Nrf2 activator Diethyl Maleate attenuates ROS mediated NLRP3 inflammasome activation in murine microglia

Abstract

Microglia are the tissue-resident immune cells of the central nervous system. As a part of the innate immune response, NLR Family Pyrin Domain Containing Protein 3 (NLRP3) inflammasome activation leads to cleavage of caspase-1 and triggers secretion of proinflammatory cytokines and may also result in pyroptotic cell death. Inflammasome activation plays a crucial role in inflammatory conditions; aberrant activation of inflammasome contributes to the pathogenesis of neurodegenerative diseases. Diethyl Maleate (DEM) is a promising antiinflammatory chemical to alleviate inflammasome activation. In this study, NLRP3 inflammasome was activated in N9 murine microglia via 1 µg/ml LPS (Lipopolysaccharide) for 4 h and 5 mM ATP (Adenosine 5′-triphosphate) for 1 h, respectively. We demonstrated that 1 h pretreatment of DEM attenuated NLRP3 inflammasome activation in microglial cells. Besides, mitochondrial ROS decreased upon DEM pretreatment in inflammasome-induced cells. Likewise, it ameliorated pyroptotic cell death in microglia. DEM is a potent activator of Nrf2 transcription factor, the key regulator of the antioxidant response pathway. Nrf2 has been a significant target to decrease aberrant inflammasome activation through the antioxidant compounds, including DEM. Here, we have shown that DEM increased Nrf2 translocation to the nucleus, resulting in Nrf2 target gene expression in microglia. In conclusion, DEM is a promising protective agent against NLRP3 inflammasome activation.

Introduction

Inflammasomes are multi-protein complexes involved in the regulation of host innate immune responses and are composed of a pattern recognition receptor (PRR), an adaptor protein, and an effector protein (Song and Li 2018). NLRP3 inflammasome is well-characterized and essential for the maturation of proinflammatory cytokines IL-1β and IL-18 (Jo et al. 2016). Activation of NLRP3 inflammasome requires two steps: priming and activation (Haque et al. 2020). The first step of NLRP3 inflammasome activation leads to upregulation of NLRP3 expression along with proinflammatory cytokines (Man and Kanneganti 2015); followed by initiation of assembly of inflammasome complex (NLRP3, ASC, and caspase-1) and activation of pro-caspase-1 (Man and Kanneganti 2015) and cleavage of proinflammatory cytokines IL-1β and IL-18 into mature forms and subsequently, they are released to the environment, which in turn triggers a further inflammatory response. This response, overall, might result in pyroptosis, a type of inflammatory cell death (Guo et al. 2015).

Microglial cells are the phagocytic innate immune cells residing in the central nervous system (CNS) (Dubbelaar et al. 2018); acting as a first-line defense mechanism during development and disease (Prinz et al. 2019). Activation of NLRP3 inflammasome in microglia is involved in many diseases, including Alzheimer’s disease and Multiple Sclerosis (He et al. 2016). NLRP3 inflammasome is activated by a wide range of stimuli; therefore, understanding the machinery of NLRP3 inflammasome and intrinsic regulation of the mechanism is considerably vital in potential NLRP3-targeted therapies in CNS disorders (Swanson et al. 2019).

Diethyl Maleate (DEM) is an electrophilic reagent (Kobayashi et al. 2016) with the C₈H₁₂O₄ molecular formula and formula weight 172.18 g/mol (Sigma-Aldrich) and categorized as an Nrf2 (Nuclear factor-erythroid-2-related factor 2) activator (Harada et al. 2011). The antiinflammatory effect of DEM has been previously demonstrated by several studies both in vitro and in vivo. (Nathens et al. 1996; Kang et al. 1999; Kano et al. 2019). Nrf2 activating compounds are effective in preventing aberrant inflammasome activation and inflammation; hence, their antiinflammatory characteristics make them significant potential therapeutic agents (Hennig et al. 2018). Overall, DEM is a promising compound since it decreases proinflammatory cytokine production. However, DEM has yet to be discovered to repress NLRP3 inflammasome activation. In this study, we have shown that NLRP3 inflammasome activation is ameliorated by DEM pretreatment.

