Summary
The notion that neutrophils exist as a homogenous population is being replaced with the knowledge that neutrophils adopt different functional states. Neutrophils can have a pro-inflammatory phenotype or an anti-inflammatory state, but how these states are regulated remains unclear. Here, we demonstrated that the neutrophil-expressed GPCR, Mrgpra1, is a negative regulator of neutrophil bactericidal functions. Mrgpra1-mediated signaling was driven by its ligand, neuropeptide FF (NPFF), which dictated the balance between pro- and anti-inflammatory programming. Specifically, the Mrgpra1-NPFF axis counter-regulated IFNγ-mediated neutrophil polarization during acute lung infection by favoring an alternative-like polarization, suggesting that it may act to balance overzealous neutrophilic responses. Distinct, cross-regulated populations of neutrophils were the primary source of NPFF and IFNγ during infection. As a subset of neutrophils at steady state expressed NPFF, these findings could have broad implications in various infectious and inflammatory diseases. Therefore, a neutrophil-intrinsic pathway determines their cellular fate, function, and magnitude of infection.
eTOC Blurb:
While it is known that pro- and anti-inflammatory neutrophils exist, the mechanisms that dictate their polarization remain unclear. Gour et al. report that neutrophils express a canonical neuronal receptor, Mrgpra1 and a neuropeptide ligand, neuropeptide FF. They find that NPFF-Mrgpra1 signaling inhibits IFNγ-mediated conditioning to promote anti-inflammatory neutrophil polarization, indicating that a neutrophil-intrinsic pathway determines their cellular fate and function.
Graphical Abstract

Introduction
During disease, immune cells can adopt differential polarization states in response to tissue signals that regulate their function. Neutrophils, long thought to be phenotypically homogeneous, can assume polarized states along a spectrum similar to what is found in macrophages1–3. Classically activated neutrophils, thought to be primarily induced via IFNγ signaling and TLR stimulation, are enhanced during infection, stroke and myocardial infarction1, 4–5. These IFNγ-programmed neutrophils also referred to as N(IFNγ) or N1-like, display a heightened anti-bacterial state characterized by enhanced migration6, elevated production of reactive oxygen species (ROS)6, and neutrophil extracellular traps (NETs)6. Conversely, neutrophils conditioned by type 2 cytokines, sometimes called N2-like, are increased during helminth infection7, skin burn4 and cancer2, 3 where they promote tissue repair and remodeling. Moreover, Th2-conditioned neutrophils have been shown to promote the formation of M2-like macrophages to aid in nematode clearance7.
Neutrophil hyperactivation resulting in uncontrolled ROS release and NET formation has been shown to drive manifestations of acute respiratory distress syndrome (ARDS) during bacterial and viral pneumonia. This has been especially prominent in COVID-19-related ARDS, where unchecked, persistent neutrophil activation increased morbidity and mortality8–13. We hypothesize that a balanced neutrophil polarization response drives protective immunity during infection while minimizing prolonged inflammation and tissue destruction. However, the mechanisms that regulate divergent functional neutrophil states remain unclear.
The Mas-Related family of G Protein-Coupled Receptors (Mrgprs), including Mrgpra1, are known to be expressed in skin-innervating sensory neurons and regulate itch and pain responses14,15. Mrgpra1 has been shown to bind several ligands, including RFamide-neuropeptides, like neuropeptide FF (NPFF), Substance P, somatostatin, and bilirubin15, 16. Despite this, the role of Mrgpra1 in immunity remains largely unknown. Conventionally thought to be restricted in expression to neuronal tissue, neuropeptides are now known to be expressed by various non-neuronal cells, such as epithelial cells and immune cells. Regardless of the cellular source, neuropeptide training of immune cells plays a key role in modulating their effector functions at mucosal sites.
Recently Mrgprs were shown to be expressed by immune cells. Notably, the mouse Mrgprb2 is expressed by mast cells17–21 where it mediates non-IgE-mediated degranulation18, recognizes antimicrobial peptides20, 21 and protects against skin bacterial infection19. Based on this, we hypothesized that Mrgprs could regulate the function of other innate immune cells. As neutrophils are the most abundant leukocyte and essential for tissue defense, we hypothesized that Mrgprs could regulate the nature and magnitude of activation. Specifically, the biology of Mrgpra1 in immune regulation remains to be studied.
Our findings uncover a key role for Mrgpra1 signaling in neutrophils that controls their activation during bacterial pneumoniae. We find that at both steady state and during infection, distinct populations of neutrophils express NPFF and IFNγ which are associated with divergent polarized states. Importantly, the Mrgpra1-NPFF axis promotes alternative differentiation and regulates the magnitude of IFNγ-induced anti-microbial programming.
Results
Neutrophil-expressed Mrgpra1 prevents their hyperactivation.
While Mrgprs were initially described as receptors on primary sensory neurons, recent studies have shown Mrgprs to be expressed on immune cells14. We aimed to examine the expression of Mrgpra1, the founding member of the Mrgprs receptor family, in immune cells. To do this, we extracted RNA from sorted immune cells from naïve mouse lungs. Using real-time PCR to analyze Mrgpra1 expression, we found it solely present in neutrophils (Fig. 1A). To test whether mast cells expressed Mrgpra1, we used purified peritoneal mast cells, as lung mast cells were technically challenging to sort in large enough numbers to obtain sufficient RNA. We found that mast cells expressed Mrgprb2 but not Mrgpra1 (Fig. S1A). To further examine the expression of Mrgpra1 in neutrophils, we looked at various histone modifications associated with active transcription at the Mrgpra1 locus. In line with our PCR data, ChIP-seq analysis showed enrichment for H3K4me1, H3K4me2, and H3K27Ac in neutrophils but not in macrophages or monocytes (Fig. 1B). Moreover, analysis of ATAC-seq data also revealed an open chromatin configuration for Mrgpra1 in neutrophils from the bone marrow, lungs, blood, and spleen (Fig. 1C). Consistent with expression in sorted lung neutrophils, we found Mrgpra1 mRNA expression from RNA-seq of bone marrow neutrophils (BMN) (Fig. 1D). In addition to lung neutrophils, we also find that Mrgpra1 is expressed by liver and spleen neutrophils and not macrophages. While Mrgpra1 is not expressed by lung and liver DCs, it is expressed in spleen DCs. This is in line with others22 showing subsets of DCs also express Mrgpra1 (Fig. S1B). In sum, Mrgpra1 is constitutively transcribed in neutrophils but not in other cells of the lungs’ innate and adaptive immune system.
Figure 1. Mrgpra1 is a neutrophil-expressed Mrgpr that regulates their function.

(A) Mrgpra1 mRNA expression relative to Rps14 mRNA housekeeping gene in flow-sorted B cells (CD11b−CD11c−CD3−gdTCR−CD4−CD8−NK1.1−Gr1−CD45+CD19+), eosinophils (CD45+ CD11bhi Ly6G− Siglec-F+), Ly6C+ monocytes (CD45+CD11bhiLy6G−Siglec-F−Ly6C+), alveolar macrophages (CD45+CD11b−CD11chi), neutrophils (CD45+CD11bhiLy6G+), dendritic cells-DCs (CD45+CD11b+CD11chi), gamma delta T cells (αβTCR−CD4−CD8−γδTCR+), CD4+ T cells (αβTCR+CD4+), CD8+ T cells (αβTCR+CD8+) and NK cells (αβTCR−CD4−CD8−gdTCR−NK1.1+NKp46+). Lungs cells from C57BL/6 mice were pooled (n=4) and sorted for PCR, each dot represents a technical replicate and repeated twice.
(B) Histone-seq (GSE63341) of mouse bone marrow-derived neutrophils (BMN) shows peaks for H3K4me1, H3K4Me2, and H3K27Ac at the Mrgpra1 locus.
(C) ATAC-seq of bone marrow (BM), lung, blood, and spleen mouse neutrophils (GSE141285) at the Mrgpra1 locus.
(D) Expression of Mrgpra1, Mpo, Dnase1, Elane, Ctsg, and Cxcr1 in bone marrow neutrophils.
(E,F) Cultured BMNs from Mrgpra1+/+ and Mrgpra1−/− animals (n= 3–4) were treated with media or 50 ug/ml peptidoglycan (PGN) for 4h, after which (E) NETs and (F) ROS were quantified. BMNs from mice (2–3 per group) were plated in replicates and used for experiments. Data is mean+SEM,
(G,H) Mrgpra1+/+ and Mrgpra1−/− were given PBS or 200 ug PGN intratracheally (i.t.), and after 3h DHR123+ (G) neutrophils and (H) alveolar macrophages (AMs) were enumerated by flow cytometry. Each dot represents an individual animal (n= 4–11), and data are pooled from 2 independent experiments
(I-K) Mice were administered pHRodoRed S. aureus bioparticles i.t., 2.5h after, the (I) frequency of pHRodoRed S. aureushi neutrophils and numbers of (J) pHRodoRed S. aureus+ and (K) pHRodoRed S. aureushi neutrophils were analyzed. Data representative of at least 2–3 independent experiments.
For all experiments, both male and female mice were used. Data was analyzed by Student’s T test or one-way ANOVA followed by posthoc test. *p<0.05, ***p<0.001, ****p<0.0001. See also Figure S1.
Next, we investigated the role of Mrgpra1 in the modulation of neutrophil function. To this end, we harvested BMNs (> 90% purity, Fig. S1C) from Mrgpra1+/+ and Mrgpra1−/− mice for cellular assays. BMN isolated from Mrgpra1−/− animals produced significantly higher level of neutrophil extracellular traps (NET) in response to bacterial peptidoglycan (PGN) compared to Mrgpra1+/+ controls (Fig. 1E). Mrgpra1−/− BMNs also generated more reactive oxygen species (ROS) in response to PGN stimulation as measured by the ROS indicator dihydrorhodamine 123 (DHR123) (Fig. 1F). Consistent with our in vitro data, intratracheal (i.t.) administration of PGN resulted in a greater accumulation of DHR123+ neutrophils (Fig. 1G), but not DHR123+ alveolar macrophages (AMs) (Fig. 1H) in Mrgpra1−/− animals as compared to controls. As ROS formation is central to eliminating many microorganisms and its concentration is related to the amount of phagocytosed microbial cargo23, 24, we examined whether Mrgpra1 also regulated microbe uptake. To this end, Mrgpra1−/− and control mice were exposed i.t. to Staphylococcus aureus (S. aureus) particles conjugated to the dye pHRodo, a pH-sensitive dye that fluoresces when internalized. We found that the frequency of S. aureushi neutrophils was significantly higher in Mrgpra1−/− mice compared to controls (Fig. 1I and Fig. S1D). We also found a greater number of both S. aureus+ and S. aureushi neutrophils in the lungs of the Mrgpra1−/− mice (Fig. 1J, K), indicating that Mrgpra1 restrains the phagocytic potential of neutrophils. As Mrgpra1 governs neutrophil activation, we wanted to determine if it could impact neutrophil numbers and frequency in various tissue. At steady-state, we found equivalent numbers and frequency of neutrophils in blood, BM, spleen, and lungs (Fig. S1E,F) in both genotypes. These findings suggest that Mrgpra1 signaling plays a role in governing the degree of activation of neutrophils during microbial stimulation.
Mrgpra1 regulates neutrophil activation in response to pulmonary infection.
Our in vitro data utilizing microbial surrogates (PGN, S. aureus bioparticles) depicted enhanced output by Mrgpra1-deficient neutrophils. To further understand this biology in the context of a lung pathogen, we used Streptococcus pneumoniae (S. pneumoniae), a leading cause of bacterial pneumonia. BMNs incubated with opsonized bacteria led to ROS production, but it was significantly more pronounced in Mrgpra1−/− than in Mrgpra1+/+ BMNs (Fig. 2A, B). There was also a greater frequency of Mrgpra1−/− neutrophils expressing CD63 (CD63+), a marker for degranulation, compared to Mrgpra1+/+ controls (Fig. 2C, D), suggesting that Mrgpra1 controls ROS production and degranulation of neutrophils. In line with this, significantly fewer bacteria (CFUs) were recovered in co-cultures of S. pneumoniae with Mrgpra1−/− than with Mrgpra1+/+ BMNs (Fig. 2E), indicating an elevated functional capacity of Mrgpra1−/− neutrophils to kill microbes.
Figure 2. Mrgpra1 signaling dampens neutrophil anti-bacterial responses to Streptococcus pneumoniae.

(A-E) BMNs from Mrgpra1+/+ and Mrgpra1−/− mice were cultured with Streptococcus pneumoniae (MOI 1) for 90 min. Frequency of DHR+ (A,B), and CD63+ (C,D) neutrophils, and (E) CFU of remaining bacteria. BMNs (pooled) from mice (3–4 per group) were plated in replicates and used for experiments. Data is mean+SEM and representative of at least 2–3 independent experiments.
(F-L) Mrgpra1+/+ and Mrgpra1−/− mice given 2.5×105 Streptococcus pneumoniae i.t. and 24 h later, the numbers of (F) neutrophils, (G) DHR123+ neutrophils, (H) DHR123hi neutrophils, (I) CD63+ neutrophils, (J) DHR123+ AMs and (K) S. pneumoniae CFU in the lungs were quantified. (L) Survival of infected Mrgpra1+/+ (n=17) and Mrgpra1−/− (n=12) mice. Each dot represents an animal (n= 3–12) (F-K). Data is mean+SEM and representative of at least 2–3 independent experiments, or pooled from 2–3 experiments (K,L)
For all experiments, both male and female mice were used. Data was analyzed by Student’s T test, one-way ANOVA followed by posthoc test or the Log-rank test for survival *p<0.05, **p<0.01. See also Figure S2.
