Skip to main content
One Health logoLink to One Health
. 2024 Mar 7;18:100708. doi: 10.1016/j.onehlt.2024.100708

Rodent-borne parasites in Qatar: A possible risk at the human-animal-ecosystem interface

Md Mazharul Islam a,b,⁎, Elmoubashar Farag c, Mohammad Mahmudul Hassan d,e, Khalid A Enan f, Ali Mohammadi g,h, Amneh Khaleel Aldiqs a, Hashim Alhussain i, Ebtesam Al Musalmani a, Abdul Azia Al-Zeyara a, Hamad Al-Romaihi c, Hadi M Yassine i, Ali A Sultan j, Devendra Bansal c, Zilungile Mkhize-Kwitshana k,l
PMCID: PMC10944255  PMID: 38496338

Abstract

Rodents are known reservoirs for a diverse group of zoonotic pathogens that can pose a threat to human health. Therefore, it is crucial to investigate these pathogens to institute prevention and control measures. To achieve this, the current study was conducted to investigate the frequency of different parasites in commensal rodents in Qatar. A total of 148 rodents, including Rattus norvegicus, Rattus rattus, and Mus musculus were captured using traps placed in different habitats such as agricultural and livestock farms, residential areas, and other localities. Blood, feces, ectoparasite, and visceral organs were collected for gross, microscopic, immunological, and molecular analysis. The study identified 10 different parasites, including Capillaria annulosa, Eimeria spp., Giardia spp., Hymenolepis diminuta, Mastophorus muris, Ornithonyssus bacoti, Taenia taeniaeformis, Toxoplasma gondii, Trypanosoma lewisi, and Xenopsylla astia. Overall, 62.2% of the rodents tested positive for at least one parasite species. Helminths were found to be the most prevalent parasites (46.0%), followed by ectoparasites (31.8%), and protozoa (10.1%). However, individually, X. astia was the most prevalent (31.8%), whereas C. annulosa was the least common (0.7%). The prevalence of X. astia and H. diminuta significantly differed between habitats (p < 0.05). The sequence analysis of Hymenolepis spp. was closely related to the previously reported H. diminuta in Iran, China, and Mexico. In conclusion, the study identified a diverse range of rodent-borne parasites that are important to public health, with most of them being recorded for the first time among commensal rodents in Qatar.

Keywords: Ectoparasite, Helminth, protozoa, Commensal rodents, Qatar, One Health

1. Background

The majority of emerging and re-emerging infectious diseases are of zoonotic origin [1] and viral in nature [2]. Many countries are facing a rising number of parasitic infections as well [3]. The spillover of zoonotic parasites to the humans occurs from different sources, including livestock, pets, poultry, fishes, and wild animals, including rodents [4,5]. Rodents are the largest terrestrial mammalian group, with approximately 10% are considered pests [6]. In Middle Eastern countries, an estimated 100 helminth species have been reported in rodents, of which 22 are of considerable public health concern [7]. These animals also carry several vectors for zoonotic pathogens. For instance, the oriental rat flea, Xenopsylla cheopis carries Rickettsia typhi, the causal agent of typhus fevers in humans [8]. Some rodent-borne diseases, such as Q fever, leishmaniasis, schistosomiasis, and soil-transmitted helminthosis, are considered to be neglected tropical diseases, hence little attention has been paid to their prevention and control. As a result, they are detrimental to human and animal health, as well as economic sustainability, due to increasing morbidity, mortality, production loss, and medical costs [9,10]. Recently, the burden of Q fever was reported to be far greater among humans than in animals [11].

Qatar is a small desert country located in the Arabian Peninsula with three predominant species of commensal rodents: Rattus norvegicus, Rattus rattus and Mus musculus, [12,13]. The country has experienced rapid urbanization and population growth over the last few decades [[14], [15], [16]]. Several rodent-borne parasitic diseases, including echinococcosis, hymenolepiasis, schistosomiasis, cryptosporidiosis, giardiasis, leishmaniasis, and toxoplasmosis, have been reported in this country [[17], [18], [19], [20], [21], [22]]. Currently, there is a significant knowledge gap regarding zoonotic transmissions and dynamics of these parasites in Qatar [23]. Population demographics, rapid urbanization, and agricultural and livestock ventures are all conducive to rodent-mediated parasitic transmission between species at the human-animal-ecosystem interface [3,9,24], with rodents facilitating parasite transmission across these factors. Understanding a disease, its possible hosts, risk factors, and transmission dynamics is essential for early preparedness, prevention, and control [25]. Therefore, the aim of this study was to determine the frequency of parasites in commensal rodents in different habitats in Qatar, as well as identify the factors associated with their occurrence.

2. Materials and methods

2.1. Rodent collection and identification

A total of 148 rodents, 120 R. norvegicus, 24 R. rattus, and 4 M. musculus, were captured using 250 baited traps, consisting of 100 multi rodent traps (MRT) and 150 single rodent traps (SRT) between August 2019 and February 2020. The traps were placed in the evening and left overnight in different habitats across eight mulicipilities of Qatar, including agricultural and livestock farms, human residence, and commercial and industrial areas (Fig. 1). The successful traps were collected the next day morning and transported to the Qatar Central Veterinary Laboratory at the Ministry of Muncipaility. The rodents were examined within four hours after their arrival at the laboratory [13]. The location of capture, habitat, species, age, sex, trap type, body mass index (BMI), and pregnancy status of the trapped rodents were recorded. The BMI was calculated by dividing the body weight (in grams) by the square of the length (in centimeters) (i.e., BMI = body weight (g)/length2 [cm2]) [26].

Fig. 1.

Fig. 1

Location of the trapped rodents in different municipalities of Qatar.

2.2. Blood microscopic examination and ELISA

The rodents were anesthetized using 5% isoflurane inhalation for 3–5 min. A volume of 3–5 ml of blood was collected via cardiac puncture using a vacutainer EDTA tube [27]. The collected blood samples were subsequently examined under a microscope with Giemsa staining for parasites [28]. Commercial ELISA test kits, the multi-species ID Screen® Toxoplasmosis IgG Indirect kit (IDVET, Montpellier) and the Leishmania IgG kit® (Cat No. IB0510, IBL, Minneapolis), were used to detect the presence of anti T. gondii and Leishmania spp. IgG antibodies, following the manufacturers instruction.

2.3. Ectoparasite collection and identification

Ectoparasites were collected from the rodents using a hairdryer, as described elsewhere [29]. The area of the ears, face, and perineum were throughly examined for the presernce of mites and ticks [30]. The ectoparasites found on each rodent were counted and recorded. Direct microscopy was used to validate their identity using conventional external identification criteria [[31], [32], [33].

