Kanold PO, Kara P, Reid RC, and Shatz CJ (2003). Role of subplate neurons in functional maturation of visual cortical columns. Science 301, 521–525. 10.1126/science.1084152. [DOI] [PubMed] [Google Scholar]
  • 11.Nair A, Treiber JM, Shukla DK, Shih P, and Müller R-A (2013). Impaired thalamocortical connectivity in autism spectrum disorder: a study of functional and anatomical connectivity. Brain 136, 1942–1955. 10.1093/brain/awt079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Clements CC, Wenger TL, Zoltowski AR, Bertollo JR, Miller JS, de Marchena AB, Mitteer LM, Carey JC, Yerys BE, Zackai EH, et al. (2017). Critical region within 22q11.2 linked to higher rate of autism spectrum disorder. Mol. Autism 8, 58. 10.1186/s13229-017-0171-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cohen E, Chow EW, Weksberg R, and Bassett AS (1999). Phenotype of adults with the 22q11 deletion syndrome: A review. Am. J. Med. Genet 86, 359–365. 10.1002/(sici)10968628(19991008)86:4<359∷aid-ajmg10>3.0.co;2-v. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tang SX, and Gur RE (2018). Longitudinal perspectives on the psychosis spectrum in 22q11.2 deletion syndrome. Am. J. Med. Genet. A 176, 2192–2202. 10.1002/ajmg.a.38500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sanders SJ, He X, Willsey AJ, Ercan-Sencicek AG, Samocha KE, Cicek AE, Murtha MT, Bal VH, Bishop SL, Dong S, et al. (2015). Insights into Autism Spectrum Disorder Genomic Architecture and Biology from 71 Risk Loci. Neuron 87, 1215–1233. 10.1016/j.neuron.2015.09.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Vorstman JAS, Breetvelt EJ, Duijff SN, Eliez S, Schneider M, Jalbrzikowski M, Armando M, Vicari S, Shashi V, Hooper SR, et al. (2015). Cognitive decline preceding the onset of psychosis in patients with 22q11.2 deletion syndrome. JAMA Psychiatry 72, 377–385. 10.1001/jamapsychiatry.2014.2671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Squarcione C, Torti MC, Di Fabio F, and Biondi M (2013). 22q11 deletion syndrome: a review of the neuropsychiatric features and their neurobiological basis. Neuropsychiatr. Dis. Treat 9, 1873–1884. 10.2147/NDT.S52188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Mancini V, Zöller D, Schneider M, Schaer M, and Eliez S (2020). Abnormal Development and Dysconnectivity of Distinct Thalamic Nuclei in Patients With 22q11.2 Deletion Syndrome Experiencing Auditory Hallucinations. Biol Psychiatry Cogn Neurosci Neuroimaging 5, 875–890. 10.1016/j.bpsc.2020.04.015. [DOI] [PubMed] [Google Scholar]
  • 19.Schleifer C, Lin A, Kushan L, Ji JL, Yang G, Bearden CE, and Anticevic A (2019). Dissociable Disruptions in Thalamic and Hippocampal Resting-State Functional Connectivity in Youth with 22q11.2 Deletions. J. Neurosci 39, 1301–1319. 10.1523/JNEUROSCI.3470-17.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Giraldo-Chica M, Rogers BP, Damon SM, Landman BA, and Woodward ND (2018). Prefrontal-Thalamic Anatomical Connectivity and Executive Cognitive Function in Schizophrenia. Biol. Psychiatry 83, 509–517. 10.1016/j.biopsych.2017.09.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Meechan DW, Maynard TM, Tucker ES, Fernandez A, Karpinski BA, Rothblat LA, and LaMantia A-S (2015). Modeling a model: Mouse genetics, 22q11.2 Deletion Syndrome, and disorders of cortical circuit development. Prog. Neurobiol 130, 1–28. 10.1016/j.pneurobio.2015.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Robin NH, and Shprintzen RJ (2005). Defining the clinical spectrum of deletion 22q11.2. J. Pediatr 147, 90–96. 10.1016/j.jpeds.2005.03.007. [DOI] [PubMed] [Google Scholar]
  • 23.Solot CB, Knightly C, Handler SD, Gerdes M, McDonald-McGinn DM, Moss E, Wang P, Cohen M, Randall P, Larossa D, et al. (2000). Communication disorders in the 22Q11.2 microdeletion syndrome. J. Commun. Disord 33, 187–203; quiz 203–204. 10.1016/s0021-9924(00)00018-6. [DOI] [PubMed] [Google Scholar]
  • 24.Kadoshima T, Sakaguchi H, Nakano T, Soen M, Ando S, Eiraku M, and Sasai Y (2013). Self-organization of axial polarity, inside-out layer pattern, and species-specific progenitor dynamics in human ES cell-derived neocortex. Proc. Natl. Acad. Sci. U. S. A 110, 20284–20289. 10.1073/pnas.1315710110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lancaster MA, Renner M, Martin C-A, Wenzel D, Bicknell LS, Hurles ME, Homfray T, Penninger JM, Jackson AP, and Knoblich JA (2013). Cerebral organoids model human brain development and microcephaly. Nature 501, 373–379. 10.1038/nature12517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Paşca AM, Sloan SA, Clarke LE, Tian Y, Makinson CD, Huber N, Kim CH, Park J-Y, O’Rourke NA, Nguyen KD, et al. (2015). Functional cortical neurons and astrocytes from human pluripotent stem cells in 3D culture. Nat. Methods 12, 671–678. 10.1038/nmeth.3415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Eiraku M, Watanabe K, Matsuo-Takasaki M, Kawada M, Yonemura S, Matsumura M, Wataya T, Nishiyama A, Muguruma K, and Sasai Y (2008). Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem Cell 3, 519–532. 10.1016/j.stem.2008.09.002. [DOI] [PubMed] [Google Scholar]