To extend our in vitro findings, we ascertained the role of Mrgpra1 in bacterial pneumonia. Mice were administered 2.5×105 CFU of S. pneumoniae i.t. 24 h later, lungs were harvested for enumeration of immune cells by flow cytometry (Fig. S2A, flow gating scheme). Infected animals showed an increase in the total number of lung neutrophils, and, while the numbers trended higher in Mrgpra1−/− mice as compared to controls, differences did not reach statistical significance (Fig. 2F). In line with our in vitro data, the numbers of neutrophils making ROS, as indicated by DHR123+ and DHR123hi neutrophils, were higher in Mrgpra1−/− mice than in controls (Fig. 2G, H). Further, we found a higher number of CD63+ neutrophils in S. pneumoniae-infected Mrgpra1−/− mice as compared to controls (Fig. 2I). In contrast, we did not observe Mrgpra1-dependent regulation of ROS (DHR123+) in alveolar macrophages (AMs) (Fig. 2J). Moreover, the numbers of total and DHR123+ Ly6Chi monocytes, and interstitial macrophages (IMs) were not different between Mrgpra1−/− and Mrgpra1+/+ mice exposed to S. pneumoniae (Fig. S2 B–D). Nonetheless, in line with elevated ROS+ neutrophil numbers, pulmonary S. pneumoniae CFUs were significantly reduced in Mrgpra1−/− mice compared to controls (Fig. 2K). Finally, we considered the possibility that Mrgpra1 might become expressed on other immune cells in response to infection. To test this, we analyzed Mrgpra1 expression in various immune cells sorted from S. pneumoniae-exposed lungs to test this. Similar to uninfected animals, we found that its expression remained exclusive to neutrophils (Fig. S2F). Notably, the overall enhanced anti-bacterial function of Mrgpra1−/− neutrophils resulted in improved survival of Mrgpra1−/− mice compared to controls (Fig. 2L).
To examine whether the enhanced functional output by Mrgpra1-deficient neutrophils could extend to another pulmonary pathogen, Mrgpra1−/− mice were challenged i.t. with Pseudomonas aeruginosa, an opportunistic gram-negative bacterium. As with S. pneumoniae, we observed a higher number of neutrophils in the lungs of Mrgpra1−/− mice and a significantly increased number of ROS (DHR123+) producing neutrophils than in controls (Fig. S2 G–H).
Mrgpra1 signaling balances neutrophil polarization during bacterial infection
To identify the molecular mechanisms downstream of Mrgpra1 that regulate neutrophil function, we performed RNA-seq on flow-sorted lung neutrophils from mice infected with S. pneumoniae (sort purity, Fig. S3A). We used the Enrichr Volcano Plot to visualize enriched pathways in Mrgpra1−/− lung neutrophils from S. pneumoniae-infected mice. This plot shows the significance of each gene set versus its odds ratio, where each point represents a single gene set. This analysis revealed that Mrgpra1−/− neutrophils are enriched for genes associated with type II IFNγ signaling, thus suggesting that aberrant IFNγ signaling may drive the enhanced anti-bacterial function of Mrgpra1−/− neutrophils (Fig. 3A and Suppl. Tables 1–2).
Figure 3. Mrgpra1 signaling balances polarization during bacterial infection.

(A to L) Male Mrgpra1+/+ and Mrgpra1−/− mice given PBS or 2.5×105 S. pneumoniae (S.p.) i.t. 24 h after lung neutrophils were flow-sorted for bulk RNA-seq.
(A) Plot of enriched pathways in Mrgpra1−/− compared to Mrgpra1+/+ lung neutrophils from infected lungs.
(B) Clustergram of TFs that regulate the top expressed genes in Mrgpra1−/− lung neutrophils from infected mice using ChIP-X Enrichment Analysis Version 3 (ChEA3).
(C) heatmap of genes associated with N1-like and N2-like states in Mrgpra1+/+ and Mrgpra1−/− neutrophils from S. pneumoniae-treated mice.
(D to L) Normalized expression (transcripts per million) of (D) Nos2, (E) Icam1, (F) Socs1, (G) Stat1, (H) Il12a, (I) Arg1, (J) Tgfb1 and (K) Cxcl1 and (L) Msr1 mRNA.
(M-P) Mrgpra1+/+ and Mrgpra1−/− mice given PBS or 2.5×105 S. pneumoniae (S.p.) i.t. 24h after, BAL was analyzed. (M) Flow plots of iNOS+ BAL neutrophils. (N) Frequency of iNOS+ BAL neutrophils. (O) Numbers of iNOS+ BAL neutrophils. (P) Numbers of iNOS+ AMs.
Data is mean+SEM, each dot (N-P) represents an animal (n= 3–6) and data is pooled (N) or representative (O,P) from at least 2 independent experiments. For all experiments, both male and female mice were used and data was analyzed by one-way ANOVA followed by posthoc test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. See also Figure S3, Table S1 and Table S2.
Further, to understand the molecular pathways that underlie signaling downstream of Mrgpra1, we examined the transcription factors (TFs) regulating the activation status of these neutrophils using ChIP-X Enrichment Analysis Version 3 (ChEA3)25. This approach obtains the signature of specific TFs in the patterns of differentially expressed genes based on mouse and human data from ENCODE, ReMap, ARCHS4, GTEx, Enrichr, and curated data from the literature25. We plotted upregulated genes in Mrgpra1−/−, as compared to control neutrophils, against the TFs that regulate them. We found a signature (red squares indicate a relationship between gene and TF, white squares indicate no relationship was found) of enriched TFs, such as SP140, BATF2, STAT1, and STAT2 (Fig. 3B), associated with cells polarized to a classically activated phenotype26–30. This initial analysis suggested that Mrgpra1 could regulate neutrophil polarization states. We analyzed neutrophils for transcripts associated with IFNγ-mediated polarization, referred to as N(IFNγ) or N1-like neutrophils versus alternatively activated signature genes, denoted as N2-like. We found that neutrophils isolated from infected Mrgpra1−/− lungs were enriched for IFNγ-associated transcripts, including Nos2 (nitric oxide synthase 2), Icam1, Socs1, Stat1, and Il12a (Fig. 3C–H). Whereas alternative activation-associated31, 32 genes like Arg1 (Arginase-1), Tgfb1, Cxcl1 and Msr1 (CD204) were significantly lower in Mrgpra1−/− neutrophils as compared to controls after S. pneumoniae challenge (Fig. 3C, I–L). These data establish that Mrgpra1 drives a polarized state compatible with anti-inflammatory alternative activation during bacterial infection.
Next, we explored the role of Mrgpra1 in conditioning differential neutrophil states during infection. To do this, we used the expression of iNOS and Arginase-1 (Arg-1) as indicators of polarized states, where iNOS is associated with N(IFNγ) and Arg-1 is associated with alternative activation. Consistent with our RNA-seq data, we found both a higher frequency and number of iNOS+ neutrophils in the BAL of S. pneumoniae-infected Mrgpra1−/− mice as compared to controls (Fig. 3N–O), but we did not detect differences in iNOS+ AMs (Fig. 3P). Moreover, we found fewer Arg1+ neutrophils in infected Mrgpra1−/− mice’s lungs than controls (Fig. S3B). Because IFNγ-mediated polarization relies on glycolysis and alternative programming upregulates beta-oxidation33, we investigated whether Mrgpra1 signaling could regulate the metabolic profile of neutrophils in response to S. pneumoniae. We found that Mrgpra1+/+ neutrophils expressed higher transcripts of beta-oxidation-associated genes (Acoxl, Fabp5, Adipor1, and Akt2) as compared to Mrgpra1−/− neutrophils (Fig. S3 C–F). Conversely, genes involved in glycolysis, such as Slc2a1, Hk1, Hk2, and Pfkp, were upregulated in Mrgpra1−/− neutrophils (Fig. S3 C–F).
Mrgpra1 promotes alternative activation that inhibits IFNγ programming
Our RNAseq data showed that Mrgpra1 controlled IFNγ-mediated signaling in neutrophils. Because STAT1 is a central mediator of the genes driven by IFNγ, we tested whether Mrgpra1 regulated its activation. We found that at baseline, Mrgpra1−/− BMNs have more phospho-STAT1 than controls, suggesting that Mrgpra1 signaling may prevent IFNγ-induced priming (Fig. 4A). Stimulation with rIFNγ also induced greater phospho-STAT1 activation in Mrgpra1−/− BMNs as compared to controls (Fig. 4A). In line with this, we found greater expression of Ifngr1, but not Ifngr2 mRNA, in Mrgpra1−/− BMNs as compared to wildtype (Fig. S4A,B) and consistently, there was a greater percentage of IFNγR1+ neutrophils, but not macrophages or DCs, in the BM of Mrgpra1−/− mice as compared to controls (Fig. S4C,D). Based on this we conceived that under defined polarization signals, Mrgpra1 would regulate neutrophil polarization. BMNs were cultured in IFNγ+LPS (to generate N1-like cells), or IL-4+TGFβ1 (to induce N2-like cells) conditions (Fig. 4B), as previously described1, and transcript of genes associated with polarized states were analyzed. N(IFNγ+LPS) BMNs were enriched for Irf1, Irf2, Cxcl10, and Il12a mRNAs in cells derived from WT animals (Fig. 4C–F), while N(IL-4+TGFβ1) BMNs expressed Chil3 and Arg1 (Fig. 4G–H). As expected, IFNγ+LPS-induced transcripts are not enriched under IL-4+TGFβ1-induced polarization conditions and vice versa (Fig. 4C–H).
Figure 4. Mrgpra1 promotes alternative activation that inhibits IFNγ programming.

(A) phospho-STAT1 MFI in BMNs cultured with increasing IFNγ concentration for 40 mins, data is fold over media.
(B-H) (B) BMNs from mice (n=3–4) plated in replicates and cultured in unstimulated N0, N (IFNγ/LPS) or N (IL-4/TGFβ) polarization conditions for 3 h. mRNA of (C) Irf1, (D) Irf2, (E) Cxcl10, (F) Il12a, (G) Chil3, and (H) Arg1 determined by PCR.
(I) S. p CFU recovered in non-polarized (N0) and N1 like-polarized BMNs (MOI 1).
(J-O) Mice treated with PBS or 2.5×105 S. pneumoniae (S.p) i.t. and analyzed 24 h post-infection. (J) BAL numbers of IFNγ+ cells and (K) mRNA of total lung Ifng mRNA. Frequencies of (L,M) BAL IFNγ+ neutrophils, (N) BAL IFNγ+ AMs and (O) BAL IFNγ+ monocytes.
(P,Q) S. pneumoniae-exposed BMNs (MOI 1) pre-incubated with control or anti-IFNγ mAbs (20 μg/ml). (P) ROS production and (Q) CFU.
Data is mean+SEM, each dot represents an individual mouse (n=3–12), and data is representative of 2–3 independent experiments (C-I and M-Q) or pooled (A,J,O) from 2 independent experiments. For all experiments, both male and female mice were used. Data is analyzed by Student’s T test or one-way ANOVA followed by posthoc test. *p<0.05, **p<0.01, ***p<0.001. See also Figure S4.
In agreement with our in vivo data that shows that Mrgpra1 prevents an IFNγ-induced state (see Fig. 3), Mrgpra1−/− neutrophils stimulated with IFNγ+LPS expressed more N1-like transcripts than controls (Fig. 4C–F). Conversely, the expression of genes associated with alternative activation was lower in Mrgpra1−/− neutrophils stimulated with IL-4+TGFβ1 than in controls (Fig. 4G–H). Moreover, consistent with the notion that IFNγ-conditioned N1-like neutrophils have enhanced anti-microbial properties,1 we found that they had greater bacterial killing capacity than non-polarized (N0) neutrophils (Fig. 4I). These data show that Mrgpra1-mediated signaling dampens classical IFNγ-induced programming and promotes an alternatively activated state.
Our data demonstrated that Mrgpra1 inhibited IFNγ signaling, resulting in a reduced anti-bacterial N1-like phenotype. We wanted to know if, besides IFNγ responsiveness, Mrgpra1 could also prevent IFNγ production, as S. pneumoniae infection can drive IFNγ production in neutrophils34. To this end, mice were infected with 2.5×105 S. pneumoniae i.t., and lungs were collected 24 h later to evaluate IFNγ production by flow cytometry. Among all the immune cells examined in the BAL, neutrophils were the predominant source of IFNγ after infection (Fig. 4J). This observation is consistent with others who report that neutrophils are a predominant source of IFNγ upon acute lung infection35. When we looked at the role of Mrgpra1, we found significantly higher Ifng transcript (Fig. 4K) and IFNγ+ neutrophils (Fig. 4L,M) in the lungs of infected Mrgpra1-deficient mice as compared to controls. We did not observe changes in IFNγ+ macrophages or monocytes in response to infection (Fig. 4N, O). Thus, Mrgpra1 signaling limits IFNγ responsiveness and production, specifically in neutrophils. Finally, we explored the mechanistic contribution of S. pneumoniae-induced IFNγ in driving neutrophil activation and bacterial clearance. BMNs from Mrgpra1+/+ and Mrgpra1−/− were pre-treated with IFNγ-neutralizing or isotype control mAb, followed by exposure with S. pneumoniae. Robust ROS production was observed in Mrgpra1-deficient neutrophils from isotype control-treated animals. However, this was abolished by anti-IFNγ treatment (Fig. 4P). In line with this, neutralizing IFNγ led to a decrease in bacterial killing by Mrgpra1-deficient neutrophils (Fig. 4Q). Thus, these data demonstrate that the Mrgpra1 signaling controls the degree of IFNγ-dependent anti-microbial functions of neutrophils.