2.4. Necropsy, feces examination, and histopathology

Following euthanasia, the rodents underwent necropsy, and their liver, stomach, and intestine were examined for the presence of parasitic cysts, worms, or eggs, using conventional identification criteria [[34], [35], [36]]. Additionally, six visceral samples, including the liver, lungs, spleen, kidney, intestine, and diaphragm, were aseptically collected from each rodent and stored at −40 °C for further analysis. Fecal samples were examined for parasitic eggs or ova using microscopy and direct smear techniques with normal saline [[36], [37], [38], [39], [40]]. Furthermore, a small piece of liver from each rodent was fixed in 10% neutral buffered formalin and subjected to paraffin-embedded histological analysis. The liver blocks were sectioned at a 5 μm diameter using a microtome, stained with routine hematoxylin and eosin stains [41], and examined under a microscope for Capillaria hepatica.

2.5. Molecular assays

2.5.1. Sample preparation and genomic DNA extraction

The visceral specimens obtained from each rodent were pooled and homogenized to form a single tissue pool [42]. Genomic DNA was extracted from fecal samples using the QIAamp DNA stool mini kit®, while tissue pools and five randomly selected cestodes were processed using the QIAamp Tissue Mini Kit®, according to manufacturer's instructions (Qiagen, CA, USA). The extracted genomic DNA was stored at -80 °C for further use.

2.5.2. PCR based identification

Conventional and nested PCR techniques were performed to detect Hymenolepis spp. and Giardia lamblia, respectively. Real-time PCR was used for the detection of Leishmania spp. and T. gondii. The detailes of the samples used for pathogen detection, PCR reaction mixture, primers/probes, and amplification are provided in Table 1. ITS 1 and 5.8 s rRNA, gdh, aap3, and b1 genes were included as a positive controls in each amplification reactions. The products of conventional and nested PCR were separated by electrophoresis in a 1% agarose gel (Sigma-Aldrich, USA) and visualized under a UV transilluminator after staining with 0.5 μg/ml of ethidium bromide.

Table 1.

Primers, probes, and the PCR conditions for detecting Hymenolepis spp. Giardia lamblia, Leishmania spp., and Toxoplasma gondii in this study.

Pathogen and sample Primer name Primer (5′-3′) PCR conditions Reference
Hymenolepis spp.; feces and cestode Hym spF GCGGAAGGATCATTACACGTTC 95 °C for 10 min, 35 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s, 72 °C for 5 min, and 12 °C hold [43]
Hym spR GCTGCACTCTTCATCGATCCACG
Giardia lamblia; feces GDHeF TCAACGTYAAYCGYGGYTTC
CGT
95 °C for 10 min, 35 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s, 72 °C for 5 min, and 12 °C hold [44]
GDHiF CAGTACAACTCYGCTCTCGG
GDHiR GTTRTCCTTGCACATCTCC
Leishmania spp.; tissue LeishF GGCGGC-GGTATTATCTCGAT 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 s, 60 °C for 1 min, and 10 °C hold [45]
LeishR ACCACGAGGTAGATGACAGA-CA
Leish (Probe) FAM-ATGTCGGGCATCATC-NFQ
Toxoplasma gondii; tissue ToxoF TCCCCTCTGCTGGCGAAAAGT 45 °C for 10 min, 95 °C for 10 min, 45 cycles of 95 °C for 15 s, 60 °C for 45 s and 10 °C hold [46]
ToxoR AGCGTTCGTGGTCAACTATCG
ATTG
Toxo (Probe) FAM-TCTGTGCAACTTTGGTGT
ATTCGCAG-TAMRA

2.5.3. Sequencing and phylogenetic analysis

The PCR products of cestode samples were purified using the AddPrep PCR purification kit according to the manufacturer's instructions (www.addbioinc.com). Sanger sequencing was performed on the purufied products at SolGent Co. Ltd., Daejeon, 34,014, Korea (http://www.solgent.com). The sequencing electropherograms were analyzed using the BioEdit Sequence Alignment Editor, and sequence alignment was generated using Gene Doc software. BLAST similarity searches were conducted in the GeneBank database, and representative sequences from other regions of the world were downloaded for comparative analysis. Furthermore, all sequences generated in this study were compared with each other within their respective groups to calculate percent pairwise identities. To study the genetic relationship of H. diminuta among global sequence, phylogenetic analysis was performed using MEGA-11 software (https://www.megasoftware.net/). Hasegawa-Kishono-Yano (HKY) model with 1000 bootstrap replications was used for constructing a Neighbour-Joining tree in Geneious Prime 2022.0.2 software.

2.6. Statistical analysis

The field and laboratory data were recorded in a Microsoft Excel 2016 spreadsheet, and statistical analyses were performed using STATA/IC- 13 (STATA Corp LLC, Lakeway Drive, TX, USA). Descriptive analysis was performed to calculate the overall prevalence of parasites, which was expressed as a percentage along with the frequency and a 95% confidence interval (CI). Ectoparasite indices were determined for each type of ectoparasite (fleas or mites) by dividing the total number of detected ectoparasites by the total number of rodents sampled [47].

Univariate analysis was conducted using the Fisher exact test to explore associations between parasitic prevalence and various factors related to demographics (rodent species, age, sex, and BMI), trap type, and habitats. Univariate logistic regression was performed to assess the strength of association between the two specific parasites and the fleas, which were assumed to be the intermediate host for those parasites. The results of the univariate logistic regression were presented as percentages and p-values.

3. Results

3.1. Description and general prevalence of parasites

A total of 10 parasite species were identified in the tested rodents (Table 2). Helminths were found to be the most common parasite (45.9%), followed by ectoparasites (31.8%) and protozoa (10.1%). Regarding individual species, X. astia was the most prevalent (31.76%) parasite, whereas the least prevalent parasite was Capillaria annulosa (0.68%).

Table 2.

Commensal rodent-borne parasitic prevalence in Qatar.