  • 28.Khan TA, Revah O, Gordon A, Yoon S-J, Krawisz AK, Goold C, Sun Y, Kim CH, Tian Y, Li M-Y, et al. (2020). Neuronal defects in a human cellular model of 22q11.2 deletion syndrome. Nat. Med 26, 1888–1898. 10.1038/s41591-020-1043-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Nehme R, Pietiläinen O, Artomov M, Tegtmeyer M, Valakh V, Lehtonen L, Bell C, Singh T, Trehan A, Sherwood J, et al. (2022). The 22q11.2 region regulates presynaptic gene-products linked to schizophrenia. Nat. Commun 13, 3690. 10.1038/s41467-022-31436-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Molnár Z, and Blakemore C (1991). Lack of regional specificity for connections formed between thalamus and cortex in coculture. Nature 351, 475–477. 10.1038/351475a0. [DOI] [PubMed] [Google Scholar]
  • 31.Xiang Y, Tanaka Y, Cakir B, Patterson B, Kim K-Y, Sun P, Kang Y-J, Zhong M, Liu X, Patra P, et al. (2019). hESC-Derived Thalamic Organoids Form Reciprocal Projections When Fused with Cortical Organoids. Cell Stem Cell 24, 487–497.e7. 10.1016/j.stem.2018.12.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kim J-I, Miura Y, Li M-Y, Revah O, Selvaraj S, Birey F, Meng X, Thete MV, Pavlov SD, Andersen J, et al. (2023). Human assembloids reveal the consequences of CACNA1G gene variants in the thalamocortical pathway. bioRxiv, 2023.03.15.530726. 10.1101/2023.03.15.530726. [DOI] [PubMed] [Google Scholar]
  • 33.Kim CN, Shin D, Wang A, and Nowakowski TJ (2023). Spatiotemporal molecular dynamics of the developing human thalamus. Science 382, eadf9941. 10.1126/science.adf9941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Fleck JS, Sanchís-Calleja F, He Z, Santel M, Boyle MJ, Camp JG, and Treutlein B (2021). Resolving organoid brain region identities by mapping single-cell genomic data to reference atlases. Cell Stem Cell 28, 1148–1159.e8. 10.1016/j.stem.2021.02.015. [DOI] [PubMed] [Google Scholar]
  • 35.Thompson CL, Ng L, Menon V, Martinez S, Lee C-K, Glattfelder K, Sunkin SM, Henry A, Lau C, Dang C, et al. (2014). A high-resolution spatiotemporal atlas of gene expression of the developing mouse brain. Neuron 83, 309–323. 10.1016/j.neuron.2014.05.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Rao SB, Brundu F, Chen Y, Sun Y, Zhu H, Shprintzen RJ, Tomer R, Rabadan R, Leong KW, Markx S, et al. (2023). Aberrant pace of cortical neuron development in brain organoids from patients with 22q11.2 deletion syndrome and schizophrenia. bioRxivorg. 10.1101/2023.10.04.557612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Singh T, Poterba T, Curtis D, Akil H, Al Eissa M, Barchas JD, Bass N, Bigdeli TB, Breen G, Bromet EJ, et al. (2022). Rare coding variants in ten genes confer substantial risk for schizophrenia. Nature 604, 509–516. 10.1038/s41586-022-04556-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Trubetskoy V, Pardiñas AF, Qi T, Panagiotaropoulou G, Awasthi S, Bigdeli TB, Bryois J, Chen C-Y, Dennison CA, Hall LS, et al. (2022). Mapping genomic loci implicates genes and synaptic biology in schizophrenia. Nature 604, 502–508. 10.1038/s41586-022-04434-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Nair A, Jalal R, Liu J, Tsang T, McDonald NM, Jackson L, Ponting C, Jeste SS, Bookheimer SY, and Dapretto M (2021). Altered Thalamocortical Connectivity in 6-Week-Old Infants at High Familial Risk for Autism Spectrum Disorder. Cereb. Cortex 31, 4191–4205. 10.1093/cercor/bhab078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Molnár Z (2000). Development and evolution of thalamocortical interactions. Eur. J. Morphol 38, 313–320. [PubMed] [Google Scholar]
  • 41.Pratt T, Vitalis T, Warren N, Edgar JM, Mason JO, and Price DJ (2000). A role for Pax6 in the normal development of dorsal thalamus and its cortical connections. Development 127, 5167–5178. 10.1242/dev.127.23.5167. [DOI] [PubMed] [Google Scholar]
