Multispecies biofilm behavior and host interaction support the association of Tannerella serpentiformis with periodontal health

Abstract

The recently identified bacterium Tannerella serpentiformis is the closest phylogenetic relative of Tannerella forsythia, whose presence in oral biofilms is associated with periodontitis. Conversely, T. serpentiformis is considered health‐associated. This discrepancy was investigated in a comparative study of the two Tannerella species. The biofilm behavior was analyzed upon their addition and of Porphyromonas gingivalis—each bacterium separately or in combinations—to an in vitro five‐species oral model biofilm. Biofilm composition and architecture was analyzed quantitatively using real‐time PCR and qualitatively by fluorescence in situ hybridization/confocal laser scanning microscopy, and by scanning electron microscopy. The presence of T. serpentiformis led to a decrease of the total cell number of biofilm bacteria, while P. gingivalis was growth‐promoting. This effect was mitigated by T. serpentiformis when added to the biofilm together with P. gingivalis. Notably, T. serpentiformis outcompeted T. forsythia numbers when the two species were simultaneously added to the biofilm compared to biofilms containing T. forsythia alone. Tannerella serpentiformis appeared evenly distributed throughout the multispecies biofilm, while T. forsythia was surface‐located. Adhesion and invasion assays revealed that T. serpentiformis was significantly less effective in invading human gingival epithelial cells than T. forsythia. Furthermore, compared to T. forsythia, a higher immunostimulatory potential of human gingival fibroblasts and macrophages was revealed for T. serpentiformis, based on mRNA expression levels of the inflammatory mediators interleukin 6 (IL‐6), IL‐8, monocyte chemoattractant protein‐1 and tumor necrosis factor α, and production of the corresponding proteins. Collectively, these data support the potential of T. serpentiformis to interfere with biological processes relevant to the establishment of periodontitis.

Recently identified Tannerella serpentiformis is the closest phylogenetic relative of the periodontal pathogen Tannerella forsythia. First comparative biological studies support the health‐association of T. serpentiformis and its potential to outcompete T. forsythia and Porphyromonas gingivalis in oral biofilms.

Abbreviations

A. oris

Actinomyces oris

BHI

brain heart infusion

CBA

Columbia Blood Agar

CBB

colloidal Coomassie Brilliant Blue R‐250

CFU

colony forming unit

CLSM

confocal laser scanning microscopy

Cq

quantification cycle

DMEM

Dulbecco’s Modified Eagle’s Medium

F. nucleatum

Fn, Fusobacterium nucleatum

FA

Fastidious Anaerobe agar

FAB

Fastidious Anaerobe Broth

FBS

fetal bovine serum

FISH

fluorescence in situ hybridization

HA

hydroxyapatite

hGFBs

human gingival fibroblasts

IL

interleukin

MCP‐1

monocyte chemoattractant protein‐1

MEM

minimal essential medium

mFUM

modified fluid universal medium

MOI

multiplicity of infection

MTT

3‐(4,5‐dimethylthiazol‐2‐yl)‐2,‐diphenyltetrazolium bromide

NAMA

N‐acetylmuramic acid

OD

optical density

P. gingivalis

Pg, Porphyromonas gingivalis

PAS

periodic acid Schiff reagent

PBS

phosphate‐buffered saline

Pen‐Strep

penicillin‐streptomycin

PFA

paraformaldehyde

qRT‐PCR

quantitative real‐time polymerase chain reaction

S. anginosus

Streptococcus anginosus

SD

standard deviation

SDS‐PAGE

sodium dodecylsulfate polyacrylamide gel electrophoresis

s.e.m.

standard error of the mean

SEM

scanning electron microscopy

S. oralis

Streptococcus oralis

T. forsythia

Tf, Tannerella forsythia

T. serpentiformis

Ts, Tannerella serpentiformis

TNF α

tumor necrosis factor (TNF) α

V. dispar

Veillonella dispar

1. INTRODUCTION

The coexistence of the oral microbiota and the human host is characterized by networks of synergistic and antagonistic interactions that generate microbial interdependencies and provide microbial biofilms and the host immune system with a resilience to minor environmental perturbations, thereby contributing to oral health. If key environmental pressures exceed individual thresholds associated with health, the competitiveness among oral microbes is altered and dysbiosis can occur which increases the risk of periodontal diseases (Ebersole et al., 2016; Marsh & Zaura, 2017; Naginyte et al., 2019). Periodontitis is an inflammatory, polymicrobial biofilm disease of the periodontium that is clinically characterized by gingival bleeding, alveolar bone resorption, and might result in tooth loss if untreated (Kinane et al., 2017). There is evidence for a relationship between periodontitis and numerous systemic conditions, including cardiovascular disease, diabetes, cancer, rheumatoid arthritis, and Alzheimer's disease, among others (Dominy et al., 2019; Hajishengallis, 2015; Park et al., 2019). Although the role of specific bacteria in the initiation and progression of periodontitis remains debatable (Bartold & Van Dyke, 2019), the disease is associated with an increased prevalence of the “red‐complex” of Gram‐negative anaerobes—Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia—acting as late colonizers of the polymicrobial biofilm (dental plaque) that adheres to the surface of the teeth (Darveau, 2010; Hajishengallis, 2014; Holt & Ebersole, 2005; Socransky et al., 1998; Trindade et al., 2014). The “red complex” bacteria have synergistic relationships (Bloch et al., 2017a; Metzger et al., 2009; Ng et al., 2019; Orth et al., 2011; Y. Zhu et al., 2013), interact with preceding biofilm colonizers (Polak et al., 2012; Socransky et al., 1998) and host tissues and immune cells (Abdi et al., 2017; de Andrade et al., 2019), and orchestrate the virulence of the microbial consortium from within the biofilm. While most previous studies were focused on P. gingivalis (Fiorillo et al., 2019; Hajishengallis & Diaz, 2020) showing that this bacterium can subvert the host immune system and acts as a keystone pathogen, our understanding of T. forsythia is currently unravelling (Bloch et al., 2019).

Tannerella forsythia is covered with a unique, 22‐nm thick cell surface (S‐) layer in which the glycosylated S‐layer proteins TfsA and TfsB align into a 2D‐paracrystalline lattice (Oh et al., 2013; Sekot et al., 2012). The bacterium's cell surface composition and multiple copies of an O‐linked S‐layer decasaccharide (Posch et al., 2011; Tomek et al., 2018) as the immediate intraspecies and bacterium–host interface have been shown to be pivotal to the establishment of T. forsythia in the oral biofilm community, especially to its co‐aggregation with P. gingivalis (Bloch et al., 2017a) as well as its recognition by the immune system in a macrophage cell culture model (Sekot et al., 2011). The S‐layer delays the recognition of the bacterium at the early phase of infection (Sekot et al., 2011) and modulates dendritic cell effector functions in a way that glycosylation ensures the persistence of the pathogen in the host (Settem et al., 2013; Tomek et al., 2018). Furthermore, S‐layer deficient T. forsythia lost its adherence ability to human gingival epithelial cells (Ca9‐22) translating into decreased infectivity (Sakakibara et al., 2007). All together, these data support the role of the glycosylated S‐layer of T. forsythia as a virulence factor. Importantly, due to its auxotrophy for the essential peptidoglycan cell wall sugar N‐acetylmuramic acid, T. forsythia is reliant on a multispecies biofilm lifestyle in the oral cavity for scavenging of peptidoglycan turn‐over products from cohabiting bacteria (Hottmann et al., 2021, 2018).