Parasites Rattus norvegicus
(n = 120)
Rattus rattus
(n = 24)
Mus musculus
(n = 4)
Overall
(N = 148)
Ectoparasites 42, 35.0 (26.5–44.2) 4, 16.7 (4.8–37.4 1, 25.0 (0.6–80.6) 47, 31.8 (24.4–39.9)
Ornithonyssus bacoti 4, 3.3 (0.9–8.3) – – 4, 2.7 (0.7–6.8)
Xenopsylla astia 42, 35.0 (26.5–44.2) 4, 16.7 (4.8–37.4) 1, 25.0 (0.6–80.6) 47, 31.8 (24.4–39.9)
Helminths 61, 50.8 (42.0–59.6) 6, 25.0 (9.8–46.7) 1, 25.0 (0.6–80.6) 68, 45.9 (38.1–54.0)
Capillaria annulosa 1, 0.8 (0.12–4.6) – – 1, 0.7 (0.1–3.7)
Hymenolepis diminuta 36, 30.0 (21.9–39.1) 6, 25.0 (9.8–46.7) – 42, 28.4 (21.3–36.4)
Mastophorus muris. 23, 19.2 (12.6–27.4) – 1, 25.0 (0.6–80.6) 24, 16.2 (10.7–23.2)
Taenia taeniaeformis 25, 29.1 (19.8–39.1) – – 25, 16.9 (11.7–23.7)
Protozoa 9, 7.5 (4.0–13.6) 6, 25 (12.0–44.9) – 15, 10.1 (6.2–16.0)
Eimeria spp. 4, 3.3 (1.3–8.3) 1, 4.1 (0.7–20.2) – 5, 2.7 (1.1–6.7)
Giardia spp. 4, 3.3 (0.9–8.3) 2, 8.3 (1.1–26.3) – 6, 4.1 (1.5–8.6)
Toxoplasma gondii 2, 2.3 (0.3–8.2) – – 2, 1.4 (1.3–5.3)
Trypanosoma lewisi 1, 0.8 (0.12–4.6) 3, 12.5 (2.7–32.3) – 4, 2.7 (0.7–6.8)
Overall 77, 64.2 (55.3–72.2) 13, 54.2 (35.1–72.1) 2, 50.0 (15.0–85.0) 92, 62.2 (54.1–69.6)
Result presented as total number of positive rodents, prevalence (95% Confidence Interval)

The overall parasitic prevalence was 62.2% (Table 2), with 31.8% positive for one parasite species, and 30.4% were coinfected (carring two or more parasite species) (Table 3). As the capture number of R. rattus (n = 24) and M. musculus (n = 4) was small, no further statistical analysis for these two species could be performed.

Table 3.

Parasite species load among different rodent species.

Rodent species No of parasite species Total rodent positive, % (95%CI)
Rattus norvegicus (n = 120) 1 35, 29.2 (21.8–37.8)
2 27, 22.5 (15.9–30.8)
3 10, 8.3 (4.6–14.7)
4 3, 2.5 (0.9–7.1)
5 1, 0.9, (0.1–4.6)
6 1, 0.9, (0.1–4.6)
Rattus rattus (n = 24) 1 10, 41.7 (24.5–61.2)
2 3, 12.5 (4.3–31.0)
Mus musculus (n = 4) 1 2, 50.0 (15.0–85.0)

3.2. Rodent-borne ectoparasites

On the trapped rodents, 249 fleas (X. astia) were found, with 79% being female and 21% male. All three rodent species had X. astia, with a prevalence of 35.0% on R. norvegicus, 16.7% on R. rattus, and 25.0% on M. musculus. This corresponds to flea indices of 1.9, 0.6, and 0.8, respectively. Additionally, four mites (Ornithonyssus bacoti) were detected only on R. norvegicus, with a mite prevalence of 3.3% and an index of 0.03. The Fisher exact test revealed a significantly higher prevalence of X. astia (p = 0.01) on R. norvegicus from agricultural farms (48.3%), followed by livestock farms (39.7%), and other sources (15.2%) (Table 4).

Table 4.

Univariate association between different categories and ectoparasite prevalence in Rattus norvegicus.

Categories Xenopsylla astia
Ornithonyssus bacoti
Positive (%) p-value Positive (%) p-value
Age
Adult (n = 115) 41 (35.7) 0.47 4 (3.5) 0.67
Young (n = 5) 1 (20.0) 0 (0.0)



Sex
Female (n = 62) 21 (33.9) 0.79 3 (4.8) 0.34
Male (n = 58) 25 (36.2) 1 (1.7)



Pregnancy
Pregnant (n = 16) 4 (25.0) 0.38 1 (6.3) 0.76
Non-pregnant (n = 46) 17 (37.0) 2 (4.4)



Body Mass Index
Low (13) 4 (30.8) 0.75 0 (0.0) 0.42
Normal (67) 26 (38.8) 4 (6.0)
High (35) 11 (31.4) 0 (0.0)



Habitats
Agricultural farm (n = 29) 14 (48.3) 0.01 1 (3.5) 0.42
Livestock farm (n = 58) 23 (39.7) 3 (8.2)
Other areas⁎ (n = 44) 5 (15.2) 0 (0.0)



Trap type
Single rodent trap (51) 19 (37.3) 0.70 1 (2.0) 0.64
Multi rodent trap (69) 23 (33.3) 3 (4.3)
⁎

Other areas: Human residence, industrial area, and commercial area.

3.3. Rodent-borne helminths

H. diminuta was the most prevalent helminth (28.4%) detected in the intestine and feces (Fig. 2 and Table 2) and was confirmed by PCR followed by Sanger sequencing and phylogenetic analysis. The phylogenetic analysis revealed that the five cestodes shared two identical gene sequences, assigned NCBI GenBank accession numbers OM778284 and OM773635. These two gene sequences showed 97–100% nucleotide sequence identity with the H. diminuta reference genomes. The Neighbour-Joining phylogenetic tree placed them in the same clade, closely related to sequences reported from the Canary Islands, South Africa, Australia, Iran, Spain, China, and Mexico (Fig. 3).

Fig. 2.

Fig. 2

Helminths detected from commensal rodents in Qatar. Cysticercus fasciolaris (A' is the larva from a cyst) in a liver (A), Eggs of Hymenolepis diminuta (B), Capillaria annulosa (C), and Mastophorus muris (D′ is a M. muris found in rodent stomach) (D) in rodent feces.

Fig. 3.

Fig. 3

The Neighbour-Joining phylogenetic tree of the Hymenolepis diminuta ITS1 and 5.8 s ribosomal RNA partial gene sequences generated in the present study from rodents in Qatar (n = 2) and related sequences downloaded from NCBI-GenBank reported during 2003–2022 worldwide.

Furthermore, 24 rodents (16.2%) were tested positive for Mastophorus muris, either through detection of nematodes in the stomach or eggs in the feces (Fig. 2). Notably, none of the R. rattus tested positive for M. muris. The majority (70%) of the 25 livers positive for Cysticercus fasciolaris (Cysticerci of Taenia taeniaeformis) had a single cyst, whereas the remaining livers (30%) had two to three cysts. T. taeniaeformis and C. annulosa were only detected in R. norvegicus. However, neither gross nor histological investigation revealed the presence of C. hepatica in the livers.

The Fisher exact test revealed that the prevalence of H. diminuta was significantly higher (p = 0.00) in the livestock farms (39.7%), followed by agriculture farms (37.9%) and other sources (6.1%) (Table 5). The logistic regression revealed a positive correlation between the prevalence of H. diminuta (OR = 4.13; p = 0.00) and the higher prevalence of X. astia (Table 6).

Table 5.

Univariate association between different categories and helminth prevalence in Rattus norvegicus.