  • 42.Mercurio S, Serra L, Motta A, Gesuita L, Sanchez-Arrones L, Inverardi F, Foglio B, Barone C, Kaimakis P, Martynoga B, et al. (2019). Sox2 Acts in Thalamic Neurons to Control the Development of Retina-Thalamus-Cortex Connectivity. iScience 15, 257–273. 10.1016/j.isci.2019.04.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Lee M, Yoon J, Song H, Lee B, Lam DT, Yoon J, Baek K, Clevers H, and Jeong Y (2017). Tcf7l2 plays crucial roles in forebrain development through regulation of thalamic and habenular neuron identity and connectivity. Dev. Biol 424, 62–76. 10.1016/j.ydbio.2017.02.010. [DOI] [PubMed] [Google Scholar]
  • 44.Ono K, Clavairoly A, Nomura T, Gotoh H, Uno A, Armant O, Takebayashi H, Zhang Q, Shimamura K, Itohara S, et al. (2014). Development of the prethalamus is crucial for thalamocortical projection formation and is regulated by Olig2. Development 141, 2075–2084. 10.1242/dev.097790. [DOI] [PubMed] [Google Scholar]
  • 45.Banerjee-Basu S, and Packer A (2010). SFARI Gene: an evolving database for the autism research community. Dis. Model. Mech 3, 133–135. 10.1242/dmm.005439. [DOI] [PubMed] [Google Scholar]
  • 46.Fu JM, Satterstrom FK, Peng M, Brand H, Collins RL, Dong S, Wamsley B, Klei L, Wang L, Hao SP, et al. (2022). Rare coding variation provides insight into the genetic architecture and phenotypic context of autism. Nat. Genet 54, 1320–1331. 10.1038/s41588-022-01104-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ebisu H, Iwai-Takekoshi L, Fujita-Jimbo E, Momoi T, and Kawasaki H (2017). Foxp2 Regulates Identities and Projection Patterns of Thalamic Nuclei During Development. Cereb. Cortex 27, 3648–3659. 10.1093/cercor/bhw187. [DOI] [PubMed] [Google Scholar]
  • 48.Miura Y, Li M-Y, Birey F, Ikeda K, Revah O, Thete MV, Park J-Y, Puno A, Lee SH, Porteus MH, et al. (2020). Generation of human striatal organoids and cortico-striatal assembloids from human pluripotent stem cells. Nat. Biotechnol 38, 1421–1430. 10.1038/s41587-020-00763-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Paranjape N, Lin Y-HT, Flores-Ramirez Q, Sarin V, Johnson AB, Chu J, Paredes M, and Wiita AP (2023). A CRISPR-engineered isogenic model of the 22q11.2 A-B syndromic deletion. Sci. Rep 13, 7689. 10.1038/s41598-023-34325-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zhang J, Velmeshev D, Hashimoto K, Huang Y-H, Hofmann JW, Shi X, Chen J, Leidal AM, Dishart JG, Cahill MK, et al. (2020). Neurotoxic microglia promote TDP-43 proteinopathy in progranulin deficiency. Nature 588, 459–465. 10.1038/s41586-020-2709-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Molnár Z, and Blakemore C (1995). How do thalamic axons find their way to the cortex? Trends Neurosci. 18, 389–397. 10.1016/0166-2236(95)93935-q. [DOI] [PubMed] [Google Scholar]
  • 52.Kaya-Okur HS, Wu SJ, Codomo CA, Pledger ES, Bryson TD, Henikoff JG, Ahmad K, and Henikoff S (2019). CUT&Tag for efficient epigenomic profiling of small samples and single cells. Nat. Commun 10, 1930. 10.1038/s41467-019-09982-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Kanehisa M, and Goto S (2000). KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28, 27–30. 10.1093/nar/28.1.27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al. (2000). Gene Ontology: tool for the unification of biology. Nat. Genet 25, 25–29. 10.1038/75556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Marcos-Mondéjar P, Peregrín S, Li JY, Carlsson L, Tole S, and López-Bendito G (2012). The lhx2 transcription factor controls thalamocortical axonal guidance by specific regulation of robo1 and robo2 receptors. J. Neurosci 32, 4372–4385. 10.1523/JNEUROSCI.5851-11.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.López-Bendito G, Flames N, Ma L, Fouquet C, Di Meglio T, Chedotal A, Tessier-Lavigne M, and Marín O (2007). Robo1 and Robo2 cooperate to control the guidance of major axonal tracts in the mammalian forebrain. J. Neurosci 27, 3395–3407. 10.1523/JNEUROSCI.4605-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Lin M, Pedrosa E, Hrabovsky A, Chen J, Puliafito BR, Gilbert SR, Zheng D, and Lachman HM (2016). Integrative transcriptome network analysis of iPSC-derived neurons from schizophrenia and schizoaffective disorder patients with 22q11.2 deletion. BMC Syst. Biol 10, 105. 10.1186/s12918-016-0366-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Li J, Ryan SK, Deboer E, Cook K, Fitzgerald S, Lachman HM, Wallace DC, Goldberg EM, and Anderson SA (2019). Mitochondrial deficits in human iPSC-derived neurons from patients with 22q11.2 deletion syndrome and schizophrenia. Transl. Psychiatry 9, 302. 10.1038/s41398-019-0643-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Kubota M, Miyata J, Sasamoto A, Sugihara G, Yoshida H, Kawada R, Fujimoto S, Tanaka Y, Sawamoto N, Fukuyama H, et al. (2013). Thalamocortical disconnection in the orbitofrontal region associated with cortical thinning in schizophrenia. JAMA Psychiatry 70, 12–21. 10.1001/archgenpsychiatry.2012.1023. [DOI] [PubMed] [Google Scholar]