Since DEM is an Nrf2 activator, it has also been shown that DEM increases levels of proteins with antioxidant properties (Harada et al. 2011). Nrf2 is a member of cap ‘n’ collar (CNC) family of basic-region leucine zipper (bZIP) transcription factors (Silva-Islas and Maldonado 2018; Tonelli et al. 2018). Nrf2 is localized within the cytoplasm of cells and is tightly regulated by Keap1 (Kelch-like ECH-associated protein 1) (Ulasov et al. 2022), which is an E3 ubiquitin ligase adaptor and sensitive to redox changes (Tonelli et al. 2018). Keap1 homodimer KELCH domains are in contact with ETGE and DLG motifs of Nrf2 in the cytosol (Ahmed et al. 2017). Under homeostatic conditions, Keap1 suppresses Nrf2 transcriptional activity through ubiquitination, leading to continuous proteasomal degradation of Nrf2 (Ahmed et al. 2017). In oxidative stress conditions or the presence of electrophilic and Nrf2 activating compounds, the Nrf2-Keap1 complex interaction is disrupted; therefore, Nrf2 degradation is prevented (Silva-Islas and Maldonado 2018). Nrf2 is translocated into the nucleus, dimerizes with Maf proteins, and binds to the antioxidant response elements (ARE), leading to transcriptional activation of its target genes (Tonelli et al. 2018). Nrf2-dependent antioxidant genes, namely HO-1(heme oxygenase-1), Nqo1 (NAD(P)H:quinone oxidoreductase 1), Gclc (glutamate cysteine ligase catalytic subunit), and Gclm (glutamate cysteine ligase regulatory subunit), suppress the expression of inflammatory proteins such as TNF-α at both mRNA and protein levels (Ahmed et al. 2017). Once activated, Nrf2 and downstream pathways suppress inflammation by binding to the regulatory element of proinflammatory cytokine genes and downregulating their expression (Kobayashi et al. 2016; Robertson et al. 2020).

In the present study, we found that DEM alleviated NLRP3 inflammasome activation and pyroptotic cell death in LPS and ATP-induced murine N9 microglial cell line. Additionally, DEM attenuated mitochondrial ROS production, which is an important inducer of NLRP3 inflammasome. Furthermore, we showed that DEM increased Nrf2 nuclear translocation and subsequent activation of its target genes in microglia.

Materials and methodology

Chemicals and reagents

DEM and adenosine 5′-triphosphate (ATP) disodium hydrate were obtained from Sigma-Aldrich (St. Louis, USA), and LPS (0111: B4) was purchased from InvivoGen (San Diego, USA). Fetal bovine serum (FBS), RPMI 1640 cell culture media, l-Glutamine, penicillin/streptomycin, phosphate-buffered saline (PBS), and trypsin/EDTA were purchased from (Sigma-Aldrich, USA).

Cell culture and treatment

N9 mouse microglial cell line, provided by Dr. Paola Ricciardi-Castagnoli (Toscana Life Sciences Foundation, Siena, Italy) (Righi et al. 1989) was used in this study. N9 microglia cell line originates from the mouse brain and is known to be similar to primary mouse microglia in many aspects (Stansley et al. 2012). N9 cells are able to both produce and secrete cytokines in response to stimulation via LPS (Timmerman et al. 2018). Maintenance of N9 cells was accomplished via RPMI 1640 medium supplemented with 10% Fetal Bovine Serum (FBS), %1 (2 mM) l-Glutamine, %1 (100 U/ml) Penicillin and 100 µg/ml Streptomycin (P/S) under 37 °C and 5% CO₂ incubation conditions. The experiments were held with RPMI 1640 medium without P/S or FBS. Prior to inflammasome activation via LPS and ATP (LA), N9 cells were treated via 50, 100 and 250 µM doses of Diethyl Maleate for 1 h. Next, cells were treated via ultra-pure LPS (1 µg/ml) for 4 h, followed by 1 h incubation with 5 mM ATP (DLA).

PrestoBlue viability assay

PrestoBlue™ Cell Viability Reagent (Invitrogen, USA) was used to detect cytotoxicity of doses of DEM. First, microglial cells were pretreated with DEM with 0, 25, 250, 500 and 1000 µM concentrations for 1 h. Next, the cells were treated with cell medium for 5 h to complete our 6 h treatment model, and the assay was performed according to the manufacturer’s instructions.