Recently, the Gram‐negative oral anaerobe Tannerella serpentiformis (previously, Tannerella HOT‐286; phylotype BU036) was affiliated as a second species to the genus Tannerella (Ansbro et al., 2020; Frey et al., 2018) and thus is the closest phylogenetic relative of the pathogen T. forsythia. Tannerella serpentiformis was originally isolated form subgingival plaque of a female subject with chronic periodontitis but is considered a periodontal health‐associated bacterium (Vartoukian, Moazzez, et al., 2016). This might be supported by the absence of several virulence‐associated genes in the T. serpentiformis genome in comparison to the T. forsythia (Beall et al., 2018). These include, among others, those coding for the BspA surface antigen (Onishi et al., 2008; Sharma et al., 1998), KLIKK proteases, and sialidase NanH (Beall et al., 2018; Stafford et al., 2012). Comparable to T. forsythia, this novel Tannerella species possesses a glycosylated S‐layer of ∼24 nm thickness that is constituted by the two high‐molecular mass proteins TssA and TssB, which, share 52% and 59% amino acid identity with the S‐layer proteins of T. forsythia (TfsA, TfsB). Based on the gene content of a glycosylation gene cluster on the T. serpentiformis genome, the glycosylation of TssA and TssB is different from that of T. forsythia (Tomek et al., 2018; Zwickl et al., 2020). Tannerella serpentiformis was initially cultured together with the helper strains Propionibacterium acnes or Prevotella intermedia (Vartoukian, Moazzez, et al., 2016) until it was shown that T. serpentiformis monospecies growth can be stimulated by supplementation of the cultivation medium with N‐acetylmuramic acid, as seen with T. forsythia. Contrary to the rod‐shaped morphology of T. forsythia (Hottmann et al., 2018; Mayer et al., 2020), the bacterium displays a distinctive snake‐like, segmented morphology of about 20–40 μm length and 1 μm across (Frey et al., 2018; Züger et al., 2007).

Currently, nothing is known about a possible influence of T. serpentiformis on the polymicrobial oral biofilm associated with periodontitis. The present study aimed at investigating the biofilm “lifestyle” of T. serpentiformis and comparing the behavior of the two Tannerella species in the microbial biofilm consortium as well as their interaction with different types of host cells that are important to the establishment and progression of periodontitis. Specifically, a five‐species oral biofilm based on the “Zurich biofilm model” (Ammann et al., 2012) including four early colonizers and the bridging bacterium Fusobacterium nucleatum was used, into which T. serpentiformis, T. forsythia, and P. gingivalis—which is known for its impact on T. forsythia—was incorporated, either separately, each, or in combinations to unravel putative synergistic or antagonistic relationships. The biofilms were evaluated for their composition based on cell numbers and the localization of the individual species using quantitative real‐time PCR and fluorescence in situ hybridization/confocal laser scanning microscopy, respectively, as well as imaged by scanning electron microscopy (SEM). Furthermore, the cross‐reactivity of anti‐T. forsythia S‐layer antibodies with the T. serpentiformis S‐layer was investigated. To obtain a first insight into potential differences in the interaction of T. serpentiformis and T. forsythia with host cells, their adhesion to and invasion of gingival epithelial cells was investigated and their potential to induce the production of the pro‐inflammatory mediators interleukin (IL)‐1β, IL‐6, IL‐8, monocyte chemoattractant protein (MCP)‐1, and tumor necrosis factor (TNF)‐α by macrophages and primary human gingival fibroblasts was assessed.

2. METHODS

2.1. General methods

SDS‐PAGE of T. serpentiformis and T. forsythia cells was performed according to Laemmli using a Mini‐Protean II electrophoresis apparatus (Bio‐Rad, Hercules, CA, USA) (Laemmli, 1970). Carbohydrates on separated protein bands were stained with the periodic acid Schiff reagent (PAS) (Doerner & White, 1990), and protein bands were visualized with colloidal Coomassie Brilliant Blue R‐250 (CBB; Serva, Heidelberg, Germany) or transferred onto a polyvinylidene difluoride membrane (Bio‐Rad) for Western‐blot analysis. Polyclonal rabbit antisera raised against the recombinant T. forsythia S‐layer proteins TfsA (α‐TfsA) and TfsB (α‐TfsB) (Sekot et al., 2012) were used as primary antibodies in combination with a monoclonal goat α‐rabbit IgG secondary antibody labeled with IRDye 800CW (LI‐COR Biosciences, Lincoln, NE, USA). Bands were visualized at 800 nm using an Odyssey Infrared Imaging System (LI‐COR Biosciences). Protein concentrations were determined using the Bradford Assay Kit (Bio‐Rad) (Bradford, 1976).

2.2. Tannerella species and cultivation conditions

Tannerella serpentiformis W11667 (kindly provided by Dr. Graham Stafford, Integrated BioSciences, School of Clinical Dentistry, University of Sheffield, UK) was grown anaerobically on Fastidious Anaerobe agar (FA; Lab M), supplemented with 5% horse blood (Sigma–Aldrich, Darmstadt, Germany) and 20 μg/ml N‐acetylmuramic acid (NAMA; Sigma–Aldrich) (Vartoukian, Adamowska, et al., 2016) for 7–10 days at 37°C. Subsequently, the biomass was scraped from the plate and transferred into 10 ml of Fastidious Anaerobe Broth (FAB, E&O Laboratories Ltd., Bonnybridge, UK) or brain heart infusion (BHI) broth (Oxoid, Basingstoke, UK) at 37°C prior to further use. Tannerella forsythia ATCC 43037 (American Type Culture Collection, Manassas, VA, USA) was grown anaerobically on FA‐NAMA‐blood agar as above prior to liquid cultivation for 24 h at 37°C in BHI broth. All liquid media had the same supplements as the agar media (i.e., 20 μg/ml NAMA and 5% horse serum).