Our data strongly indicate that neutrophil-intrinsic Mrgpra1 signaling directly inhibits IFNγ mediated polarization. However, because Mrgprs, including Mrgpra116, were traditionally found in sensory neurons, we wanted to ascertain that our phenotype was due to its neutrophil expression and not neuronal participation. Since the lungs are mainly innervated via the vagal ganglia (VG)36, we examined whether Mrgpra1 was expressed in the VG. We found clusters of Mrgprd+ and Mrgpra3+ neurons but not of Mrgpra1+ (Fig. S4E–H). Neurons from the dorsal root ganglia (DRG) make a minor contribution to lung afferents and Mrgpra1 is expressed in skin DRG neurons16. We performed bone marrow chimeras to exclude the possibility that lung innervating Mrgpra1+ DRG could participate in our phenotype. Lethally-irradiated Mrgpra1−/− hosts were supplemented with either Mrgpra1−/− or Mrgpra1+/+ bone marrow (Fig. S4I). Chimeric animals were exposed to S. pneumoniae and 24h post-infection, neutrophils were analyzed. In line with our previous data, numbers of iNOS+, IFNγ+ and CD63+ BAL neutrophils (Fig. S4J–L) were significantly higher in Mrgpra1−/− as compared to Mrgpra1+/+ chimeras. Together, these data reveal a key role for neutrophil-expressed Mrgpra1 in controlling the elaboration of anti-bacterial neutrophils.
A distinct population of neutrophils express NPFF, the Mrgpra1 ligand, and associates with an alternative phenotype
Mrgpra1 is a receptor for several neuropeptides15. These include RFamide neuropeptide family members such as the neuropeptide FF (NPFF), somatostatin, and substance P. Among these, NPFF is the most robust mammalian Mrgpra1 ligand15, which is generally found in the central nervous system. Because isolated BMN from Mrgpra1−/− mice showed phenotypic differences as compared to controls, this suggested that Mrgpra1 could be engaged in a neutrophil-intrinsic manner. Analysis of BMN RNA-seq data showed Npff to be a highly-expressed neuropeptide (Fig. 5A).
Figure 5: A distinct population of neutrophils express NPFF, the Mrgpra1 ligand, and this populations correlates with an alternative program.

(A,B) RNA-seq data (GSE164766) showing expression of (A) neuropeptides (NP) and (B) NP receptors in BMNs.
(C) NP mRNAs from BMNs exposed in vitro to PBS or S. pneumoniae (S.p) (MOI 1) for 16 h determined by PCR.
(D-G) Mice treated with saline or S. pneumoniae and 24 h later (D) number of various NPFF+ lung cells, (E) number of NPFF+ neutrophils in the BAL and (F) frequency of NPFF+ neutrophils. (G) Representative flow plots depicting NPFF staining in BAL neutrophils.
(H-Q) Characteristics of NPFF− and NPFF+ BAL neutrophils 24h after saline or S. pneumoniae (S.p) exposure. (H) forward scatter, (I) side scatter, (J) Ly6G MFI and (K) CD11b MFI. Frequency and representative flow plots of (L) CD63+, (M) iNOS+, (N) CD24+, (O) FcεRI+, (P) CD204+, (Q) Arg1+.
Data is mean+SEM, each dot (E-Q) represents individual animal (n=3–9) and is representative (H-Q) or pooled (D-F) from at least 2–4 independent experiments that used male and female mice. Data is analyzed by Student’s T test or two-way ANOVA followed by posthoc test. *p<0.05, **p<0.01, ***p<0.001, ***p<0.001. See also Figure S5.
The canonical receptors for NPFF, Npffr1 and Npffr2 were not detected in resting BMNs or after stimulation with S. pneumoniae (Fig. 5B and Fig. S5A). We found that in response to in vitro exposure to S. pneumoniae, Npff mRNA was significantly upregulated in neutrophils (Fig. 5C). Next, we explored NPFF+ cells in vivo, and found that after infection, neutrophils were the predominant source of NPFF+ in the lungs (Fig. 5D). In both the lungs (Fig. 5D) and BAL (Fig. 5E), we observed the accumulation of NPFF+ neutrophils numbers following infection. While the total number of NPFF+ neutrophils increased, owing to greater influx during infection (Fig. 5E), the frequency of neutrophils expressing NPFF decreased after infection, suggesting the release of pre-formed stores of NPFF (Fig. 5F, G).
Next, we wanted to characterize these NPFF+ neutrophils. We found, both at steady state and after infection, that NPFF+ neutrophils were larger and more complex than NPFF− neutrophils, as marked by increased forward scatter (FSC, Fig. 5H) and side-scatter (SSC, Fig. 5I), respectively. Ly6G which is dynamically regulated, showed highest expression in activated ROS-producing neutrophils (Fig. S5B,C). In contrast, we found that NPFF+ neutrophils were less activated than NPFF− neutrophils as they not only expressed less Ly6G (Fig. 5J) and CD11b (Fig. 5K), but also did not upregulate these markers after infection. Consistent with this, the frequency of degranulating neutrophils (%CD63+) was negligible in the NPFF+ compared to the NPFF− subset (Fig. 5L). In contrast, CD63 expression was associated with activated ROS+ neutrophils (Fig. S5D).
Next, we looked at the expression of markers associated with polarized states. Here we found that NPFF− neutrophils preferentially clustered with IFNγ-associated markers such as iNOS (Fig. 5M) and CD24 (Fig. 5N). However, NPFF+ neutrophils preferentially expressed markers associated with an alternative N2-like phenotype like FcεRI (Fig. 5O), CD204 (Fig. 5P), and Arginase-1 (Fig. 5Q). Conversely, CD204, FcεR1 and CD206 were not associated with ROS-producing neutrophils (Fig. S5E–G). Overall, the phenotype of these NPFF-producing neutrophils overlaps with that of alternatively activated cells.
Mrgpra1-NPFF prevents neutrophil hyperactivation by regulating aberrant IFNγ signaling while promoting an alternatively activated state.
As our findings indicated that Mrgpra1 signaling regulates IFNγ mediated neutrophil polarization, we next assessed the relationship between NPFF and IFNγ. Analysis of NPFF+ and IFNγ+ BAL neutrophils showed that they clustered into separate populations at steady state and after infection (Fig. 6A). As we had seen before (see Figs. 4J and 5F), post-infection, neutrophils gained IFNγ and lost NPFF in vivo (Fig. 6A). Further, we found that IFNγ+ neutrophils were enriched in the NPFF− subset (Fig. 6B). This phenomenon was recapitulated in isolated neutrophils. BMNs incubated with increasing concentrations of S. pneumoniae showed decreasing NPFF positivity and increasing IFNγ+ cells (Fig. 6C, D). We then tested whether NPFF could directly inhibit the IFNγ phenotype. We found that IFNγ-induced phospho-STAT1 could be inhibited by addition of recombinant NPFF (Fig. S6A). These findings show that NPFF+ neutrophils exist as a distinctively regulated population, where a decline in NPFF+ neutrophils is concurrent with the elaboration of an IFNγ phenotype.
Figure 6: Mrgpra1-NPFF prevents neutrophil hyperactivation by regulating aberrant IFNγ signaling and promotes an anti-inflammatory alternative program.

(A,B) (A) Representative flow plots and (B) frequency of IFNγ+, in NPFF− and NPFF+ BAL neutrophils from saline or S. pneumoniae (S.p)-exposed mice.
(C,D) (C) Representative flow plots and (D) frequencies of IFNγ, and NPFF staining in BMNs exposed to PBS or S. pneumoniae for 4 h (dashed lines represent 95% CI).
(E-J) Mrgpra1+/+ and Mrgpra1−/− mice treated with NPFF followed by 2.5×105 S. pneumoniae i.t, 24 h post-infection. Frequency of (E, F) IFNγ+ neutrophils, (G, H) DHR123+ and (I, J) CD204+ BAL neutrophils.
(K) Percentage of Arg1+ BMNs from Mrgpra1+/+ and Mrgpra1−/− mice treated with media or NPFF.
(L) CFU from BMNs treated with media or NPFF and incubated with S. pneumoniae (MOI 10).
Data is mean+SEM and each dot (E-J) represent an animal (n=4–6) and data is pooled (D, K, L) or representative (A-C and E-J) of 2–3 independent experiment using male and female mice. Data and analyzed by Student’s T test or one-way or two-way ANOVA followed by posthoc test. *p<0.05, **p<0.01, #p<0.0001. See also Figure S6.
Next, we wanted to know whether the Mrgpra1-NPFF axis could direct the activation and polarization of neutrophils during infection. To this end, mice were treated with recombinant NPFF, after which they received S. pneumoniae. We found that NPFF inhibited infection-induced BAL IFNγ+ neutrophils (Fig. 6E, F), and reduced the frequency of ROS+ neutrophils (Fig. 6G, H), but not in Mrgpra1−/− mice. Conversely, NPFF promoted Mrgpra1-dependent alternative neutrophil polarization, as we measured by an increased frequency of CD204+ neutrophils in infected animals (Fig. 6I, J). Lastly, to directly examine the effect of this signaling in neutrophils, we exposed BMNs to S. pneumoniae in the presence of NPFF. We found the NPFF-Mrgpra1 axis promoted alternatively activated neutrophils as marked by increased production of arginase-1 (Fig. 6K). Importantly, NPFF conditioning of neutrophils resulted in significant impairment of bacterial clearance in control but not in Mrgpra1−/− deficient neutrophil-bacteria co-cultures (Fig. 6L).
In the context of pulmonary bacterial infection, lung-innervating fibers have been shown to play a crucial role in mediating neutrophil function37. While NPFF’s neuronal expression is primarily thought to be restricted to the CNS, we looked at whether lung-innervating fibers, which largely emanate from the VG, could express NPFF. While we did not observe clusters of Npff+ neurons in the VG, as expected we found clusters of Tac1+ (substance P) neurons (Fig. S6B), which is an Mrgpra1 ligand22, 38. This could suggest that SP release from these neurons during infection could regulate neutrophil responses via Mrgpra1. To examine this possibility, we tested the effect of SP on neutrophil-mediated bacteria killing. While we found that NPFF inhibits the ability of neutrophils to kill microbes (Fig.6L), SP pretreatment of neutrophils had no effect on bacterial clearance. As neutrophils express the canonical receptor for SP, TACR1, albeit at low mRNA levels (Fig. S6D), and the EC50 of SP for TACR1 is substantially lower than for Mrgpra138, 39, the net effect of SP on neutrophil will likely be dictated through canonical pathways.
Together, these data demonstrate that a neutrophil intrinsic Mrgpra1-NPFF axis prevents the adoption of an IFNγ-associated phenotype, via control of IFNγ signaling and production. NPFF-mediated regulation of N(IFNγ) cells is concomitant with promoting an alternatively activated program (Fig. 6M). Although the usual host response favors anti-microbial neutrophils, in virulent lung infections, the co-elicitation of N2-like neutrophils would seem detrimental. Our experiments were not designed to experimentally address the potential benefits of alternatively programmed neutrophils during acute infection. However, we speculate that the normal N2-like response may offer advantages in inflammatory resolution and tissue repair in less acutely lethal infections.
Discussion
Growing evidence shows that Mrgprs regulate functional immunity in immune cells17–22, 40. Here we have uncovered a role for neutrophil-expressed Mrgpra1 in regulating their inflammatory and anti-inflammatory polarization states.
The concept that cells undergo a spectrum of activation states is well documented in macrophages. Microbial signals combined with IFNγ elicit M1-like macrophages, also called classically activated or M(IFNγ). They play a microbicidal role through their enhanced production of reactive oxygen and nitrogen species through the enhanced expression of iNOS. M1-like macrophages are thought to be beneficial in clearing bacterial infections41. Spectrums of activation states is not limited to macrophages. Recent work demonstrates the existence of similar programs in mouse and human neutrophils1, 5, 6. Specifically, N(IFNγ) neutrophils overexpress IFNγ-driven genes, display enhanced ROS generation and are more glycolytic6, similar to what is seen in M(IFNγ) macrophages33, 42. In line with this, our data demonstrate that neutrophils lacking Mrgpra1 signaling express enhanced IFNγ-associated transcripts, produce themselves more IFNγ, more ROS, and express higher levels of genes involved in glycolysis, ultimately leading to better bacterial clearance. While we observe that Mrgpra1-deficient neutrophils express more IFNγ, they also express more IFNγR1 and downstream signaling molecules. Thus, the aberrant N1-like polarization of Mrgpra1-deficient neutrophils could be in response to IFNγ production alone or in combination with elevated signaling molecules. Mechanistically, blocking IFNγ signaling in neutrophils lacking Mrgpra1 inhibited the elicitation of ROS and impaired S. pneumoniae killing. This suggests that Mrgpra1 regulates IFNγ-dependent neutrophil function during infection. IFNγ signaling is required to protect against S. pneumoniae-induced pneumonia35, Group A Streptococcal infection43 and several other pathogens44. Moreover, mice deficient for iNOS, a key IFNγ-induced gene, have impaired lung clearance of S. pneumoniae45. Our data shows that Mrgpra1-deficient neutrophils also express higher transcripts of Il12a. IL-12 has been shown to drive S. pneumoniae clearance, which occurs through the induction of IFNγ46. Consistent with this mouse data, human IL-12 deficiency is associated with chronic S. pneumoniae and S. aureus infections47.
