Abstract
Corms of Gladiolus grandiflorus cv. “White Prosperity” was irradiated via red laser at wavelength 635 nm. Various morphological, flowering, elemental and chemical characterizations were studied. Irradiation with different power (5, 20, and 50 mW) and various irradiation time (0.0, 0.5, 1, 3, 5 and 10 min) was studied. Several characters), totaletermined include vegetative growth parameter (spouting days, plant height (cm), leaves number, leaves fresh and dry weights (g/plant), diameter of plant middle part (mm) and leaf area (cm2), floral parameters (flowering days, vase life (day), fresh and dry weights of inflorescence (g/plant), number of flowers per inflorescence, inflorescence length(cm), flowers diameter(cm), number of corms per plant, corms fresh weight(g/plant), circumference/ corms), pigments [total chlorophylls in leaves (SPAD), anthocyanin content (mg/100 g F.W.) in petals], NPK (%) in new corms and chemical composition in corms; total carbohydrates (%),total phenol (μg CE/g (%),total flavonoid (μg CE/g) (%), antioxidant (DPPH IC50 (μg /ml (%), and proline content (μ moles/g). The results showed that the medium level (20 mW) of He–Ne laser at 5 min caused favorable changes in the leaf anatomical structures and other studied characters followed by the low level (5 mW) of He–Ne laser at 5min. 112 bands emerged from 22 SSR primers, ranging between 130 and 540 bp, with 32 bands having polymorphism ranging from 17–100%. Out of the 22 SSR primers, 3 primers exhibited a high polymorphism percentage, i.e., SSR6, SSR16 and SSR22 which exhibited 7 positive markers. These findings revealed the efficiency of SSR primers for differentiating gladiolus plants and revealed that some alleles were affected by laser in their corms and the expression resulted in color or abnormalities in leaves and/or flowers. Mutation in some alleles could result in abnormalities like mutation in the allele with 410 bp revealed by SSR16.
Keywords: Gladiolus grandifloras, He–Ne, Anatomical structures, SSR marker, Genetics of gladiolus
Subject terms: Biological techniques, Biotechnology, Genetics, Plant sciences
Introduction
Gladiolus is derived from the native plants of South and Central Africa, as well as the Mediterranean region. It belongs to the family Iridaceae. Gladiolus is an economic flowering bulb plant used as a landscape plant in home gardens and in decoration as a lovely and rich-colored cut flower spike with a relatively long vase life1.
Flowers create a motivating, pleasing, colorful and fragrant environment for people, also they are used to decorate houses, offices, and to complete ceremonies as purpose friendships, and marriage. Additionally, gladiolus is used for making perfumes, medicine, essential oil, and other cosmetics purposes2.
Laser is one of the most advanced and successful physical techniques used recently to bio-stimulate seeds and vegetative parts of plants. The term “LASER” is an acronym for “Light Amplification by Stimulated Emission of Radiation,” and it refers to a technology that produces coherent monochromatic light beams with specific optical characteristics, such as intensity, emission wavelength, beam divergence, these beams interact with plant cells, which absorb and store radiant energy3. The synergism between the polarized monochromatic laser beams and photoreceptors forms was the basis of the laser stimulation mechanism in plant's physiological development. Considerable studies support the bio-stimulating effect of laser on various plant tissues and organs. Plants utilize their photoreceptors to absorb light and regulate all phases of a plant's growth4. Radiation has been used for inducing mutations and examining the variability that can be obtained through mutation breeding, flowers are now brighter and deeper in hue5. Several beneficial effects, including stimulation of plant growth during all stages of vegetation, such as shorthand the time needed for germination and flowering, increase in the number of flowers per plant, qualitative and quantitative increase in yield, etc., were achieved by irradiating seeds and other plant parts6,7. Many factors affect the way laser radiation works, including the wavelength used, exposure period, power, dosage, and irradiation technique (constant or pulse)8. The primary effect of laser irradiation after absorption shows thermal and electromagnetic effects9.
Targeted genes related to various traits were genotyped, barcoded, and their gene expression is assessed using molecular markers10–12. To determine the gene expression and QTLs in plants, markers including amplified fragment length (AFLP), simple sequence repeats (SSR), and start codon targeted marker (SCoT) are utilized7,13–17. This method has advantages over all others since it is less expensive, more efficient, easier to use, quicker, and more easily reproducible18. One of the most popular molecular markers in plant breeding and genetic diversity are SSR markers, commonly known as microsatellites Due of their co-dominant inheritance, high repeatability, high polymorphism, and multi-allelic nature, SSRs are the ideal marker system19. The simplest and most affordable source for SSR production is chloroplast SSR (cpSSR), which are frequently employed to evaluate the genetic diversity of Gladiolus12,20,21. To achieve the needed genetic variability in a variety of ornamental plant species, irradiation with diverse types of radiation has been applied7,17. Commercially, ornamental plants are admired and in high demand because they have a wide range of floral colors and consistent shapes. In comparison to the control plant, a high number of mutations produced by irradiation technology assist in introducing new, improved variations22,23.
No recorded data are available on laser irradiation effect on gladiolus. Therefore, the aim of this research is to investigate the effect of He–Ne laser irradiation on Gladiolus grandiflorus cv. “White Prosperity” and response of growth, quality characteristics, genetic attributes, and anatomy of gladiolus when exposed to red laser light.
Results
Vegetative growth characters
Data in Tables 1 and 2 showed that treated gladiolus corms with three laser power levels (5, 20, and 50 mW) resulted significantly increase in the studied growth parameters, (plant height, number of leaves/plant, leaf area, fresh and dry weight of leaves (g)/plant) compared with control. The best results were obtained after irradiation with medium power at 20 mW for 5 min. This treatment gave significantly higher plants (117.2 cm) than the control plants 68.33 cm) in both seasons (Table 2). The best results for the number of leaves per plant (L/p) were recorded at 20 mW for 5 min irradiation (13 L/p) in comparison with the other treatments. Additionally, it was detected that, treating corms of Gladiolus plants with 20 mW for 5 min was more effective than other used combinations of powers and irradiation timing on fresh weight (46.13 g/plant) and dry weights (18.9 g/ plant) of leaves per plant in both seasons as compared to control. Also, the highest leaf area (107.450 cm2) and diameter of plant middle part (57.28 mm) were recorded in 20 mW for 5 min irradiation compared to control (Table 2). All previously mentioned growth characters increased with increasing both power and exposure times except high power (50 mW) irradiation with long irradiation time (10 min).
Table 1.
Mean square for the effect of He–Ne Laser (L), irradiation time (T) and their interaction on vegetative growth parameters of (Gladiolus grandiflorus L.) cv.”White Prosperity”.
| Traits | Source of variation | Error | Cv | ||
|---|---|---|---|---|---|
| Treatment | |||||
| He–Ne Laser(L) | irradiation time (T) | L × T | |||
| Days to corms sprouting | 229.34*** | 4.82*** | 10.08*** | 0.693 | 7.09 |
| Plant height (cm) | 2178.62*** | 285.38*** | 125.50*** | 2.932 | 1.973 |
| N. of leaves/plant | 33.48*** | 6.83*** | 1.44*** | 0.271 | 5.333 |
| FW of leaves (g/plant) | 1516.04*** | 106.72*** | 25.03*** | 0.669 | 2.411 |
| DW of leaves (g/plant) | 152.89*** | 13.37*** | 3.25*** | 0.173 | 3.270 |
| Diameter of middle part of plant (mm) | 407.78*** | 12.77*** | 9.42*** | 0.834 | 1.803 |
| Leaf area (cm2) | 4904.14*** | 219.10*** | 135.08*** | 1.520 | 1.517 |
| Days to flowering | 1099.72*** | 69.96*** | 97.53*** | 2.600 | 1.82 |
| No.floLets/spike | 15.533*** | 9.000*** | 2.714*** | 0.171 | 4.43 |
| florlets dimater(cm) | 72.66*** | 6.64*** | 4.306*** | 0.544 | 7.06 |
| spike length (cm) | 1901.54 | 105.71 | 38.89 | 4.671 | 5.35 |
| FW of flower (g/ plant) | 2777.63*** | 262.09*** | 118.1*** | 1.570 | 2.05 |
| DW of flower (g/plant) | 51.95*** | 34.18*** | 6.20*** | 0.608 | 4.91 |
| Vase life (days) | 28.533*** | 3.058*** | 2.27*** | 0.434 | 6.74 |
| N. of corms/plant | 435.76*** | 131.75*** | 67.05*** | 0.655 | 5.80 |
| FW of corms (g/plant) | 760.57*** | 582.02*** | 296.49*** | 1.785 | 3.73 |
| Circumference/corms | 131.42*** | 5.60*** | 5.25*** | 0.145 | 3.69 |
*, **, *** significant at P ≤ 0.05, P ≤ 0.01, P ≤ 0.001, respectively.
Table 2.
Vegetative growth characteristics (Gladiolus grandiflorus L.) cv.”White Prosperity” affected by the interactions between He–Ne Laser mW and different irradiation time during mean of seasons 2022/ 2023.
| He–Ne laser (L) | Irradiation time (min) | Days to spourting | Plant height (cm) | N. of leaves/plant | FW of leaves (g/plant) | DW of leaves (g/plant) |
|---|---|---|---|---|---|---|
| Control | 0.5 | 16.00 ± 0.57 cd | 68.33 ± 1.02 k | 7.17 ± 0.33 h | 17.75 ± 0.56 m | 7.11 ± 0.15 m |
| 1 | 17.33 ± 0.33 bc | 68.67 ± 0.17 jk | 7.50 ± 0.29 h | 19.48 ± 0.16 l | 8.39 ± 0.56 l | |
| 3 | 16.33 ± 0.17 cd | 69.83 ± 0.45 jk | 8.00 ± 0.50 gh | 20.66 ± 0.26 kl | 7.78 ± 0.09 lm | |
| 5 | 19.17 ± 0.33 a | 71.67 ± 0.62 j | 7.67 ± 0.17 h | 21.47 ± 0.20 k | 9.11 ± 0.02 k | |
| 10 | 18.67 ± 0.67 ab | 71.67 ± 0.73 j | 8.67 ± 0.17 fg | 20.87 ± 0.15 k | 9.10 ± 0.45 k | |
| 5 mW | 0.5 | 15.33 ± 0.93 d | 81.00 ± 0.58 i | 8.67 ± 0.45 fg | 24.58 ± 0.71 j | 10.9 ± 0.20 j |
| 1 | 11.00 ± 0.76 e | 87.67 ± 1.67 gh | 10.5 ± 0.50 cd | 34.27 ± 1.00 h | 12.3 ± 0.32 hi | |
| 3 | 9.000 ± 0.02 hij | 97.33 ± 0.89 c | 10.5 ± 0.50 cd | 36.97 ± 0.91 g | 12.9 ± 0.17 gh | |
| 5 | 8.500 ± 0.77 ij | 86.50 ± 1.53 gh | 11.5 ± 0.02 bc | 40.63 ± 0.29 e | 14.5 ± 0.03 def | |
| 10 | 10.17 ± 0.33 efgh | 81.83 ± 0.33 i | 10.2 ± 0.17 d | 29.77 ± 0.07 i | 12.2 ± 0.21 i | |
| 20 mW | 0.5 | 10.50 ± 0.77 efg | 85.17 ± 0.33 h | 9.67 ± 0.17 de | 40.14 ± 0.33 e | 14.7 ± 0.25 cde |
| 1 | 10.83 ± 0.45 ef | 89.17 ± 2.35 fg | 11.3 ± 0.33 b | 43.02 ± 0.27 cd | 14.6 ± 0.24 cde | |
| 3 | 10.33 ± 0.67 efgh | 104.8 ± 1.92 b | 12.5 ± 0.29 a | 44.99 ± 0.61 ab | 15.2 ± 0.11 c | |
| 5 | 8.500 ± 0.02 ij | 117.2 ± 0.60 a | 13.0 ± 0.02 a | 46.13 ± 0.28 a | 18.9 ± 0.06 a | |
| 10 | 8.167 ± 0.33 ij | 93.67 ± 1.42 de | 10.3 ± 0.17 ef | 38.52 ± 0.16 f. | 14.0 ± 0.18 ef | |
| 50 mW | 0.5 | 8.167 ± 0.17 ij | 90.83 ± 0.44 ef | 9.00 ± 0.02 d | 38.42 ± 0.43 f. | 13.8 ± 0.36 f. |
| 1 | 9.500 ± 0.02 efgh | 93.33 ± 0.89 de | 9.83 ± 0.33 de | 42.26 ± 0.50 d | 14.2 ± 0.27 ef | |
| 3 | 8.000 ± 0.04 j | 95.50 ± 1.04 cd | 10.3 ± 0.33 d | 43.70 ± 0.47 bc | 16.2 ± 0.13 b | |
| 5 | 9.167 ± 0.17 ghij | 92.67 ± 0.44 de | 10.0 ± 0.29 d | 38.55 ± 0.32 f. | 14.9 ± 0.05 cd | |
| 10 | 10.17 ± 0.33 efgh | 88.67 ± 0.44 fg | 9.00 ± 0.02 ef | 36.42 ± 0.21 g | 13.1 ± 0.08 g |
Averages (means) in each column with the same letter (s) are not significantly different according to Steel et al., (1997) test with Bonferroni correction (p ≤ 0.05).