ELISA

N9 cells were treated with DEM, LPS and ATP via the conditions mentioned earlier, and levels of IL-1β proinflammatory cytokine were measured using Quantikine ELISA Mouse IL-1β Immunoassay KIT (R&D Systems, USA) according to the manufacturer’s protocol.

Quantitative RT-PCR

Total RNA from N9 cells treated via DEM, LPS and ATP was extracted by using MN DNA, RNA and protein purification kit (MACHEREY-NAGEL, Germany) according to the manufacturer’s instructions. RNA concentrations of samples were determined via Nanodrop spectrophotometer and cDNA synthesis was performed by HighCapacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo, USA) using 2 µg of total RNA. Quantitative real-time PCR (qPCR) was performed using SYBR-Green GoTaq qPCR Master Mix (Promega, USA) and LightCyclerR480 Instrument II (Roche Life Science, USA) according to the manufacturer’s protocol. The list of primers is given in Table 1. For normalization of mRNA data, endogenous Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The 2^−ΔCt formula was used to determine relative expression levels.

Table 1.

List of primers

IL-1β	F R	GTGCTCATGTCCTCATCCTG CACAGCAGCACATCAACAAG
NLRP3	F R	TGCCTGTTCTTCCAGACTGGTGA CACAGCACCCTCATGCCCGG
HO-1	F R	GAGACGGCTTCAAGCTGGTGATG GTTGAGCAGGACGCAGTCTTGG
Nqo1	F R	CTGAGGCAGGAGAATTGCTGGAACC GCCTAGCACAAGTACCACTCTTGGTC
Gclm	F R	TTGGCTTAGGCATCAGGGTG TGTGGTGAGTCCAACTGAGC
Gclc	F R	GGCTCTCTGCACCATCACTT TCTGACACGTAGCCTCGGTA
GAPDH	F R	ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA

Western blotting

Following the treatment of cells, total proteins were lysed via RIPA lysis buffer. To investigate the nuclear translocation of Nrf2, NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific, USA) were used according to the manufacturer’s protocol to extract nuclear proteins. All extracted proteins were stored at − 80 °C. For Western blotting, equal amounts of proteins were loaded and separated with SDS-PAGE and were transferred onto polyvinylidene fluoride (PVDF) membranes (Sigma-Aldrich, USA). The membranes were blocked via bovine serum albumin (BSA) or milk with the required percentages in accordance with the used antibody. Within Tris-buffered saline containing 0.05%Tween-20 (TBS-T), membranes were incubated overnight at 4 °C with primary and secondary antibodies of proteins of interest according to the manufacturer’s protocol. Antibodies are given in Table 2. The antigen-antibody complex was detected by chemiluminescence using the Supersignal West Dura ECL reagent (Thermo Scientific, USA), and images were captured. Afterward, the band densities were analyzed and normalized to β-actin and Lamin A/C as the loading controls.

Table 2.

List of primary and secondary antibodies

NLRP3	Adipogen	Ag-20b-0014-c100
Nrf2	Cell signaling	12,721
β-actin	Abcam	Ab-8727
Lamin A/C	Santa Cruz	sc-20,681
Anti-rabbit	Cell signaling	Cst-7074
Anti-mouse	Cell signaling	Cst-7076

Caspase-1 activity assay

Following the treatment, Caspase-1 activity was determined via luminometric Caspase-Glo-1 Inflammasome Assay (Promega, USA) according to the manufacturer’s protocol. The treated samples were measured with Centro XS₃ lb 960 microplate luminometer (Berthold Technologies, Germany).