  • 60.Klingner CM, Langbein K, Dietzek M, Smesny S, Witte OW, Sauer H, and Nenadic I (2014). Thalamocortical connectivity during resting state in schizophrenia. Eur. Arch. Psychiatry Clin. Neurosci 264, 111–119. 10.1007/s00406-013-0417-0. [DOI] [PubMed] [Google Scholar]
  • 61.Anticevic A, Cole MW, Repovs G, Murray JD, Brumbaugh MS, Winkler AM, Savic A, Krystal JH, Pearlson GD, and Glahn DC (2014). Characterizing thalamo-cortical disturbances in schizophrenia and bipolar illness. Cereb. Cortex 24, 3116–3130. 10.1093/cercor/bht165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Woodward ND, Karbasforoushan H, and Heckers S (2012). Thalamocortical dysconnectivity in schizophrenia. Am. J. Psychiatry 169, 1092–1099. 10.1176/appi.ajp.2012.12010056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Cheng W, Palaniyappan L, Li M, Kendrick KM, Zhang J, Luo Q, Liu Z, Yu R, Deng W, Wang Q, et al. (2015). Voxel-based, brain-wide association study of aberrant functional connectivity in schizophrenia implicates thalamocortical circuitry. NPJ Schizophr 1, 15016. 10.1038/npjschz.2015.16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Li T, Wang Q, Zhang J, Rolls ET, Yang W, Palaniyappan L, Zhang L, Cheng W, Yao Y, Liu Z, et al. (2017). Brain-Wide Analysis of Functional Connectivity in First-Episode and Chronic Stages of Schizophrenia. Schizophr. Bull 43, 436–448. 10.1093/schbul/sbw099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Marenco S, Stein JL, Savostyanova AA, Sambataro F, Tan H-Y, Goldman AL, Verchinski BA, Barnett AS, Dickinson D, Apud JA, et al. (2012). Investigation of anatomical thalamo-cortical connectivity and FMRI activation in schizophrenia. Neuropsychopharmacology 37, 499–507. 10.1038/npp.2011.215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Cho KIK, Shenton ME, Kubicki M, Jung WH, Lee TY, Yun J-Y, Kim SN, and Kwon JS (2016). Altered Thalamo-Cortical White Matter Connectivity: Probabilistic Tractography Study in Clinical-High Risk for Psychosis and First-Episode Psychosis. Schizophr. Bull 42, 723–731. 10.1093/schbul/sbv169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Woodward ND, Giraldo-Chica M, Rogers B, and Cascio CJ (2017). Thalamocortical dysconnectivity in autism spectrum disorder: An analysis of the Autism Brain Imaging Data Exchange. Biol Psychiatry Cogn Neurosci Neuroimaging 2, 76–84. 10.1016/j.bpsc.2016.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Baran B, Nguyen QTH, Mylonas D, Santangelo SL, and Manoach DS (2023). Increased resting-state thalamocortical functional connectivity in children and young adults with autism spectrum disorder. Autism Res. 16, 271–279. 10.1002/aur.2875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Ayub R, Sun KL, Flores RE, Lam VT, Jo B, Saggar M, and Fung LK (2021). Thalamocortical connectivity is associated with autism symptoms in high-functioning adults with autism and typically developing adults. Transl. Psychiatry 11, 93. 10.1038/s41398-021-01221-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Normand EA, Crandall SR, Thorn CA, Murphy EM, Voelcker B, Browning C, Machan JT, Moore CI, Connors BW, and Zervas M (2013). Temporal and mosaic Tsc1 deletion in the developing thalamus disrupts thalamocortical circuitry, neural function, and behavior. Neuron 78, 895–909. 10.1016/j.neuron.2013.03.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Konopka G, Bomar JM, Winden K, Coppola G, Jonsson ZO, Gao F, Peng S, Preuss TM, Wohlschlegel JA, and Geschwind DH (2009). Human-specific transcriptional regulation of CNS development genes by FOXP2. Nature 462, 213–217. 10.1038/nature08549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Pearson CA, Moore DM, Tucker HO, Dekker JD, Hu H, Miquelajáuregui A, and Novitch BG (2020). Foxp1 Regulates Neural Stem Cell Self-Renewal and Bias Toward Deep Layer Cortical Fates. Cell Rep. 30, 1964–1981.e3. 10.1016/j.celrep.2020.01.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Araujo DJ, Anderson AG, Berto S, Runnels W, Harper M, Ammanuel S, Rieger MA, Huang H-C, Rajkovich K, Loerwald KW, et al. (2015). FoxP1 orchestration of ASD-relevant signaling pathways in the striatum. Genes Dev. 29, 2081–2096. 10.1101/gad.267989.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Guillery RW, and Sherman SM (2002). Thalamic relay functions and their role in corticocortical communication: generalizations from the visual system. Neuron 33, 163–175. 10.1016/s0896-6273(01)00582-7. [DOI] [PubMed] [Google Scholar]