Days of sprouting
In the present work, investigations days done to study the influence of He–Ne laser irradiation on the number of the days required for sprouting, vegetative growthparameters, flowering parameters, chemical composition, leaves anatomy, genetic attributes. According to data presented in Table 2, it is noticed that the three laser power levels (5, 20, 50 mW) at the tested exposure times (0.5, 1, 3, 5 and 10 min.) significantly decrease the needed period for sprouts appearance compared to control group. In both seasons, early sprouting was detected using laser irradiation, while a long period for corm sprouting was observed in control plants (19 days).
The minimum number of days (8–9 days) needed for corms sprouting was observed in plants treated with 5mW at irradiation time (3, 5 min), 20 mW at irradiation time (5,10 min) and 50 mW at all time exposure evaluated except 10 min irradiation. All laser treatments significantly enhanced early appearance of sprouts compared with control, Table 2.
Flowering characteristics
The results recorded in Tables 3 and 4 indicated that, He–Ne laser radiation treatments affected significantly on a flowering date, the control plants gained the highest value of days of flowering (≈102 days), Meanwhile, the lowest value of early flowering was recorded with 20 mW for 5 min (67 days) as mentioned in Table 3. Additional data shows that laser treatments increased inflorescence characteristics. The vas life, flower FW (g/ plant), flower DW (g/ plant), No. flowers/inflorescence, flower diameter (cm), and inflorescence length (cm) were significantly affected (Table 3 and 4), the maximum increase was achieved at 20 mW for 5 min irradiation compared with the control.
Table 3.
Flowering growth characteristics of (Gladiolus grandiflorus L.) cv.”White Prosperity” affected by the interactions between He–Ne Laser mW and different irradiation time during mean of seasons 2022/ 2023.
| He–Ne laser (L) | Irradiation time (min) | Diameter of middle part of the plant (mm) | Leaf area (cm2) | Days to flowering | Vase life (days) |
|---|---|---|---|---|---|
| Control | 0.5 | 43.260 ± 0.527 ij | 55.007 ± 0.713 m | 102.00 ± 0.289 a | 7.500 ± 0.289 i |
| 1 | 43.797 ± 0.920 ij | 56.133 ± 0.411 m | 101.00 ± 0.289 a | 7.667 ± 0.441 i | |
| 3 | 42.688 ± 0.878 j | 56.700 ± 0.759 m | 101.17 ± 0.882 a | 8.167 ± 0.333 hi | |
| 5 | 42.687 ± 0.419 j | 56.567 ± 0.188 m | 100.83 ± 1.302 a | 8.000 ± 0.289 hi | |
| 10 | 44.713 ± 0.262 i | 58.800 ± 0.464 l | 101.67 ± 0.727 a | 8.500 ± 0.289 ghi | |
| 5 mW | 0.5 | 47.683 ± 0.073 h | 71.257 ± 1.295 k | 87.333 ± 0.441 bc | 9.333 ± 0.441 efg |
| 1 | 48.978 ± 0.090 gh | 86.413 ± 1.461 g | 84.833 ± 0.833 cd | 9.833 ± 0.601 def | |
| 3 | 52.758 ± 0.535 cde | 97.927 ± 0.678 cd | 82.000 ± 0.500 e | 12.00 ± 0.289 ab | |
| 5 | 50.167 ± 1.126 fg | 99.743 ± 0.348 c | 84.500 ± 0.500 de | 11.17 ± 0.441 bc | |
| 10 | 51.610 ± 0.451 ef | 90.703 ± 0.264 e | 85.333 ± 0.333 cd | 10.83 ± 0.167 cd | |
| 20 mW | 0.5 | 52.110 ± 0.395 e | 96.987 ± 0.686 d | 85.833 ± 1.364 cd | 10.33 ± 0.167 cde |
| 1 | 53.810 ± 0.362 bcd | 98.678 ± 0.342 cd | 89.833 ± 0.726 b | 10.50 ± 0.289 cd | |
| 3 | 55.032 ± 0.158 b | 102.800 ± 0.35 b | 90.000 ± 1.443 b | 11.17 ± 0.726 bc | |
| 5 | 57.283 ± 0.220 a | 107.450 ± 0.40 a | 67.500 ± 0.289 g | 13.00 ± 0.577 a | |
| 10 | 52.295 ± 0.069 de | 88.638 ± 0.665 f. | 83.667 ± 0.601 de | 10.17 ± 0.167 cde | |
| 50 mW | 0.5 | 54.718 ± 0.491 b | 83.335 ± 0.698 h | 84.000 ± 2.517 de | 10.00 ± 0.500 de |
| 1 | 54.283 ± 0.753 bc | 81.830 ± 0.703 h | 88.833 ± 0.601 b | 9.833 ± 0.167 def | |
| 3 | 58.272 ± 0.776 a | 87.645 ± 1.162 fg | 75.167 ± 0.167 f. | 10.17 ± 0.167 cde | |
| 5 | 54.028 ± 0.400 bc | 77.530 ± 0.209 i | 87.500 ± 1.041 bc | 8.833 ± 0.167 fgh | |
| 10 | 52.745 ± 0.291 cde | 74.222 ± 0.528 j | 87.500 ± 0.289 bc | 8.333 ± 0.167 ghi |
Averages (means) in each column with the same letter (s) are not significantly different according to Steel et al., (1997) test with Bonferroni correction (p ≤ 0.05).
Table 4.
Flowering growth characteristics of (Gladiolus grandiflorus L.) cv.”White Prosperity” affected by the interactions between He–Ne Laser mW and different irradiation time during mean of seasons 2022/ 2023.
| He–Ne laser (L) | Irradiation time (min) | FW of flower (g/ plant) | DW of flower (g/plant) | No. flowers/inflorescence | flowers diameter(cm) | inflorescence length (cm) |
|---|---|---|---|---|---|---|
| Control | 0.5 | 41.69 ± 0.49 opq | 11.53 ± 0.063 k | 8.33 ± 0.17 ghij | 7.33 ± 0.44 gh | 23.33 ± 1.09 g |
| 1 | 42.21 ± 0.19 nopq | 12.78 ± 0.163jk | 7.83 ± 0.17 j | 6.83 ± 0.17 h | 24.67 ± 0.17 g | |
| 3 | 40.57 ± 0.38 q | 13.59 ± 0.07 ij | 8.17 ± 0.44 hij | 8.00 ± 0.76 gh | 22.83 ± 1.83 g | |
| 5 | 42.93 ± 0.97 nop | 14.25 ± 0.21 hi | 8.17 ± 0.17 hij | 7.17 ± 0.33 gh | 25.67 ± 0.67 g | |
| 5 mW | 10 | 43.87 ± 1.10 n | 14.07 ± 0.81 hij | 8.00 ± 0.29 ij | 7.83 ± 0.60 gh | 25.00 ± 0.76 fg |
| 0.5 | 57.37 ± 0.17 m | 12.85 ± 0.56 j | 6.83 ± 0.60 k | 8.17 ± 0.67 g | 29.00 ± 0.58 f. | |
| 1 | 64.23 ± 0.89 hi | 14.52 ± 0.61 ghi | 8.83 ± 0.44 fgh | 10.50 ± 0.50 ef | 39.00 ± 0.57 e | |
| 3 | 73.57 ± 0.81 c | 18.21 ± 0.19 bc | 10.83 ± 0.17 bc | 11.50 ± 0.17 bcde | 46.50 ± 0.50 cd | |
| 5 | 70.70 ± 0.62 d | 17.53 ± 0.38 bcd | 9.30 ± 0.17 ef | 10.83 ± 0.17 cdef | 45.00 ± 1.15 d | |
| 20 mW | 10 | 68.29 ± 0.31 ef | 16.94 ± 0.65 cde | 8.67 ± 0.17 fghi | 10.00 ± 0.29 f. | 44.83 ± 0.44 d |
| 0.5 | 59.48 ± 0.69 l | 15.58 ± 0.13 fg | 8.67 ± 0.17 fghi | 10.67 ± 0.33 def | 44.00 ± 0.57 d | |
| 1 | 70.12 ± 1.12 de | 15.74 ± 0.29gh | 9.83 ± 0.17 de | 10.67 ± 0.44 def | 47.00 ± 0.57 cd | |
| 3 | 84.55 ± 0.38 b | 18.32 ± 0.97 b | 10.33 ± 0.17 cd | 10.67 ± 0.33 def | 49.17 ± 0.61 bc | |
| 5 | 89.00 ± 0.59 a | 21.47 ± 0.18 a | 13.00 ± 0.02 a | 15.17 ± 0.60 a | 54.00 ± 0.29 a | |
| 50 mW | 10 | 66.96 ± 0.91 fg | 17.07 ± 0.31 bcd | 9.31 ± 0.17 ef | 11.83 ± 0.17 bcd | 49.67 ± 0.61 bc |
| 0.5 | 62.06 ± 1.28 jk | 15.61 ± 0.61 fg | 9.00 ± 0.00 fg | 11.67 ± 0.67 bcde | 46.83 ± 0.73 | |
| 1 | 63.38 ± 0.38 ij | 15.05 ± 0.48 gh | 9.83 ± 0.17 de | 12.17 ± 0.33 b | 45.50 ± 0.00 d | |
| 3 | 65.48 ± 0.35 gh | 20.50 ± 0.13 a | 11.50 ± 0.00 b | 14.00 ± 0.57 a | 52.17 ± 0.17 ab | |
| 5 | 60.38 ± 0.80 kl | 16.53 ± 0.29 def | 10.33 ± 0.17 cd | 12.00 ± 0.29 bc | 46.50 ± 0.77 cd | |
| 10 | 56.70 ± 0.262 m | 14.74 ± 0.40 ghi | 9.83 ± 0.17 de | 11.83 ± 0.33 bcd | 46.67 ± 0.62 cd |
Averages (means) in each column with the same letter (s) are not significantly different according to Steel et al., (1997) test with Bonferroni correction (p ≤ 0.05).
Changes in (Gladiolus grandiflorus L.) cv.”White Prosperity” the color and shape of flowers after irradiated with different treatments of He–Ne laser radiation
The changes in the range of flower color and its shape were illustrated as shown in Fig. 1 as follows. The flowers of unirradiated plants were characterized by the clear white color of all the petals, white or yellow color. Treated plants with irradiation low laser irradiation (5 mW, 5 min) (Fig. 1b–e), normal flowers were obtained, while irradiation for 10 min resulted in change petals color to dark yellow (Fig. 1f). The irradiation with 20 mW for 0.5 min and 1.0 min. flowers will not be affected by radiation (Fig. 1g–l). Otherwise, irradiated plants either with He–Ne or with increasing irradiation time, clear difference was observed in inflorescences colors and growth. In addition, caused a change in color and petals compressed (Fig. 1), on the other hand dark red edges were observed, but this treatment gave the best flowers in shape, color, and quality (Fig. 1k). Increasing doses of irradiation to 10 min distorted the shape of the flower (Fig. 1l). However, it was noted that irradiation with a high dose at all levels led to a distortion of the general shape of gladiolus flowers, especially with an increase of 5 and 10 min.
Figure 1.
Illustrate Changes in (Gladiolus grandiflorus L.) cv.”White Prosperity” the color and shape of flowers after irradiated with different treatments of He–Ne laser radiation exposure times (0.0, 0.5, 1, 3, 5 and 10 min.) and power levels (5, 20, 50 mW).