Lactate dehydrogenase (LDH) activity assay

The release of LDH from N9 microglial cells was determined by Cytotoxicity Detection Kit (Roche, Germany) according to the manufacturer’s protocol. Cytotoxicity was determined using a Varioskan microplate reader (Thermo, USA) at 492 nm with a reference wavelength of 630 nm. Calculations were performed by the following formula:

$$\text{Cytotoxicity}=\left(\text{ODSample}-{\text{OD}}_{\text{LowControl}}\right)/\left({\text{OD}}_{\text{MaximalRelease}}-{\text{OD}}_{\text{LowControl}}\right)\ast \text{1}00$$

Propidium iodide staining

Microglial cells were treated with DEM, LPS and ATP. Following the treatment, the cells were treated with Propidium Iodide (PI) Stain (Sigma-Aldrich, USA) (50 µg/ml) and incubated for up to 20 min at 37 °C. The PI-positive cells were imaged via fluorescent microscope Olympus IX-71 (Olympus, Japan). PI positive and total cells were counted via ImageJ.51n software and data were demonstrated as a percentage of total cells.

Detection of mitochondrial ROS

Mitochondrial ROS was detected via MitoSOX™ Red mitochondrial superoxide indicator (Molecular Probes, Invitrogen, USA) after the treatment of 1 × 10⁴ cells/96-well plate well via DEM, LPS and ATP. 5 µM MitoSOX dye was added onto cells, and incubated for 15 min at 37 °C and 5% CO₂. The absorbances of the samples were determined via microplate reader Varioskan Flash (Thermo Scientific, USA). Additionally, fluorescence images of the treated cells were taken via an inverted fluorescent microscope Olympus IX-71 (Olympus, Japan).

Statistical analysis

For each experiment, GraphPad Prism 6.0 (GraphPad Software Inc., CA, USA) was used for data analysis and presented as means ± SEM. Comparisons between treated cells and untreated control cells were analyzed using the Mann–Whitney U test, p values < 0.05 were considered statistically significant.

Results

DEM decreased inflammasome-induced IL-1β at both mRNA and protein levels

Firstly, the influence of DEM on the viability of microglial cells was investigated by using various doses of DEM (25-1000 µM), and no significant effect was determined (Fig. 1a). A previous study showed that 100 μm DEM suppressed the increased IL-1β mRNA expression by LPS administration, which is one of the inflammasome inducers (Kobayashi et al. 2016). Therefore, we continued with DEM at 50, 100 and 250 µM doses which are close to suppressing IL-1 β expression. The effect of DEM pretreatment on microglial NLRP3 inflammasome activation was investigated. To evaluate IL-1β mRNA expression and secretion, we performed RT-qPCR and ELISA, respectively. Proinflammatory cytokine IL-1β mRNA expression and IL-1β protein secretion were strongly increased upon LPS and ATP treatment. DEM pretreatment resulted in a significant downregulation in IL-1β mRNA expression and also IL-1β secretion compared to LPS and ATP-induced cells (Fig. 1b, c). As evidenced by our data, DEM ameliorates NLRP3 inflammasome activation.

Fig. 1.

DEM Decreased IL-1β on Both mRNA and secreted protein Levels. DEM reduced mRNA and protein levels of IL-1β. N9 microglial cells were pretreated with DEM (50, 100, and 250 µM) for 1 h, thereafter treated with LPS (1 µg/ml) for 4 h and ATP (5mM) for 1 h. a The viability of varying concentrations of DEM was investigated. b mRNA level of IL-1β decreased upon DEM pretreatment in comparison with inflammasome-induced cells by LPS + ATP. c Dose-dependent inhibitory effect of DEM on secreted IL-1β cytokine was measured with ELISA. Data are presented as mean ± SEM, n = 5. *p < 0.05, **p < 0.01 compared to control and ^#p < 0.05, ^##p < 0.01 compared to LPS and ATP-induced cells

DEM decreased inflammasome-induced caspase-1 activity and NLRP3 levels

As IL-1β cytokine expression and secretion are dependent on inflammasome-induced caspase-1 activation, we further elucidated Caspase-1 activity via commercial Caspase-1 activity assay. DEM pretreatment at 250 µM dose significantly reduced LPS and ATP-induced Caspase-1 activity in microglia by 1.9-fold compared to LPS and ATP-induced cells (Fig. 2a). Consistently, NLRP3 mRNA expression was upregulated by 5.5-fold upon LPS and ATP treatment, while DEM restrained inflammasome-induced transcription of NLRP3 mRNA (Fig. 2b). Likewise, DEM pretreatment resulted in a 1.8-fold decrease in upregulated NLRP3 protein expression by LPS and ATP (Fig. 2c, d).