Growth curves of T. serpentiformis and T. forsythia in 10 ml of FAB and BHI broth, respectively, were recorded over a time of 160 h. For this purpose, 1 ml of an over‐night liquid culture was inoculated, the OD₆₀₀ of the inoculum was set to 0.1 with medium, and bacterial growth was monitored by OD₆₀₀ measurement in three independent experiments with three technical replicates, each. The growth rate μ [h^–1] and the doubling time t_d [h] of the bacteria in the exponential phase were calculated according to μ = (lnOD₁‐lnOD₂)/(t2‐t1) and t_d = ln2/μ.

2.3. Growth of Tannerella species biofilms in polystyrene plates

Biofilm growth of T. serpentiformis and T. forsythia in polystyrene plates was determined by differential OD₆₀₀ measurement of resuspended biofilm versus total bacterial culture. For this purpose, half‐concentrated BHI medium (diluted with 1× PBS) (Friedrich et al., 2017) with supplements as described above was inoculated with either T. forsythia or T. serpentiformis, each grown on FA blood agar plates supplemented with NAMA (10 μg/ml), and set to an OD₆₀₀ of 0.05 with growth medium. The bacteria were grown anaerobically at 37°C for 6 days in 24‐well polystyrene plates coated with mucin (from bovine submaxillary gland, Sigma–Aldrich, St. Louis, USA) solution (0.5 mg/ml in 0.1 M sodium acetate buffer, pH 4.5). One ml of cell suspension was added to five wells, each, per strain, sterile half‐concentrated BHI medium served as a negative control. Two wells per strain were used to determine the total OD₆₀₀ for normalization. From the other wells, medium and planktonic cells were removed and the remaining cells forming a biofilm washed gently with 500 μl distilled H₂O and finally resuspended in 1 ml distilled H₂O, and the OD₆₀₀ of the biofilm was measured. The values were normalized to the total OD₆₀₀ of each bacterium.

2.4. Growth of multispecies biofilms on hydroxyapatite discs

Five‐species biofilms based on the “Zurich subgingival biofilm model” (Ammann et al., 2012) were established. These were comprised of Fusobacterium nucleatum (OMZ598), Actinomyces oris (OMZ745), Veillonella dispar (OMZ493), Streptococcus anginosus (OMZ871), and Streptococcus oralis (OMZ607), to which T. forsythia, T. serpentiformis and P. gingivalis (OMZ925), either each bacterium separately, or different combinations of the three bacteria were added (for details of the compositions of the different biofilms see Table 1). For this purpose, precultures of F. nucleatum, A. oris, V. dispar, S. anginosus, S. oralis, and P. gingivalis were grown anaerobically at 37°C for 3 days on Columbia Blood Agar (CBA; Oxoid) supplemented with 5% horse blood. Subsequently, the bacteria were scraped off the plates and, with the exception of P. gingivalis, transferred into modified fluid universal medium (mFUM) (Gmür & Guggenheim, 1983); in the case of V. dispar, FUM was supplemented with sodium DL‐lactate (Sigma–Aldrich; 10 μg/ml), and P. gingivalis was transferred into BHI broth. All bacteria were grown anaerobically at 37°C for 24 h. For the two Tannerella species to be added to these five‐species biofilms, the overnight cultures as prepared above were used.

TABLE 1.

Composition of the different biofilms investigated in this study

Species	Abbreviation*
“Five species”: Fusobacterium nucleatum OMZ598 Actinomyces oris OMZ745 Veillonella dispar OMZ493 Streptococcus anginosus OMZ871 Streptococcus oralis OMZ607	Five species
“Five species,” Tannerella forsythia ATCC 43037	Tf
“Five species,” Tannerella serpentiformis	Ts
“Five species,” T. forsythia ATCC 43037, T. serpentiformis	TF + Ts
“Five species,” Porphyromonas gingivalis OMZ925	Pg
“Five species,” T. forsythia ATCC 43037, P. gingivalis OMZ925	Tf + Pg
“Five species,” T. serpentiformis, P. gingivalis OMZ925	Ts + Pg
“Five species,” T. forsythia ATCC 43037, T. serpentiformis, P. gingivalis OMZ925	Tf + Ts + Pg

*Abbreviation as used in Figures 3 and 4.

For multispecies biofilm formation on sintered, pellicle‐coated HA discs (9 mm in diameter; Clarkson Chromatography Products, South Williamsport, USA), all bacteria from over‐night cultures were freshly inoculated into mFUM and grown for an additional 5 h. Thereafter, the OD₆₀₀ of these cultures was adjusted to 1.0. Subsequently, the cultures were mixed at equal volumes, and 200 μl of the cell suspension was used to inoculate 1.6 ml of growth medium (960 μl pooled saliva, 160 μl horse serum [Thermo‐Fischer] and 480 μl mFUM) (Gmür & Guggenheim, 1983) in 24‐well polystyrene tissue culture plates (Greiner, Darmstadt, Germany). The medium was changed after 16 h and 40 h, and discs were dip‐washed in 0.9% NaCl twice a day. After anaerobic incubation at 37°C for 64 h, biofilms were dip‐washed again and either harvested by vigorous vortexing for 3 min in 1 ml 0.9% NaCl or fixed for 1 h at 4°C in 4% paraformaldehyde (Sigma–Aldrich) solution prior to fluorescence in situ hybridization (FISH) and SEM. To image T. forsythia in multispecies biofilms, 100 μl of the initial culture was added at each medium change in order to obtain enough cells for FISH‐staining.

Growth of T. forsythia and T. serpentiformis monospecies biofilms and of a dual Tannerella species biofilm on pellicle‐coated HA discs was carried out essentially as described above for the multispecies biofilms.

2.5. Quantitative analysis of biofilms

The cell number of all bacteria in the biofilms was determined by qPCR (Ammann et al., 2013). For this purpose, genomic DNA was extracted from 500 μl of harvested biofilm using the GenElute Bacterial Genomic DNA kit (Sigma–Aldrich) and analyzed on an MJ Mini Thermal Cycler and MiniOpticon Detector (Bio‐Rad) using species‐specific primers (Table 2) amplifying the 16S rRNA gene (Ammann et al., 2013).

TABLE 2.