  • 75.Baran B, Karahanoğlu FI, Mylonas D, Demanuele C, Vangel M, Stickgold R, Anticevic A, and Manoach DS (2019). Increased Thalamocortical Connectivity in Schizophrenia Correlates With Sleep Spindle Deficits: Evidence for a Common Pathophysiology. Biol Psychiatry Cogn Neurosci Neuroimaging 4, 706–714. 10.1016/j.bpsc.2019.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Vukadinovic Z (2011). Sleep abnormalities in schizophrenia may suggest impaired trans-thalamic cortico-cortical communication: towards a dynamic model of the illness. Eur. J. Neurosci 34, 1031–1039. 10.1111/j.1460-9568.2011.07822.x. [DOI] [PubMed] [Google Scholar]
  • 77.Spiteri S, and Crewther D (2021). Neural Mechanisms of Visual Motion Anomalies in Autism: A Two-Decade Update and Novel Aetiology. Front. Neurosci 15, 756841. 10.3389/fnins.2021.756841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Zhao D, Lin M, Chen J, Pedrosa E, Hrabovsky A, Fourcade HM, Zheng D, and Lachman HM (2015). MicroRNA Profiling of Neurons Generated Using Induced Pluripotent Stem Cells Derived from Patients with Schizophrenia and Schizoaffective Disorder, and 22q11.2 Del. PLoS One 10, e0132387. 10.1371/journal.pone.0132387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Paranjape N, Lin Y-HT, Flores-Ramirez Q, Sarin V, Johnson AB, Chu J, Paredes M, and Wiita AP (2022). A CRISPR-engineered Isogenic Model Reveals Altered Neuronal Phenotypes of the 22q11.2 A-B Syndromic Deletion. bioRxiv, 2022.06.22.497212. 10.1101/2022.06.22.497212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Gallego Romero I, Pavlovic BJ, Hernando-Herraez I, Zhou X, Ward MC, Banovich NE, Kagan CL, Burnett JE, Huang CH, Mitrano A, et al. (2015). A panel of induced pluripotent stem cells from chimpanzees: a resource for comparative functional genomics. Elife 4, e07103. 10.7554/eLife.07103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Bershteyn M, Nowakowski TJ, Pollen AA, Di Lullo E, Nene A, Wynshaw-Boris A, and Kriegstein AR (2017). Human iPSC-Derived Cerebral Organoids Model Cellular Features of Lissencephaly and Reveal Prolonged Mitosis of Outer Radial Glia. Cell Stem Cell 20, 435–449.e4. 10.1016/j.stem.2016.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Kreitzer FR, Salomonis N, Sheehan A, Huang M, Park JS, Spindler MJ, Lizarraga P, Weiss WA, So P-L, and Conklin BR (2013). A robust method to derive functional neural crest cells from human pluripotent stem cells. Am. J. Stem Cells 2, 119–131. [PMC free article] [PubMed] [Google Scholar]
  • 83.Matsumoto Y, Hayashi Y, Schlieve CR, Ikeya M, Kim H, Nguyen TD, Sami S, Baba S, Barruet E, Nasu A, et al. (2013). Induced pluripotent stem cells from patients with human fibrodysplasia ossificans progressiva show increased mineralization and cartilage formation. Orphanet J. Rare Dis 8, 190. 10.1186/1750-1172-8-190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682. 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Butler A, Hoffman P, Smibert P, Papalexi E, and Satija R (2018). Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat. Biotechnol 36, 411–420. 10.1038/nbt.4096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Stuart T, Srivastava A, Madad S, Lareau CA, and Satija R (2021). Single-cell chromatin state analysis with Signac. Nat. Methods 18, 1333–1341. 10.1038/s41592-021-01282-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Kuo H-H, Gao X, DeKeyser J-M, Fetterman KA, Pinheiro EA, Weddle CJ, Fonoudi H, Orman MV, Romero-Tejeda M, Jouni M, et al. (2020). Negligible-Cost and Weekend-Free Chemically Defined Human iPSC Culture. Stem Cell Reports 14, 256–270. 10.1016/j.stemcr.2019.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Chang CC, Chow CC, Tellier LC, Vattikuti S, Purcell SM, and Lee JJ (2015). Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience 4, 7. 10.1186/s13742-015-0047-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.1000 Genomes Project Consortium, Auton A, Brooks LD, Durbin RM, Garrison EP, Kang HM, Korbel JO, Marchini JL, McCarthy S, McVean GA, et al. (2015). A global reference for human genetic variation. Nature 526, 68–74. 10.1038/nature15393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Price AL, Weale ME, Patterson N, Myers SR, Need AC, Shianna KV, Ge D, Rotter JI, Torres E, Taylor KD, et al. (2008). Long-range LD can confound genome scans in admixed populations. Am. J. Hum. Genet 83, 132–135; author reply 135–9. 10.1016/j.ajhg.2008.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Taliun D, Harris DN, Kessler MD, Carlson J, Szpiech ZA, Torres R, Taliun SAG, Corvelo A, Gogarten SM, Kang HM, et al. (2021). Sequencing of 53,831 diverse genomes from the NHLBI TOPMed Program. Nature 590, 290–299. 10.1038/s41586-021-03205-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Package B (2014). liftOver (Bioconductor) 10.18129/B9.BIOC.LIFTOVER. [DOI]