Corm characteristics and productivity
Corms are thick fleshy shortened stems, with a storage function analogous to the leaf scales of a bulb. After flowering, the base of the flower stem forms a new corm. The results recorded in Table 5 and Fig. 2, indicated that He–Ne irradiation treatments significantly affected the No. of corms/plant, FW of corms (g/plant), and circumference/corms. The medium level (20 mW) of He–Ne laser at 5 min. irradiation time gave the best values of the N. of corms /corm, FW of corms (g/plant), and hormones and enzymes like cytokinin and gibberellic acid are linked to plant growth (GA3).
Table 5.
Corm characteristics of (Gladiolus grandiflorus L.) cv.”White Prosperity” affected by the interactions between He–Ne Laser mW and different irradiation time during mean of seasons 2022/ 2023.
| He–Ne laser (L) | Irradiation time (min) | N. of corms/plant | FW of corms (g/plant) | Circumference/corms |
|---|---|---|---|---|
| Control | 0.5 | 6.33 ± 0.17 i | 25.33 ± 1.03 kl | 5.90 ± 0.29 i |
| 1 | 6.83 ± 0.17 hi | 25.75 ± 1.56 kl | 6.10 ± 0.37 i | |
| 3 | 7.00 ± 0.29 hi | 26.73 ± 0.14 k | 6.20 ± 0.18 i | |
| 5 | 7.83 ± 0.44 h | 25.52 ± 0.30 kl | 6.28 ± 0.09 i | |
| 10 | 7.00 ± 0.29 hi | 23.80 ± 0.35 l | 5.90 ± 0.39 i | |
| 5 mW | 0.5 | 11.83 ± 0.44 fg | 38.45 ± 0.20 e | 8.02 ± 0.02 h |
| 1 | 14.17 ± 0.44 e | 39.28 ± 0.03 e | 8.43 ± 0.26 h | |
| 3 | 20.33 ± 0.33 c | 55.95 ± 0.47 c | 12.7 ± 0.04 cd | |
| 5 | 11.50 ± 0.29 g | 32.87 ± 0.655 fg | 12.0 ± 0.34 ef | |
| 10 | 11.67 ± 0.44 fg | 29.31 ± 1.11 ij | 10.7 ± 0.05 g | |
| 20 mW | 0.5 | 12.17 ± 0.44 fg | 29.77 ± 0.11 hi | 11.9 ± 0.47 ef |
| 1 | 19.00 ± 0.33 c | 31.64 ± 0.83 gh | 12.1 ± 0.02 def | |
| 3 | 25.00 ± 0.33 b | 34.54 ± 0.47f. | 10.9 ± 0.07 g | |
| 5 | 33.50 ± 0.75 a | 61.14 ± 0.97 b | 14.5 ± 0.22 a | |
| 10 | 11.00 ± 0.33 g | 27.34 ± 0.18 jk | 12.8 ± 0.13 c | |
| 50 mW | 0.5 | 12.33 ± 0.60 fg | 29.03 ± 0.91 ij | 12.5 ± 0.08 cde |
| 1 | 15.83 ± 1.17 d | 33.23 ± 1.74 gh | 12.3 ± 0.04 cdef | |
| 3 | 19.50 ± 0.76 c | 64.58 ± 0.34 a | 13.5 ± 0.14 b | |
| 5 | 13.00 ± 0.18 ef | 42.98 ± 0.39 d | 11.8 ± 0.17 f. | |
| 10 | 13.00 ± 0.29 ef | 37.44 ± 0.25 e | 10.9 ± 0.14 g |
Averages (means) in each column with the same letter (s) are not significantly different according to Steel et al., (1997) test with Bonferroni correction (p ≤ 0.05).
Figure 2.
Changes in (Gladiolus grandiflorus L.) cv.”White Prosperity corms and cormlets morphology after irradiated with different treatments of He–Ne laser radiation exposure times (0.0, 0.5, 1, 3, 5 and 10 min.) and power levels (5, 20, 50 mW).
Chemical composition
The illustrated results in Tables 6, 7 and 8 indicate that the highest values of total chlorophylls in leaves (SPAD), anthocyanin content (mg/100 g F.W) in petals, N%, P%, K%, and total carbohydrates in new corms (%), were recorded at 20 mW He–Ne irradiation at 5 min. On the other hand, the lowest values of total chlorophylls in leaves (SPAD), P%, K%, and total carbohydrates in new corms (%), were obtained from the control. By increasing laser dosage both power and irradiation time, high values of N%, anthocyanin content (mg/100 g F.W) in petals, total phenol (%) (μg CE/g) in corms, total flavonoid (%) (μg CE/g) in new corms, antioxidant (DPPH IC50 (μg/ml) (%) in new corms, and proline content in corms (μ moles/g) compared to the control.
Table 6.
Mean square for the effect of He–Ne Laser (L), irradiation time (T) and their interaction on chemical composition of (Gladiolus grandiflorus L.) cv.”White Prosperity”.
| Traits | Source of variation | ||||
|---|---|---|---|---|---|
| Treatment | Error | Cv | |||
| He–Ne Laser (L) | irradiation time (T) | L × T | |||
| Total chlorophylls in leaves (SPAD) | 1342.27** | 112.339** | 79.313** | 0.673 | 1.612 |
| Anthocyanin content (mg/100 g F.W) in petals | 0.152N.S | 0.004 N.S | 0.001 | 0.000 | 4.324 |
| N (%) in bulbs (%) | 4.048* | 0.117* | 0.049* | 0.066 | 11.89 |
| P (%) in bulbs (%) | 1.559** | 0.081** | 0.039* | 0.002 | 0.530 |
| K (%) in bulbs (%) | 1.729*** | 0.260*** | 0.125*** | 0.001 | 1.410 |
| Total carbohydrates in bulbs (%) | 276.755** | 28.628** | 10.503** | 0.261 | 1.551 |
| Total phenol (μg CE/g) in bulbs (%) | 18.386*** | 2.242*** | 0.554*** | 0.001 | 1.342 |
| Total flavonoid (μg CE/g) in bulbs (%) | 484.025*** | 18.889*** | 1.765*** | 0.077 | 1.625 |
| Antioxidant (DPPH IC50 (μg/ml) in bulbs (%) | 944.325*** | 79.600*** | 10.585*** | 0.185 | 1.323 |
| Proline content in bulbs (μ moles/g) | 202.329*** | 11.531*** | 2.624*** | 0.003 | 0.942 |
Table 7.
Chemical composition of (Gladiolus grandiflorus L.) cv.”White Prosperity” affected by the interactions between He–Ne Laser mW and different irradiation time during mean of seasons 2022/ 2023.
| He–Ne laser (L) | Irradiation time (min) | Total chlorophylls in leaves (SPAD) | Anthocyanin content (mg/100 g F.W) in petals | N (%) in bulbs (%) | P (%) in bulbs (%) | K (%) in bulbs (%) | ||||
|---|---|---|---|---|---|---|---|---|---|---|
| Control | 0.5 | 35.51 ± 0.307q | 0.102 | ± 0.002 g | 1.380 | ± 0.006d | 1.940 | ± 0.012 l | 2.183 | ± 0.003 m |
| 1 | 36.24 ± 0.011opq | 0.104 | ± 0.002 g | 1.413 | ± 0.007d | 1.963 | ± 0.007 k | 2.220 | ± 0.006 m | |
| 3 | 36.94 ± 0.194nop | 0.103 | ± 0.001 g | 1.443 | ± 0.015d | 1.963 | ± 0.009 k | 2.223 | ± 0.015 m | |
| 5 | 38.21 ± 0.049 mn | 0.104 | ± 0.001 g | 1.420 | ± 0.006d | 1.960 | ± 0.006kl | 2.230 | ± 0.006 m | |
| 10 | 39.54 ± 0.002 m | 0.106 | ± 0.006 g | 1.460 | ± 0.006d | 1.943 | ± 0.012kl | 2.330 | ± 0.085 l | |
| 5 mW | 0.5 | 48.31 ± 0.127 k | 0.188 | ± 0.008f. | 2.137 | ± 0.003c | 2.260 | ± 0.006j | 2.347 | ± 0.009 l |
| 1 | 49.78 ± 0.098j | 0.192 | ± 0.004f. | 2.153 | ± 0.007c | 2.283 | ± 0.003i | 2.420 | ± 0.006 k | |
| 3 | 53.18 ± 0.038hi | 0.196 | ± 0.002f. | 2.227 | ± 0.003c | 2.320 | ± 0.006 h | 2.460 | ± 0.012 jk | |
| 5 | 58.33 ± 0.019 cd | 0.199 | ± 0.006f. | 2.277 | ± 0.003c | 2.747 | ± 0.003 b | 2.567 | ± 0.007gh | |
| 10 | 55.85 ± 0.350ef | 0.201 | ± 0.002f. | 2.270 | ± 0.006c | 2.613 | ± 0.003 d | 2.487 | ± 0.003ij | |
| 20 mW | 0.5 | 55.20 ± 0.009 fg | 0.222 | ± 0.001e | 2.240 | ± 0.012c | 2.677 | ± 0.009c | 2.540 | ± 0.012hi |
| 1 | 54.70 ± 0.328 fg | 0.227 | ± 0.001e | 2.327 | ± 0.009b | 2.680 | ± 0.006c | 2.587 | ± 0.003fgh | |
| 3 | 57.23 ± 0.954de | 0.277 | ± 0.001d | 2.380 | ± 0.006b | 2.727 | ± 0.012 b | 2.637 | ± 0.015f. | |
| 5 | 69.32 ± 0.003a | 0.292 | ± 0.003 cd | 2.540 | ± 0.015b | 2.790 | ± 0.006a | 2.853 | ± 0.007d | |
| 10 | 59.42 ± 0.137 c | 0.303 | ± 0.001c | 2.467 | ± 0.009b | 2.567 | ± 0.007e | 2.747 | ± 0.015e | |
| 50 mW | 0.5 | 50.80 ± 0.668j | 0.299 | ± 0.008c | 2.510 | ± 0.006b | 2.473 | ± 0.007 g | 2.613 | ± 0.007 fg |
| 1 | 54.31 ± 0.053gh | 0.332 | ± 0.001b | 2.490 | ± 0.031b | 2.480 | ± 0.006 g | 2.633 | ± 0.003f. | |
| 3 | 66.87 ± 0.945b | 0.336 | ± 0.001b | 2.540 | ± 0.015b | 2.670 | ± 0.006 c | 3.650 | ± 0.006a | |
| 5 | 52.38 ± 0.171i | 0.370 | ± 0.025a | 2.470 | ± 0.015b | 2.687 | ± 0.003 c | 3.193 | ± 0.044b | |
| 10 | 45.83 ± 1.448 l | 0.366 | ± 0.001a | 3.087 | ± 0.662 a | 2.537 | ± 0.009 f. | 3.080 | ± 0.006c | |
Averages (means) in each column with the same letter (s) are not significantly different according to Steel et al., (1997) test with Bonferroni correction (p ≤ 0.05).
Table 8.