Primers used in this study

Organism	Sequence (5′ → 3′)	Strand	Reference
V. dispar	CCCGGGCCTTGTACACACCG CCCACCGGCTTTGGGCACTT	+ −	(Ammann et al., 2013)
F. nucleatum	CGCCCGTCACACCACGAGA ACACCCTCGGAACATCCCTCCTTAC	+ −	(Ammann et al., 2013)
S. oralis	ACCAGGTCTTGACATCCCTCTGACC ACCACCTGTCACCTCTGTCCCG	+ −	(Ammann et al., 2013)
A. oris	GCCTGTCCCTTTGTGGGTGGG GCGGCTGCTGGCACGTAGTT	+ −	(Ammann et al., 2013)
S. anginosus	ACCAGGTCTTGACATCCCGATGCTA CCATGCACCACCTGTCACCGA	+ −	(Ammann et al., 2013)
P. gingivalis	GCGAGAGCCTGAACCAGCCA ACTCGTATCGCCCGTTATTCCCGTA	+ −	(Ammann et al., 2013)
T. forsythia (TfsB)	ACGGAGTGAAGGACTTTGCA CAAGCCTCCACCGGTACTTT	+ −	This study
T. forsythia/ T. serpentiformis (16S rRNA)	CGAGCGATCGGATGCAAATC CAGCTTCACGGAGTCGAGTT	+ −	(Ammann et al., 2013)
T. serpentiformis (TssB)	TCCGTACTGATCGCTGGAGA TTAGCAGCATCGAACGTGGT	+ −	This study

To quantify the bacteria, a standard curve was generated for each bacterium using the logarithm of the quantification cycle (Cq) values of the serial dilution samples. With the concentration of the extracted genomic DNA of the biofilm samples, determined using a NanoDrop ND‐1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and the obtained Cq values, the sample DNA concentration was calculated by interpolating from the standard curve. The cell number per biofilm was further calculated with the theoretical genome weight of the respective organism (Ammann et al., 2013). The abundance of each organism was determined in three independent biological experiments with three technical replicates per biofilm.

2.6. Imaging of biofilms

To assess the distribution and potential aggregation of certain bacteria within the biofilms, FISH staining was performed (Thurnheer et al., 2004) using the probe combinations listed in Table 3. The fixed biofilms on HA discs were permeabilized with lysozyme solution (7 × 10⁴ U/ml in H₂O; Sigma–Aldrich) for 10 min at room temperature and prehybridized in hybridization buffer (0.9 M NaCl, 20 mM Tris–HCl [pH 7.5], 0.01% SDS, 30% formamide) at 46°C for 15 min, followed by 3 h of hybridization with specific oligonucleotide probes (Ammann et al., 2012). This was followed by washing in wash buffer (20 mM Tris–HCl, pH 7.5, 5 mM EDTA, 0.01% SDS, 46–70 mM NaCl) for 45 min at 48°C. To counterstain the biofilms, the discs were incubated with a solution of 10 μM Sytox Green (Invitrogen/Thermo Fisher Scientific) for 30 min at room temperature in the dark. Finally, the discs were fixed in Mowiol in confocal microscopy dishes for 24 h (Thurnheer et al., 2006).

TABLE 3.

Probes used in this study (Ammann et al., 2012)

Probe	Organism	Sequence (5′→3′)
Tan1260b‐Cy3	Tannerella serpentiformis	TGCATCCGATCGCTCGGT
Pging1006‐2‐Cy3	Porphyromonas gingivalis	GTTTTCACCATCMGTCAT
Tfor127‐Cy5	Tannerella forsythia	CTCTGTTGCGGGCAGGTTAC

The architecture of the biofilms was analyzed by confocal laser scanning microscopy (CLSM) using a Leica SP‐8 microscope. Images were captured using a 100× and 40× objective and processed with Fiji software (Schindelin et al., 2012).

SEM was performed to examine the biofilm architecture and to specifically compare the monospecies biofilms of the two Tannerella species. The fixed biofilms were dehydrated by incubation in an ascending ethanol series of 35%, 50%, 70%, 95%, and 100% for 5 min, each. High‐vacuum secondary electron imaging was performed using an Apreo VS SEM (Thermo Fisher Scientific) at 2 kV.

Presented images are snapshots of the biofilm structures present on the HA discs, and the depicted structures represent a comprehensive collection of biofilm behavior observed during sampling.

2.7. Cultivation of human host cells

The immortalized human gingival cell line Ca9‐22 derived from squamous carcinoma of the gingiva was used (Japanese Collection of Research Bioresources Cell Bank, JCRB0625, Ibaraki, Japan); cells were cultured in minimal essential medium (MEM; Invitrogen, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin (Pen‐Strep; Sigma–Aldrich) at 37°C in 5% CO₂. Cells between passages 6 and 11 were used for the experiments.

The U937 monocytic cell line was purchased from ATCC and cultured in RPMI 1640 medium (Invitrogen), supplemented with 10% FBS and Pen‐Strep at 37°C in a humidified atmosphere containing 5% CO₂ (Friedrich et al., 2015).

Human gingival fibroblasts (hGFBs) were isolated from the gingival tissue of third molar teeth of periodontally and systemically healthy individuals extracted for orthodontic reasons (Blufstein et al., 2021; Sekot et al., 2011). The procedure was approved by the Ethics Committee of the Medical University of Vienna (EK 1079/2019, extended in 2021), and all patients gave their written consent. Gingival tissue was cut off with a scalpel, placed into Dulbecco's Modified Eagle's Medium (DMEM, Invitrogen) supplemented with 10% FBS, Pen‐Strep, shredded into small pieces, and incubated at 37°C and 5% CO₂ for cell outgrowth. Cells between passages three and six were used for the experiments.

2.8. Invasion and adhesion of T. serpentiformis and T. forsythia to gingival epithelial cells

Ca9‐22 cells were seeded into 24‐well tissue culture plates at a concentration of 10⁵ cells per well. After 48 h of incubation, the cells were infected with either T. forsythia or T. serpentiformis at a multiplicity of infection (MOI) of 100 for 90 min (Megson et al., 2015).

To determine the number of intracellularly invaded bacteria, the Ca9‐22 cells were washed three times with 1× PBS and incubated for further 60 min in 500 μl MEM, supplemented with 10% FBS and Pen‐Strep (Bloch et al., 2018) to kill extracellular bacteria. The cells were washed with 1× PBS followed by addition of 200 μl of sterile, distilled H₂O per well, and cells were scraped from the wells with a pipette tip for 1 min for physical disruption. From the cell lysate, a 10‐fold serial dilution was made, and 10 μl from each dilution step was spotted in triplicate onto a FA‐NAMA‐blood agar plate and incubated anaerobically at 37°C for 8 days in order for each invading bacterium to grow and form a colony.

This procedure was repeated without addition of Pen‐Strep to obtain numbers of total bacteria associated with Ca9‐22 cells. The difference between the total count of bacteria and the count of intracellular bacteria was considered as the numbers of extracellularly adhering bacteria. The invasion and adherence of bacteria to Ca9‐22 cells was characterized as the percentage of colony‐formung unit (CFU) counts of intracellular and extracellular bacteria in relation to CFU counts obtained for bacteria grown under the same conditions without Ca9‐22 cells.

2.9. Stimulation of human macrophages and human gingival fibroblasts with Tannerella species

Prior to stimulation with bacteria, U937 monocytes were differentiated into macrophages (Braun et al., 2022; Sekot et al., 2011). Briefly, 3 ml of cell suspension at a concentration of 10⁶ cells/ml were added to each well of a 6‐well plate and cells were stimulated with phorbol 12‐myristate 13‐acetate (Sigma–Aldrich) at a concentration of 0.2 μg/ml for 72 h.