Although beneficial acutely, uncontrolled IFNγ-driven responses can lead to tissue damage41, 48 and are associated with greater mortality in patients with sepsis41. In LPS-induced acute lung injury (ALI), IFNγ exacerbates pathogenesis.49 It is thus conceivable that dysregulated N(IFNγ) could also lead to organ damage Recent studies have shown that during SARS-CoV2 infection, a dysregulated IFNγ-neutrophil axis is associated with mortality and cytokine storm50, 51. Thus, mechanisms that counter excessive anti-microbial mechanisms could include eliciting anti-inflammatory, alternatively activated cells, to dampen inflammation by directly inhibiting classical activation or producing anti-inflammatory cytokines like IL-1033, 41. In agreement with this, IL-4 confers protection from LPS-induced ALI, partially due to the induction of M2-like, or M(IL-4) macrophages52. Similarly, alternatively conditioned neutrophils could be induced to regulate N(IFNγ) responses to resolve inflammation and preserve tissue integrity. Although this may come at the expense of a pathogen clearance efficiency. In line with this, we and others have shown than N2-like cells have less effective anti-bacterial functions. Studies have shown that in humans and mice, IL-4 conditioning of neutrophils renders them ineffective during skin infection with Group A Streptococcus and during Listeria monocytogenes-induced sepsis53–55. This is thought to partly explain why, in conditions such as atopic dermatitis (AD), where despite greater neutrophils numbers than in healthy individuals, these patients have a higher risk of cutaneous bacterial infections56. The type 2 rich environment of AD renders neutrophils compromised in clearing bacteria56.
Several neuropeptides (NPs), which are known ligands of Mrgprs15, are released during bacterial infections. NPs like vasoactive intestinal polypeptide (VIP), calcitonin gene-related peptide (CGRP), corticotropin-releasing hormone (CRH), and atrial natriuretic peptide (ANP) have been shown to play roles during bacterial infections37, 57. Many of these have well-documented anti-inflammatory properties, which may help resolve inflammation58–60. However, aberrant production or sensing of these NPs can impair anti-bacterial defenses37, 57. The source of NP production during inflammation and infection is typically associated with neurons. Although neurons are thought to be the prototypical source of NPs, they can also be found in non-neuronal cells in the inflamed lungs61, 62,63–65. NPs that activate Mrgpra1 include FMRF-amide-related peptides, a family of neuropeptides primarily identified in insects. NPFF, the mammalian homolog of FMRFa66, binds Mrgpra1 as well as several other neuropeptides, such as somatostatin and substance P15, 22, 38. Notably, our data show that among various neuropeptides, NPFF is expressed by neutrophils and becomes the predominant source of NPFF in response to S. pneumoniae. Our data also indicate a mutually exclusive relationship between IFNγ+ and NPFF+ neutrophils, where these cells form separate clusters. We observe in vivo and in vitro that neutrophils gain IFNγ production and lose NPFF expression after exposure to bacteria, likely due to neuropeptide release. In comparison to NPFF− neutrophils, when we examined NPFF+ neutrophils, we found that they expressed less CD24, CD63 and IFNγ but more Arg1, FcεRI and CD204, suggesting that NPFF+ neutrophils are N2-like. Mechanistically, treatment with recombinant NPFF during infection reduced the frequency of IFNγ+ and ROS+ neutrophils but increased the proportion of CD204+ neutrophils and led to a decreased ability by NPFF-conditioned neutrophils to clear bacteria.
Based on our findings, we hypothesize that NPFF-induced neutrophils may adopt an anti-inflammatory phenotype, a well-recognized role for alternatively activated immune cells. This is supported by reports showing that NPFF promotes nerve regeneration and epithelial wound repair in the cornea67. Further a recent study identified an IL-4R+Arg1+CD206+Ly6Glo neutrophil subset that promotes nerve regeneration following injury68. This neutrophil subset increases in numbers chronically over days following injury. NPFF+ N2-like neutrophils are similar to these as they are also Arg1+CD206+Ly6Glo. This highlights the likelihood that NPFF- or IL-4-conditioned neutrophils may accumulate following acute inflammation to promote resolution of inflammation and tissue repair. In addition, our findings are consistent with work in adipose tissue macrophages, where NPFF can inhibit LPS-induced nitric oxide60 and induce M2-like polarization in an NPFFR2-dependent fashion69. Recent work shows that Mrgpra1 mediates the recruitment of a dendritic cell subset, CD301b+ dermal dendritic cell, in the skin in response to papain via a substance P-dependent mechanism22, suggesting this Mrgpr may enhance type 2 responses at barrier sites. While we did not find Mrgpra1 in lung and liver DCs, it is expressed in splenic DCs. This highlights that Mrgpra1 expression may be selective to a few cell types in a tissue-specific manner and plays a central role in barrier immunity.
Taken together, our data support a role for an intrinsic Mrgpra1-NPFF axis in regulating a balance between classically activated N1-like or alternatively activated N2-like states. However, we cannot discount the possibility that NPFF or other Mrgpra1 ligands, like substance P and somatostatin, secreted by other cells in the pulmonary tissue, may be induced during infection to modulate neutrophil function. Further, we find that without adding exogenous NPFF, Mrgpra1 signaling promotes IL-4-induced polarization in vitro. While this may suggest that IL-4 could induce NPFF in BMNs, another possibility would be the inability of Mrgpra1−/− neutrophils to receive NPFF conditioning in vivo, resulting in unopposed and lasting IFNγ programming. This is supported by our data where baseline Mrgpra1−/− BMNs express lower transcripts of the N2-like marker chitinase (Chil3) and higher phospho-STAT1 than controls. Importantly, beyond the established drivers of alternative activation, such as IL-4, IL-13, IL-10 and TGFβ, we have found that NPFF can polarize neutrophils to an alternative N2-like state. Therefore, we suggest that NPFF acts as a non-canonical driver of an alternative program. Because at steady state, we detect NPFF+ neutrophils in the airways and in the bone marrow, NPFF may provide homeostatic signals.
Our findings likely extend beyond bacterial infections, as dysregulated states of neutrophil activation is now thought to play a pathogenic role in various inflammatory diseases such as cancer, stroke, and myocardial infarctions2, 3, 5, 70. In sum, we have identified a pathway that balances neutrophil responses, which may serve as a target for preventing and treating refractory lung infections.
Limitation of the Study
Our studies were designed to study the acute response by neutrophils post-infection. However, it remains to be determined the role of Mrgprs and neuropeptides in regulating the extent of tissue damage and to evaluate their role in resolution of inflammation in chronic settings. Moreover, while we focused on S. pneumoniae, other common pneumonia-causing bacterial pathogens like Klebsiella pneumoniae, S. aureus, and mycoplasma, remain to be studied. Further, arginase-1 secretion from neutrophils causes T cell immunosuppression71, therefore, it remains a possibility that this NPFF pathway participates in the development of subsequent adaptive immune responses to pathogens. Moreover, while Mrgpra1 remains exclusive to lung neutrophils during infection, we anticipate that during sepsis, Mrgpra1 on other immune cells like dendritic cells may get engaged in lymphoid organs like the spleen and contribute to host responses. Future studies using cell-specific deletion of Mrgpra1 would be valuable to evaluate its contribution on different cells. Lastly, as alternatively activated neutrophils exist in humans, we posit that our findings will extend to human neutrophils. Future studies will be done to evaluate this pathway in humans.
Resource availability
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Xinzhong Dong (xdong2@jhmi.edu).
Materials availability
This study did not generate new unique reagents.
Data and code availability
RNA-seq data from sorted lung neutrophils are deposited in the Gene Expression Omnibus (GEO) database and are publicly available from the date of publication Accession numbers are listed in the Key Resources Table. The following public datasets were used: Histone ChIP-seq dataset from mouse bone marrow neutrophils, bone marrow monocytes, and peritoneal macrophages; ATAC-seq datasets of mouse neutrophils; RNAseq from bone marrow neutrophils (BMN; and Single cell RNAseq of mouse vagal ganglia. Accession numbers are listed in the Key Resources Table.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Key resources table.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-mouse CD45-APC-Cy7 (1/800) | BioLegend | Cat#103115; RRID: AB_312980 |
| anti-mouse CD45-Alexa 700 (1/800) | BioLegend | Cat#103127; RRID: AB_493714 |
| anti-mouse Ly6C-PE-Dazzle594 (1/400) | BioLegend | Cat#128043; RRID: AB_256676 |
| anti-mouse Ly6G-APC-Cy7 (1/800) | BioLegend | Cat#127623; RRID: AB_10645331 |
| anti-mouse Ly6G-BV421 (1/800) | BioLegend | Cat#127627; RRID: AB_10897944 |
| anti-mouse CD63-PE-Cy7 (1/300) | BioLegend | Cat#143909; RRID: AB_2565499 |
| anti-mouse CD11c-BV605 (1/400) | BioLegend | Cat#117333; RRID: AB_11204262 |
| anti-mouse CD11b-PE-Cy7 (1/2500) | BioLegend | Cat#101215; RRID: AB_312798 |
| anti-mouse CD11b-PerCP-Cy5.5 (1/2500) | BioLegend | Cat#101227; RRID: AB_893233 |
| anti-mouse CD11b-BV785 (1/2500) | BioLegend | Cat#101243; RRID: AB_2561373 |
| anti-mouse Siglec-F-PerCP-Cy5.5 (1/400) | BD Biosciences | Cat#565526; RRID: AB_2739281 |
| anti-mouse CD64-BV421 (1/150) | BioLegend | Cat#139309; RRID: AB_2562694 |
| anti-mouse MerTK-APC (1/150) | BioLegend | Cat#151507; RRID: AB_2650738 |
| anti-mouse MerTK-PE (1/150) | BioLegend | Cat#151505; RRID: AB_2617036 |
| anti-mouse MerTK-PE-Cy7 (1/150) | BioLegend | Cat#151521; RRID: AB_2876508 |
| anti-mouse IFNγ-BV421 (1/100) | BioLegend | Cat#505829; RRID: AB_10897937 |
| anti-mouse IFNγ-PE (1/100) | BioLegend | Cat#505807; RRID: AB_315401 |
| anti-mouse iNOS-PE (1/100) | Thermo | Cat#12-5920-82; RRID: AB_2572642 |
| anti-mouse Arginase-1-PE (1/100) | Thermo | Cat#12-3697-82; RRID: AB_2734839 |
| anti-mouse pSTAT1-PE (1/100) | Thermo | Cat#MA5-37073; RRID: AB_2897008 |
| anti-mouse CD204-BV421 (1/100) | BD Biosciences | Cat#748083; RRID: AB_2872544 |
| anti-mouse CD204-BV786 (1/100) | BD Biosciences | Cat#748089; RRID: AB_2872550 |
| anti-mouse CD206-BV605 (1/100) | BioLegend | Cat#141721; RRID: AB_2562340 |
| anti-mouse CD24-BV605 (1/300) | BioLegend | Cat#101827; RRID: AB_2563464 |
| anti-mouse ckit-BV421 (1/200) | BioLegend | Cat#135123; RRID: AB_2562236 |
| anti-mouse FcER1-PE-Cy7 (1/200) | BioLegend | Cat#134317; RRID: AB_10643996 |
| anti-mouse FcER1-APC (1/200) | BioLegend | Cat#134315; RRID: AB_10640726 |
| Donkey anti-rabbit IgG-BV421 (1/400) | BioLegend | Cat#406410; RRID: AB_10897810 |
| rabbit anti-NPFF polyclonal (1/200) | Thermo | Cat#PA5-25175; RRID:AB_2542675 |
| anti-mouse IFNγR1-BV605 (1/100) | BD Biosciences | Cat#745111; RRID:AB_2742716 |
| anti-mouse IFNγR2-Ax647 (1/100) | R&D Systems | Cat#FAB773R |
| TruStain FcX™ (anti-mouse CD16/32) | Biolegend | Cat#101319 RRID:AB_1574975 |
| InVivoMAb anti-mouse CD16/CD32 | BioXcell | Cat# #BE0307 RRID:AB_2736987 |
| anti-mouse IFNγ | BioXcell | Cat#BE0055 RRID:AB_1107692 |
| Bacterial and virus strains | ||
| Streptococcus pneumoniae 6303 | ATCC | Strain ID: CIP 104225 |
| Pseudomonas aeruginosa (PAO1) | Dr. Ying Zhang (JHU) | N/A |
| PGN from Staphylococcus aureus | InvivoGen | Cat# tlrl-pgns2 |
| pHrodo™ Red S. aureus BioParticles™ | ThermoFisher | Cat# A10010 |
| Chemicals, peptides, and recombinant proteins | ||
| Neuropeptide FF | Tocris | Cat#3137 |
| Substance P | Tocris | Cat# 1156 |
| anti-mouse IFNγ | BioXcell | Cat#BE0055 |
| Recombinant Mouse IL-3 | R&D systems | Cat# 403-ML-010 |
| Recombinant Mouse SCF | R&D systems | Cat# 455-MC-010 |
| Recombinant Murine IFNγ | Peprotech | Cat# 315-05 |
| Recombinant Murine IL-4 | Peprotech | Cat# 214-14 |
| Recombinant Mouse TGF-beta 1 | R&D systems | Cat#: 7666-MB |
| Histopaque®-1119 | Millipore Sigma | Cat# 11191 |