Chemical composition of (Gladiolus grandiflorus L.) cv.”White Prosperity” affected by the interactions between He–Ne Laser mW and different irradiation time during mean of seasons 2022/ 2023.
| He–Ne Laser (L) | Irradiation time (min) | Total carbohydrates in bulbs (%) | Total phenol (μg CE/g) in bulbs (%) | Total flavonoid (μg CE/g) in bulbs (%) | Antioxidant (DPPH IC50 (μg/ml) in bulbs (%) | Proline content in bulbs (μ moles /g) | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Control | 0.5 | 25.61 | ± 0.307 l | 1.42 | ± 0.009 m | 10.21 | ± 0.004 k | 22.13 | ± 0.016 m | 2.13 | ± 0.009q |
| 1 | 26.67 | ± 0.272jk | 1.47 | ± 0.010 lm | 10.32 | ± 0.006 k | 22.13 | ± 0.012 m | 2.17 | ± 0.010q | |
| 3 | 27.08 | ± 0.333j | 1.48 | ± 0.007 l | 10.65 | ± 0.282 k | 22.27 | ± 0.047 m | 2.19 | ± 0.019q | |
| 5 | 28.15 | ± 0.032i | 1.45 | ± 0.020 lm | 11.24 | ± 0.010 j | 22.33 | ± 0.013 m | 2.21 | ± 0.007p | |
| 10 | 26.00 | ± 0.321kl | 1.49 | ± 0.009 l | 11.25 | ± 0.006 j | 22.34 | ± 0.016 m | 2.24 | ± 0.006op | |
| 5 mW | 0.5 | 32.17 | ± 0.537 g | 1.63 | ± 0.017 k | 11.98 | ± 0.348 i | 28.14 | ± 0.030 l | 2.37 | ± 0.115n |
| 1 | 30.95 | ± 0.410 h | 1.68 | ± 0.003 k | 12.71 | ± 0.175 h | 29.44 | ± 0.020 k | 2.65 | ± 0.015 m | |
| 3 | 32.29 | ± 0.143 g | 1.75 | ± 0.009j | 13.40 | ± 0.087 g | 29.02 | ± 0.289 k | 3.16 | ± 0.012 l | |
| 5 | 37.53 | ± 0.171b | 1.88 | ± 0.003i | 15.56 | ± 0.191 f. | 32.17 | ± 0.042j | 3.27 | ± 0.009 k | |
| 10 | 35.22 | ± 0.094 d | 1.95 | ± 0.017 h | 15.96 | ± 0.020 f. | 35.10 | ± 0.898 h | 4.24 | ± 0.022j | |
| 20 mW | 0.5 | 34.32 | ± 0.141e | 1.85 | ± 0.005i | 20.19 | ± 0.042 e | 31.81 | ± 0.335j | 4.88 | ± 0.006i |
| 1 | 32.82 | ± 0.333 | 1.97 | ± 0.003 h | 20.46 | ± 0.100 e | 33.25 | ± 0.101i | 4.98 | ± 0.006 h | |
| 3 | 36.47 | ± 0.110c | 2.26 | ± 0.032 g | 21.18 | ± 0.034 d | 37.45 | ± 0.003f. | 5.05 | ± 0.021 h | |
| 5 | 39.03 | ± 0.007a | 3.36 | ± 0.017e | 21.44 | ± 0.029 d | 39.23 | ± 0.109d | 5.64 | ± 0.036 g | |
| 10 | 33.14 | ± 0.012f. | 3.55 | ± 0.070d | 22.25 | ± 0.075 c | 40.90 | ± 0.340c | 7.30 | ± 0.053f. | |
| 50 mW | 0.5 | 36.09 | ± 0.038c | 2.98 | ± 0.003f. | 20.31 | ± 0.032 e | 36.42 | ± 0.088 g | 7.85 | ± 0.037e |
| 1 | 36.83 | ± 0.304bc | 3.35 | ± 0.015e | 21.36 | ± 0.017 d | 38.25 | ± 0.100e | 9.22 | ± 0.007d | |
| 3 | 39.13 | ± 0.010a | 3.98 | ± 0.006c | 22.18 | ± 0.035 c | 39.36 | ± 0.074d | 9.88 | ± 0.012c | |
| 5 | 36.46 | ± 0.345c | 4.43 | ± 0.012b | 23.62 | ± 0.559 b | 42.92 | ± 0.608b | 11.44 | ± 0.016b | |
| 10 | 32.82 | ± 0.664 fg | 4.98 | ± 0.006a | 25.47 | ± 0.056 a | 45.68 | ± 0.067a | 13.64 | ± 0.031a | |
Averages (means) in each column with the same letter (s) are not significantly different according to Steel et al., (1997) test with Bonferroni correction (p ≤ 0.05).
Anatomical studies
Transection made in untreated leaves of Gladiolus grandiflorus L. plants exhibited that the uniseriate layer with small papillae is present in both the upper (adaxial) and lower (abaxial) epidermal tissues. Adaxial epidermal cells are larger than abaxial epidermal cells. The veins have closed lateral vascular bundles in two rows and are distributed in two different sizes: large vascular bundles in the midvein region and small vascular bundles in the lamina region. The vascular bundles are surrounded by a single-layer sheath and each bundle has xylem towards the center of the leaf and phloem towards the surface of the leaf. There is a group of sclerenchyma cells above each bundle (phloem fiber cap). The mesophyll tissue appears to consist of many layers of spongy tissue. Moreover, tannin cells were clearly visible beneath the upper and lower lamina epidermal cells. The data indicated the effect of He–Ne laser dose power of 5 (low), 20 (medium) and 50 (high) mW for 5 min on the anatomical structure of gladiolus leaves as shown in Table 9 and in the cross-sections (Fig. 3). The results showed that the medium level (20 mW) of He–Ne laser at 5 min caused a vital increase in the leaf anatomical features, followed by the low level (5 mW) of He–Ne laser at 5min. An increment in midvein thickness was noted by such treatments. Compared with control plants, the percentages of increments in leaf midvein thickness were 29.83 and 19.59%, respectively.
Table 9.
Anatomical changes in (Gladiolus grandiflorus L.) cv.”White Prosperity” leaves irradiated with different He–Ne laser power levels (5, 20, and 50 mW) and 5 min irradiation time.
| Anatomical features (µ) | Control | 5 mW He–Ne irradiation | 20 mW He–Ne irradiation | 50 mW He–Ne irradiation at 5 min |
|---|---|---|---|---|
| Upper epidermis thickness | 24.37 | 24.48 | 30.36 | 18.03 |
| Lamina thickness | 616.30 | 590.21 | 781.52 | 254.68 |
| Mesophyll tissue thickness | 513.67 | 525.25 | 586.80 | 219.92 |
| Midvein thickness | 1789.63 | 2140.02 | 2323.51 | 552.89 |
| Sclerenchymatous sheath thickness | 132.84 | 146.26 | 172.87 | 68.47 |
| midvein vascular bundle dimensions | ||||
| The upper bundle | ||||
| Length | 229.74 | 256.24 | 289.44 | 93.90 |
| Width | 208.00 | 227.29 | 241.61 | 73.25 |
| Phloem tissue thickness | 63.70 | 76.06 | 87.12 | 26.48 |
| Xylem tissue thickness | 87.12 | 121.77 | 155.23 | 54.23 |
| Xylem vessels diameter | 25.79 | 33.75 | 47.73 | 23.09 |
| The lower bundle | ||||
| Length | 193.54 | 257.17 | 300.00 | 71.06 |
| Width | 228.22 | 200.96 | 248.02 | 51.08 |
| Phloem tissue thickness | 82.66 | 82.66 | 84.44 | 22.80 |
| Xylem tissue thickness | 121.69 | 129.24 | 131.55 | 40.85 |
| Xylem vessel diameter | 32.26 | 40.33 | 48.38 | 21.38 |
| Sclerenchymatous sheath thickness | 96.77 | 112.90 | 129.03 | 80.65 |
| Lower epidermis thickness | 17.67 | 22.46 | 28.84 | 12.81 |
Figure 3.
Anatomical changes in (Gladiolus grandiflorus L.) cv.”White Prosperity leaf after irradiated with different treatments of He–Ne laser radiation exposure time5min. and power levels (5, 20, and 50 mW. (A) Control B) plants irradiated with low power at 5mWfor 5min C) plants irradiated with medium power at 20mW for 5 min D) plants irradiated with50mW for 5 min. Details: U ep., Upper epidermis; Scl., Sclerenchyma tissue; Ph, Phloem tissue; Xy, Xylem tissue; L ep., Lower epidermis; Up Vb, Upper vascular bundle; Lp Vb, lower vascular bundle; Mes., Mesophyll tissue.
Molecular analysis
PCR products of 22 SSR primers were visualized on agarose gels and analyzed for variants induced in Gladiolus treated with different laser doses. The SSR primers exhibited various bands among the treated plants (Fig. 4). 112 bands emerged from the 22 SSR primers, ranging between 130 and 540 bp, with 32 bands having polymorphism ranging from 17 to 100% (Table 10). The highest band size was observed in primer SSR13 (540 bp), while the lowest was in primer SSR22 (130 bp). The average PIC was 0.63), MI was 1.61, and RP was 2.32 (Table 11). The maximum value of PIC (0.82) came from SSR2, whereas SSR22 revealed minimum PIC values of 0.28. The SSR15 recorded the greatest value of RP (3.01), whereas the lowest one by SSR4 (1.91). The MI was 2.32 as the greatest value recorded by SSR18, while the lowest one recorded by SSR22 (1.04) (Table 11).
Figure 4.
Patterns of SSR primers revealed by treated and non-treated Gladiolus against different LASER treatments. M = DNA ladder, [1] control 1 corm = CC1, [2] control 2 corm = CC2, [3] control Bulk 1 + 2 corm = BCC, [4] control 1 Flowers = CF1, [5] control 2 Flowers = CF2, [6] control Bulk 1 + 2 Flowers = BCF, [7] control 1 Leaves = CL1, [8] control 2 Leaves = CL2, [9] control Bulk 1 + 2 Leaves = BCL, [10] Control All Bulk = BC, [11] Medium 1 corm = MC1, [12] Medium 2 corm = MC2, [13] Medium Bulk 1 + 2 corm = BMC, [14Medium 1 Flowers = MF1, [15] Medium 2 Flowers = MF2, [16] Medium Bulk 1 + 2 Flowers = BMF, [17] Medium 1 Leaves = ML1, [18] Medium 2 Leaves = ML2, [19] Medium Bulk 1 + 2 Leaves = BML, [20] Medium All Bulk = BM, [21] High 1 corm = HC1, [22] High 2 corm = HC2, [23] High Bulk 1 + 2 corm = BHC, [24] High 1 Flowers = HF1, [25] High 2 Flowers = HF2, [26] High Bulk 1 + 2 Flowers = BHF, [27] High 1 Leaves = HL1, [28] High 2 Leaves = HL2, [29] High Bulk 1 + 2 Leaves = BHL, [30] High All Bulk = BH.
Table 10.
SSR marker parameters calculated across different LASER treatments applied to the Gladiolus.
| Marker code | TF | MF | PF | P% | Allele size (bp) |
|---|---|---|---|---|---|
| SSR1 | 6 | 5 | 1 | 17 | 290–340 |
| SSR2 | 5 | 4 | 1 | 20 | 230–270 |
| SSR3 | 5 | 4 | 1 | 20 | 190–390 |
| SSR4 | 4 | 4 | 0 | 0 | 240–365 |
| SSR5 | 5 | 4 | 1 | 20 | 210–290 |
| SSR6 | 6 | 0 | 6 | 100 | 220–365 |
| SSR7 | 5 | 4 | 1 | 20 | 270–300 |
| SSR8 | 4 | 3 | 1 | 25 | 220–290 |
| SSR9 | 7 | 5 | 2 | 29 | 200–230 |
| SSR10 | 5 | 4 | 1 | 20 | 210–280 |
| SSR11 | 6 | 5 | 1 | 17 | 340–510 |
| SSR12 | 5 | 5 | 0 | 0 | 500–540 |
| SSR13 | 4 | 4 | 0 | 0 | 210–300 |
| SSR14 | 5 | 4 | 1 | 20 | 170–290 |
| SSR15 | 6 | 5 | 1 | 17 | 240–290 |
| SSR16 | 8 | 0 | 8 | 100 | 243–386 |
| SSR17 | 6 | 5 | 1 | 17 | 180–215 |
| SSR18 | 6 | 6 | 0 | 0 | 160–300 |
| SSR19 | 3 | 3 | 0 | 0 | 290–400 |
| SSR20 | 4 | 4 | 0 | 0 | 280–400 |
| SSR21 | 2 | 2 | 0 | 0 | 190–230 |
| SSR22 | 5 | 0 | 5 | 100 | 130–405 |
| Total | 112 | 80 | 32 | ||
| Average | 5.09 | 3.64 | 1.45 |
Table 11.