Adherent macrophages were gently scraped, counted, and seeded in a 24‐well plate at a density of 3 × 10⁵ cells/well in 0.5 ml RPMI 1640 medium supplemented with 10% FBS and Pen‐Strep. hGFBs were seeded at a density of 5 × 10⁴ cells/well in 0.5 ml DMEM containing the same supplements. After 24 h, the medium was discarded, cells were washed once with 1× PBS, and exposed to the different bacterial stimuli at an MOI of 50. Stimulation was performed in the respective media without supplements for 4 and 24 h at 37°C and 5% CO₂. Cells incubated in the media without bacteria and supplements were used as a negative control. After stimulation, the cell viability and inflammatory response were analyzed. At least five independent experiments with four technical replicates were performed.

2.10. MTT cell viability assay

After cell stimulation, 100 μl of 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) dye (5 mg/ml in PBS) was added to the cells, and the plates were incubated at 37°C for 2 h (Vistica et al., 1991). Subsequently, the medium was discarded, and 500 μl of dimethylsulfoxide was added to each well. The plates were shaken to facilitate the dissolving of formazan crystals. Controls were performed in which each bacterium was solely added. OD₅₇₀ values were measured on a Synergy HTX multi‐mode reader (BioTek Instruments, Winooski, USA).

2.11. Gene expression analysis of inflammatory mediators

Cell lysis, transcription into cDNA, and qPCR were performed using the TaqMan® Gene Expression Cells‐to‐CT™ kit (Ambion/Applied Biosystems, Foster City, CA, USA) (Behm et al., 2019; Blufstein et al., 2019). The target genes were amplified using the following primers (all Applied Biosystems): TNF‐α, 99999043_m1; IL‐1β Hs01555410_m1; IL‐6, Hs00985639_m1; IL‐8, Hs00174103_m1; MCP‐1, Hs00234140_m1; GAPDH, Hs99999905_m1. qPCR was performed in paired reactions using the ABI StepOnePlus device. C_t values were determined for each gene, and the expression of the target gene was calculated by the 2^−ΔΔCt method, where ΔΔC_t = (C_t ^target – C_t ^GAPDH) sample – (C_t ^target – C_t ^GAPDH) control. Cells which were not treated with bacteria served as control. For U937 macrophages, expression of TNF‐α, IL‐1β, IL‐8, and MCP‐1 was analyzed, for hGFBs, IL‐6, IL‐8, and MCP‐1.

2.12. Determination of secreted cytokines and chemokines by ELISA

The concentration of the inflammatory mediators IL‐1β, IL‐6, IL‐8, MCP‐1, and TNF‐α in conditioned media was determined using uncoated ELISA kits (Invitrogen) according to the manufacturer's protocol. The sensitivity of the ELISA was 2 pg/ml for IL‐1β, IL‐6, and IL‐8, 7 pg/ml for MCP‐1, and 4 pg/ml for TNF‐α.

2.13. Statistical analysis

Statistical analysis of the bacterial biofilms was performed using RStudio, with results being considered statistically different at p < 0.05. The data were initially tested for homoscedasticity with Levene's test and for normality with the Shapiro–Wilk test. Nonhomoscedastic and normally distributed samples were compared with Welch's analysis of variance (ANOVA), followed by the Games–Howell post hoc test. Homoscedastic non‐normally distributed samples were compared using the Kruskal–Wallis test. Samples passing the initial tests for normal distribution and homogeneity of variance were tested by one‐way ANOVA, followed by Tukey's test for multiple comparisons. All data are expressed as mean ± SD. Differences in invasion and adhesion between the two Tannerella species were analyzed with the unpaired Student's t‐test using RStudio, with results being considered statistically different at p < 0.05. Four independent experiments with three technical replicates were performed for each assay.

The Friedman test followed by the post hoc Wilcoxon test for pairwise comparison was used to analyze statistical differences of immunological data. Statistical analysis was performed using SPSS 24.0 software (IBM, Armonk, NY, USA). All data are expressed as mean ± standard error of the mean (SEM). Significant statistical differences were considered at p < 0.05.

3. RESULTS

3.1. General description of T. serpentiformis in comparison to T. forsythia

For T. serpentiformis grown in FAB, a doubling time of 37.79 ± 15.21 h (μ = 0.060 ± 0.022 h^‐1) was calculated, while T. forsythia grew in BHI broth to higher density with a doubling time of 16.90 ± 6.52 h (μ = 0.046 ± 0.016 h^‐1) (Figure 1a,b).

FIGURE 1.

(A) Growth curve of T. serpentiformis (left) and T. forsythia (right) in liquid culture. Growth was monitored by OD₆₀₀ measurement over 160 h.10% SDS‐PAGE of T. forsythia and T. serpentiformis cells, stained with (B) Coomassie Brilliant Blue for proteins and (C) periodic acid‐Schiff reagent for carbohydrates. (D) Western‐blot of T. forsythia and T. serpentiformis cells using the α‐TfsA and α‐TfsB antibodies raised against the T. forsythia S‐layer proteins. M, PageRuler Plus Prestained Protein Ladder; Tf, T. forsythia; Ts, T. serpentiformis

After separation of T. serpentiformis and T. forsythia biomass by SDS‐PAGE, upon staining with CBB (Figure 1b) and PAS‐reagent (Figure 1c), respectively, the high‐molecular weight S‐layer glycoproteins were clearly visible for either Tannerella species, with the upshift in molecular weight in comparison to the calculated molecular weight of the S‐layer proteins based on the amino acid sequence—TfsA (Tanf_03370), 133.1 kDa; TfsB (Tanf_03375), 150.4 kDa; TssA (BCB71_00675), 134.2 kDa; TssB (BCB71_00680), 156.0 kDa—in either case due to glycosylation. As previously described for T. forsythia (Posch et al., 2011), T. serpentiformis contains in addition to the prominent S‐layer glycoproteins also other glycoproteins. The T. forsythia S‐layer antibodies α‐TfsA and α‐TfsB showed no cross‐reactivity with the T. serpentiformis S‐layer proteins (Figure 1d), indicative of different cell surface‐exposed S‐layer epitopes in the two Tannerella species.

3.2. Biofilm lifestyle of T. serpentiformis

Tannerella serpentiformis showed a very low, if at all, capability to form a monospecies biofilm on pellicle‐coated HA discs (Figure 2a); T. serpentiformis cells displayed a filamentous morphology with individual rods of about 20 μm, conforming with previous data of the bacterium when grown in liquid culture (Frey et al., 2018). In contrast, T. forsythia formed a biofilm with a net‐like appearance and individual T. forsythia rods had a length of about 3 μm (Figure 2b). In the dual‐species biofilm, the two Tannerella species were clearly discernible based on their morphology and did not show co‐aggregation (Figure 2c). Tannerella serpentiformis seemed to antagonize the biofilm formation capability of T. forsythia in the dual‐species biofilm, as evidenced by a loose assembly of bacterial cells on the solid support. Replica of the observed biofilm structures can be found in Figure S1.