  • 93.Choi SW, and O’Reilly PF (2019). PRSice-2: Polygenic Risk Score software for biobank-scale data. Gigascience 8. 10.1093/gigascience/giz082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Grove J, Ripke S, Als TD, Mattheisen M, Walters RK, Won H, Pallesen J, Agerbo E, Andreassen OA, Anney R, et al. (2019). Identification of common genetic risk variants for autism spectrum disorder. Nat. Genet 51, 431–444. 10.1038/s41588-019-0344-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Bhaduri A, Andrews MG, Mancia Leon W, Jung D, Shin D, Allen D, Jung D, Schmunk G, Haeussler M, Salma J, et al. (2020). Cell stress in cortical organoids impairs molecular subtype specification. Nature 578, 142–148. 10.1038/s41586-020-1962-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Horlbeck MA, Gilbert LA, Villalta JE, Adamson B, Pak RA, Chen Y, Fields AP, Park CY, Corn JE, Kampmann M, et al. (2016). Compact and highly active next-generation libraries for CRISPR-mediated gene repression and activation. Elife 5. 10.7554/eLife.19760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Zheng GXY, Terry JM, Belgrader P, Ryvkin P, Bent ZW, Wilson R, Ziraldo SB, Wheeler TD, McDermott GP, Zhu J, et al. (2017). Massively parallel digital transcriptional profiling of single cells. Nat. Commun 8. 10.1038/ncomms14049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Huang Y, McCarthy DJ, and Stegle O (2019). Vireo: Bayesian demultiplexing of pooled single-cell RNA-seq data without genotype reference. Genome Biol. 20. 10.1186/s13059-019-1865-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM 3rd, Hao Y, Stoeckius M, Smibert P, and Satija R (2019). Comprehensive Integration of Single-Cell Data. Cell 177, 1888–1902.e21. 10.1016/j.cell.2019.05.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Korsunsky I, Millard N, Fan J, Slowikowski K, Zhang F, Wei K, Baglaenko Y, Brenner M, Loh P-R, and Raychaudhuri S (2019). Fast, sensitive and accurate integration of single-cell data with Harmony. Nat. Methods 16, 1289–1296. 10.1038/s41592-019-0619-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Kang JB, Nathan A, Weinand K, Zhang F, Millard N, Rumker L, Moody DB, Korsunsky I, and Raychaudhuri S (2021). Efficient and precise single-cell reference atlas mapping with Symphony. Nat. Commun 12, 5890. 10.1038/s41467-021-25957-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Finak G, McDavid A, Yajima M, Deng J, Gersuk V, Shalek AK, Slichter CK, Miller HW, McElrath MJ, Prlic M, et al. (2015). MAST: a flexible statistical framework for assessing transcriptional changes and characterizing heterogeneity in single-cell RNA sequencing data. Genome Biol. 16, 278. 10.1186/s13059-015-0844-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103.Hoffman GE, and Schadt EE (2016). variancePartition: interpreting drivers of variation in complex gene expression studies. BMC Bioinformatics 17, 483. 10.1186/s12859-016-1323-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Wu T, Hu E, Xu S, Chen M, Guo P, Dai Z, Feng T, Zhou L, Tang W, Zhan L, et al. (2021). clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation (Camb) 2, 100141. 10.1016/j.xinn.2021.100141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Zhou X, Feliciano P, Shu C, Wang T, Astrovskaya I, Hall JB, Obiajulu JU, Wright JR, Murali SC, Xu SX, et al. (2022). Integrating de novo and inherited variants in 42,607 autism cases identifies mutations in new moderate-risk genes. Nat. Genet 54, 1305–1319. 10.1038/s41588-022-01148-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 106.Mullins N, and Bipolar Disorder Working Group of the Psychiatric Genomics Consortium (2021). Biological insights into bipolar disorder from genome-wide association study of over 40,000 cases. Biol. Psychiatry 89, S62–S63. 10.1016/j.biopsych.2021.02.172. [DOI] [Google Scholar]
  • 107.Gandal MJ, Zhang P, Hadjimichael E, Walker RL, Chen C, Liu S, Won H, van Bakel H, Varghese M, Wang Y, et al. (2018). Transcriptome-wide isoform-level dysregulation in ASD, schizophrenia, and bipolar disorder. Science 362. 10.1126/science.aat8127. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

Table S2. Cell type markers for week 10 thalamic and cortical organoid scRNAseq data. Related to Figure 1 and Figure S1.