SSR marker PIC, Rp and MI calculated across different LASER treatments applied to Gladiolus.
| Marker code | Allele size (bp) | PIC | RP | MI | Marker code | Allele size (bp) | PIC | RP | MI |
|---|---|---|---|---|---|---|---|---|---|
| SSR1 | 290–340 | 0.59 | 2.3 | 1.9 | SSR12 | 500–540 | 0.76 | 2.52 | 1.47 |
| SSR2 | 230–270 | 0.82 | 2.69 | 1.9 | SSR13 | 210–300 | 0.73 | 2.16 | 1.46 |
| SSR3 | 190–390 | 0.73 | 2.01 | 1.45 | SSR14 | 170–290 | 0.75 | 2.34 | 1.47 |
| SSR4 | 240–365 | 0.59 | 1.91 | 1.91 | SSR15 | 240–290 | 0.76 | 3.01 | 1.9 |
| SSR5 | 210–290 | 0.77 | 2.57 | 1.43 | SSR16 | 243–386 | 0.44 | 1.98 | 1.9 |
| SSR6 | 220–365 | 0.74 | 2.3 | 1.47 | SSR17 | 180–215 | 0.79 | 2.93 | 1.9 |
| SSR7 | 270–300 | 0.77 | 2.58 | 1.48 | SSR18 | 160–300 | 0.65 | 2.13 | 2.32 |
| SSR8 | 220–290 | 0.29 | 1.94 | 1.47 | SSR19 | 290–400 | 0.59 | 2.37 | 1.04 |
| SSR9 | 200–230 | 0.77 | 2.54 | 1.48 | SSR20 | 280–400 | 0.8 | 2.79 | 1.9 |
| SSR10 | 210–280 | 0.55 | 2.04 | 1.9 | SSR21 | 190–230 | 0.37 | 1.98 | 1.04 |
| SSR11 | 340–510 | 0.41 | 1.98 | 1.48 | SSR22 | 130–405 | 0.28 | 1.98 | 1.04 |
| Average | PIC | RP | MI | ||||||
| 0.63 | 2.32 | 1.61 |
Out of the 22 SSR primers, 3 primers exhibited high polymorphism percentage, i.e., SSR6, SSR16 and SSR22 (Table 10). SSR6 exhibited 2 positive alleles which could be used as marker to differentiate the Gladiolus accessions. The first allele with 350 bp that was found in leaves generated from corms that were exposed to medium laser treatment, also found in Corms and their leaves which exposed to high treatment (Table 12). While the second with 290 bp which found in the flowers that produced from corms treated with high laser treatment. Four different alleles were observed in SSR16, the alleles with 144, 235 and 410 bp which found in leaves generated from corms that exposed to medium and high laser treatments; while allele with 131 bp observed in leaves that generated from corms exposed to medium treatment only. On the other hand, SSR22 exhibited the allele with 220 bp that appears with high treatment of corms and their leaves.
Table 12.
Presence or absence of alleles among different primers used in Gladiolus.
| SSR6 | ||||||||
|---|---|---|---|---|---|---|---|---|
| Code | bp | |||||||
| 309 | 350 | 315 | 290 | 250 | 240 | |||
| CC1 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| CC2 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| BCC | 0 | 0 | 1 | 0 | 0 | 1 | ||
| CF1 | 0 | 0 | 0 | 0 | 1 | 0 | ||
| CF2 | 0 | 0 | 0 | 0 | 1 | 0 | ||
| BCF | 0 | 0 | 0 | 0 | 1 | 0 | ||
| CL1 | 0 | 0 | 0 | 0 | 1 | 0 | ||
| CL2 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| BCL | 0 | 0 | 1 | 0 | 0 | 0 | ||
| BC | 0 | 0 | 0 | 0 | 1 | 0 | ||
| MC1 | 0 | 0 | 0 | 0 | 1 | 0 | ||
| MC2 | 0 | 0 | 0 | 0 | 1 | 0 | ||
| BMC | 0 | 0 | 0 | 0 | 1 | 0 | ||
| MF1 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| MF2 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| BMF | 0 | 0 | 1 | 0 | 0 | 0 | ||
| ML1 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| ML2 | 0 | 1 | 1 | 0 | 0 | 0 | ||
| BML | 0 | 0 | 1 | 0 | 0 | 0 | ||
| BM | 0 | 1 | 1 | 0 | 0 | 0 | ||
| HC1 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| HC2 | 0 | 1 | 1 | 0 | 0 | 0 | ||
| BHC | 0 | 0 | 1 | 0 | 0 | 0 | ||
| HF1 | 0 | 0 | 0 | 0 | 0 | 1 | ||
| HF2 | 0 | 0 | 0 | 1 | 1 | 0 | ||
| BHF | 0 | 0 | 0 | 1 | 1 | 0 | ||
| HL1 | 0 | 0 | 0 | 0 | 1 | 0 | ||
| HL2 | 0 | 1 | 1 | 0 | 0 | 0 | ||
| BHL | 0 | 1 | 1 | 0 | 0 | 0 | ||
| BH | 1 | 1 | 0 | 0 | 0 | 0 | ||
| SSR16 | ||||||||
|---|---|---|---|---|---|---|---|---|
| Code | bp | |||||||
| 410 | 305 | 280 | 235 | 223 | 211 | 144 | 131 | |
| CC1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 |
| CC2 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
| BCC | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 |
| CF1 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
| CF2 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
| BCF | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 |
| CL1 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 |
| CL2 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 |
| BCL | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 |
| BC | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| MC1 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 |
| MC2 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| BMC | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
| MF1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 |
| MF2 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
| BMF | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 |
| ML1 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 1 |
| ML2 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 |
| BML | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 |
| BM | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 |
| HC1 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 |
| HC2 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| BHC | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
| HF1 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
| HF2 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
| BHF | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 1 |
| HL1 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 |
| HL2 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 |
| BHL | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 0 |
| BH | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 |
| SSR22 | ||||||||
|---|---|---|---|---|---|---|---|---|
| Code | bp | |||||||
| 363 | 351 | 259 | 238 | 220 | ||||
| CC1 | 0 | 1 | 1 | 0 | 0 | |||
| CC2 | 0 | 1 | 0 | 0 | 0 | |||
| BCC | 1 | 1 | 1 | 0 | 0 | |||
| CF1 | 1 | 0 | 0 | 1 | 0 | |||
| CF2 | 1 | 0 | 0 | 1 | 0 | |||
| BCF | 0 | 0 | 1 | 0 | 0 | |||
| CL1 | 0 | 1 | 0 | 0 | 0 | |||
| CL2 | 1 | 0 | 0 | 1 | 0 | |||
| BCL | 1 | 0 | 0 | 1 | 0 | |||
| BC | 0 | 0 | 1 | 0 | 0 | |||
| MC1 | 1 | 0 | 0 | 1 | 0 | |||
| MC2 | 1 | 0 | 0 | 1 | 0 | |||
| BMC | 0 | 0 | 1 | 0 | 0 | |||
| MF1 | 0 | 1 | 0 | 0 | 0 | |||
| MF2 | 0 | 0 | 0 | 1 | 0 | |||
| BMF | 1 | 0 | 0 | 1 | 0 | |||
| ML1 | 1 | 0 | 0 | 1 | 0 | |||
| ML2 | 0 | 0 | 1 | 0 | 0 | |||
| BML | 0 | 1 | 0 | 0 | 0 | |||
| BM | 0 | 0 | 0 | 1 | 0 | |||
| HC1 | 0 | 1 | 0 | 0 | 1 | |||
| HC2 | 1 | 0 | 0 | 1 | 0 | |||
| BHC | 1 | 0 | 0 | 1 | 0 | |||
| HF1 | 1 | 0 | 0 | 1 | 0 | |||
| HF2 | 1 | 0 | 0 | 1 | 0 | |||
| BHF | 0 | 0 | 1 | 0 | 0 | |||
| HL1 | 0 | 1 | 0 | 0 | 0 | |||
| HL2 | 0 | 0 | 0 | 1 | 0 | |||
| BHL | 0 | 1 | 0 | 0 | 1 | |||
| BH | 0 | 1 | 0 | 0 | 0 | |||
[1] control 1 corm = CC1, [2] control 2 corm = CC2, [3] control Bulk 1 + 2 corm = BCC, [4] control 1 Flowers = CF1, [5] control 2 Flowers = CF2, [6] control Bulk 1 + 2 Flowers = BCF, [7] control 1 Leaves = CL1, [8] control 2 Leaves = CL2, [9] control Bulk 1 + 2 Leaves = BCL, [10] Control All Bulk = BC, [11] Medium 1 corm = MC1, [12] Medium 2 corm = MC2, [13] Medium Bulk 1 + 2 corm = BMC, [14Medium 1 Flowers = MF1, [15] Medium 2 Flowers = MF2, [16] Medium Bulk 1 + 2 Flowers = BMF, [17] Medium 1 Leaves = ML1, [18] Medium 2 Leaves = ML2, [19] Medium Bulk 1 + 2 Leaves = BML, [20] Medium All Bulk = BM, [21] High 1 corm = HC1, [22] High 2 corm = HC2, [23] High Bulk 1 + 2 corm = BHC, [24] High 1 Flowers = HF1, [25] High 2 Flowers = HF2, [26] High Bulk 1 + 2 Flowers = BHF, [27] High 1 Leaves = HL1, [28] High 2 Leaves = HL2, [29] High Bulk 1 + 2 Leaves = BHL, [30] High All Bulk = BH.
Discussion
Data in Tables 1 and 2 showed that treated gladiolus corms with three laser power levels (5, 20, and 50 mW) resulted significantly increase in the studied growth parameters, (plant height, number of leaves/plant, leaf area, fresh and dry weight of leaves (g)/plant) compared with control. The obtained results were in agreement with other work done on mustard, cauliflower, and turnip plants, when they exposed to, He–Ne radiation, showed an increase in biomass, leaf count, and overall fresh weight24.
Similar outcomes were reported in the literature for medicinal sage25, Curculigo orchioides24, Eustoma grandiflorum4, Adansonia digitata26, and Ashwagandha27. The Red light accelerates the rhythm of plant growth producing an increase in root growth that increases plant height is another important indicator of plant growth. Red illumination also increases biomass and encourages plants' vertical development. As a result, comparable changes were seen in the leaf's length and width in accordance with this principle28. Authors asserted that cytokinin and GA, among other hormones and enzymes, engage in the growth, development, and reproduction of plants. The red light from laser irradiation is necessary for both the production and endogenous content of GA3 and GA146. The greater leaf area reflects laser beams effect which encourages cell division, raises GA levels, and subsequent growth during the vegetative stage29 and improved morphological and physiological traits30. As a result of the laser-mediated elevation of GA3, which was connected to various physiological processes including cell elongation, auxin, and sugar content; the plant's height, number of branches, and blooming stems were increased31. Plant growth and development, seed germination, and phytochrome function were all correlated with one another. The phytochrome system was stimulated by a red-light-emitting He–Ne laser, and responses were shown in lettuce32 at a wavelength of (632.8 nm).
In the present work, investigations have been done to study the influence of He–Ne laser irradiation on the number of the days required for sprouting, vegetative growthparameters, flowering parameters, chemical composition, leaves anatomy, genetic attributes. All laser treatments significantly enhanced early appearance of sprouts compared with control, Table 2.
The laser light mode of action has been mentioned in previous work7, laser light stimulant seed germination and plant development by turning light energy into chemical energy. Phytochromes that absorb laser light at a specific wavelength tend to boost the internal energy of seeds33. Our current findings are consistent with past findings of better germination in scorzonera34, and green beans seed7; all reported similar observations of improved germination ability with laser light treatment. A recent study by Khamis et al.26 found that Adansonia digitata seeds treated with a He–Ne laser had a higher percentage of seeds germinate than control seeds. On the contrary, Abou-Dahab et al.4 found that red laser radiation delayed bud flower initiation and the longest period was resulted from red light laser treatments in Eustoma grandiflorum.
He–Ne laser radiation treatments affected significantly on a flowering date. The results agree with Danaila et al.35 who reported that low irradiation time of He–Ne laser diode (660 nm, 200 mW) have significant positive differences in all studied and determined characteristics (growth rate, number of formed shoots, number of leaves formed, flower development in the two studied plants Dianthus caryophyllus and Petunia hybrida35. In addition, Abou-Dahab et al.4 worked on Eustoma grandiflorum most of the tested floral characters, days to flower bud initiation, days to bloom, Flowering percentage, No .of flower buds/plant, No. of flowers/plant, flower Diameter (cm), bloom stem length (cm.), Peduncle length (cm), days to flower senescence ( from blooming), No. of petals /flower, Petals area (cm2), No. of Stamens per flower, F.W. of flower (g), and D.W. of flower (g) were significantly increased when irradiated using red He–Ne at wavelength with irradiation output power 50 mW compared to control4. Enhanced results were recorded for the studied characters when the same author used blue light at 460 nm and green light at 530 nm.