| Histopaque®-1077 | Millipore Sigma | Cat# 10771 |
| SYTOX™ Orange Nucleic Acid Stain | ThermoFisher | Cat# S11368 |
| Hoechst 33342 | ThermoFisher | Cat# H1399 |
| Normal Mouse Serum | ThermoFisher | Cat# 10410 |
| TRIzol™ Reagent | ThermoFisher | Cat# 15596026 |
| 32% Paraformaldehyde | FisherScientific | Cat# 50-980-494 |
| Tryptic Soy Agar Plates | Teknova | Cat# T0144 |
| Blood agar plate | BD | Cat# 22126 |
| Penicillin-Streptomycin-Glutamine (100X) | ThermoFisher | Cat# 10378016 |
| Fixation & Permeabilization Buffer set | ThermoFisher | Cat# 88-8824-00 |
| Liberase ™ TL | Millipore Sigma | Cat#05401020001 |
| Deoxyribonuclease I | Millipore Sigma | Cat#DN25 |
| Zombie Aqua viability dye | BioLegend | Cat#423101 |
| Dihydrorhodamine 123 | ThermoFischer | Cat# D632 |
| Deposited data | ||
| RNAseq of sorted mouse lung neutrophils | this manuscript | Accession# GSE200214 |
| Histone-ChIP (neutrophils, monocytes, macrophages | Lavin et al.72 | Accession# GSE63341 |
| ATAC-seq of mouse neutrophils | Ballesteros et al.73 | Accession# GSE141285 |
| RNAseq of mouse bone marrow neutrophils (BMN) | Timaxian et al.74 | Accession# GSE164766 |
| scRNAseq of mouse vagal ganglia | Zhao et al.75 | Accession# GSE192987 |
| Experimental models: Cell lines: not applicable | ||
| Experimental models: Organisms/strains | ||
| Mrgpra1−/− mice | Liu et al.76 | N/A |
| Oligonucleotides | ||
| mNpff.S: 5’-GGTCCCTCTTTCGTGTTCTG-3’ AS: 5’-GCG GAT TTA GCT GTT CCT TG-3’ | Integrated DNA Technologies | N/A |
| mNpvf.S: 5’-CATGATGCCTCATTTTCACAGC-3’ AS: 5’-CCTCTCCTCGTTCGCTTTCC-3’ | Integrated DNA Technologies | N/A |
| mQrfp: S:5’-TCACCTGCCCTTCTTAGAGC-3’ AS: 5’-CGGTTCAAAATCCACAGCCA-3’ | Integrated DNA Technologies | N/A |
| mSst.S: 5’-CTCCGTCAGTTTCTGCAGAA-3’ AS: 5’-TTCTCTGTCTGGTTGGGCTC-3’ | Integrated DNA Technologies | N/A |
| mTac1.S: 5’-TTTCTCGTTTCCACTCAACTGTT-3’ AS: 5’-GTCTTCGGGCGATTCTCTGC-3’ | Integrated DNA Technologies | N/A |
| mPrlh.S: 5’-CCCTGACATCAATCCTGCCT-3’ AS: 5’-GCTGTGAGAGAACTTGGCAC-3’ | Integrated DNA Technologies | N/A |
| mCalca.S: 5’-CAGTGCCTTTGAGGTCAATCT-3’ AS: 5’-CCAGCAGGCGAACTTCTTCTT-3’ | Integrated DNA Technologies | N/A |
| mCalcb.S: 5’-TGGAACAGGAGGAGCAAGAG-3’ AS: 5’-CACACCTCCTGATCTGCTCA-3’ | Integrated DNA Technologies | N/A |
| mKiss1.S: 5’-AAGTGAAGCCTGGATCCACA-3’ AS:5’-TTAACGAGTTCCTGGGGTCC-3’ | Integrated DNA Technologies | N/A |
| mPomc.S: 5’-ATGCCGAGATTCTGCTACAGT-3’ AS: 5’-TCCAGCGAGAGGTCGAGTTT-3’ | Integrated DNA Technologies | N/A |
| mS14.S: 5’-TGGTGTCTGCCACATCTTTGCATC-3’ AS: AGTCACTCGGCAGATGGTTTCCTT | Integrated DNA Technologies | N/A |
| mMrgpra1 | ThermoFisher | Assay ID: Mm01984314 |
| mNpffr1 | ThermoFisher | Assay ID: Mm01176033 |
| mNpffr2 | ThermoFisher | Assay ID: Mm00500040 |
| mTacr1 | ThermoFisher | Assay ID: Mm00436892 |
| mIrf1 | ThermoFisher | Assay ID: Mm01288580 |
| mIrf2 | ThermoFisher | Assay ID: Mm00515206 |
| mCxcl10 | ThermoFisher | Assay ID: Mm00445235 |
| mIl12a | ThermoFisher | Assay ID: Mm00434169 |
| mChil3 | ThermoFisher | Assay ID: Mm00657889 |
| mArg1 | ThermoFisher | Assay ID: Mm00475988 |
| Software and algorithms | ||
| Biorender | Biorender | www.biorender.com |
| FlowJo v10.9.0 | BD/Tree Star Inc. | https://www.flowjo.com/solutions/flowjo |
| GraphPad Prism v10 | Prism | www.graphpad.com |
| ChEA3 - ChIP-X Enrichment Analysis Version 3 | Keenan et al.25 | https://maayanlab.cloud/chea3/ |
| fastp v0.2 | Chen et al.77 | https://github.com/OpenGene/fastp |
| Salmon v1.1 | Patro et al.78 | https://github.com/COMBINE-lab/salmon |
| DEseq 2 v1.34 | Love et al.79 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| Seurat v4 | Hao et al.80 | https://satijalab.org/seurat/ |
| Bioconda | Gruning et al.81 | https://bioconda.github.io |
| Morpheus (heat map) | N/A | https://software.broadinstitute.org/morpheus |
| Harmony integration | Korsunsky et al.82 | https://github.com/immunogenomics/harmony |
| scDbFfinder | Germain et al.83 | https://bioconductor.org/packages/release/bioc/html/scDblFinder.html |
| Other | ||
| BD LSRII cell analyzer | BD Biosciences | N/A |
| MoFlo XDP cell sorter | Beckman Coulter | N/A |
| MA900 cell sorter | Sony | N/A |
| ABI StepOnePlus | ThermoFisher | N/A |
Experimental model and study participant details
Mice
Mrgpra1-deficient mice were generated as previously described76. Briefly, Mrgpra1-deficient animals were generated on 129 genetic background. Mrgpra1 locus (exon 2) on mouse Chromosome 7 was targeted via homologous recombination. Age (5–12 weeks) and sex-matched (males and females) Mrgpra1−/− and Mrgpra1+/+ littermate mice were used for all experiments. For studies requiring intranasal challenges, mice were briefly anesthetized using isoflurane. For intratracheal administrations (i.t.), mice were anesthetized with intraperitoneal administration of ketamine-xylazine solution. All mice were maintained in a specific-pathogen free facility and used according to the Institutional Animal Care and Use Committee.
Method details
Flow cytometry
Mouse lung and, spleen cells were obtained following digestion with 0.05 mg/ml Liberase TL (Roche) and 0.5 mg/ml DNaseI (Sigma) for 45 min at 37°C in 5% CO2. Liver single cell suspension were obtained as described84. Digested tissue was filtered through a 70-um nylon mesh (BD Biosciences). Lung, spleen, liver, bone marrow and blood-derived cells were suspended in red blood cell lysis buffer (ACK lysis buffer). Recovered cells were counted (trypan blue exclusion) and plated at 1–2 ×106 cells/ml. Cells were washed with PBS and labeled with Zombie Aqua live/dead dye (Biolegend) for 10 min at RT and blocked with 10 ug/ml anti-CD16/32 (BioLegend or BioXCell) for an additional 20 min at RT. Cells were stained with fluorochrome-labeled antibodies. For intracellular staining, cells were first fixed with 4% paraformaldehyde for 10 mins at RT, then permeabilized with 0.1% saponin for 20 min at RT. For NPFF intracellular staining, fixed and permeabilized cells were stained with a primary anti-NPFF antibody (30 min), followed by two washes with permeabilization buffer and then stained for BV421-labelled secondary antibody (30 min). NPFF FMO cells were stained with BV421-labeled secondary antibody without anti-NPFF primary. Data were acquired on an LSRII flow cytometer (BD Biosciences) and gated to exclude debris and select single cells (SSC-W/SSC-A). Data were analyzed using FlowJo (BD Biosciences).
PGN and S. aureus bioparticles administrations
Mice were given saline or 200 μg Staphylococcus aureus-derived peptidoglycan (PGN-SA) (Invivogen) intratracheally (i.t.), and 3 h later, lungs were harvested for flow cytometry. In other experiments, 80 μg pHrodoRed-labeled S. aureus bioparticles (Thermo) were given i.t. and 2.5 h later, lungs were harvested and cells isolated for flow cytometry.
Bacterial cultures
Streptococcus pneumoniae 6303 (ATCC) was grown and maintained on sheep blood agar (BD Biosciences). Single colonies were harvested into PBS, followed by serial dilution plating to determine bacterial stock concentration. Pseudomonas aeruginosa (PAO1) was grown in tryptic soy broth (Sigma-Aldrich) overnight in a shaking incubator (37°C; 150 rpm). An aliquot of stock was removed, and pellets were washed thrice with PBS. Serial dilutions were then plated onto tryptic soy agar plates (Teknova) to determine stock concentrations.
Opsonization of S. pneumoniae
S. pneumoniae were mixed in 1:1 volume (50% opsonization) with normal mouse serum (Invitrogen) and incubated at 37°C for 30 min, shaking at 230 RPMs. Bacteria were washed twice in PBS and suspended in RPMI containing 10% FBS and 2 mM L-glutamine, without penicillin/streptomycin.
In vivo bacteria administration
For experiments with S. pneumoniae, 2.5×105 CFU were administered (40 μl in PBS) i.t., for Pseudomonas aeruginosa, mice were exposed to 107 CFU i.t. (40 μl in PBS). In some experiments, mice were given PBS or 4 nmoles NPFF (Tocris) intranasally, 24 h later, mice were given 2.5×105 S. pneumoniae CFU, with or without NPFF, intratracheally. For IFNγ blockade, mice received isotype control or 0.2 mg anti-IFNγ (XMG1.2, BioXCell) in 100 ul of PBS intraperitoneally a day before infection.
Bone marrow chimeras
Bone marrow chimeras were performed as described previously85. Briefly, 10- to 12-week-old Mrgpra1−/− mice were irradiated with two doses of 4.5 Gy given 3 hours apart. After, mice were injected intravenously (2×106 cells/200 ul) with bone marrow cells from Mrgpra1+/+ or Mrgpra1−/− mice. Mice were kept on neomycin (1.1 mg/ml) water for 2 weeks following irradiation. At the end of 12–15 weeks, mice were challenged with S. pneumoniae (2.5 X 105 CFU) intratracheally, and 24h later, BAL was harvested for flow cytometric analysis.
Peritoneal mast cell (PMC) culture
PMCs were cultured as described86. Briefly, the peritoneal cavity of 2–3 mice was flushed using ice-cold sterile PBS (10 ml each) and the peritoneal cavity was gently massaged. The peritoneal fluid was then collected into a 50 ml conical and cells were spun (300×g, 10 min) followed by a PBS wash. Cells were resuspended in 5 ml complete media (RPMI, 10% FBS/pen/strep) supplemented with recombinant mouse (rm) IL-3 (10 ng/ml) and rmSCF (30 ng/ml). The cell suspension was then transferred to a 25 cm2 tissue culture flask and incubated at 37°C, 5% CO2. At day 3, non-adherent cells were discarded with the media and fresh media (5 ml) containing rmIL-3 (10 ng/ml) and rmSCF (30 ng/ml) was added. On day 6, 5 ml of fresh media containing rmIL-3 (10 ng/ml) and rmSCF (30 ng/ml) was added to the culture. At the end of the culture (day 10), PMCs which are the floating, non-adherent cells were harvested and sorted to >95% purity (CD45+FcεR1+c-kit+) and cells (1s106 cells) were used for RT-PCR.
Bone marrow-derived neutrophil (BMN) isolation
Marrow from tibias and femurs was harvested, and bone-marrow-derived neutrophils (BMN) were isolated using Histopaque (Sigma) employing a protocol described previously87. Briefly, bone marrow was collected from mice in PBS containing 2 mM EDTA, followed by red-blood cell lysis with ACK buffer. The bone marrow cells were then suspended in ice-cold PBS and gently layered onto Histopaque to avoid disturbing the gradient. After centrifugation (872×g, 30 min), BMNs were collected at the interface layer and washed twice in RPMI containing 10% FBS, 2 mM L-glutamine, and penicillin/streptomycin. BMNs were seeded at 1.5–2.5×105 cells in round-bottom 96-well plates in RPMI containing 10% FBS, 2 mM L-glutamine, and penicillin/streptomycin. For experiments, BMNs from multiple (n= 3–6) mice were pooled for each genotype and experiments were performed with replicates. We routinely harvest high purity (>90%) BMNs using this isolation method. Further, we obtain similar numbers of neutrophils from both Mrgpra1−/− and Mrgpra1+/+ mice.
N1-like/N2-like polarization cultures
BMNs were seeded at 2.5×105 cells in round-bottom 96-well plates in RPMI containing 10% FBS, 2 mM L-glutamine and stimulated with 20 ng/ml IFNγ (RnD Systems) and 1 μg/ml LPS (Sigma) for N1-like or 20 ng/ml IL-4 (RnD Systems) and 10 ng/ml TGFβ1 (Peprotech) for N2-like polarization for 3 h. Following this, cells were harvested and used for RNA isolation. Some BMNs were incubated overnight with 10 uM NPFF (Tocris). For intracellular staining, cells were first fixed with 4% paraformaldehyde for 10 mins at RT, then permeabilized with 0.1% saponin for 20 min at RT, followed by intracellular staining.
NET assay
1.5×105 BMNs were resuspended in RPMI containing 10% BSA and plated in black 96-well dishes with clear bottoms and treated with media or 50 μg/ml PGN for approx. 3.5 h. Following this, 1 ug/ml Hoechst (Invitrogen) and 5 μM SYTOX orange (Thermo) was added, and cells were incubated for another 10 min at 37°C with 5% CO2. NETosis was assessed as a ratio of fluorescence from SYTOX orange (cell-impermeable nucleic acid stain) to Hoescht (cell-permeable nucleic acid stain).
ROS assay
For in vitro ROS measurement, 1.5×105 BMNs were resuspended in RPMI containing 10% FBS and 2 mM L-glutamine and plated in round-bottom 96-well dishes. Cells were stimulated with media or 10 μg/ml PGN for 2 h. During the last 20 min of incubation, 0.5 μg/ml DHR123 (Thermo) was added. Cells were washed and analyzed by flow cytometry. For in vivo ROS analysis, 2×106 lung cells in 96-well dishes were incubated with 0.5 μg/ml DHR123 for 20 min, after which cells were washed and prepared for flow cytometry.