Fig. 2.

DEM Decreased Caspase-1 activity; and NLRP3 on both protein and mRNA levels. N9 microglial cells were pretreated with DEM (50, 100, and 250 µM) for 1 h, thereafter treated with LPS and ATP. a DEM pretreatment reduced caspase-1 activity compared to LPS and ATP-induced cells. b DEM pretreatment suppressed NLRP3 mRNA levels in comparison with inflammasome-induced cells by LPS + ATP in 50, 100, and 250 µM doses. c, d DEM pretreatment decreased NLRP3 protein level in comparison with inflammasome-induced cells by LPS + ATP on protein level. Data are presented as mean ± SEM, n = 5. *p < 0.05, **p < 0.01, ****< 0,0001 compared to control and ^#p < 0.05, ^##p < 0.01 compared to LPS and ATP-induced cells

DEM decreased inflammasome-induced pyroptotic cell death

NLRP3 inflammasome activation results in inflammatory cell death, pyroptosis in microglia. We examined cell death upon LPS and ATP treatment and the effect of DEM on cytotoxicity by LDH cytotoxicity assay and PI staining of cells. While cell death detected by LDH toxicity assay was %15.1 in LPS and ATP-induced cells, DEM pretreatment significantly decreased cell cytotoxicity caused by inflammasome activation in LPS and ATP-induced microglia. Additionally, when compared to the control group, PI-positive cells were significantly upregulated upon LPS and ATP-induced inflammasome activation. PI staining of cells further revealed that DEM pretreatment significantly reduced the PI-positive cell ratio in inflammasome-induced microglia (Fig. 3a–c). Taken together, our findings demonstrate that DEM pretreatment evidently suppressed cell cytotoxicity caused by inflammasome activation.

Fig. 3.

DEM Decreased Pyroptotic Cell Death. N9 microglial cells were pretreated with DEM (50, 100, and 250 µM) for 1 h, and thereafter treated with LPS and ATP. a DEM pretreatment impeded pyroptotic cell death. b, c DEM pretreatment reduced pyroptotic cell death and decreased PI-positive cells in comparison with inflammasome-induced cells by LPS + ATP. Data are presented as mean ± SEM, n = 5. *p < 0.05, **p < 0.01 compared to control and ^#p < 0.05, ^##p < 0.01 compared to LPS and ATP-induced cells. Scale bar 200 μm. LA: LPS and ATP, DLA: DEM, LPS and ATP

DEM prevented inflammasome-induced mitochondrial ROS production

To define the effect of DEM treatment on mitochondrial ROS production, we performed MitoSOX staining. We observed that LPS and ATP treatment increased ROS levels upon inflammasome induction by LPS and ATP, while DEM pretreatment resulted in a significant decrease when compared to inflammasome-induced mitochondrial ROS production (Fig. 4a, b) in a dose-dependent manner.

Fig. 4.

DEM Prevented Mitochondrial ROS production and induced Nrf2 nuclear translocation. N9 microglial cells were pretreated with DEM (50, 100, and 250 µM) for 1 h, and thereafter treated with LPS and ATP. a, b DEM pretreatment reduced mitochondrial production of ROS in comparison with inflammasome-induced cells by LPS + ATP. c, d DEM pretreatment induced Nrf2 nuclear translocation against LPS + ATP treatment of cells. e DEM significantly induced mRNA expressions of Nrf2 target genes HO-1, Nqo1, Gclm and Gclc. Lamin A/C was used as the loading control. Data are presented as mean ± SEM, n = 5. ****< 0,0001 compared to control and ##p < 0.01, ###p < 0,001 compared to LPS and ATP-induced cells. Scale bar 50 μm. LA: LPS and ATP, DLA: DEM, LPS and ATP

DEM-induced nuclear translocation of Nrf2

DEM is a well-known activator of Nrf2. To gain insight into the effects of DEM, we investigated the nuclear translocation of the Nrf2 transcription factor. We demonstrated that DEM pretreatment significantly enhanced translocation of Nrf2 to the nucleus by 4.8-fold in comparison to LPS and ATP-induced cells (Fig. 4c, d). We further confirmed the effect of Nrf2 translocation on Nrf2 target gene expression, which are HO-1, Nqo1, Gclm, and Gclc genes. According to our analysis, Nrf2 target gene expressions are strongly upregulated upon DEM pretreatment when compared to LPS and ATP inflammasome-induced cells (Fig. 4e). As shown, DEM activates the Nrf2 pathway and attenuates inflammatory effects of NLRP3 inflammasome activation.