FIGURE 2.

Scanning electron micrographs of T. serpentiformis (a) and T. forsythia (b) cells after biofilm growth in comparison to a mixed biofilm of the two Tannerella sp. (c) grown for 64 h on pellicle‐coated HA discs. Tannerella forsythia (blue arrow) and T. serpentiformis (red arrow) are discernible based on their cell morphology. The lower panel shows an enlarged view of each biofilm.

Tannerella serpentiformis’ significantly decreased biofilm formation capability in comparison to its pathogenic counterpart was confirmed upon cultivation on mucin‐coated polystyrene plates for 6 days (Figure S2).

3.3. Influence of T. serpentiformis on a commensal oral model biofilm in comparison to T. forsythia and P. gingivalis

To analyze the effect of the two Tannerella species in comparison to the known keystone pathogen P. gingivalis on the composition of the multispecies oral biofilm, the change in the cell numbers of the commensal species (i.e., A. oris, V. dispar, S. anginosus, S. oralis) and of F. nucleatum (together termed “five species”) upon introduction of T. forsythia, T. serpentiformis and P. gingivalis or combinations of the three species was determined by qPCR after 64 h of incubation.

The total cell number of the “five species” was significantly increased upon incorporation of P. gingivalis (Pg), T. forsythia together with P. gingivalis (Tf + Pg), and both Tannerella species together (Tf + Ts) (Figure 3). In contrast, the total cell number was significantly lower in the biofilms containing T. serpentiformis and P. gingivalis (Ts + Pg or Tf + Ts + Pg) compared to the biofilms containing T. forsythia plus P. gingivalis (Tf + Pg) and P. gingivalis alone (Pg), supporting the growth‐mitigating effect of T. serpentiformis. Compared to the “five‐species” biofilm with T. forsythia alone, the presence of T. serpentiformis led to a significant decrease of the total cell number, as well as the cell numbers of F. nucleatum, S. oralis, and A. oris.

FIGURE 3.

Comparison of the cell numbers of the “five species” in different biofilm set‐ups measured by qPCR. Data were obtained from three independent experiments and plotted on a logarithmic scale. Significances were determined against the commensal biofilm (five species) and are reported as *p < 0.05, **p < 0.0 1, ***p < 0.001, and ****p < 0.0001. “Five species”: V. dispar, F. nucleatum, S. oralis, A. oris, and S. anginosus; gray, “five species” plus T. forsythia (Tf) (blue), “five species” plus T. serpentiformis (Ts) (red), “five species” plus Tf and Ts (pink), “five species” plus P. gingivalis (Pg) (violet), “five species” plus Tf and Pg (light blue), five species plus Ts and Pg (turquoise), “five species” plus Tf, Ts, and Pg (petrol). For details of biofilm bacteria, see Table 1.

On the single‐species level, the number of the individual species was changed upon incorporation of P. gingivalis alone (Pg) or of P. gingivalis combined with the Tannerella species (Pg + Tf or Pg + Ts or Tf + Ts + Pg). Fusobacterium nucleatum and A. oris highly benefitted from the incorporation of P. gingivalis to the biofilm in every biofilm set‐up tested, as their cell numbers were significantly increased in all cases where P. gingivalis was present. This emphasizes the role of P. gingivalis in promoting biofilm growth. The results for S. oralis were similar as for the total of the “five species,” with S. oralis cell numbers being significantly increased in the presence of P. gingivalis (Pg), as well as in the presence of T. forsythia together with P. gingivalis (Tf + Pg) or T. serpentiformis (Tf + Ts). Interestingly, the cell number of S. oralis, along with the total cell number, was not significantly increased if both T. serpentiformis and P. gingivalis (Ts + Pg) were incorporated into the biofilm. Here, the presence of T. serpentiformis could mitigate the growth‐promoting effect of P. gingivalis.

Notably, V. dispar showed the opposite response to the addition of P. gingivalis (Pg) and P. gingivalis in combination with T. serpentiformis (Ts + Pg) to the biofilm with significantly reduced cell numbers, and it was detected in slightly lower cell numbers when both Tannerella species together with or without P. gingivalis where present (Tf + Ts or Tf + Ts +Pg).

3.4. Quantitative analysis of T. forsythia, T. serpentiformis, and P. gingivalis in the commensal biofilm

In addition to the “five‐species,” the cell numbers of both Tannerella species and of P. gingivalis were determined by qPCR in the same biofilms in order to assess their behavior in the commensal biofilm (Figure 4).

FIGURE 4.

Comparison of the cell numbers of the two Tannerella species and P. gingivalis in different biofilm set‐ups according to qPCR results. Data derived from three independent experiments were plotted on a logarithmic scale. Significances were determined against the Tannerella biofilms (Tf and Ts) and are reported as ****p < 0.0001. “Five species”: V. dispar, F. nucleatum, S. oralis, A. oris, and S. anginosus. “Five species” plus T. forsythia (Tf) (blue), “five species” plus T. serpentiformis (Ts) (red), “five species” plus Tf and Ts (pink), five species plus P. gingivalis (Pg) (violet), “five species” plus Tf and Pg (light blue), “five species” plus Ts and Pg (turquoise), “five species” plus Tf, Ts, and Pg (petrol). For details of biofilm bacteria, see Table 1.

Similar as for the commensals, the presence of P. gingivalis significantly increased T. forsythia and T. serpentiformis cell numbers (Figure 4). However, this growth‐promoting effect could not be observed when both Tannerella species were incorporated into the biofilm in addition to P. gingivalis, especially for T. forsythia. Moreover, the two Tannerella species seemed to be competing, as indicated by their cell numbers being significantly decreased when both were added to the commensal biofilm. Conversely, P. gingivalis cell numbers were constant across the different biofilm setups, with only slight decreases in the presence of T. serpentiformis.

3.5. Imaging of the multispecies biofilm structure by CLSM and SEM

To assess potential differences in the localization of the Tannerella species in the multispecies biofilm, their ability to aggregate with other species, and their influence on the overall biofilm structure, FISH and subsequent CLSM analysis as well as SEM of fixed biofilms was performed for qualitative evaluation.

The “five‐species” biofilm containing T. serpentiformis (Figure 5a, left) was looser, with less coverage of the HA disc according to SEM evidence in comparison to the biofilm containing T. forsythia (Figure 5a, right).

FIGURE 5.