Irradiated plants either with He–Ne or with increasing irradiation time, clear difference was observed in inflorescences colors and growth. In addition, caused a change on color and petals compressed (Fig. 1). From previous research, Abou-Dahab et al.4 changes in color and shape of Eustoma grandiflorum after times was reported. The range change of flower color and form were varied. as shown in (Fig. 1). He–Ne laser irradiation affected flowers to change into dark purple flowers for the exposure time of 20 min. While increasing time to 25 min flowers varied in the darkness of purple color from light to dark purple reddish and planed in white color.
He–Ne irradiation treatments significantly affected the No. of corms /plant, FW of corms (g/plant), and circumference/corms. The primary investigation found that the synthesis of GA3 and the endogenous GA1 content are significantly influenced by the red light of laser radiation. The GA3 response for cell elongation and other effects such as weakening the cell wall, production of proteolytic enzymes, increase of auxin content, increase of concentration of sugar, raising the osmotic pressure in cell soap4. The impact of laser light in the developmental processes is critical and it is necessary to understand the molecular mechanisms involved in various processes. This elongation of a cell that is treated with laser radiation led to an increase of plant height, number of branches, and number of flowers. Gibberellic acid (GA) and abscisic acid (ABA), the two main phytohormones, are known as endogenous regulators of seed germination, dormancy, plant growth, and development. In this research no investigations were done on plant hormones and enzymes but based on other work the effect of red laser increase plant height, number of branches, and number of flowers, which is directly affect corms morphology including No. of corms /plant, FW of corms (g/plant), and circumference of corms as found in the presented data31.
The results indicate that the total chlorophylls in leaves (SPAD), anthocyanin content in petals, N%, P%, K%, and total carbohydrates in new corms (%), were affected by He–Ne irradiation. Khamis et al.26 reported that the germination rate of Adansoina digitata was dramatically improved by low power laser therapy (10 mW/2 min). Additionally, the root and leaf lengths were evaluated in comparison to the control and another laser treatment at various powers and time intervals. Additionally, Marchant et al.36 indicated that the red photons in RB light appear to be the key to gene expression of Curcuma longa plants. Also, the red photons in RB light affect the synthesis of flavonoids and other antioxidants compared to the control and white illumination. In cucumber seedlings, the red light increased the net photosynthetic and chlorophyll content more than blue light28. Data in literature stated that utilizing laser energy raised the nitrogen level, which increased the protein content needed to develop plant organs such as the number of umbels and branches37. Laser light caused an increase in the number of cell membranes composed of phospholipids and nucleic acids as well as higher potassium and phosphorus concentrations that led to laser radiation-induced cell elongation. Other authors found the same results, laser irradiation involves raising nitrogen levels, which raise protein levels, growing plant organs including number of leaves and leaf area, number of branches, and umbels37. Responses of chlorophyll a, b, total chlorophyll and carotenoids to different He–Ne laser irradiation were analyzed A significant increase in total chlorophyll content was noted at 15 J/cm2 (P = 0.02) than control, among different pigments, the total chlorophyll showed a significant increment than control, whereas chlorophyll a, b and carotenoids show slight variations without significance as has been reported for cabbage and beet varieties38. Recently, Zielinska et al.39, have reported higher chlorophyll content in M. laevis with LED illumination than photosynthetic active radiation and different chlorophyll a/b ratio to light spectra and LED illumination based on the altered effect of cytokinin on photosynthesis. Similarly, improved chlorophyll synthesis was reported in Doritaenopsis40, with photosynthetic active radiation and tobacco with blue light. According to past studies, the pigment concentration in the leaves of the control and irradiation groups predicted the overall photosynthetic rate41. The current findings are consistent with He–Ne laser upregulation of genes associated to photosynthesis, including photosystem II PsbR. protein, ATP synthase, and chlorophyll a/b binding protein; and increased pigment content from laser radiation42. wheat treated to UV-B light showed improved electron transport chain efficiency of the ability to biosynthesis photosynthetic pigments43,44. Similar findings suggested that laser exposure could affect the chlorophyll biosynthetic gene, which is primarily responsible for protochlorophyllide synthesis7,45. Their investigation supported the findings that laser activation of photosystems I and II in brinjal plants might enhance pigment production and improve photosynthetic rate. Additionally, compared to the control group, the laser-irradiated groups showed a significant increase in stomatal conductance, transpiration rate, and concentrations.
The enhancement in leaf thickness due to laser treatments was associated with its role in improving GA formation and release of IAA which is reflected on cell elongation and growth and encouraged nutrient and water uptake46. Moreover, the increments in lamina thickness were linked with another increment in the thickness of the upper and lower epidermal tissues as well as mesophyll tissue thickness. Where the rates of increase in the previous three characteristics amounted to 24.58, 63.21, and 14.24%, respectively, when using the medium dose of laser radiation (20 mW) for 5 min. compared to the control. The largest vascular bundle, xylem, phloem tissue, and xylem vessels diameter were obtained after irradiation with medium power at 20 mW for 5 min. Compared with the control, the average increase percentages in the dimensions of upper and lower vascular bundles of the leaf midvein were 25.99 and16.16% for the upper bundle and 55.00 and 8.68% for the lower one in length and width, respectively. Furthermore, the percentage of increments in phloem, xylem tissue thickness, and xylem diameter in such bundles were 36.77, 78.18, and 85.07% in upper vascular bundle, 2.15, 8.10, and 49.96% in the lower one, more than control plants, respectively. Wider xylem vessels due to this treatment lead to increased water and nutrient uptake as well as plant growth. In this respect, Metwally et al.47 on Celosia argentea plants as well as Abu Dahab et al.4 on Eustoma grandiflorum plants found that laser irradiation caused an increase in vascular bundle dimensions (length and width) and lamina thickness. On the contrary, the higher level (50 mW) of He–Ne laser radiation resulted in a decrease in all anatomical features of leaves compared to control plants. From the anatomical results of gladiolus plants, it could be concluded that the positive effect of laser irradiation on plant growth may be due to its stimulation of the plant's ability to absorb light energy, which is transformed into energy stored in a chemical compound used in plant growth. In addition to its role in improving the potential energy of the plant hormone, which leads to the stimulation and activation of biochemical metabolism. It also improves mineral content, biomass, and antioxidant metabolism48. Laser irradiation that improves chlorophyll content, photosynthesis, and respiration in addition to increasing the activity of key enzymes contributes to the biosynthesis of phenylpropanoids and coumarins49.
The SSR primers exhibited various bands among the treated plants (Fig. 4). 112 bands emerged from the 22 SSR primers, ranging between 130 and 540 bp, with 32 bands having polymorphism ranging from 17–100% (Table 10). These finding revealed the efficiency of SSR primers for differentiating Gladiolus plants, our finding are in harmony with Hiremath et al.50 who used SSR in studying the Genetic diversity and structure analysis for efficient utilization and sustainable management of gladiolus germplasm. On the other hand, our finding revealed that some alleles were affected by laser in their corms and the gene expression was resulted color or abnormalities aspects in leaves and /or flowers. Mutation in some alleles could result abnormalities like mutation in the allele with 410 bp revealed by SSR16. Thess finding are in harmony with Shehata et al.7, who demonstrated that the maximum value of GTS was %40% at 20-milliwatt power for 120min, while the minimum value was recorded at 22.5%at5-milliwatt power for 30s and the control.
Methods
Field experiment and laser treatments
A field experiment was conducted at the Nursery of Ornamental Horticulture Department, Faculty of Agriculture, Cairo University, Egypt, during the seasons of 2021 and 2022 to study the response of growth, quality characteristics, genetic attributes, and anatomy of Gladiolus grandiflorus against several red laser light treatments. Corms of Gladiolus grandiflorus cv. “White Prosperity” were provided by blooms nurseries, Cairo, Egypt with 10–12 cm in circumference and 20–30 gm in weight. The corms of 2.8–3.1 cm in diameter were selected and cured at ambient temperature (28 ± 2 °C) till July and stored under low temperature (5 °C) for 2 months to break their dormancy. Corms were pre-illuminated using He–Ne continuous laser with a wavelength at 630 nm, as light source (equipment whitening, LASER II, DMC Equipment Ltd.). Corms were divided into five groups with five replications for each according to the exposure times (0, 0.5, 1, 3, 5 and 10 min), and power levels [5(low), 20 (medium), and 50 mW (high)], the unirradiated corms were used as control. Then corms planted by the 6th of October on rows in open field. Corms planted on one side of the row, at a spacing of 20 cm within the row, and at a depth of 8–10 cm. All practices, i.e., irrigation and fertilization, were applied as commonly recommended.
Morphological measurements
The following morphological and chemical constituent measurements were conducted on the gladiolus plants:
Sprouting, days to corms sprouting.
Vegetative growth characteristics, Plant height (cm), number of leaves per plant, fresh and dry weights of leaves (g), plant diameter (mm), at 5 cm above soil surface, and leaf area (cm2).
Flowering characteristics, Days to flowering (days), number of flowers per inflorescence, flowers diameters (cm), at the third flowers per inflorescence from the bottom of each spike), inflorescence length (cm), flowers fresh and dry weights per inflorescence (g).
Vase life of flowering (days), After cut flowers were transferred to 500 ml glass jars containing 300 ml of Distilled water was used for the control and to prepare the tested solutions. 2% sucrose was added to all treatments including the control treatment for improving postharvest vase life and quality of flowering.
Corms characteristics, Number of corms per plant, fresh weight of corms and corms circumference.
Chemical constituents
Photosynthetic pigments of leaves: Leaf chlorophyll using the SPAD-502 m (Konica-Minolta, Japan).
Total anthocyanins content of petals (mg/100g petal fresh weight) determined in the third flower from the bottom of each inflorescence was excised after harvest and the petals (100 mg) were diced51.
Total carbohydrates % in the newly formed corms (cormels) and leaves were determined in dried leaves samples52.
Proline content in dried corms (μ moles/g)53.
Total phenols and indole acetic acid54.
Minerals content N, P, and K were determined in corms. Nitrogen was determined by using Kjeldahl methods55, Phosphorus was determined by using spectrophotometer56, while potassium concentration by flam photometer apparatus (BWB-1).
Anatomical structure
Specimens in the second growing season at the age of two months were collected from the medium parts of the leaves of the main stems, killed and fixed in F.A.A. buffer (10ml formalin, 5ml glacial acetic acid, and 85 ml ethyl alcohol 70%) for 48 h. then anatomical process was carried out according to57.
Molecular genetic studies
DNA extraction, primers and SSR markers amplification
DNA separated from irradiated corms and their green leaves and petals as described by Khaled et al.10. 22 SSRs primers were constructed according to Hiremath et al.50. (Table 13). Amplification has proceeded as follows, 94 °C for 1 min (one cycle); 94 °C for 20 s, 50–55 °C for 35 s, 72 °C for 45 s (35 cycles) and the last extension at 72 °C for 45 s (one cycle). The PCR products and DNA Marker Ladder, 11 Fragments (50–1000 bp) were run on electrophoresis at 90 V, in 2% agarose gel containing 0.5 μg/ml ethidium bromide for 2 h. The gel was imagined under UV.
Table 13.