Discussion

The knowledge of NLRP3 inflammasome in innate immunity (Zhou et al. 2011) and aberrant NLRP3 inflammasome activation resulting in prolonged inflammation (Mamik and Power 2017); contributing to the pathogenesis of neurodegenerative disorders is well-established (Heneka et al. 2013; Holbrook et al. 2021). Therefore, in order to ameliorate the NLRP3 inflammasome activation, targeting this mechanism is of great importance (Mangan et al. 2018). In this study, we have demonstrated that DEM strongly ameliorated LPS and ATP-induced NLRP3 inflammasome activation and pyroptotic cell death in the N9 murine microglial cell line. In addition, mitochondrial ROS production was also attenuated upon DEM pretreatment. Furthermore, we showed that DEM, as an Nrf2-activator, increased Nrf2 nuclear translocation and subsequent activation of its target genes.

DEM is a promising agent with antiinflammatory and antioxidant effects. There is a limited number of studies related to the effects of DEM on inflammation, while no study has been conducted regarding the effects of DEM on NLRP3 inflammasome activation. DEM pretreatment was demonstrated to strongly reverse the effects of LPS induction in lungs and prevent further inflammation, resulting in reduced TNF-α levels in rats (Nathens et al. 1996). Furthermore, DEM exerted an antiinflammatory characteristic and prevented liver injury in a rat endotoxemia model. TNF-α expression and secretion were considerably decreased upon DEM treatment (Jones et al. 1999). It was demonstrated that serum IL-1β levels were decreased upon DEM treatment in LPS-treated mice. Also, DEM was shown to repress iNOS expression in LPS-induced macrophages in endotoxic animal models. It was suggested that this repression is through the inhibition of NO synthase, an essential regulator of inflammation (Kang et al. 1999). Proinflammatory IL-1β, IL-6 and IL-1α mRNA levels were suppressed upon DEM treatment in LPS-induced bone marrow-derived macrophages from mice and in human monocytic THP1 cells. In agreement with these results, IL-1β and IL-6 cytokine secretion was suppressed upon DEM treatment (Kobayashi et al. 2016).

Although no studies have revealed antiinflammatory effects of DEM in microglia, pretreatment of cells with DEM decreased NF-kB activation in LPS-treated astrocytes, which are partly involved in brain inflammatory responses (Kano et al. 2019). Here, we demonstrated that LPS and ATP-induced NLRP3 inflammasome activation in microglia were ameliorated with DEM in a dose-dependent manner.

Pyroptosis is a proinflammatory type of cell death that is caused by inflammasome activation (Voet et al. 2019). It is known that LPS and ATP induce pyroptotic cell death in N9 murine microglia (Tufekci et al. 2021). To the best of our knowledge, there are no studies demonstrating the effect of DEM on pyroptotic cell death. However, DEM decreased cell death types necrosis and apoptosis in LPS-treated rodents (Jones et al. 1999). In our study, we have shown that DEM strongly attenuated pyroptosis in LPS and ATP-induced microglia.

ROS is one of the main inducers of NLRP3 inflammasome activation (Yu and Lee 2016) due to mitochondrial dysfunction (Sarkar et al. 2017). This particular impairment of mitochondrial functioning and disruption of membrane integrity further contribute to neurodegeneration, and also provide potential targets in order to decrease inflammasome activation (Sarkar et al. 2017). It was shown that LPS-induced increase in ROS level was alleviated upon DEM treatment in bone marrow derived macrophages (Kobayashi et al. 2016). In our study, we elucidated the effect of DEM on cellular ROS. Our findings have shown for the first time that DEM pretreatment reversed the increased ROS levels in LPS and ATP-induced microglia.