SEM micrographs (a) of a fixed, “five‐species” biofilm containing T. serpentiformis and T. forsythia, grown for 64 h on a pellicle‐coated HA disc. CLSM images (b) of the same biofilms with FISH‐probes specific for T. serpentiformis and T. forsythia for localization of the Tannerella species in the biofilm consortium. Red: T. serpentiformis; blue: T. forsythia; green: nonhybridized cells (DNA staining Sytox green). One area of the biofilm is presented here as viewed from the top in the big upper left panel with side views in the right and bottom panels. The biofilm surface is directed toward the top left panel. Objective 100×.

In the CLSM images with FISH‐probes specific for the individual Tannerella species, the long, segmented T. serpentiformis cells could be detected as single cells throughout the whole biofilm structure (Figure 5b, left), without an indication of cluster formation. In contrast, T. forsythia cells were found in large groups in the upper layer of the biofilm, closely associated with itself and other bacteria (Figure 5b, right), conforming with previous data (Bloch et al., 2017b). The cells could only be detected when fresh culture of T. forsythia was added to the medium, thereby increasing its concentration by almost two log units to 9.83 × 10⁸ ± 2.15 × 10⁸ cells per biofilm. Replica of the biofilm structures shown in Figure 5 can be found in Figure S3.

Based on the growth‐promoting effect of P. gingivalis on T. serpentiformis, a possible co‐localization of these bacteria was investigated in a “five‐species” biofilm containing the two bacteria, where P. gingivalis was FISH‐stained and T. serpentiformis was determined based on its distinct morphology (Figure 6). The presence of P. gingivalis did not alter the distribution and localization of T. serpentiformis in any discernible way and the two bacteria were not found to co‐localize. Nevertheless, T. serpentiformis was highly abundant in “five species” biofilms with P. gingivalis (compare with Figure 4).

FIGURE 6.

CLSM image of a fixed “five‐species” biofilm containing T. serpentiformis and P. gingivalis. Yellow/red: FISH‐stained P. gingivalis cells; green/teal: nonhybridized cells (DNA staining Sytox green). Tannerella serpentiformis cells can be distinguished by their snake‐like morphology; red arrows indicate exemplarily T. serpentiformis cells. Objective 100×.

3.6. Invasion and adhesion of T. serpentiformis and T. forsythia to Ca9‐22 cells

Figure 7 shows the percentage of viable intracellularly invaded and extracellularly adherent Tannerella species upon infection of Ca9‐22 cells. The percentage of intracellularly invaded and surviving bacteria was significantly higher for T. forsythia (26.90 ± 8.28%) than for T. serpentiformis (6.10 ± 3.12%). No significant difference in the percentage of extracellularly adherent bacteria was observed between the two Tannerella species, with 9.96 ± 7.73% and 5.42 ± 5.23% for T. forsythia and T. serpentiformis, respectively.

FIGURE 7.

Tannerella forsythia (blue) and T. serpentiformis (red) invading or adhering to Ca9‐22 cells. Following infection at a MOI of 100, intracellular and Ca9‐22 cell‐associated bacteria were spotted in triplicate on blood agar plates and the CFUs were counted. The y‐axis shows the percentage of CFUs counted for the invaded or adherent bacteria in relation to those counted for the corresponding Tannerella species in cell‐free medium. Four independent experiments with three technical replicates per assay were performed. Data are presented as mean ± SD. Asterisks indicate statistically significant differences between the strains as determined by the unpaired Student's t‐test (**p < 0.01).

3.7. MTT cell viability assay

Prior to studying the immunestimulatory potential of T. forsythia and T. serpentiformis in U937 macrophages and hGFs, the influence of the two Tannerella species on the viability of the human cells was determined (Figure 8). Four hours post stimulation, no significant effect of the bacteria on the viability of both host cell types was observed, while 24 h post stimulation, both T. forsythia and T. serpentiformis significantly increased the viability of U937 macrophages, but no difference between the two Tannerella species was found. A similar tendency was observed for hGFs, but the increase in viability was statistically insignificant.

FIGURE 8.

Effect of T. forsythia and T. serpentiformis on the viability of (a) U937 macrophages and (b) human gingival fibroblasts (hGFs). Cells were stimulated with T. forsythia or T. serpentiformis at a multiplicity of infection (MOI) 50 for 4 h or 24 h, and cell viability was measured by the MTT method. Cells without bacterial stimulation served as a control. The y‐axis shows OD₅₇₀ values. Data are presented as mean ± s.e.m. of five independent experiments. *Significantly different from control.

3.8. Inflammatory response elicited by T. serpentiformis and T. forsythia in U937 macrophages

The effect of T. forsythia and T. serpentiformis on the production of TNF‐α, IL‐1 β, IL‐8, and MCP‐1 in U937 macrophages four and 24 h post stimulation was investigated (Figure 9). Both Tannerella species induced a significant increase in the gene expression of all investigated inflammatory mediators after 4 h. After 24 h, significantly higher gene expression levels compared to the controls were observed for IL‐1β and IL‐8, but not for TNF‐α and MCP‐1. No significant difference in the gene expression of all investigated mediators was observed between T. forsythia and T. serpentiformis at both analyzed time points. On the protein level, IL‐1β was below the detection limit 4 h post stimulation, but otherwise, both Tannerella species induced a significant increase in the concentrations of all investigated inflammatory mediators. Four hours post stimulation, T. serpentiformis induced a significantly higher concentration of TNF‐α and IL‐8 in the conditioned media compared to T. forsythia, whereas no difference in the concentration of MCP‐1 was observed. IL‐1β was not detected in the conditioned media 4 h post stimulation. Twenty‐four hours post stimulation, no significant difference in the concentrations of all investigated mediators was detected.

FIGURE 9.

Inflammatory response of U937 macrophages upon the stimulation with T. forsythia and T. serpentiformis. U937 macrophages were stimulated with T. forsythia and T. serpentiformis at a MOI of 50 for 4 h or 24 h and (A) the resulting gene‐expression of tumor necrosis factor α (TNF‐α) (a), Interleukin‐1β (IL‐1β) (b), IL‐8 (c), and monocyte chemoattractant protein‐1 (MCP‐1) (d), and (B) the concentration of corresponding proteins in conditioned media was determined by qPCR and ELISA, respectively. Changes in the gene expression of target protein (n‐fold expression) was calculated by the 2^–ΔΔCt method taking unstimulated cells as a control (n‐fold expression = 1, shown by the dotted lines). Data are presented as mean ± s.e.mEM of five independent experiments. *Significantly different from control. #Significantly different between T. forsythia and T. serpentiformis.