Twenty-two microsatellite characterizations used in Gladiolus grandiflorus cv. “White Prosperity” investigation.
| Primers code | Forward Primer sequence (5′–3′) | Anneal. °C | Reverse Primer sequence (5′–3′) | Anneal. °C | |
|---|---|---|---|---|---|
| 1 | SSR1 | TGCCACTCCAGCATAACTTCTA | 60 | ACTCCTTTTCCTCCCATTCTTC | 60 |
| 2 | SSR2 | GGCATCCTTCCTCTCCGT | 60 | CGGCCTTGGGTGTAGAAGTAG | 60 |
| 3 | SSR3 | GGTATGGAAACCTGCTAAGTGG | 60 | TAGATCCACAATTTCTCCCCAT | 60 |
| 4 | SSR4 | GGAGACTGACTAGGGCAAAAGA | 60 | AACTCCTTGACGCATTACGACT | 60 |
| 5 | SSR5 | GAAGAAGCGTGAGAAATCCATA | 58 | GGACCAACCGCAATAAATAA | 58 |
| 6 | SSR6 | TCTATGTCAGTGCTCTACCGGA | 60 | GAAGCAAACGAGTCTGTGGAC | 60 |
| 7 | SSR7 | AAACCCTCACTTCGGAGATCA | 54 | TAAAGTCAGTCAGCTGTAACACTG | 54 |
| 8 | SSR8 | TTGTTACTGGTGCGGACTCC | 58 | CAGGTCCGATTGCTTGAGGA | 58 |
| 9 | SSR9 | CCAAGTAAGTGATGGCGGC | 56 | GGGTCTAGAGAAGGCTTGGG | 56 |
| 10 | SSR10 | AGAGAAGAGAGCATGGCGATA | 46 | GCGAGAAGTGGCATAAAGAGA | 46 |
| 11 | SSR11 | CCCTAGCAAACATCTCTTCCA | 54 | TGTTATCAGCAAGCAGTCCAG | 54 |
| 12 | SSR12 | AAAGTCCCTCCTCTCCTCTGAT | 60 | GAGCTTGTTACTGAACGGAACC | 60 |
| 13 | SSR13 | CCTTGGTATGGAAACCTGCTAA | 60 | ATAGATCCACAATTTCTCCCCA | 60 |
| 14 | SSR14 | GGAAGCTGTTCTAACGAATGGA | 61 | TATTGGGGATAGAGGGACTTGA | 60 |
| 15 | SSR15 | GCTCACAACAATAATCCTTCCC | 60 | CAATGAACTCAGCAATACCAGC | 60 |
| 16 | SSR16 | GTGTCTTCGGTGCTTTTCTCTT | 60 | CAGCGATAACCTAGAACGAACA | 59 |
| 17 | SSR17 | GGGTCATCGCCTGTCATGAA | 54 | TCGTATCGGCTTGTTGGCTG | 54 |
| 18 | SSR18 | ATGCCTTTGTCCTCTCACCT | 54 | TTTGTCCCTAATTGGAACACGTC | 54 |
| 19 | SSR19 | TCTCCTCCTGTCCGTCTATCC | 45 | AGTCGTCCAAATCTCCGAACT | 45 |
| 20 | SSR20 | AAGCAAAAGGTTTTCCATTCC | 52 | GTTTCTTGTCGAGGAACATGC | 52 |
| 21 | SSR21 | GGGTTTGTATTGTTTGTTGGAGA | 60 | GGGTGATGTGGTCCTTGTAGA | 60 |
| 22 | SSR22 | TATAGAGGAATGCGTGTCCGAT | 61 | TACTGCATGACGAGGAAATCAC | 60 |
Statistical analysis and data scoring
This experiment was factorial [5 exposure time treatments × 4 irradiation treatments (including the control)] and conducted using a randomized complete design with three replicates for each treatment as well as the controls, and 20 corms were used in each treatment. The recorded data were subjected to one-way analysis of variance according to Snedecor and Cochran58. The values of the least significant difference and the means were compared using the least significant difference test at 5% levels of probability. The banding patterns generated by the SSR primers were scored as 0 and 1 of bands for absence and presence. The number of polymorphic and monomorphic bands recorded, as well as the total number of bands and polymorphism%, were all determined by the banding patterns observed and produced by SSR primers. Furthermore, the ability of markers to estimate genetic variability was evaluated by measuring resolving power (RP) from Gorji et al.59, effective multiplex ratio (EMR), marker index (MI) from Varshney et al.60, and polymorphism information content (PIC) from De-Riek et al.61.
Ethical approval
The authors confirm that experimental research on the gladiolus plant (Gladiolus grandiflorus cv. “White Prosperity”), including the collection of plant material, complied with institutional, national, and international guidelines and legislation.
Conclusions
In the current research, Corms of Gladiolus grandiflorus cv. “White Prosperity” was irradiated using He–Ne at 635 nm at various exposure times in minutes (0.0, 0.5, 1, 3, 5 and 10 min.), and three power levels, low, medium, and high in milliwatt (mW) (5, 20, 50 mW). Vegetative growth parameter including (spouting days, Plant height (cm), leaves number, fresh and dry weights (g/plant), plant diameter (mm) and leaf area (cm2), floral parameters including (flowering days, vase life/day), fresh and dry weights of flower (g/plant), number of flowers per spike, spike length(cm), flower diameter(cm), number of corms per corm, corms fresh weight(g/plant) Circumference/corms), pigments (Total chlorophylls in leaves (SPAD), Anthocyanin content (mg/100 g F.W) in petals, NPK (%) in pulp and chemical composition in bulbs total carbohydrates (%),total phenol (μg CE/g (%),total flavonoid (μg CE/g) (%),Antioxidant (DPPH IC50 (μg/ml (%), and Proline content (μ moles /g). All mentioned studied characters illustrated that the medium irradiation power (20 mW for 20 mW for 5 min irradiation significantly increased compared with the control group and other irradiation powers and times. The results showed that the medium level (20 mW) of He–Ne laser at 5 min caused a vital increase in the leaf anatomical features, followed by the low level (5 mW) of He–Ne laser at 5min. Wider xylem vessels due to this treatment lead to increased water and nutrient uptake as well as plant growth. Improving GA formation and release of IAA which is reflected on cell elongation and growth and encourages nutrient and water uptake. Reduction in some of the studied morphological characters were recorded by increasing laser power 50mW and exposure time and resulted in a decrease in all anatomical features of leaves compared to control plants. The author concluded that high laser power or long exposure time may negatively affect the plant growth and some of the studied parameters. Prospective laser studies may use lower power and irradiation time. 112 bands emerged from 22 SSR primers, ranging between 130–540 bp, with 32 bands having polymorphism ranging from 17–100%. Out of the 22 SSR primers, 3 primers exhibited a high polymorphism percentage, i.e., SSR6, SSR16 and SSR22 which exhibited 7 positive markers. These findings revealed the efficiency of SSR primers for differentiating Gladiolus plants and revealed that some alleles were affected by laser in their corms and the expression resulted in color or abnormalities in leaves and/or flowers. Mutation in some alleles could result in abnormalities like mutation in the allele with 410 bp revealed by SSR16 (Supplementary Figure 4).
Supplementary Information
Acknowledgements
We would like to express our gratitude to Cairo University and Beni-Suef University for all of the support we have received, as well as to the staff of the Genetics Laboratory, Faculty of Agriculture, Beni-Suef University for creating an ideal setting in which to conduct our studies. Great thanks and appreciation to Professor Asmaa Al-Attar, Cairo University, Faculty of Agriculture, Department of Ornamental Horticulture, for her contributions to following up research during planting and after harvest and conducting various analyses of plants.
Author contributions
M.H. and K.A.K. contributed conceptualization, M.H. and K.A.K. collected, prepared, and drafted data. K.A.K., M.H., S.A.S., and R.A. contributed writing and approval of the contents. M.H. and K.A.K. did the work of paraphrasing and measuring the plagiarism ratio. K.A.K., M.H., S.A.S., and R.A. generated the numbers and did the final revision. F.M.E., R.A.A.Y. & M.A.A. supervised all stages of manuscript preparation. K.A.K. have read, reviewed, approved, and approved the content of the final version of this review.
Funding
Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).
Data availability
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-024-56430-6.
References
- 1.Abdou MH, El-Sayed AA, Attia FA, Khalil AR. Effect of compost, salicylic and ascorbic acids treatments on vegetative growth and flowering of Gladiolus grandiflorus cv. White Prosperity. Sci. J. Flowers Ornam. Plants. 2014;1(3):223–231. doi: 10.21608/sjfop.2014.4133. [DOI] [Google Scholar]
- 2.Singh R, Kumar M, Raj S, Kumar S. Flowering and corm production in gladiolus (Gladiolus grandiflorus L.) Cv. “White Prosperity” as influenced by integrated nutrient management (INM) Ann. Hortic. 2014;7(1):36–42. [Google Scholar]
- 3.Krawiec M, Dziwulska-Hunek A, Kornarzyński K. The use of physical factors for seed quality improvement of horticultural plants. J. Hortic. Res. 2018;26(2):81–94. doi: 10.2478/johr-2018-0019. [DOI] [Google Scholar]
- 4.Abou-Dahab MAD, et al. In vitro laser radiation induces mutation and growth in Eustoma grandiflorum plant. Bull. Natl. Res. Centre. 2019;43:3. doi: 10.1186/s42269-018-0036-z. [DOI] [Google Scholar]
- 5.Kasumi, M. Studies on induction of flower color mutants in gladiolus (Gladiolus x grandiflora Hort.) by gamma irradiation and tissue culture. Bulletin of the Plant Biotechnology Institute Ibaraki Agricultural Center (Japan) Issue 4, p 1–49, ISSN 1341-2809 (2001).
- 6.Costilla-Hermosillo MG, et al. Laser biostimulation for improving seeds germinative capacity and seedlings growth of Prosopis laevigata and Jacaranda mimosifolia. Madera y bosques. 2019;25(2):6. doi: 10.21829/myb.2019.2521665. [DOI] [Google Scholar]
- 7.Shehata AS, et al. Physiological, anatomical, chemical, and genetic responses of two snap bean (Phaseolus vulgaris L.) varieties to invitro optical bio-stimulation induction. Sci. J. Agric. Sci. 2023;5(1):49–73. [Google Scholar]
- 8.Hernandez AC, et al. Laser in agriculture. Int. Agrophys. 2010;24:407–422. [Google Scholar]
- 9.Janayon, R. V. B., & Guerrero, R. A. Laser irradiation of mung bean (Vigna radiata L.) at two wavelengths for enhanced seedling development. Int. J. Opt. 3479562. 10.1155/2019/3479562 (2019).