BMN-bacteria cultures
BMNs were seeded at 1.5×105 cells in round-bottom 96-well plates in RPMI containing 10% FBS, 2 mM L-glutamine (without penicillin/streptomycin) in combination with 0.15×105 (ROS measurement). For bacteria killing assay a MOI of 1–10 utilizing opsonized S. pneumoniae CFU in a total volume of 200 μl was performed. Plates were incubated at 37°C for 120 min with shaking (180 RPMs). During the last 20 min of incubation, 0.5 μg/ml dihydrorhodamine 123 (DHR123, Thermo) was added. Cells were washed and analyzed by flow cytometry. For CFU enumeration, BMNs and bacteria were incubated as above, and 20 μL (10% of the culture volume) was taken and incubated in 980 μL pH 11 water to lyse neutrophils for 20 min at 37°C. 10 μL of this mixture was used for serial dilution on sheep blood agar plates. Plates were incubated overnight for CFU enumeration. In specific experiments, BMNs were treated with NPFF (25 uM), substance P (25 uM) or in N1-like conditions for 3 h or with 20 μg/ml control or anti-IFNγ mAbs for 40 min before addition of bacteria.
Real-time PCR
Total RNA was extracted using TRIzol (Thermo) and cDNA generated (Applied Biosystems). PCR was performed using primer probes (Thermo). For experiments with BMN, 0.5 μg of RNA was used, whereas, for lung tissue, 2 μg of RNA was utilized to prepare cDNA. Data are expressed as relative expression to the housekeeping gene ribosomal protein S14 (Rps14).
Phosphoflow
BMNs were treated with recombinant mouse IFNγ for 40 mins in RPMI containing 2% FBS with l-glutamine and penicillin/streptomycin. Cells were fixed by directly adding 32% PFA (Electron Microscopy Sciences) for a final concentration of 1.6% for 10 min. PFA was removed, and BMNs were permeabilized with ice-cold 90% methanol for 60 min at 4°C. Cells were stained with phycoerythrin-conjugated phospho-STAT1 antibodies in PBS+0.2% BSA and washed with PBS+0.2% BSA. In some experiments, BMNs were pretreated with NPFF (25 uM) for 4h before the addition of mouse IFNγ for 45 min.
Flow sorting for PCR
Lung cells from naïve mice or S. pneumoniae infected mice (24 h p.i) were pooled (n=3–4) and stained (see legends of Figure 1 and Fig. S2), and various live (propidium iodide−) lung immune cells were flow-sorted using a MoFlo XDP (JHU Cell Sorting Core Facility). Liver and spleen cells from naïve mice (n=3) were pooled for sorting and various populations were sorted as described (see Figure S1 legend). Cells were split into replicates and resuspended in TRIzol for RNA extraction.
RNA sequencing of lung neutrophils and analysis
Mrgpra1+/+ and Mrgpra1−/− mice (n=4–5) were treated (i.t.) with saline or 2.5×105 S. pneumoniae CFU, 24 h later, lungs were harvested and processed for single-cell suspensions. Neutrophils (propidium iodide−CD45+CD11b+Ly6G+) were flow-sorted (see above) to more than 95% purity (Fig. S3a). To mitigate the low quantity of RNA in pulmonary neutrophils (about 20 times less than other cells), neutrophils from 4–5 animals in each group were pooled and then split into replicates prior to RNA extraction. RNA was extracted using RNeasy columns (Qiagen), and genomic DNA was removed by on-column digestion. Library construction and sequencing were done commercially (Cofactor Genomics) using the picoRNA platform. Reads were mapped to GRCm38, and differential expression was performed using DESeq2. Data are expressed as normalized transcripts per million.
scRNAseq data analysis
Cells were processed via the Seurat 4.0 workflow. All cells that expressed fewer than 200 genes were removed. Cells with high (>30%) mitochondrial reads were removed. Doublets were removed via the ‘scDblFinder’ method. Datasets were integrated using Harmony and Log-normalized gene expression data was used for visualizations.
Quantification and statistical analysis
Statistical significances were calculated using Student’s T test or one-way ANOVA followed by posthoc test, as indicated in figure legends. P-value are denoted as: *p<0.05, ***p<0.001, ****p<0.0001. Error bars on all figures represents standard error of mean (SEM).
Supplementary Material
Table S1: Pathway analysis of lung neutrophils depicting odd ratios post-infection. Related to Figure 3.
Table S2: List of differentially expressed (DE) genes in Mrgpra1 deficient lung neutrophils post-infection. Related to Figure 3.
Highlights:
Mrgpra1 is a neutrophil-expressed anti-inflammatory Mrgpr
Mrgpra1 drives anti-inflammatory neutrophils and inhibits activated neutrophils
A distinct population of neutrophils makes the Mrgpra1 ligand, neuropeptide FF (NPFF)
The Mrgpra1-NPFF axis inhibits IFNγ-driven anti-bacterial neutrophils
Acknowledgment
The work was supported by the Howard Hughes Medical Institute to X.D. X.D is also supported R37NS054791. F.A was supported by R21AI147598 and R01AR069569 grants by NIH. S.L was supported by NIH R01AI27644, R01AI170709 grants and the Johns Hopkins Catalyst Award. We thank Hao Zhang and the Bloomberg Flow Cytometry and Immunology Core for cell sorting, Dr. Il Minn (JHU) for help with chimera studies, Dr. Ying Zhang (JHU) for providing Pseudomonas aeruginosa (PAO1) bacterial strain, and Dr. Alan Scott for critical reading of the manuscript.
Footnotes
Declaration of Interests
X.D. is the scientific founder and consultant of Escient Pharmaceuticals, a pharmaceutical company developing drugs targeting Mrgprs. X.D. collaborates with GlaxoSmithKline (GSK) on Mrgpr-related projects, unrelated to this manuscript. N.G. has served as a consultant for Escient Pharmaceuticals on topics unrelated to this manuscript.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- 1.Ohms M, Moller S, Laskay T (2020). An Attempt to Polarize Human Neutrophils Toward N1 and N2 Phenotypes in vitro. Front Immunol. 11, 532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Fridlender ZG, Sun J, Kim S, Kapoor V, Cheng G, Ling L, Worthen GS, Albelda SM (2009). Polarization of tumor-associated neutrophil phenotype by TGF-beta: “N1” versus “N2” TAN. Cancer Cell. 16, 183–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Wang X, Qiu L, Li Z, Wang XY, Yi H (2018). Understanding the Multifaceted Role of Neutrophils in Cancer and Autoimmune Diseases. Front Immunol. 9, 2456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Neely CJ, Kartchner LB, Mendoza AE, Linz BM, Frelinger JA, Wolfgang MC, Maile R, Cairns BA (2014). Flagellin treatment prevents increased susceptibility to systemic bacterial infection after injury by inhibiting anti-inflammatory IL-10+ IL-12− neutrophil polarization. PLoS One. 9, e85623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Ma Y, Yabluchanskiy A, Iyer RP, Cannon PL, Flynn ER, Jung M, Henry J, Cates CA, Deleon-Pennell KY, Lindsey ML (2016). Temporal neutrophil polarization following myocardial infarction. Cardiovasc Res. 110, 51–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Mihaila AC, Ciortan L, Macarie RD, Vadana M, Cecoltan S, Preda MB, Hudita A, Gan AM, Jakobsson G, Tucureanu MM, et al. (2021). Transcriptional Profiling and Functional Analysis of N1/N2 Neutrophils Reveal an Immunomodulatory Effect of S100A9-Blockade on the Pro-Inflammatory N1 Subpopulation. Front Immunol. 12, 708770. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chen F, Wu W, Millman A, Craft JF, Chen E, Patel N, Boucher JL, Urban JF Jr., Kim CC, Gause WC (2014). Neutrophils prime a long-lived effector macrophage phenotype that mediates accelerated helminth expulsion. Nat Immunol. 15, 938–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Panda R, Castanheira FV, Schlechte JM, Surewaard BG, Shim HB, Zucoloto AZ, Slavikova Z, Yipp BG, Kubes P, McDonald B (2022). A functionally distinct neutrophil landscape in severe COVID-19 reveals opportunities for adjunctive therapies. JCI Insight. 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Barnes BJ, Adrover JM, Baxter-Stoltzfus A, Borczuk A, Cools-Lartigue J, Crawford JM, Dassler-Plenker J, Guerci P, Huynh C, Knight JS, et al. (2020). Targeting potential drivers of COVID-19: Neutrophil extracellular traps. J Exp Med. 217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Narasaraju T, Tang BM, Herrmann M, Muller S, Chow VTK, Radic M (2020). Neutrophilia and NETopathy as Key Pathologic Drivers of Progressive Lung Impairment in Patients With COVID-19. Front Pharmacol. 11, 870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Chiang CC, Korinek M, Cheng WJ, Hwang TL (2020). Targeting Neutrophils to Treat Acute Respiratory Distress Syndrome in Coronavirus Disease. Front Pharmacol. 11, 572009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Meizlish ML, Pine AB, Bishai JD, Goshua G, Nadelmann ER, Simonov M, Chang CH, Zhang H, Shallow M, Bahel P, et al. (2021). A neutrophil activation signature predicts critical illness and mortality in COVID-19. Blood Adv. 5, 1164–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Liu Y, Du X, Chen J, Jin Y, Peng L, Wang HHX, Luo M, Chen L, Zhao Y (2020). Neutrophil-to-lymphocyte ratio as an independent risk factor for mortality in hospitalized patients with COVID-19. J Infect. 81, e6–e12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Meixiong J, Dong X (2017). Mas-Related G Protein-Coupled Receptors and the Biology of Itch Sensation. Annu Rev Genet. 51, 103–21. [DOI] [PubMed] [Google Scholar]
- 15.Dong X, Han S, Zylka MJ, Simon MI, Anderson DJ (2001). A diverse family of GPCRs expressed in specific subsets of nociceptive sensory neurons. Cell. 106, 619–32. [DOI] [PubMed] [Google Scholar]
- 16.Meixiong J, Vasavda C, Green D, Zheng Q, Qi L, Kwatra SG, Hamilton JP, Snyder SH, Dong X (2019). Identification of a bilirubin receptor that may mediate a component of cholestatic itch. Elife. 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Green DP, Limjunyawong N, Gour N, Pundir P, Dong X (2019). A Mast-Cell-Specific Receptor Mediates Neurogenic Inflammation and Pain. Neuron. 101, 412–20 e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.McNeil BD, Pundir P, Meeker S, Han L, Undem BJ, Kulka M, Dong X (2015). Identification of a mast-cell-specific receptor crucial for pseudo-allergic drug reactions. Nature. 519, 237–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Pundir P, Liu R, Vasavda C, Serhan N, Limjunyawong N, Yee R, Zhan Y, Dong X, Wu X, Zhang Y, et al. (2019). A Connective Tissue Mast-Cell-Specific Receptor Detects Bacterial Quorum-Sensing Molecules and Mediates Antibacterial Immunity. Cell Host Microbe. 26, 114–22 e8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Subramanian H, Gupta K, Guo Q, Price R, Ali H (2011). Mas-related gene X2 (MrgX2) is a novel G protein-coupled receptor for the antimicrobial peptide LL-37 in human mast cells: resistance to receptor phosphorylation, desensitization, and internalization. J Biol Chem. 286, 44739–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Subramanian H, Gupta K, Lee D, Bayir AK, Ahn H, Ali H (2013). beta-Defensins activate human mast cells via Mas-related gene X2. J Immunol. 191, 345–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Perner C, Flayer CH, Zhu X, Aderhold PA, Dewan ZNA, Voisin T, Camire RB, Chow OA, Chiu IM, Sokol CL (2020). Substance P Release by Sensory Neurons Triggers Dendritic Cell Migration and Initiates the Type-2 Immune Response to Allergens. Immunity. 53, 1063–77 e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Nguyen GT, Green ER, Mecsas J (2017). Neutrophils to the ROScue: Mechanisms of NADPH Oxidase Activation and Bacterial Resistance. Front Cell Infect Microbiol. 7, 373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Dahlgren C, Karlsson A, Bylund J (2019). Intracellular Neutrophil Oxidants: From Laboratory Curiosity to Clinical Reality. J Immunol. 202, 3127–34. [DOI] [PubMed] [Google Scholar]
- 25.Keenan AB, Torre D, Lachmann A, Leong AK, Wojciechowicz ML, Utti V, Jagodnik KM, Kropiwnicki E, Wang Z, Ma’ayan A (2019). ChEA3: transcription factor enrichment analysis by orthogonal omics integration. Nucleic Acids Res. 47, W212–W24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Baillie JK, Arner E, Daub C, De Hoon M, Itoh M, Kawaji H, Lassmann T, Carninci P, Forrest AR, Hayashizaki Y, et al. (2017). Analysis of the human monocyte-derived macrophage transcriptome and response to lipopolysaccharide provides new insights into genetic aetiology of inflammatory bowel disease. PLoS Genet. 13, e1006641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ghiboub M, Koster J, Craggs PD, Li Yim AYF, Shillings A, Hutchinson S, Bingham RP, Gatfield K, Hageman IL, Yao G, et al. (2020). Modulation of macrophage inflammatory function through selective inhibition of the epigenetic reader protein SP140. bioRxiv. 2020.08.10.239475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Lawrence T, Natoli G (2011). Transcriptional regulation of macrophage polarization: enabling diversity with identity. Nat Rev Immunol. 11, 750–61. [DOI] [PubMed] [Google Scholar]
- 29.Mehta S, Cronkite DA, Basavappa M, Saunders TL, Adiliaghdam F, Amatullah H, Morrison SA, Pagan JD, Anthony RM, Tonnerre P, et al. (2017). Maintenance of macrophage transcriptional programs and intestinal homeostasis by epigenetic reader SP140. Sci Immunol. 2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Roy S, Guler R, Parihar SP, Schmeier S, Kaczkowski B, Nishimura H, Shin JW, Negishi Y, Ozturk M, Hurdayal R, et al. (2015). Batf2/Irf1 induces inflammatory responses in classically activated macrophages, lipopolysaccharides, and mycobacterial infection. J Immunol. 194, 6035–44. [DOI] [PubMed] [Google Scholar]