Categories Hymenolepis diminuta
Mastophorus muris
Taenia taeniaeformis
n (Positive) % p-value n (Positive) % p-value n (Positive) % p-value
Age
Adult 115 (36) 31.3 0.14 115 (23) 20.0 0.27 82 (25) 30.5
0.19
Young 5 (0) 0.0 5 (0) 0.00 4 (0) 0.00



Sex
Female 62 (18) 29.0 0.81 62 (14) 22.6 0.33 38 (8) 21.1
0.15
Male 58 (20) 31.0 58 (9) 15.5 48 (17) 35.4



Pregnancy
Pregnant 16 (6) 37.5 0.39 16 (2) 12.5 0.26 11 (2) 18.2 0.78
Non-pregnant 46 (12) 16.1 46 (12) 26.1 27 (6) 22.2



Body Mass Index
Low 13 (2) 15.4 0.34 13 (2) 15.4 0.49 10 (2) 20 0.34
Normal 67 (21) 31.3 67 (16) 23.9 50 (18) 36.0
High 35 (13) 37.1 35 (5) 14.3 5 (5) 25.0



Habitats
Agricultural farm 29 (11) 37.9 0.00 29 (5) 17.2 0.67 24 (9) 37.5. 0.22
Livestock farm 58 (23) 39.7 58 (13) 22.4 46 (14) 30.4
Other areas⁎ 33 (2) 6.1 33 (5) 15.1 16 (2) 12.5



Trap type
Single rodent trap 51 (21) 41.2 0.03 51 (10) 19.6 1.00 40 (8) 20.0 0.26
Multi rodent trap 69 (15) 21.7 69 (13) 18.8 46 (17) 11.6
⁎

Other areas: Human residence, industrial area, and commercial area.

Table 6.

Univariate logistic regression of the effect of fleas on the prevalence of parasites in rodents.

Parasites Odds Ratio p-value 95%CI
Hymenolepis diminua 4.13 0.00 1.93–8.83
Trypanosoma lewisi 0.73 0.79 0.06–7.98

3.4. Rodent-borne protozoa

Out of the 148 tested fecal samples, five samples were positive for Eimeria spp. (Fig. 4). Six fecal specimens were found to be positive for Giardia spp. by microscopic examination, but negative for Giardia lamblia by PCR. By ELISA or PCR, none of the samples tested positive for Leishmania spp. Two samples (1.4%) tested positive for IgG against T. gondii by ELISA, however none of the tissue samples were positive by PCR. It is worth noting that Eimeria spp. exhibited a higher prevalence among female rodents (4.8%) compared to male rodents (1.7%) (p = 0.03) in R. norvegicus (Table 7). Additionally, Giardia spp. showed a significantly higher prevalence (p = 0.01) among young rodents (40.0%) compared to adults (1.7%).

Fig. 4.

Fig. 4

Eimeria spp. oocyst (A) and Giardia spp. oocyst (B) in feces and Trypanosoma lewisi worm (C) in blood (indicated by arrows) of rodents in Qatar. A' and B′ are the large size figure of the respective parasite oocysts.

Table 7.

Univariate association between different categories and protozoa prevalence in Rattus norvegicus.

Categories (n) Eimeria spp.
Giardia spp.
Toxoplasma gondii
Positive (%) p-value Positive (%) p-value Positive (%) p-value
Age
Adult (115) 4 (3.5) 1.00 2 (1.7) 0.00 2 (1.7) 0.77
Young (5) 0 (0.0) 2 (40.0) 0 (0.0)



Sex
Female (62) 3 (4.8) 0.03 1 (1.6) 0.28 0 (0.0) 0.14
Male (58) 1 (1.7) 3 (5.2) 2 (3.45)



Pregnancy
Pregnant (16) 3 (18.8) 1.00 0 (0.0) 0.55 0 (0.0) –
Non-pregnant (46) 0 (0.0) 1 (2.2) 0 (0.0)



Body Mass Index
Low (13) 1 (7.7) 0.07 0 (0.0) 0.64 0 (0.0) 0.64
Normal (67) 2 (3.0) 2 (3.0) 2 (3.0)
High (35) 1 (2.9) 0 (0.0) 0 (0.0)



Habitats
Agricultural farm (29) 2 (6.7) 1.00 1 (3.5) 1.00 0 (0.0) 0.34
Livestock farm (58) 0 (0.0) 2 (3.5) 2 (3.45)
Other areas⁎ (22) 2 (9.1) 1 (3.0) 0 (0.0)



Trap types
Single rodent trap (51) 1 (2.0) 0.64 2 (3.9) 1.00 0 (0.0) 0.51
Multi rodent trap (69) 3 (4.5) 2 (2.9) 2 (2.3)
⁎

Other areas: Human residence, industrial area, and commercial area.

4. Discussion

Most emerging infectious diseases have their origins in wildlife species, and changes in the human-animal-ecosystem interface play a significant role in facilitating pathogen transmission at this interface. While many parasites do not cause the death of their host, they can induce various pathologies, including weakness and anemia. Parasitic infection in rodents can reduce their competitive abilities and make them more susceptibe to predators [48,49]. However, certain rodent-borne parasites such as leishmaniasis, toxoplasmosis, and hymenolepiasis are extrementaly important at the One Health interface. The goal of this study was to assess the risk of rodent-borne parasites at the human-animal interface and determine the frequency patterns across different habitats in Qatar. A total of ten parasite species were identified in this study, of which only X. astia and H. diminuta had been previously reported [50]. The remaining eight parasite species were detected in the country for the first time.

In the present study, we found that the prevalence of the flea was highest on R. norvegisus, followed by R. rattus and M. musculus. This finding is inconsistent with a previous report in the Middle East, where the overall prevalence of fleas was highest on R. norvegicus (44.4%), followed by R. rattus (33.9%), and M. musculus (21.6%) [51]. Recently, we reported that rodent-borne fleas and mites in Qatar carry Rickettsia spp. [42], suggesting that X. astia and O. bacoti may play a role in transmitting Rickettsial pathogens at the human-animal-ecosystem interface through rodents [23].

Among the four helminth species identified in this study, H. diminuta and T. taeniaeformis were the most prevalent. H. diminuta is a common intestinal parasite found in small rodents worldwide [7,52], including in Qatar [50]. H. diminuta can be transmitted by arthropod vectors such as beetles, caterpillars, cockroaches, and fleas [52]. Humans, particularly children, can acquire H. diminuta infection by accidentally ingesting the intermediate host containing the cysticerci of the cestode [52,53]. A previous study identified cysticerci of H. diminuta in X. cheopis [54]. In this study, a positive correlation was observed between the prevalence of H. diminuta and X. astia, which corroborates with previous studies [50]. Cats are the primary host and rodents act as intermediate host of T. taeniaeformis [36]. Previous studies detected eggs of T. taeniaeformis in cats in Qatar [17], indicating that it is a common parasite at the cat-rodent interface in the country. Although M. muris and C. annulosa are not considered of significant public health concern [7], they can negatively impact rodent health [55]. Previous studies have reported the presence of M. muris in rodents in Egypt and Iran [56,57], and C. annulosa in Iran [58].