3

Table S3. Differentially expressed genes in 22q11DS thalamic and cortical organoid cell types with disease association annotations. Related to Figure 2 and Figure S2.

4

Table S4. Annotation of FOXP2 CUT&Tag peaks in week 5 thalamic organoids. Related to Figure 4.

Data Availability Statement

scRNAseq data (GSE245719) from cortical and thalamic organoids is available through GEO. scRNAseq data from the second trimester human thalamus is available through NEMO (http://data.nemoarchive.org/biccn/lab/kriegstein/transcriptome/scell/processed/counts/). Genotyping data from deidentified iPS lines is available through dbGAP (phs002624.v3.p1). Processed data related to the figures are available through UCSC Cell Browser: https://cells-test.gi.ucsc.edu/?ds=organoid-22q11 for organoid data and https://dev-thal.cells.ucsc.edu/ for primary reference data. This paper does not report original code, but all code used for analysis has been deposited at Github and is publicly available as of the date of publication. DOIs are listed in the key resources table. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon reasonable request.

KEY RESOURCE TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
TCF7L2 (mouse IgG2a, 1:250) Millipore 05-511
TCF7L2 (rabbit, 1:100) Cell Signaling C48H11
FOXG1 (rabbit, 1:500) Abcam ab196868
GBX2 (rabbit, 1:250) Proteintech 21639-1-AP
PAX6 (rabbit, 1:300) Biolegend 901301
PAX6 (sheep, 1:500) R&D Systems AF8150
EOMES (sheep, 1:300) R&D Systems AF6166
EOMES (mouse IgG1k, 1:500) eBioscience 14-4877-82
TBR1 (rabbit, 1:200) Abcam ab31940
SATB2 (mouse, 1:250) Santa Cruz Biotechnology sc-81376
OTX2 (goat, 1:100) R&D Systems AF1979
FOXP2 (sheep, 1:1000) R&D Systems AF5647
FOXP2 (rabbit, 1:1000) Abcam ab16046
FOXP2 (mouse IgG1k, 1:250) Millipore MABE415
SOX2 (rat, 1:500) Invitrogen 14-9811-82
HuC/D (mouse IgG2b, 1:250) ThermoFisher A21271
NeuN (chicken, 1:500) Millipore ABN91
VGluT2 (mouse, 1:200) Millipore MAB5504
GFP (chicken, 1:1000) Aves 1020
dsRed (rabbit, 1:250) Takara 632496
H3K27me3 Cell Signaling Technologies 9733
IgG Epicypher 13-0042
Anti-IgG secondary antibody Antibodies-Online ABIN101961
Bacterial and Viral Strains
5-alpha Competent E. Coli New England BioLabs C2987H
NEB Stable Competent E. Coli New England Biolabs C3040H
Chemicals, Peptides, and Recombinant Proteins
FBS HyClone SH30071.03
Matrigel Fisher Scientific 354234
PBS-EDTA, pH 7.5 Lonza BE02-017F
Trans-Isrib Tocris 5284
Chroman 1 Medchem Express HY-15392
Emricasan Selleckchem S7775
Polyamine Supplement Sigma-Aldrich P8483
IWR1-ε Cayman Chemical 13659
SB431542 Tocris 1614
Dorsomorphin Sigma-Aldrich P5499
LDN193189 Sigma-Aldrich SML0559
Insulin Sigma-Aldrich I9278
PD0325901 Tocris 4192
BMP7 R&D Systems 354-BP-010
BDNF Alomone b250
Penicillin-Streptomycin Gibco 15070-063
Antibiotic-Antimycotic Gibco 15240-062
Glutamax Gibco 35050-061
N2 supplement Gibco 17502-048
B27 supplement w/o Vitamin A Gibco 12587-001
B27 w/ Vitamin A Gibco 17504-001
Neurobasal Gibco 21103049
DMEM/F12 with Glutamax Gibco 10565042
L-Ascorbic Acid 2-Phosphate Wako Chemicals USA 321-44823
Insulin Gibco A11382ij
Optiferrin Invitria 777TRF029
Sodium Selenite Sigma-Aldrich S5261
FGF2-G3 Northwestern Recombinant Protein Production Core FGF2-G3
NRG1 Shenandoah 100-46
TGFB3 Qkine Qk054-0100
DMEM/F12 Corning 10-092-CM
Donkey Serum Jackson Immuno 017-000-121
Prolong Gold ThermoFisher P36934
Glycine Millipore 410225
1M HEPES ThermoFisher H3537
5M NaCl Sigma-Aldrich 71386
Spermidine Sigma-Aldrich 85558
EDTA-free complete protease inhibitor tablet Millipore 11873580001
Concanavalin A-coated beads Fisher Scientific NC1526856
1M CaCl2 VWR B9000S
MnCl2 Sigma-Aldrich M5005
0.5M EDTA Fisher Scientific AM9261