- 31.Kubota K, Moriyama M, Furukawa S, Rafiul H, Maruse Y, Jinno T, Tanaka A, Ohta M, Ishiguro N, Yamauchi M, et al. (2017). CD163(+)CD204(+) tumor-associated macrophages contribute to T cell regulation via interleukin-10 and PD-L1 production in oral squamous cell carcinoma. Sci Rep. 7, 1755. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Kaku Y, Imaoka H, Morimatsu Y, Komohara Y, Ohnishi K, Oda H, Takenaka S, Matsuoka M, Kawayama T, Takeya M, et al. (2014). Overexpression of CD163, CD204 and CD206 on alveolar macrophages in the lungs of patients with severe chronic obstructive pulmonary disease. PLoS One. 9, e87400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Viola A, Munari F, Sanchez-Rodriguez R, Scolaro T, Castegna A (2019). The Metabolic Signature of Macrophage Responses. Front Immunol. 10, 1462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Gomez JC, Yamada M, Martin JR, Dang H, Brickey WJ, Bergmeier W, Dinauer MC, Doerschuk CM (2015). Mechanisms of interferon-gamma production by neutrophils and its function during Streptococcus pneumoniae pneumonia. Am J Respir Cell Mol Biol. 52, 349–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Yamada M, Gomez JC, Chugh PE, Lowell CA, Dinauer MC, Dittmer DP, Doerschuk CM (2011). Interferon-gamma production by neutrophils during bacterial pneumonia in mice. Am J Respir Crit Care Med. 183, 1391–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Klein Wolterink RGJ, Wu GS, Chiu IM, Veiga-Fernandes H (2022). Neuroimmune Interactions in Peripheral Organs. Annu Rev Neurosci. 45, 339–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Baral P, Umans BD, Li L, Wallrapp A, Bist M, Kirschbaum T, Wei Y, Zhou Y, Kuchroo VK, Burkett PR, et al. (2018). Nociceptor sensory neurons suppress neutrophil and gammadelta T cell responses in bacterial lung infections and lethal pneumonia. Nat Med. 24, 417–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Azimi E, Reddy VB, Pereira PJS, Talbot S, Woolf CJ, Lerner EA (2017). Substance P activates Mas-related G protein-coupled receptors to induce itch. J Allergy Clin Immunol. 140, 447–53 e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Jenkinson KM, Southwell BR, Furness JB (1999). Two affinities for a single antagonist at the neuronal NK1 tachykinin receptor: evidence from quantitation of receptor endocytosis. Br J Pharmacol. 126, 131–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Dong X, Limjunyawong N, Sypek EI, Wang G, Ortines RV, Youn C, Alphonse MP, Dikeman D, Wang Y, Lay M, et al. (2022). Keratinocyte-derived defensins activate neutrophil-specific receptors Mrgpra2a/b to prevent skin dysbiosis and bacterial infection. Immunity. 55, 1645–62 e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Benoit M, Desnues B, Mege JL (2008). Macrophage polarization in bacterial infections. J Immunol. 181, 3733–9. [DOI] [PubMed] [Google Scholar]
- 42.Canton J, Khezri R, Glogauer M, Grinstein S (2014). Contrasting phagosome pH regulation and maturation in human M1 and M2 macrophages. Mol Biol Cell. 25, 3330–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Matsumura T, Ato M, Ikebe T, Ohnishi M, Watanabe H, Kobayashi K (2012). Interferon-gamma-producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections. Nat Commun. 3, 678. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Ellis TN, Beaman BL (2004). Interferon-gamma activation of polymorphonuclear neutrophil function. Immunology. 112, 2–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Kerr AR, Wei XQ, Andrew PW, Mitchell TJ (2004). Nitric oxide exerts distinct effects in local and systemic infections with Streptococcus pneumoniae. Microb Pathog. 36, 303–10. [DOI] [PubMed] [Google Scholar]
- 46.Sun K, Salmon SL, Lotz SA, Metzger DW (2007). Interleukin-12 promotes gamma interferon-dependent neutrophil recruitment in the lung and improves protection against respiratory Streptococcus pneumoniae infection. Infect Immun. 75, 1196–202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Haraguchi S, Day NK, Nelson RP Jr., Emmanuel P, Duplantier JE, Christodoulou CS, Good RA (1998). Interleukin 12 deficiency associated with recurrent infections. Proc Natl Acad Sci U S A. 95, 13125–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Hofbauer R, Kaye AD, Kapiotis S, Frass M (1999). The immune system and the effects of non-volatile anesthetics on neutrophil transmigration through endothelial cell monolayers. Curr Pharm Des. 5, 1015–27. [PubMed] [Google Scholar]
- 49.Mock JR, Tune MK, Dial CF, Torres-Castillo J, Hagan RS, Doerschuk CM (2020). Effects of IFN-gamma on immune cell kinetics during the resolution of acute lung injury. Physiol Rep. 8, e14368. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Karki R, Sharma BR, Tuladhar S, Williams EP, Zalduondo L, Samir P, Zheng M, Sundaram B, Banoth B, Malireddi RKS, et al. (2021). Synergism of TNF-alpha and IFN-gamma Triggers Inflammatory Cell Death, Tissue Damage, and Mortality in SARS-CoV-2 Infection and Cytokine Shock Syndromes. Cell. 184, 149–68 e17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Rosa BA, Ahmed M, Singh DK, Choreno-Parra JA, Cole J, Jimenez-Alvarez LA, Rodriguez-Reyna TS, Singh B, Gonzalez O, Carrion R Jr., et al. (2021). IFN signaling and neutrophil degranulation transcriptional signatures are induced during SARS-CoV-2 infection. Commun Biol. 4, 290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.D’Alessio FR, Craig JM, Singer BD, Files DC, Mock JR, Garibaldi BT, Fallica J, Tripathi A, Mandke P, Gans JH, et al. (2016). Enhanced resolution of experimental ARDS through IL-4-mediated lung macrophage reprogramming. Am J Physiol Lung Cell Mol Physiol. 310, L733–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Impellizzieri D, Ridder F, Raeber ME, Egholm C, Woytschak J, Kolios AGA, Legler DF, Boyman O (2019). IL-4 receptor engagement in human neutrophils impairs their migration and extracellular trap formation. J Allergy Clin Immunol. 144, 267–79 e4. [DOI] [PubMed] [Google Scholar]
- 54.Egholm C, Ozcan A, Breu D, Boyman O (2022). Type 2 immune predisposition results in accelerated neutrophil aging causing susceptibility to bacterial infection. Sci Immunol. 7, eabi9733. [DOI] [PubMed] [Google Scholar]
- 55.Woytschak J, Keller N, Krieg C, Impellizzieri D, Thompson RW, Wynn TA, Zinkernagel AS, Boyman O (2016). Type 2 Interleukin-4 Receptor Signaling in Neutrophils Antagonizes Their Expansion and Migration during Infection and Inflammation. Immunity. 45, 172–84. [DOI] [PubMed] [Google Scholar]
- 56.Egholm C, Heeb LEM, Impellizzieri D, Boyman O (2019). The Regulatory Effects of Interleukin-4 Receptor Signaling on Neutrophils in Type 2 Immune Responses. Front Immunol. 10, 2507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Augustyniak D, Kramarska E, Mackiewicz P, Orczyk-Pawilowicz M, Lundy FT (2021). Mammalian Neuropeptides as Modulators of Microbial Infections: Their Dual Role in Defense versus Virulence and Pathogenesis. Int J Mol Sci. 22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Gonzalez-Rey E, Chorny A, Delgado M (2007). Regulation of immune tolerance by anti-inflammatory neuropeptides. Nat Rev Immunol. 7, 52–63. [DOI] [PubMed] [Google Scholar]
- 59.Delgado M, Ganea D (2008). Anti-inflammatory neuropeptides: a new class of endogenous immunoregulatory agents. Brain Behav Immun. 22, 1146–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Sun YL, Zhang XY, Sun T, He N, Li JY, Zhuang Y, Zeng Q, Yu J, Fang Q, Wang R (2013). The anti-inflammatory potential of neuropeptide FF in vitro and in vivo. Peptides. 47, 124–32. [DOI] [PubMed] [Google Scholar]
- 61.Larsson O, Tengroth L, Xu Y, Uddman R, Kumlien Georen S, Cardell LO (2018). Substance P represents a novel first-line defense mechanism in the nose. J Allergy Clin Immunol. 141, 128–36 e3. [DOI] [PubMed] [Google Scholar]
- 62.Bonnard E, Burlet-Schiltz O, Monsarrat B, Girard JP, Zajac JM (2003). Identification of proNeuropeptide FFA peptides processed in neuronal and non-neuronal cells and in nervous tissue. Eur J Biochem. 270, 4187–99. [DOI] [PubMed] [Google Scholar]
- 63.Tuncer LI, Alacam T, Oral B (2004). Substance P expression is elevated in inflamed human periradicular tissue. J Endod. 30, 329–32. [DOI] [PubMed] [Google Scholar]
- 64.Suvas S (2017). Role of Substance P Neuropeptide in Inflammation, Wound Healing, and Tissue Homeostasis. J Immunol. 199, 1543–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Goetzl EJ, Grotmol T, Van Dyke RW, Turck CW, Wershil B, Galli SJ, Sreedharan SP (1990). Generation and recognition of vasoactive intestinal peptide by cells of the immune system. Ann N Y Acad Sci. 594, 34–44. [DOI] [PubMed] [Google Scholar]
- 66.Vilim FS, Aarnisalo AA, Nieminen ML, Lintunen M, Karlstedt K, Kontinen VK, Kalso E, States B, Panula P, Ziff E (1999). Gene for pain modulatory neuropeptide NPFF: induction in spinal cord by noxious stimuli. Mol Pharmacol. 55, 804–11. [PubMed] [Google Scholar]
- 67.Dai Y, Zhao X, Chen P, Yu Y, Wang Y, Xie L (2015). Neuropeptide FF Promotes Recovery of Corneal Nerve Injury Associated With Hyperglycemia. Invest Ophthalmol Vis Sci. 56, 7754–65. [DOI] [PubMed] [Google Scholar]
- 68.Sas AR, Carbajal KS, Jerome AD, Menon R, Yoon C, Kalinski AL, Giger RJ, Segal BM (2020). A new neutrophil subset promotes CNS neuron survival and axon regeneration. Nat Immunol. 21, 1496–505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Waqas SFH, Hoang AC, Lin YT, Ampem G, Azegrouz H, Balogh L, Thuroczy J, Chen JC, Gerling IC, Nam S, et al. (2017). Neuropeptide FF increases M2 activation and self-renewal of adipose tissue macrophages. J Clin Invest. 127, 2842–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Cuartero MI, Ballesteros I, Moraga A, Nombela F, Vivancos J, Hamilton JA, Corbi AL, Lizasoain I, Moro MA (2013). N2 neutrophils, novel players in brain inflammation after stroke: modulation by the PPARgamma agonist rosiglitazone. Stroke. 44, 3498–508. [DOI] [PubMed] [Google Scholar]
- 71.Munder M, Schneider H, Luckner C, Giese T, Langhans CD, Fuentes JM, Kropf P, Mueller I, Kolb A, Modolell M, et al. (2006). Suppression of T-cell functions by human granulocyte arginase. Blood. 108, 1627–34. [DOI] [PubMed] [Google Scholar]
- 72.Lavin Y, Winter D, Blecher-Gonen R, David E, Keren-Shaul H, Merad M, Jung S, Amit I (2014). Tissue-resident macrophage enhancer landscapes are shaped by the local microenvironment. Cell. 159, 1312–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Ballesteros I, Rubio-Ponce A, Genua M, Lusito E, Kwok I, Fernandez-Calvo G, Khoyratty TE, van Grinsven E, Gonzalez-Hernandez S, Nicolas-Avila JA, et al. (2020). Co-option of Neutrophil Fates by Tissue Environments. Cell. 183, 1282–97 e18. [DOI] [PubMed] [Google Scholar]
- 74.Timaxian C, Vogel CFA, Orcel C, Vetter D, Durochat C, Chinal C, P NG, Aknin ML, Mercier-Nome F, Davy M, et al. (2021). Pivotal Role for Cxcr2 in Regulating Tumor-Associated Neutrophil in Breast Cancer. Cancers (Basel). 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Zhao Q, Yu CD, Wang R, Xu QJ, Dai Pra R, Zhang L, Chang RB (2022). A multidimensional coding architecture of the vagal interoceptive system. Nature. 603, 878–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Liu Q, Tang Z, Surdenikova L, Kim S, Patel KN, Kim A, Ru F, Guan Y, Weng HJ, Geng Y, et al. (2009). Sensory neuron-specific GPCR Mrgprs are itch receptors mediating chloroquine-induced pruritus. Cell. 139, 1353–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Chen S, Zhou Y, Chen Y, Gu J (2018). fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 34, i884–i90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Patro R, Duggal G, Love MI, Irizarry RA, Kingsford C (2017). Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods. 14, 417–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Love MI, Huber W, Anders S (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Hao Y, Hao S, Andersen-Nissen E, Mauck WM 3rd, Zheng S, Butler A, Lee MJ, Wilk AJ, Darby C, Zager M, et al. (2021). Integrated analysis of multimodal single-cell data. Cell. 184, 3573–87 e29. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Gruning B, Dale R, Sjodin A, Chapman BA, Rowe J, Tomkins-Tinch CH, Valieris R, Koster J, Bioconda T (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nat Methods. 15, 475–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Korsunsky I, Millard N, Fan J, Slowikowski K, Zhang F, Wei K, Baglaenko Y, Brenner M, Loh PR, Raychaudhuri S (2019). Fast, sensitive and accurate integration of single-cell data with Harmony. Nat Methods. 16, 1289–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Germain PL, Lun A, Garcia Meixide C, Macnair W, Robinson MD (2021). Doublet identification in single-cell sequencing data using scDblFinder. F1000Res. 10, 979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Way WG, Lu H, Wang X, Zhao D, Camarena C, Sarkar D, Martin RK, Zhou H (2023). Optimization of high throughput spectral flow cytometry for immune cell profiling in mouse liver. Liver Research. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Gour N, Lajoie S, Smole U, White M, Hu D, Goddard P, Huntsman S, Eng C, Mak A, Oh S, et al. (2018). Dysregulated invertebrate tropomyosin-dectin-1 interaction confers susceptibility to allergic diseases. Sci Immunol. 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Vukman KV, Metz M, Maurer M, O’Neill SM (2014). Isolation and Culture of Peritoneal Cell-derived Mast Cells. Bio-protocol. 4, e1052. [Google Scholar]
- 87.Swamydas M, Luo Y, Dorf ME, Lionakis MS (2015). Isolation of Mouse Neutrophils. Curr Protoc Immunol. 110, 3 20 1–3 15. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1: Pathway analysis of lung neutrophils depicting odd ratios post-infection. Related to Figure 3.