Eimeria parasites are not zoonotic but are economically important as they infect livestock and poultry [59]. However, the degree of host specificity of rodent eimeriosis is still not clearly known [60]. Giardia muris and Giardia microti are commonly reported among rodents but do not have any zoonotic importance [61]. On the other hand, G. lamblia is a zoonotic parasite that can infect humans, pets, livestock, and other mammals, including rodents [62]. In Qatar, G. lamblia is a common cause of enteritis among humans and animals [22,63]. The Giradia spp. detected in this study are not G. lamblia; they may be some other species, like G. muris and G. microti, which requires further confirmation.

A single study reported that toxoplasmosis is endemic among humans in Qatar [20]. This protozoan has been reported to cause abortion among livestock animals in this country [63]. Cats are considered a source of disease transmission at the human-animal interface [18,64]. In the present study, T. gondii seroprevalence was found to be low in rodents. Furthermore, T. lewisi causes murine trypanosomiasis in domestic rodents worldwide [32] and occasionally infects humans [65,66]. Previous studies have reported that Ceratophyllus fasciatus, Nosopsyllus fasciatus, X. cheopis, and Xenopsylla nubica act as biological carriers of T. lewisi [67,68], but there is a dearth of knowledge on the pathophysiology and epidemiology of T. lewisi in Qatar due to lack of studies.

The current surge in emerging and re-emerging infectious diseases has aroused public health concerns for medical and veterinary practitioners as well as policymakers regarding their origin, transmission dynamics, and severity [2,9]. We identified ten species of parasites that infect rodents in Qatar, some of which have the potential to infect humans, livestock, dogs, cats and other animals. Peri-urban rodents, such as Rattus spp. and Mus spp. usually prefer to live in cities [69]. Urbanization can increases the likelihood of rodent infestation and risk of related zoonoses at the human-animal interface [48,70,71]. This is important in light of the rapid urbanization and agricultural development in Qatar over recent years. X. astia and H. diminuta across different habitats in Qatar, with higher prevalence in agricultural and animal farming facilities. The animal farms in Qatar typically keep multiple species of animals with minimal biosecurity practices, which makes it easier for rodents to infest these places. For this region, it is commonly and strongly recommended to institute well-structured and enhanced farm biosecurity measures to control the spread of identified parasites and their zoonotic transmission at the human-animal-ecosystem interface. It is crucial to comprhend the burden of the rodent population and maintain an eco-friendly rodent population within the Qatari ecosystem through integrated pest management [72]. Public health authorities, community leaders, and policymakers should establish guidelines and policies aimed at diminsihing rodent-borne zoonotic risks. A shareed awareness within the community and support from the media are pivotal aspects in achieving this objective [2]. A One Health framework was proposed to combat the risks associated to rodent-borne pathogens in Qatar [73]. We suggest to enriched and implicat the framework as presented in Fig. 5.

Fig. 5.

Fig. 5

Possible key activities to combat risk associated with rodent-borne parasites for effective One Health intervention.

Our study has some limitations: first, due to limited resources, direct smear method was used to detect fecal parasites, which may have underestimated parasitic prevalence due to false-negative results; second, we collected a limited number of samples from M. musculus and R. rattus; third, the use of MRT could have led to biased ectoparasite prevalence.

5. Conclusions

The current study has identified a diverse range of rodent-borne ectoparasites, helminths, and protozoa. Out of the 10 species of rodent-borne parasites, X. astia, O. bacoti, H. diminuta, T. gondii, T. lewisi, and T. taeniaeformis are important for public health and, as such, require urgent action for their prevention and control. Commensal rodents can mediate the transmission of these parasites at the human-animal-ecosystem interface. In addition, with the exception of X. astia and H. diminuta, all parasite species detected in this study are for the first time recorded in commensal rodents across different habitats in the history of Qatar. Further studies are required to identify the biology and transmission dynamics of these parasites in these habitats.

Funding

This research was funded by the Ministry of Public Health, Qatar.

Ethical permission

Ethical clearance for the current study was obtained from the “Institutional Animal Care and use Committee” of the Ministry of Municipality and Environment in the State of Qatar. with permission number IACUC-A-MME-4, dated 09 Feb 2020.

Authorship contribution statement

Md Mazharul Islam: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review & editing. Elmoubashar Farag: Conceptualization, Resources, Supervision, Visualization, Writing – review & editing. Mohammad Mahmudul Hassan: Formal analysis, Writing – original draft, Writing – review & editing. Khalid A. Enan: Methodology, Writing – review & editing. Ali Mohammadi: Methodology, Writing – review & editing. Amneh Khaleel Aldiqs: Methodology, Writing – review & editing. Hashim Alhussain: Methodology, Writing – review & editing. Ebtesam Al Musalmani: Investigation, Methodology, Writing – review & editing. Abdul Azia Al-Zeyara: Project administration, Writing – review & editing. Hamad Al-Romaihi: Funding acquisition, Project administration, Writing – review & editing. Hadi M. Yassine: Resources, Writing – review & editing. Ali A. Sultan: Funding acquisition, Visualization, Writing – review & editing. Devendra Bansal: Visualization, Writing – review & editing. Zilungile Mkhize-Kwitshana: Conceptualization, Visualization, Writing – original draft, Writing – review & editing.

Declaration of competing interest

The authors declare no conflict of interest.

Acknowledgments

The authors would like to express their gratitude for the facility support provided by the Department of Animal Resources, Qatar, and the Biomedical Research Center of Qatar University for this research. They would also like to extend thanks to the Central Laboratory of the Ministry of Higher Education and Scientific Research, Sudan, for their support in providing the positive control of some tested pathogens. The authors would like to acknowledge Swaid Ali Al Malki, Dr. Abdullah Al Marri, Dr. Randa Abdeen, Syed Zahed Ali, Golam Dastagir Syed, and Newaj Abdul Majeed for their cordial support in this research. Additionally, the authors are grateful for the assistance of Dr. Ross S. MacDonald (Health Sciences Library, Weill Cornell Medicine, Qatar) and Syed Shariq Jaffrey (Ministry of Public Health, Qatar) for their English editing of the manuscript.

Data availability

Data will be made available on request.