BSA NEB B9000S
Digitonin, 5% Fisher Scientific BN2006
pA-Tn5 with Nextera Adapters Epicypher 15-1117
SDS, 10% Fisher Scientific AM9822
Proteinase K Fisher Scientific FEREO0492
Phenol:chloroform:isoamyl alcohol (25:24:1 v/v) ThermoFisher 15593031
Chloroform Fisher Scientific 60-047-878
NEBNext High Fidelity 2X Master Mix NEB M0541S
Critical Commercial Assays
10X Chromium V2 10X Genomics PN-120237
10X Chromium V3 10X Genomics PN-1000092
Deposited Data
iPS line high density genotyping data This study, dbGAP phs002624.v3.p1
Processed single cell RNA-seq data (Thalamic Organoids) This study, GEO GSE245719
Processed single cell RNA-seq data (Cortical Organoids) This study, GEO GSE245719
Experimental Models: Cell Lines
Human 22q11DS iPS cell line 3577-3 (male) This study N/A
Human 22q11DS iPS cell line 5401-35 (male) This study N/A
Human 22q11DS iPS cell line 7215-32 (female) This study N/A
Human 22q11DS iPS cell line 60C2 (male) Lachmann Lab78 N/A
Human 22q11DS iPS cell line WTC11-22q11AB Deletion Clone 1 (WTC11-CRISPR1; male) Wiita Lab79 N/A
Human 22q11DS iPS cell line WTC11-22q11AB Deletion Clone 2 (WTC11-CRISPR2; male) Wiita Lab79 N/A
Human 22q11DS iPS cell line WTC11-22q11AB Deletion Clone 3 (WTC11-CRISPR3; male) Wiita Lab79 N/A
Human Ctrl iPS cell line 28126 (male) Gilad Lab80 N/A
Human Ctrl iPS cell line 20961B (male) Gilad Lab80 N/A
Human Ctrl iPS cell line WTC-11 (male) Conklin Lab81,82 CVCL_Y803
Human Ctrl iPS cell line 1323-4 (female) Conklin Lab83 CVCL_0G84
Experimental Models: Organisms/strains
wt/+ mice, C57BL/6N (male, post-natal day 56) Taconic Biosciences B6-M
Df(h22q11/+) mice, C57BL/6N (male, post-natal day 56) Taconic Biosciences 11026-M
Oligonucleotides
FOXP2 qPCR fwd primer https://pga.mgh.harvard.edu/primerbank/ AATCTGCGACAGAGACAATAAGC
FOXP2 qPCR rev primer https://pga.mgh.harvard.edu/primerbank/ TCCACTTGTTTGCTGCTGTAAA
ROBO2 qPCR fwd primer https://pga.mgh.harvard.edu/primerbank/ CGAGCCCACGACTCTGAAC
ROBO2 qPCR rev primer https://pga.mgh.harvard.edu/primerbank/ ACACAAACGTAGCTTCCTTCATC
UBC qPCR fwd primer https://pga.mgh.harvard.edu/primerbank/ GGAGCCGAGTGACACCATTG
UBC qPCR rev primer https://pga.mgh.harvard.edu/primerbank/ CAGGGTACGACCATCTTCCAG
GAPDH qPCR fwd primer https://pga.mgh.harvard.edu/primerbank/ GGAGCGAGATCCCTCCAAAAT
GAPDH qPCR rev primer https://pga.mgh.harvard.edu/primerbank/ GGCTGTTGTCATACTTCTCATGG
Recombinant DNA
pMD2.G Addgene 12259
psPAX2 Addgene 12260
pcDNA 3.1 puro Nodamura B2 Addgene 17228
pSico-CAG::GFP Nowakowski Lab N/A
pSico-CAG::dTomato Nowakowski Lab N/A
pLV-U6::sgRNAFOXP2.1-UbC::dCas9-KRAB-2A-GFP Nowakowski Lab N/A
pLV-U6::sgRNAFOXP2.2-UbC::dCas9-KRAB-2A-GFP Nowakowski Lab N/A
pLV-U6::sgRNAROBO2-UbC::dCas9-KRAB-2A-GFP Nowakowski Lab N/A
pLV-U6::sgRNAnon-targeting-UbC::dCas9-KRAB-2A-GFP Nowakowski Lab N/A
pSico-CAG:: FOXP2-2A-GFP-WPRE Nowakowski Lab N/A
pSico-CAG:: DGCR8-2A-GFP-WPRE Nowakowski Lab N/A
Software and Algorithms
ImageJ (Fiji) ImageJ84 https://imagej.net/Fiji
CellRanger v3.0 10X Genomics https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger
Seurat v3.0 Satija Lab85 https://satijalab.org/seurat/
Signac Satija Lab86 https://github.com/timoast/signac
Affinity Designer Affinity https://affinity.serif.com/en-us/designer/
BioRender BioRender https://biorender.com/
Github This Study https://github.com/dmshin14/22q11DSProject
Other
6-well Ultralow Attachment Plates Corning 3471
Cell Culture Inserts, 0.4 μm pore size Millipore PICM03050
Lipofectamine 3000 ThermoFisher L3000015
Phase Lock Tube Qiagen 129046
SPRIselect beads Beckman Coulter B23317
PhiX Control v3 Illumina FC-110-3001
NextSeq 2000 P2 100 cycle Illumina 20046811
Neon Transfection System 100μL Kit ThermoFisher MPK10096

RESOURCES