Several studies suggested that Nrf2 activators are potent compounds to decrease ROS levels and alleviate activation of NLRP3 inflammasome as Nrf2 has a major role in cellular response to oxidative stress; besides, decreases neuroinflammation (Ahmed et al. 2017; Zhang et al. 2021; Satoh et al. 2022). As a known Nrf2 inducer, DEM is a potent compound to decrease inflammation through alleviating the NLRP3 inflammasome. DEM induces Nrf2 by modifying cysteine residues of Keap1 and enhances Keap1 degradation (Taguchi and Yamamoto 2020; Krafczyk and Klotz 2022). DEM interacts with Cus151 residue of Keap1 to alter its interaction with Nrf2, resulting in Nrf2 release (Krafczyk and Klotz 2022). DEM was previously reported to increase Nrf2 levels in RAW264.7 cells by interfering with reactive cysteine residues of Keap1 (Iso et al. 2016) and induce its target HO-1 in macrophages (Ishii et al. 2000). Along with enhancing Nrf2 accumulation in the nucleus, basal cytoplasmic Nrf2 levels are increased as well. It was shown that DEM treatment resulted in increased Nrf2 accumulation and upregulated the expression of the Nrf2 target gene Nqo1 in bone marrow-derived macrophages in mice (Kobayashi et al. 2016). Also, Nrf2 target gene HO-1 mRNA expression was increased in human peripheral blood-derived macrophages upon DEM treatment (Harada et al. 2011). Here, we have shown for the first time the nuclear accumulation of Nrf2 in N9 murine microglia upon DEM pretreatment. Furthermore, we demonstrated that in LPS and ATP-induced microglia, DEM pretreatment resulted in nuclear translocation of Nrf2 and reversed the Nrf2 decreasing effect of inflammasome activation. Moreover, we determined that DEM pretreatment resulted in a significant increase in mRNA levels of Nrf2 target genes HO-1, Nqo1, Gclm, and Gclc. Therefore, DEM is a promising agent to use against aberrant activation of NLRP3 inflammasome in microglia.

Nrf2-NF-κB crosstalk enables homeostatic conditions where activation of the NF-κB (nuclear factor-κB) transcription factor, which is a major regulator of proinflammatory response, induces Nrf2 activity. In turn, Nrf2 prevents NF-κB activation, thus, decreases inflammation (Cuadrado et al. 2014). Our data suggests that DEM attenuates NLRP3 inflammasome activation and increases Nrf2 activity against LPS and ATP treatment. Given that it was shown that DEM alleviated activation of NF-κB in astrocytes (Kano et al. 2019), DEM might exert its inflammasome inhibitory effect through interfering in the NF-κB pathway.

Conclusion

In summary, we demonstrated for the first time that DEM ameliorates NLRP3 inflammasome activation in murine microglia. It is well known that the presence of aberrant NLRP3 inflammasome activation contributes to the pathogenesis of neurodegenerative diseases (Mamik and Power 2017). Although further in vivo studies are required to fully understand the effect of DEM in the brain, the presented results shed new light on the mechanisms of antiinflammatory effects of DEM in microglia.

Abbreviations

ARE

Antioxidant response element

ATP

Adenosine 5′-triphosphate

ASC

Apoptosis-associated speck-like protein containing a CARD

bZIP

Basic-region leucine zipper

CNC

Cap “n” collar

CNS

Central nervous system

DEM

Diethyl Maleate

Gclc

Glutamate cysteine ligase catalytic subunit

Gclm

Glutamate cysteine ligase regulatory subunit

HO-1

Heme oxygenase-1

Keap1

Kelch-like ECH-associated protein 1

LPS

Lipopolysaccharide

NF-κB

Nuclear factor-κB

NLRP3

NLR family pyrin domain containing protein 3

Nqo1

NAD(P)H:quinone oxidoreductase 1

Nrf2

Nuclear factor-erythroid-2-related factor 2

PRR

Pattern recognition receptor

ROS

Reactive oxygen species

Author contributions

CK and CPG conceived the study, performed the experiments. CK analyzed and interpreted the data and wrote the manuscript. SG conceived the study, interpreted the data, and edited the manuscript.

Funding

The authors declare that no funds or grants were received during the preparation of this manuscript.

Declarations

Conflict of interest

The authors have no conflict of interest.

Research involving human and animal rights

This article does not contain any studies with human participants or animals performed by any of the authors.