References

  • 1.Jones K.E., Patel N.G., Levy M.A., Storeygard A., Balk D., Gittleman J.L., Daszak P. Global trends in emerging infectious diseases. Nature. 2008;451:990–993. doi: 10.1038/nature06536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Mostafavi E., Ghasemian A., Abdinasir A., Nematollahi Mahani S.A., Rawaf S., Salehi Vaziri M., Gouya M.M., Nhu T. Minh, Nguyen S. Al Awaidy, Al Ariqi L., et al. Emerging and re-emerging infectious diseases in the WHO Eastern Mediterranean region, 2001-2018. Int. J. Health Policy Manag. 2021 doi: 10.34172/ijhpm.2021.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Alasil S., Abdullah K. An epidemiological review on emerging and re-emerging parasitic infectious diseases in Malaysia. Open Microbiol. J. 2019;13:112–120. doi: 10.2174/1874285801913010112. [DOI] [Google Scholar]
  • 4.Meerburg B.G., Singleton G.R., Kijlstra A. Rodent-borne diseases and their risks for public health. Crit. Rev. Microbiol. 2009;35:221–270. doi: 10.1080/10408410902989837. [DOI] [PubMed] [Google Scholar]
  • 5.Thompson R.C.A., Kutz S.J., Smith A. Parasite zoonoses and wildlife: emerging issues. Int. J. Environ. Res. Public Health. 2009;6:678–693. doi: 10.3390/ijerph6020678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Han B.A., Schmidt J.P., Bowden S.E., Drake J.M. Rodent reservoirs of future zoonotic diseases. Proc. Natl. Acad. Sci. USA. 2015;112:7039–7044. doi: 10.1073/pnas.1501598112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Islam M.M., Farag E., Hassan M.M., Bansal D., Awaidy S.A., Abubakar A., Al-Rumaihi H., Mkhize-Kwitshana Z. Helminth parasites among rodents in the Middle East countries: a systematic review and meta-analysis. Animals (Basel) 2020;10:2342. doi: 10.3390/ani10122342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Christou C., Psaroulaki A., Antoniou M., Toumazos P., Ioannou I., Mazeris A., Chochlakis D., Tselentis Y. Rickettsia typhi and Rickettsia felis in Xenopsylla cheopis and Leptopsylla segnis parasitizing rats in Cyprus. Am. J. Trop. Med. Hyg. 2010;83:1301–1304. doi: 10.4269/ajtmh.2010.10-0118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Atehmengo N.L., Nnagbo C.S. Emerging animal parasitic diseases: a global overview and appropriate strategies for their monitoring and surveillance in Nigeria. Open Microbiol. J. 2014;8:87–94. doi: 10.2174/1874285801408010087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Engels D., Zhou X.-N. Neglected tropical diseases: an effective global response to local poverty-related disease priorities. Infect. Dis. Povert. 2020;9:10. doi: 10.1186/s40249-020-0630-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Noguera L.P.Z., Charypkhan D., Hartnack S., Torgerson P.R., Rüegg S.R. The dual burden of animal and human zoonoses: a systematic review. PLoS Negl. Trop. Dis. 2022;16 doi: 10.1371/journal.pntd.0010540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Noureldin S., Farrag H. Qatar State; Qatar Foundation Annual Research Forum Proceedings. Hamad bin Khalifa University Press Doha; Qatar: 2010. Rodent control strategy in animal farms (Izzab) [Google Scholar]
  • 13.Islam M.M., Farag E., Mahmoudi A., Hassan M.M., Atta M., Mostafavi E., Alnager I.A., Farrag H.A., Eljack G.E.A., Bansal D., et al. Morphometric Study of Mus musculus, Rattus norvegicus, and Rattus rattus in Qatar. Animals (Basel) 2021:11. doi: 10.3390/ani11082162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.The World Bank Total Population, Qatar. 2022. https://data.worldbank.org/indicator/SP.POP.TOTL?locations=QA Available online:
  • 15.The World Bank The Country Data, Qatar. 2022. https://data.worldbank.org/country/qatar Available online:
  • 16.Shandas V., Makido Y., Ferwati M.S. Rapid urban growth and land use patterns in Doha, Qatar: opportunities for sustainability? Eur. J. Sustain. Develop. Res. 2017;1:1–13. doi: 10.20897/ejosdr.201711. [DOI] [Google Scholar]
  • 17.Abu-Madi M.A., Behnke J.M., Prabhaker K.S., Al-Ibrahim R., Lewis J.W. Intestinal helminths of feral cat populations from urban and suburban districts of Qatar. Vet. Parasitol. 2010;168:284–292. doi: 10.1016/j.vetpar.2009.11.027. [DOI] [PubMed] [Google Scholar]
  • 18.Dubey J.P., Pas A., Rajendran C., Kwok O.C.H., Ferreira L.R., Martins J., Hebel C., Hammer S., Su C. Toxoplasmosis in sand cats (Felis margarita) and other animals in the breeding Centre for Endangered Arabian Wildlife in the United Arab Emirates and Al Wabra wildlife preservation, the State of Qatar. Vet. Parasitol. 2010;172:195–203. doi: 10.1016/j.vetpar.2010.05.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lima C., Colella V., Latrofa M.S., Cardoso L., Otranto D., Alho A.M. Molecular detection of Leishmania spp. in dogs and a cat from Doha, Qatar. Parasit. Vectors. 2019;12:125. doi: 10.1186/s13071-019-3394-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Abu-Madi M.A., Al-Molawi N., Behnke J.M. Seroprevalence and epidemiological correlates of Toxoplasma gondii infections among patients referred for hospital-based serological testing in Doha. Qatar. Parasit Vect. 2008;1:39. doi: 10.1186/1756-3305-1-39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Abu-Madi M.A., Behnke J.M., Ismail A., Al-Olaqi N., Al-Zaher K., El-Ibrahim R. Comparison of intestinal parasitic infection in newly arrived and resident workers in Qatar. Parasit. Vectors. 2011;4:211. doi: 10.1186/1756-3305-4-211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Boughattas S., Behnke J.M., Al-Ansari K., Sharma A., Abu-Alainin W., Al-Thani A., Abu-Madi M.A. Molecular analysis of the enteric protozoa associated with acute diarrhea in hospitalized children. Frontiers in cellular and infection. Microbiology. 2017;7 doi: 10.3389/fcimb.2017.00343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Islam M.M., Farag E., Mahmoudi A., Hassan M.M., Mostafavi E., Enan K.A., Al-Romaihi H., Atta M., El Hussein A.R.M., Mkhize-Kwitshana Z. Rodent-related zoonotic pathogens at the human-animal-environment Interface in Qatar: a systematic review and meta-analysis. Int. J. Environ. Res. Public Health. 2021;18 doi: 10.3390/ijerph18115928. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Petersen E., Petrosillo N., Koopmans M., Beeching N., Di Caro A., Gkrania-Klotsas E., Kantele A., Kohlmann R., Koopmans M., Lim P.L., et al. Emerging infections—an increasingly important topic: review by the emerging infections task force. Clin. Microbiol. Infect. 2018;24:369–375. doi: 10.1016/j.cmi.2017.10.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Rahmann G., Seip H. Alternative management strategies to prevent and control endo-parasite diseases in sheep and goat farming systems - a review of the recent scientific knowledge. Landbauforschung Volkenrode. 2007;57 [Google Scholar]