- 10.Khaled KA, El-Demardash IS, Amer EAM. Genetic polymorphism among some sugarcane germplasm collections as revealed by RAPD and ISSR analyses. Life Sci. J. 2015;12(3):159–167. [Google Scholar]
- 11.Azzam CR, et al. SRAP and IRAP revealed molecular characterization and genetic relationships among cowpea (Vigna unguiculata L.) irradiated by gamma-ray. Beni-Suef Univ. J. Basic Appl. Sci. 2023;12(1):109. doi: 10.1186/s43088-023-00448-8. [DOI] [Google Scholar]
- 12.Abdelaziz SA, et al. Comparison of four DNA barcoding loci to distinguish between some Apiaceae family species. Beni-Suef Univ. J. Basic Appl. Sci. 2024;13(1):12. doi: 10.1186/s43088-023-00457-7. [DOI] [Google Scholar]
- 13.Khaled KA, El-Arabi NI, Sabry NM, El-Sherbiny S. Sugarcane genotypes assessment under drought conditions using amplified fragment length polymorphism. Biotechnology. 2018;17:120–127. doi: 10.3923/biotech.2018.120.127. [DOI] [Google Scholar]
- 14.Al-Taweel SK, Abdel-Aziz RM, Rabea K, Khaled K. Studying cDNA SCoT in response to salinity stress in Stevia rebaudiana bertoni. SABRAO J. Breed. Genet. 2019;51(3):281–294. [Google Scholar]
- 15.Abou-Sreea AIB, et al. Natural biostimulant attenuates salinity stress effects in chili pepper by remodeling antioxidant, ion, and phytohormone balances and augment gene expression. Plants. 2021;10(11):2316. doi: 10.3390/plants10112316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Salah HA, et al. Production and optimization of xylanase and (alpha)- amylase from non-saccharomyces yeasts (Pichia membranifaciens) J. Pure Appl. Microbiol. 2021;15(1):452–462. doi: 10.22207/JPAM.15.1.43. [DOI] [Google Scholar]
- 17.Khaled KAM, Habiba RMM, Bashasha JA, Azzam CR, Abdel-Aziz MH. In silico and genetic analysis related to tillering ability in maize. SABRAO J. Breed. Genet. 2023;55(1):156–162. doi: 10.54910/sabrao2023.55.1.15. [DOI] [Google Scholar]
- 18.Luo C, et al. Oligo-dT anchored cDNA–SCoT: A novel differential display method for analyzing differential gene expression in response to several stress treatments in mango (Mangifera indica L.) Gene. 2014;548(2):182–189. doi: 10.1016/j.gene.2014.07.024. [DOI] [PubMed] [Google Scholar]
- 19.Gupta PK, et al. Transferable EST-SSR markers for the study of polymorphism and genetic diversity in bread wheat. Mol. Gen. Genomics. 2003;270:315–323. doi: 10.1007/s00438-003-0921-4. [DOI] [PubMed] [Google Scholar]
- 20.Singh N, Pal AK, Roy RK, Tamta S, Rana TS. Development of cpSSR markers for analysis of genetic diversity in gladiolus cultivars. Plant Genet. 2017;10:31–36. doi: 10.1016/j.plgene.2017.05.003. [DOI] [Google Scholar]
- 21.Malkocs T, et al. Isolation and characterization of 15 SSR loci for the endangered European tetraploid species Gladiolus palustris (Iridaceae) Appl. Plant. Sci. 2019;7(5):e01245. doi: 10.1002/aps3.1245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Azzam C, Sultan F, Sayed M, Khaled K. Gamma-rays and microwaves irradiation influence on guar (Cyamopsis Tetragonoloba): II–proteomic analysis linked to plant height and crude proteins. SABRAO J. Breed. Genet. 2022;54(5):1101–1112. doi: 10.54910/sabrao2022.54.5.12. [DOI] [Google Scholar]
- 23.Khaled KAM, Sultan FM, Azzam CR. Gamma- rays and microwave irradiation influence on guar (Cyamopsis tetragonoloba): I—Markers assisted selection for responding to mutagen agents. SABRAO J. Breed. Genet. 2022;54(2):331–349. doi: 10.54910/sabrao2022.54.2.10. [DOI] [Google Scholar]
- 24.Dutta Gupta S, Kumar A, Agarwal A. Impact of light-emitting diodes (LEDs) on the growth and morphogenesis of encapsulated shoot buds of Curculigo orchioides Gaertn an endangered medicinal herb. Acta Physiol. Plant. 2019;41:1–12. doi: 10.1007/s11738-019-2840-y. [DOI] [Google Scholar]
- 25.Abdani NA, Mortazaeinezhad F, Taheri R. Seed germination of medicinal sage is affected by gibberellic acid, magnetic field and laser irradiation. Electromagn. Biol. Med. 2018;37(1):50–56. doi: 10.1080/15368378.2017.1336100. [DOI] [PubMed] [Google Scholar]
- 26.Khamis G, et al. Innovative application of helium-neon laser: enhancing the germination of Adansonia digitata and evaluating the hepatoprotective activities in mice. Environ. Sci. Pollut. Res. 2020;27:1–2. doi: 10.1007/s11356-020-09036-0. [DOI] [PubMed] [Google Scholar]
- 27.Thorat SA, Poojari P, Kaniyassery A, Kiran KR, Satyamoorthy K, Mahato KK, Muthusamy A. Red laser-mediated alterations in seed germination, growth, pigments and withanolide content of Ashwagandha [Withania somnifera (L.) Dunal] J. Photochem. Photobiol. B: Biol. 2021;216:112144. doi: 10.1016/j.jphotobiol.2021.112144. [DOI] [PubMed] [Google Scholar]
- 28.Jin D, et al. Effect of red and blue light on cucumber seedlings grown in a plant factory. Horticulturae. 2023;9(2):124. doi: 10.3390/horticulturae9020124. [DOI] [Google Scholar]
- 29.Al-Sherbini A, El-Gawad HA, Kamal M. Potential of He-Ne laser irradiation and iron nanoparticles to increase growth and yield of pea. Nanotechnology. 2015;3:4. [Google Scholar]
- 30.Możdżeń K, Barabasz-Krasny B, Zandi P. Effect of long-term of He–Ne laser light irradiation on selected physiological processes of Triticale. Plants. 2020;9:1703. doi: 10.3390/plants9121703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Rania AT, Lobna ST, Metwally SA. In vitro cultures of jojoba (Simmondsia chinensis L.) afecting by laser irradiation. J. Chem. Biol. Phys. Sci. 2015;5:3906–3913. [Google Scholar]
- 32.Seo M, Nambara E, Choi G, Yamaguchi S. Interaction of light and hormone signals in germinating seeds. Plant Mol. Biol. 2009;69:463–472. doi: 10.1007/s11103-008-9429-y. [DOI] [PubMed] [Google Scholar]
- 33.Chen YP, Yue M, Wang XL. Influence of He–Ne laser irradiation on seeds thermodynamic parameters and seedlings growth of Isatis indogotica. Plant Sci. 2005;168(3):601–606. doi: 10.1016/j.plantsci.2004.09.005. [DOI] [Google Scholar]
- 34.Krawiec M, Dziwulska-Hunek A, Sujak A, Palonka S. Laser irradiation effects on scorzonera (Scorzonera hispanica L.) seed germination and seedling emergence. Acta Sci. Polonorum. Hortorum Cultus. 2015;14(2):145–158. [Google Scholar]
- 35.Danaila SG, Niculita P, Ristici E, Mona P, Marian R, Burnichi F, Draghici M, Geicu M. The influence of modulated red laser light on seedlings of some annual ornamental species Dianthus caryophyllus and Petunia hybrid. Rom. Biotchnol. Lett. 2011;16(6):34–39. [Google Scholar]
- 36.Marchant MJ, Molina P, Montecinos M, Guzmán L, Balada C, Castro M. Effects of LED Light spectra on the development, phytochemical profile, and antioxidant activity of curcuma longa from Easter Island. Plants. 2022;11(20):2701. doi: 10.3390/plants11202701. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Osman YA, El-Tobgy KM, El-Sherbini ESA. Effect of laser radiation treatments on growth, yield and chemical constituents of fennel and coriander plants. J. Appl. Sci. Res. 2009;5(3):244–252. [Google Scholar]
- 38.Kacharava N, Chanishvili S, Badridze G, Chkhubianishvili E, Janukashvili N. Effect of seed irradiation on the content of antioxidants in leaves of Kidney bean, Cabbage and Beet cultivars. Austr. J. Crop Sci. 2009;3(3):137–145. [Google Scholar]
- 39.Zielińska S, Piątczak E, Kozłowska W, Bohater A, Jezierska-Domaradzka A, Kolniak-Ostek J, Matkowski A. LED illumination and plant growth regulators’ effects on growth and phenolic acids accumulation in Moluccella laevis L. in vitro cultures. Acta Physiol. Plant. 2020;42(5):72. doi: 10.1007/s11738-020-03060-w. [DOI] [Google Scholar]
- 40.Shin KS, Murthy HN, Heo JW, Hahn EJ, Paek KY. The effect of light quality on the growth and development of in vitro cultured Doritaenopsis plants. Acta Physiol. Plant. 2008;30:339–343. doi: 10.1007/s11738-007-0128-0. [DOI] [Google Scholar]
- 41.Cioć M, Szewczyk A, Żupnik M, Kalisz A, Pawłowska B. LED lighting affects plant growth, morphogenesis and phytochemical contents of Myrtus communis L. in vitro. Plant Cell Tissue Organ Cult. 2018;132:433–447. doi: 10.1007/s11240-017-1340-2. [DOI] [Google Scholar]
- 42.Gao L, Li Y, Shen Z, Han R. Responses of He–Ne laser on agronomic traits and the crosstalk between UVR8 signaling and phytochrome B signaling pathway in Arabidopsis thaliana subjected to supplementary ultraviolet-B (UV-B) stress. Protoplasma. 2018;255:761–771. doi: 10.1007/s00709-017-1184-y. [DOI] [PubMed] [Google Scholar]
- 43.Qiu Z, Yuan M, He Y, Li Y, Zhang L. Physiological and transcriptome analysis of He–Ne laser pre-treated wheat seedlings in response to drought stress. Sci. Rep. 2017;7:6108. doi: 10.1038/s41598-017-06518-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Chen H, Han R. He-Ne laser treatment improves the photosynthetic efficiency of wheat exposed to enhanced UV-B radiation. Laser Phys. 2014;24(10):105602. doi: 10.1088/1054-660X/24/10/105602. [DOI] [Google Scholar]
- 45.Swathy PS, Kiran KR, Joshi MB, Mahato KK, Muthusamy A. He–Ne laser accelerates seed germination by modulating growth hormones and reprogramming metabolism in brinjal. Sci. Rep. 2021;11(1):7948. doi: 10.1038/s41598-021-86984-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Hwida MF, Metwally SA, Lobna ST. In vitro growth behavior and leaf anatomical structure of Balanites aegyptiaca and Cotoneoster horizontalis affected by different types of laser radiation. J. Appl. Sci. Res. 2012;8:2386–2396. [Google Scholar]
- 47.Metwally SA, Abou-Ellail M, Abo-Leila BH, Aboud KA. Effect of laser radiation on the growth, anatomical and biochemical genetic markers of Celosia argentea plants. Int. J. Approx. Reason. 2013;5:200–206. [Google Scholar]
- 48.Zrig A, Najar B, Magdy Korany S, Hassan AH, Alsherif EA, Ali Shah A, Fahad S, Selim S, Abd El-gawad H. The interaction effect of laser irradiation and 6-benzylaminopurine improves the chemical composition and biological activities of linseed (Linum usitatissimum) prouts. Biology. 2022;11(10):1398. doi: 10.3390/biology11101398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Balkhyour MA, Tammar AM, Summan AS, Hassan AH. Enhancing biomass and productivity of coumarins and essential oil in ajwain (Trachyspermum ammi) sprouts via laser light treatment. Ind. Crops Prod. 2021;170:113837. doi: 10.1016/j.indcrop.2021.113837. [DOI] [Google Scholar]
- 50.Hiremath, V. et al. Cross species/genera transferability of simple sequence repeat markers, genetic diversity and population structure analysis in gladiolus (Gladiolus × grandiflorus L.) genotypes. Peer J. 11, e15820. 10.7717/peerj.15820 (2023). PMID: 37701831; PMCID: PMC10493085. [DOI] [PMC free article] [PubMed]
- 51.Giusti MM, Wrolstad RE. Characterization and measurement of anthocyanins by UV-visible spectroscopy. In: Wrolstad RE, Acree TE, Decker EA, Penner MH, Reid DS, Schwartz SJ, Shoemaker CF, Smith D, Sporns P, editors. Handbook of Food Analytical Chemistry: Pigments, Colorants, Flavors, Texture, and Bioactive Food Components. John Wiley & Sons; 2005. [Google Scholar]
- 52.DuBois M, Gilles KA, Hamilton JK, Rebers PT, Smith F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956;28(3):350–356. doi: 10.1021/ac60111a017. [DOI] [Google Scholar]
- 53.Bates LS, Waldern RP, Teare LD. Rapid determination of free proline under water stress studies. Plant Soil. 1973;39:205–207. doi: 10.1007/BF00018060. [DOI] [Google Scholar]
- 54.Daniel HD, George CM. Peach seed dormancy in relation to indigenous inhibition and applied growth substances. J. Amer. Soc. Hort. Sci. 1972;97:651–654. doi: 10.21273/JASHS.97.5.651. [DOI] [Google Scholar]
- 55.Kjeldahl C. A new method for the determination of nitrogen in organic matter. Z. Anal. Chem. 1883;22:366. doi: 10.1007/BF01338151. [DOI] [Google Scholar]
- 56.Chen PS, Toribara TT, Warner H. Microdetermination of phosphorus. Analy. Chem. 1956;28(11):1756–1758. doi: 10.1021/ac60119a033. [DOI] [Google Scholar]
- 57.Nassar MA, El-Sahhar KF. Botanical Preparations and Microscopy (Microtechnique) Academic Bookshop; 1998. [Google Scholar]
- 58.Snedecor G, Cochran W. Statistical Methods. 8. Iowa State University Press; 1989. [Google Scholar]
- 59.Gorji AM, Poczai P, Polgar Z, Taller J. Efficiency of arbitrarily amplified dominant markers (SCoT, ISSR and RAPD) for diagnostic fingerprinting in tetraploid potato. Am. J. Potato Res. 2011;88:226–237. doi: 10.1007/s12230-011-9187-2. [DOI] [Google Scholar]
- 60.Varshney RK, Chabane K, Hendre PS, Aggarwal RK, Graner A. Comparative assessment of EST-SSR, EST-SNP and AFLP markers for evaluation of genetic diversity and conservation of genetic resources using wild, cultivated and elite barleys. Plant Sci. 2007;173(6):638–649. doi: 10.1016/j.plantsci.2007.08.010. [DOI] [Google Scholar]
- 61.De Riek J, Calsyn E, Everaert I, Van Bockstaele E, De Loose M. AFLP based alternatives for the assessment of distinctness, uniformity and stability of sugar beet varieties. Theor. Appl. Genet. 2001;103:1254–1265. doi: 10.1007/s001220100710. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.