Table S2: List of differentially expressed (DE) genes in Mrgpra1 deficient lung neutrophils post-infection. Related to Figure 3.
Data Availability Statement
RNA-seq data from sorted lung neutrophils are deposited in the Gene Expression Omnibus (GEO) database and are publicly available from the date of publication Accession numbers are listed in the Key Resources Table. The following public datasets were used: Histone ChIP-seq dataset from mouse bone marrow neutrophils, bone marrow monocytes, and peritoneal macrophages; ATAC-seq datasets of mouse neutrophils; RNAseq from bone marrow neutrophils (BMN; and Single cell RNAseq of mouse vagal ganglia. Accession numbers are listed in the Key Resources Table.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Key resources table.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-mouse CD45-APC-Cy7 (1/800) | BioLegend | Cat#103115; RRID: AB_312980 |
| anti-mouse CD45-Alexa 700 (1/800) | BioLegend | Cat#103127; RRID: AB_493714 |
| anti-mouse Ly6C-PE-Dazzle594 (1/400) | BioLegend | Cat#128043; RRID: AB_256676 |
| anti-mouse Ly6G-APC-Cy7 (1/800) | BioLegend | Cat#127623; RRID: AB_10645331 |
| anti-mouse Ly6G-BV421 (1/800) | BioLegend | Cat#127627; RRID: AB_10897944 |
| anti-mouse CD63-PE-Cy7 (1/300) | BioLegend | Cat#143909; RRID: AB_2565499 |
| anti-mouse CD11c-BV605 (1/400) | BioLegend | Cat#117333; RRID: AB_11204262 |
| anti-mouse CD11b-PE-Cy7 (1/2500) | BioLegend | Cat#101215; RRID: AB_312798 |
| anti-mouse CD11b-PerCP-Cy5.5 (1/2500) | BioLegend | Cat#101227; RRID: AB_893233 |
| anti-mouse CD11b-BV785 (1/2500) | BioLegend | Cat#101243; RRID: AB_2561373 |
| anti-mouse Siglec-F-PerCP-Cy5.5 (1/400) | BD Biosciences | Cat#565526; RRID: AB_2739281 |
| anti-mouse CD64-BV421 (1/150) | BioLegend | Cat#139309; RRID: AB_2562694 |
| anti-mouse MerTK-APC (1/150) | BioLegend | Cat#151507; RRID: AB_2650738 |
| anti-mouse MerTK-PE (1/150) | BioLegend | Cat#151505; RRID: AB_2617036 |
| anti-mouse MerTK-PE-Cy7 (1/150) | BioLegend | Cat#151521; RRID: AB_2876508 |
| anti-mouse IFNγ-BV421 (1/100) | BioLegend | Cat#505829; RRID: AB_10897937 |
| anti-mouse IFNγ-PE (1/100) | BioLegend | Cat#505807; RRID: AB_315401 |
| anti-mouse iNOS-PE (1/100) | Thermo | Cat#12-5920-82; RRID: AB_2572642 |
| anti-mouse Arginase-1-PE (1/100) | Thermo | Cat#12-3697-82; RRID: AB_2734839 |
| anti-mouse pSTAT1-PE (1/100) | Thermo | Cat#MA5-37073; RRID: AB_2897008 |
| anti-mouse CD204-BV421 (1/100) | BD Biosciences | Cat#748083; RRID: AB_2872544 |
| anti-mouse CD204-BV786 (1/100) | BD Biosciences | Cat#748089; RRID: AB_2872550 |
| anti-mouse CD206-BV605 (1/100) | BioLegend | Cat#141721; RRID: AB_2562340 |
| anti-mouse CD24-BV605 (1/300) | BioLegend | Cat#101827; RRID: AB_2563464 |
| anti-mouse ckit-BV421 (1/200) | BioLegend | Cat#135123; RRID: AB_2562236 |
| anti-mouse FcER1-PE-Cy7 (1/200) | BioLegend | Cat#134317; RRID: AB_10643996 |
| anti-mouse FcER1-APC (1/200) | BioLegend | Cat#134315; RRID: AB_10640726 |
| Donkey anti-rabbit IgG-BV421 (1/400) | BioLegend | Cat#406410; RRID: AB_10897810 |
| rabbit anti-NPFF polyclonal (1/200) | Thermo | Cat#PA5-25175; RRID:AB_2542675 |
| anti-mouse IFNγR1-BV605 (1/100) | BD Biosciences | Cat#745111; RRID:AB_2742716 |
| anti-mouse IFNγR2-Ax647 (1/100) | R&D Systems | Cat#FAB773R |
| TruStain FcX™ (anti-mouse CD16/32) | Biolegend | Cat#101319 RRID:AB_1574975 |
| InVivoMAb anti-mouse CD16/CD32 | BioXcell | Cat# #BE0307 RRID:AB_2736987 |
| anti-mouse IFNγ | BioXcell | Cat#BE0055 RRID:AB_1107692 |
| Bacterial and virus strains | ||
| Streptococcus pneumoniae 6303 | ATCC | Strain ID: CIP 104225 |
| Pseudomonas aeruginosa (PAO1) | Dr. Ying Zhang (JHU) | N/A |
| PGN from Staphylococcus aureus | InvivoGen | Cat# tlrl-pgns2 |
| pHrodo™ Red S. aureus BioParticles™ | ThermoFisher | Cat# A10010 |
| Chemicals, peptides, and recombinant proteins | ||
| Neuropeptide FF | Tocris | Cat#3137 |
| Substance P | Tocris | Cat# 1156 |
| anti-mouse IFNγ | BioXcell | Cat#BE0055 |
| Recombinant Mouse IL-3 | R&D systems | Cat# 403-ML-010 |
| Recombinant Mouse SCF | R&D systems | Cat# 455-MC-010 |
| Recombinant Murine IFNγ | Peprotech | Cat# 315-05 |
| Recombinant Murine IL-4 | Peprotech | Cat# 214-14 |
| Recombinant Mouse TGF-beta 1 | R&D systems | Cat#: 7666-MB |
| Histopaque®-1119 | Millipore Sigma | Cat# 11191 |
| Histopaque®-1077 | Millipore Sigma | Cat# 10771 |
| SYTOX™ Orange Nucleic Acid Stain | ThermoFisher | Cat# S11368 |
| Hoechst 33342 | ThermoFisher | Cat# H1399 |
| Normal Mouse Serum | ThermoFisher | Cat# 10410 |
| TRIzol™ Reagent | ThermoFisher | Cat# 15596026 |
| 32% Paraformaldehyde | FisherScientific | Cat# 50-980-494 |
| Tryptic Soy Agar Plates | Teknova | Cat# T0144 |
| Blood agar plate | BD | Cat# 22126 |
| Penicillin-Streptomycin-Glutamine (100X) | ThermoFisher | Cat# 10378016 |
| Fixation & Permeabilization Buffer set | ThermoFisher | Cat# 88-8824-00 |
| Liberase ™ TL | Millipore Sigma | Cat#05401020001 |
| Deoxyribonuclease I | Millipore Sigma | Cat#DN25 |
| Zombie Aqua viability dye | BioLegend | Cat#423101 |
| Dihydrorhodamine 123 | ThermoFischer | Cat# D632 |
| Deposited data | ||
| RNAseq of sorted mouse lung neutrophils | this manuscript | Accession# GSE200214 |
| Histone-ChIP (neutrophils, monocytes, macrophages | Lavin et al.72 | Accession# GSE63341 |
| ATAC-seq of mouse neutrophils | Ballesteros et al.73 | Accession# GSE141285 |
| RNAseq of mouse bone marrow neutrophils (BMN) | Timaxian et al.74 | Accession# GSE164766 |
| scRNAseq of mouse vagal ganglia | Zhao et al.75 | Accession# GSE192987 |
| Experimental models: Cell lines: not applicable | ||
| Experimental models: Organisms/strains | ||
| Mrgpra1−/− mice | Liu et al.76 | N/A |
| Oligonucleotides | ||
| mNpff.S: 5’-GGTCCCTCTTTCGTGTTCTG-3’ AS: 5’-GCG GAT TTA GCT GTT CCT TG-3’ | Integrated DNA Technologies | N/A |
| mNpvf.S: 5’-CATGATGCCTCATTTTCACAGC-3’ AS: 5’-CCTCTCCTCGTTCGCTTTCC-3’ | Integrated DNA Technologies | N/A |
| mQrfp: S:5’-TCACCTGCCCTTCTTAGAGC-3’ AS: 5’-CGGTTCAAAATCCACAGCCA-3’ | Integrated DNA Technologies | N/A |
| mSst.S: 5’-CTCCGTCAGTTTCTGCAGAA-3’ AS: 5’-TTCTCTGTCTGGTTGGGCTC-3’ | Integrated DNA Technologies | N/A |
| mTac1.S: 5’-TTTCTCGTTTCCACTCAACTGTT-3’ AS: 5’-GTCTTCGGGCGATTCTCTGC-3’ | Integrated DNA Technologies | N/A |
| mPrlh.S: 5’-CCCTGACATCAATCCTGCCT-3’ AS: 5’-GCTGTGAGAGAACTTGGCAC-3’ | Integrated DNA Technologies | N/A |
| mCalca.S: 5’-CAGTGCCTTTGAGGTCAATCT-3’ AS: 5’-CCAGCAGGCGAACTTCTTCTT-3’ | Integrated DNA Technologies | N/A |
| mCalcb.S: 5’-TGGAACAGGAGGAGCAAGAG-3’ AS: 5’-CACACCTCCTGATCTGCTCA-3’ | Integrated DNA Technologies | N/A |
| mKiss1.S: 5’-AAGTGAAGCCTGGATCCACA-3’ AS:5’-TTAACGAGTTCCTGGGGTCC-3’ | Integrated DNA Technologies | N/A |
| mPomc.S: 5’-ATGCCGAGATTCTGCTACAGT-3’ AS: 5’-TCCAGCGAGAGGTCGAGTTT-3’ | Integrated DNA Technologies | N/A |
| mS14.S: 5’-TGGTGTCTGCCACATCTTTGCATC-3’ AS: AGTCACTCGGCAGATGGTTTCCTT | Integrated DNA Technologies | N/A |
| mMrgpra1 | ThermoFisher | Assay ID: Mm01984314 |
| mNpffr1 | ThermoFisher | Assay ID: Mm01176033 |
| mNpffr2 | ThermoFisher | Assay ID: Mm00500040 |
| mTacr1 | ThermoFisher | Assay ID: Mm00436892 |
| mIrf1 | ThermoFisher | Assay ID: Mm01288580 |
| mIrf2 | ThermoFisher | Assay ID: Mm00515206 |
| mCxcl10 | ThermoFisher | Assay ID: Mm00445235 |
| mIl12a | ThermoFisher | Assay ID: Mm00434169 |
| mChil3 | ThermoFisher | Assay ID: Mm00657889 |
| mArg1 | ThermoFisher | Assay ID: Mm00475988 |
| Software and algorithms | ||
| Biorender | Biorender | www.biorender.com |
| FlowJo v10.9.0 | BD/Tree Star Inc. | https://www.flowjo.com/solutions/flowjo |
| GraphPad Prism v10 | Prism | www.graphpad.com |
| ChEA3 - ChIP-X Enrichment Analysis Version 3 | Keenan et al.25 | https://maayanlab.cloud/chea3/ |
| fastp v0.2 | Chen et al.77 | https://github.com/OpenGene/fastp |
| Salmon v1.1 | Patro et al.78 | https://github.com/COMBINE-lab/salmon |
| DEseq 2 v1.34 | Love et al.79 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| Seurat v4 | Hao et al.80 | https://satijalab.org/seurat/ |
| Bioconda | Gruning et al.81 | https://bioconda.github.io |
| Morpheus (heat map) | N/A | https://software.broadinstitute.org/morpheus |
| Harmony integration | Korsunsky et al.82 | https://github.com/immunogenomics/harmony |
| scDbFfinder | Germain et al.83 | https://bioconductor.org/packages/release/bioc/html/scDblFinder.html |
| Other | ||
| BD LSRII cell analyzer | BD Biosciences | N/A |
| MoFlo XDP cell sorter | Beckman Coulter | N/A |
| MA900 cell sorter | Sony | N/A |
| ABI StepOnePlus | ThermoFisher | N/A |