  • 26.Novelli E.L., Diniz Y.S., Galhardi C.M., Ebaid G.M., Rodrigues H.G., Mani F., Fernandes A.A., Cicogna A.C., Novelli Filho J.L. Anthropometrical parameters and markers of obesity in rats. Lab. Anim. 2007;41:111–119. doi: 10.1258/002367707779399518. [DOI] [PubMed] [Google Scholar]
  • 27.Parasuraman S., Raveendran R., Kesavan R. Blood sample collection in small laboratory animals. J. Pharmacol. Pharmacother. 2010;1:87–93. doi: 10.4103/0976-500X.72350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Thrall M.A. Lippincott Williams & Wilkins; Philadelphia: 2005. Veterinary Hematology and Clinical Chemistry. [Google Scholar]
  • 29.Herrero-Cófreces S., Flechoso M.F., Rodríguez-Pastor R., Luque-Larena J.J., Mougeot F. Patterns of flea infestation in rodents and insectivores from intensified agro-ecosystems, Northwest Spain. Parasit. Vectors. 2021;14:16. doi: 10.1186/s13071-020-04492-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Stekolnikov A., Alghamdi S., Alagaili A., Makepeace B. First data on chigger mites (Acariformes: Trombiculidae) of Saudi Arabia, with a description of four new species. Systemat. Appl. Acarol. 2019;24:1937–1963. doi: 10.11158/saa.24.10.12. [DOI] [Google Scholar]
  • 31.Huynh L.N., Diarra A.Z., Pham Q.L., Berenger J.-M., Ho V.H., Nguyen X.Q., Parola P. Identification of vietnamese flea species and their associated microorganisms using morphological, molecular, and protein profiling. Microorganisms. 2023;11:716. doi: 10.3390/microorganisms11030716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Durden L.A., Traub R. In: Medical and Veterinary Entomology. Mullen G., Durden L., editors. Academic Press; San Diego: 2002. FLEAS (Siphonaptera) pp. 103–125. [Google Scholar]
  • 33.Centers for Disease Control and Prevention . U.S. Department of Health, Education, and Welfare; Atlanta: 1967. Pictorial Keys to Arthropods, Reptiles, Birds and Mammals of Public Health Significance. [Google Scholar]
  • 34.Baker D.G. Blackwell Publishing; Ames, Iowa: 2007. Flynn’s Parasites of Laboratory Animals. [Google Scholar]
  • 35.Viney M., Kikuchi T. Strongyloides ratti and S. Venezuelensis - rodent models of Strongyloides infection. Parasitology. 2017;144:285–294. doi: 10.1017/S0031182016000020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Taylor M.A., Coop R.L., Wall R. 4th ed. Wiley Blackwell; 2016. Veterinary Parasitology. 9600 Garsington Rd, Cowley, Oxford OX4 2DQ, United Kingdom. [Google Scholar]
  • 37.Zajac A.M., Conboy G.A. 8th ed. Wiley-Blackwell; 2012. Veterinary Clinical Parasitology. 9600 Garsington Rd, Cowley, Oxford OX4 2DQ, United Kingdom. [Google Scholar]
  • 38.Schoener E.R., Alley M.R., Howe L., Charleston T., Castro I. Helminths in endemic, native and introduced passerines in New Zealand. NZ J. Zool. 2012;39:245–256. doi: 10.1080/03014223.2012.676992. [DOI] [Google Scholar]
  • 39.Baker D.G. In: The Laboratory Rat (Second Edition) Suckow M.A., Weisbroth S.H., Franklin C.L., editors. Academic Press; Burlington: 2006. Parasitic Diseases; pp. 453–478. [Google Scholar]
  • 40.Lyu Z., Shao J., Min X., Ye Q., Chen B., Qin Y., Wen J. A new species of Giardia Künstler, 1882 (Sarcomastigophora: Hexamitidae) in hamsters. Parasit. Vectors. 2018;11:202. doi: 10.1186/s13071-018-2786-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bancroft J.D., Gamble M. 6th ed. Churchill Livingstone; Edinburgh: 2008. Theory and Practice of Histological Techniques; pp. 53–74. [Google Scholar]
  • 42.Islam M.M., Farag E., Hassan M.M., Enan K.A., Mohammad Sabeel K.V., Alhaddad M.M., Smatti M.K., Al-Marri A.M., Al-Zeyara A.A., Al-Romaihi H., H., et al. Diversity of bacterial pathogens and their antimicrobial resistance profile among commensal rodents in Qatar. Vet. Res. Commun. 2022 doi: 10.1007/s11259-021-09876-2. [DOI] [PubMed] [Google Scholar]
  • 43.Makki M.S., Mowlavi G., Shahbazi F., Abai M.R., Najafi F., Hosseini-Farash B.R., Teimoori S., Hasanpour H., Naddaf S.R. Identification of Hymenolepis diminuta cysticercoid larvae in Tribolium castaneum (Coleoptera: Tenebrionidae) beetles from Iran. J. Arthropod. Borne Dis. 2017;11:338–343. [PMC free article] [PubMed] [Google Scholar]
  • 44.Rafiei A., Baghlaninezhad R., Köster P.C., Bailo B., Hernández De Mingo M., Carmena D., Panabad E., Beiromvand M. Multilocus genotyping of Giardia duodenalis in southwestern Iran. A community survey. PLoS One. 2020;15 doi: 10.1371/journal.pone.0228317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Vidal S., Kegler K., Greub G., Aeby S., Borel N., Dagleish M.P., Posthaus H., Perreten V., Rodriguez-Campos S. Neglected zoonotic agents in cattle abortion: tackling the difficult to grow bacteria. BMC Vet. Res. 2017;13:373. doi: 10.1186/s12917-017-1294-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Lin M.H., Chen T.C., Kuo T.T., Tseng C.C., Tseng C.P. Real-time PCR for quantitative detection of Toxoplasma gondii. J. Clin. Microbiol. 2000;38:4121–4125. doi: 10.1128/jcm.38.11.4121-4125.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Dennis D.T. World Health Organization; Geneva: 1999. Plague Manual Epidemiology, Distribution, Surveillance and Control. [PubMed] [Google Scholar]
  • 48.Blasdell K.R., Morand S., Laurance S.G.W., Doggett S.L., Hahs A., Trinh K., Perera D., Firth C. Rats and the city: implications of urbanization on zoonotic disease risk in Southeast Asia. Proc. Natl. Acad. Sci. 2022;119 doi: 10.1073/pnas.2112341119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Gomez Villafañe I.E., Robles M.R., Busch M. Helminth communities and host-parasite relationships in argentine brown rat (Rattus norvegicus) Helminthologia. 2008;45:126. doi: 10.2478/s11687-008-0024-1. [DOI] [Google Scholar]
  • 50.Abu-Madi M.A., Behnke J.M., Mikhail M., Lewis J.W., Al-Kaabi M.L. Parasite populations in the brown rat Rattus norvegicus from Doha, Qatar between years: the effect of host age, sex and density. J. Helminthol. 2005;79:105–111. doi: 10.1079/JOH2005274. [DOI] [PubMed] [Google Scholar]
  • 51.Islam M.M., Farag E., Eltom K., Hassan M.M., Bansal D., Schaffner F., Medlock J.M., Al-Romaihi H., Mkhize-Kwitshana Z. Rodent Ectoparasites in the Middle East: a systematic review and meta-analysis. Pathogens. 2021;10:139. doi: 10.3390/pathogens10020139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kapczuk P., Chlubek D., Baranowska-Bosiacka I. Epidemiological and clinical characteristic of Hymenolepis diminuta infection - review of current literature. Pomeranian journal of. Life Sci. 2020;66 doi: 10.21164/pomjlifesci.664. [DOI] [Google Scholar]
  • 53.Chatterjee K.D. CBS Publishers & Distributors Pvt Ltd; India: 2012. Parasitology : Protozoology and Helminthology in Relation to Clinical Medicine : With Two Hundred Fourteen Illustrations. [Google Scholar]
  • 54.Gárate I., Jimenez P., Flores K., Espinoza B. Xenopsylla cheopis record as natural intermediate host of Hymenolepis diminuta in Lima, Peru. Rev. Peru. Biol. 2011;18:249–252. [Google Scholar]
  • 55.Mcgarry J.W., Higgins A., White N.G., Pounder K.C., Hetzel U. Zoonotic helminths of urban brown rats (Rattus norvegicus) in the UK: neglected public health considerations? Zoonoses Public Health. 2015;62:44–52. doi: 10.1111/zph.12116. [DOI] [PubMed] [Google Scholar]
  • 56.Behnke J.M., Harris P.D., Bajer A., Barnard C.J., Sherif N., Cliffe L., Hurst J., Lamb M., Rhodes A., James M., et al. Variation in the helminth community structure in spiny mice (Acomys dimidiatus) from four montane wadis in the St Katherine region of the Sinai peninsula in Egypt. Parasitology. 2004;129:379–398. doi: 10.1017/s003118200400558x. [DOI] [PubMed] [Google Scholar]
  • 57.Fasihi Harandi M., Madjdzadeh S.M., Ahmadinejad M. Helminth parasites of small mammals in Kerman province, southeastern Iran. J. Parasit. Dis. 2016;40:106–109. doi: 10.1007/s12639-014-0456-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Meshkekar M., Sadraei J., Mahmoodzadeh A., Mobedi I. Helminth infections in Rattus ratus and Rattus norvigicus in Tehran, Iran. Iran. J. Parasitol. 2014;9:548–552. [PMC free article] [PubMed] [Google Scholar]
  • 59.Burrell A., Tomley F.M., Vaughan S., Marugan-Hernandez V. Life cycle stages, specific organelles and invasion mechanisms of Eimeria species. Parasitology. 2020;147:263–278. doi: 10.1017/s0031182019001562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Kvičerová J., Hypša V. Host-parasite incongruences in rodent Eimeria suggest significant role of adaptation rather than cophylogeny in maintenance of host specificity. PLoS One. 2013;8 doi: 10.1371/journal.pone.0063601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Thompson R.C., Monis P. Giardia--from genome to proteome. Adv. Parasitol. 2012;78:57–95. doi: 10.1016/b978-0-12-394303-3.00003-7. [DOI] [PubMed] [Google Scholar]
  • 62.Heyworth M.F. Giardia duodenalis genetic assemblages and hosts. Parasite. 2016;23:13. doi: 10.1051/parasite/2016013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Veterinary Laboratory . Department of Animal Resources, Ministry of Municipality and Enviroenment; Qatar: 2020. Report of Laboratory Analysis. [Google Scholar]
  • 64.Boughattas S., Behnke J., Sharma A., Abu-Madi M. Seroprevalence of Toxoplasma gondii infection in feral cats in Qatar. BMC Vet. Res. 2017;13:26. doi: 10.1186/s12917-017-0952-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Truc P., Büscher P., Cuny G., Gonzatti M.I., Jannin J., Joshi P., Juyal P., Lun Z.-R., Mattioli R., Pays E., et al. Atypical human infections by animal trypanosomes. PLoS Negl. Trop. Dis. 2013;7 doi: 10.1371/journal.pntd.0002256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Verma A., Manchanda S., Kumar N., Sharma A., Goel M., Banerjee P.S., Garg R., Singh B.P., Balharbi F., Lejon V., et al. Trypanosoma lewisi or T. Lewisi-like infection in a 37-day-old Indian infant. Am. J. Trop. Med. Hyg. 2011;85:221–224. doi: 10.4269/ajtmh.2011.11-0002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Lee C.M., Armstrong E. In: Encyclopedia of Entomology. Capinera J.L., editor. Springer Netherlands; Dordrecht: 2008. Rodent trypanosomiasis: A comparison between Trypanosoma lewisi and Trypanosoma musculi; pp. 3208–3210. [Google Scholar]
  • 68.Schwan T.G., Lopez J.E., Safronetz D., Anderson J.M., Fischer R.J., Maïga O., Sogoba N. Fleas and trypanosomes of peridomestic small mammals in sub-Saharan Mali. Parasit. Vectors. 2016;9:541. doi: 10.1186/s13071-016-1818-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Belmain S. Proliferation. World Health Organization, 20-21; March, Lima, Peru: 2019. Expert Meeting on “Innovative Control Approaches of Rodent-Borne Epidemic Diseases and Other Public Health Consequences of Rodents. [Google Scholar]
  • 70.Dahmana H., Granjon L., Diagne C., Davoust B., Fenollar F., Mediannikov O. Rodents as hosts of pathogens and related zoonotic disease risk. Pathogens. 2020;9:202. doi: 10.3390/pathogens9030202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Byers K.A., Lee M.J., Patrick D.M., Himsworth C.G. Rats about town: a systematic review of rat movement in urban ecosystems. Front. Ecol. Evol. 2019;7 doi: 10.3389/fevo.2019.00013. [DOI] [Google Scholar]
  • 72.Faulde M., Schrader J., Heyl G., Hoerauf A. High efficacy of integrated preventive measures against zoonotic cutaneous leishmaniasis in northern Afghanistan, as revealed by quantified infection rates. Acta Trop. 2009;110:28–34. doi: 10.1016/j.actatropica.2008.12.005. [DOI] [PubMed] [Google Scholar]
  • 73.Islam M.M., Farag E., Hassan M.M., Jaffrey S.S., Atta M., Al-Marri A.M., Al-Zeyara A.M., Al Romaihi H., Bansal D., Mkhize-Kwitshana Z.L. Rodent-borne zoonoses in Qatar: a possible one-health framework for the intervention of future epidemic. One Health. 2023;16:100517. doi: 10.1016/j.onehlt.2023.100517. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available on request.


Articles from One Health are provided here courtesy of Elsevier

RESOURCES