3.9. Inflammatory response elicited by T. serpentiformis and T. forsythia in human gingival fibroblasts

Figure 10 shows the production of IL‐6, IL‐8, and MCP‐1 by hGFs in response to the stimulation with T. forsythia and T. serpentiformis four and 24 h post stimulation. While after 4 h, no significant changes in the gene expression of the inflammatory mediators were found, both T. forsythia and T. serpentiformis induced a significant increase in the gene expression of all proteins after 24 h. Tannerella serpentiformis induced a significantly higher gene expression of IL‐8 than T. forsythia, but no difference in the gene expression of IL‐6 and MCP‐1 was observed. After 4 h, the concentration of all proteins in the conditioned media was below the detection limit. After 24 h, the levels of IL‐6, IL‐8, and MCP‐1 protein in the conditioned media were significantly increased by both bacteria, and the levels induced by T. serpentiformis were significantly higher than those induced by T. forsythia.

FIGURE 10.

Inflammatory response of human gingival fibroblasts (hGFs) upon the stimulation with T. forsythia and T. serpentiformis. hGFs were stimulated with T. forsythia and T. serpentiformis at a multiplicity of infection (MOI) and the resulting gene‐expression of (A) interleukin 6 (IL‐6), IL‐8, and monocyte chemoattractant protein‐1 (MCP‐1) after 4 h and 24 h and (B) the concentration of corresponding proteins in conditioned media after 24 h were assessed by qPCR and ELISA, respectively. Please note that 4 h post stimulation, protein concentrations were below the detection limit. Changes in the gene expression of target protein (n‐fold expression) was calculated by the 2^–ΔΔCt method taking unstimulated cells as a control (n‐fold expression = 1, shown by the dotted lines). Data are presented as mean ± s.e.m. of six independent experiments with cells isolated from six different donors. *Significantly different from control. #Significantly different between T. forsythia and T. serpentiformis.

4. DISCUSSION

Biofilm formation on the tooth surface results in bacterial colonization and invasion of gingival tissue which plays an important role in the pathogenesis of periodontitis. This study was devised to compare two phylogenetically closely related bacterial species—the novel, Gram‐negative oral anaerobe T. serpentiformis, which is predictably associated with a healthy periodontium, and the “red‐complex” member T. forsythia—with regards to their behavior in a multispecies oral model biofilm and their interaction with various human host cells.

In an in vitro set‐up, the effects of the two Tannerella species on biofilms grown on pellicle‐coated HA discs and consisting of the five species F. nucleatum, A. oris S. oralis, S. anginosus, and V. dispar were investigated. Porphyromonas gingivalis was included in this study due to its documented role as a keystone pathogen and contributor to the progression of periodontitis and its potential interplay with T. forsythia (W. D. Zhu & Lee, 2016).

An important finding was unraveled by the simultaneous addition of the two Tannerella species to the multispecies biofilm, revealing a competitive effect between T. forsythia and T. serpentiformis (Figure 3). Furthermore, P. gingivalis’ important role in the microbial consortium was supported by demonstrating its growth‐promoting effect not only on the commensal species and F. nucleatum but also on T. forsythia and T. serpentiformis (Figure 4). This is in accordance with the literature; P. gingivalis was described to cause an overall increase in the bacterial load of biofilms (Hajishengallis & Lamont, 2012), which is characteristic of periodontitis. Tannerella serpentiformis, but not T. forsythia, decreased the growth of the “five species” and mitigated P. gingivalis’ growth‐promoting effect, especially on S. oralis. Notably, in a previous study, S. oralis showed significantly decreased numbers in the absence of the ‘‘red complex’’ at 24 h (p < 0.05), followed by a significant increase at 48 h (Thurnheer et al., 2014). Streptococcus oralis was also found to serve as commensal keeper of homeostasis in the subgingival biofilm by antagonizing Streptococcus mutans, thereby preventing a caries‐favoring dysbiotic state (Thurnheer & Belibasakis, 2018). Influencing or preventing oral biofilm growth to a certain degree by T. serpentiformis could be an important mechanism for maintaining the symbiotic relationship between the oral microbiome and the host immune system in vivo and support the role of this species in oral health maintenance.

In contrast to T. forsythia (W. D. Zhu & Lee, 2016), no co‐localization or co‐aggregation of T. serpentiformis with P. gingivalis could be visualized by CLSM in biofilms after FISH‐staining or by SEM (Figure 5). This was surprising, considering that the S‐layer, which both Tannerella species possess as an outermost cell surface coating (Frey et al., 2018; Sekot et al., 2012), is presumed to be the major driver in co‐aggregation (W. D. Zhu & Lee, 2016). However, given that antibodies raised against the T. forsythia S‐layer do not cross‐react with the S‐layer of T. serpentiformis (Figure 1c), different epitopes might be presented at the cell surface of these bacteria. The S‐layer was also described to be important for T. forsythia’s monospecies biofilm formation (Bloch et al., 2017a). Biofilm formation was, however, significantly decreased or absent for T. serpentiformis compared to T. forsythia (Figure S2). Another factor involved in this observation might be the absence of the NanH sialidase in T. serpentiformis (Beall et al., 2018) which was described to be important for T. forsythia’s biofilm formation on mucin‐covered supports (Roy et al., 2011).

Concerning the interaction capability of T. serpentiformis and T. forsythia with different host cells, a substantial difference between the two Tannerella species was observed in their ability to invade to and survive in epithelial Ca9‐22 cells (Figure 7). Host cell invasion is a useful mechanism for bacteria to evade immune effector molecules and utilize a nutrient‐rich environment supporting their pathogenicity (Lamont & Hajishengallis, 2015). This ability was shown previously for several putative periodontal pathogens, including P. gingivalis, T. denticola, T. forsythia, and F. nucleatum (Inagaki et al., 2016; Lamont et al., 1995; Li et al., 2015; Mishima & Sharma, 2011; Zhang et al., 2021). Our data show that the invasion and survival capability of T. serpentiformis in oral epithelial cells is markedly lower than that of T. forsythia, underlining the association of T. serpentiformis with oral health. The difference between T. serpentiformis and T. forsythia in their invasive capability might involve the NanH sialidase, considering that this enzyme is absent in T. serpentiformis, and NanH‐deficient T. forsythia exhibited impaired epithelial cell invasion compared to the wild‐type bacterium (Honma et al., 2011).

Both T. serpentiformis and T. forsythia had no detrimental effect on the viability of U937 macrophages and primary hGFs (Figure 8). Moreover, both Tannerella species significantly increased the viability of U937 macrophages—with no significant difference observed between them—and did not affect that of hGFs. A similar observation regarding cell viability was made in one of our recent studies (Braun et al., 2022). An increased viability of U937 macrophages upon infection with Tannerella species could be due to metabolic remodeling of these cells after bacterial infection (Fleetwood et al., 2017). However, the implications on oral health maintenance and progression of periodontitis are unclear.

Tannerella serpentiformis induced generally a higher production of various pro‐inflammatory mediators by host cells than T. forsythia. Particularly, a significant difference was observed for TNF‐α, IL‐8, and MCP‐1 four h post‐infection (Figure 9), and of IL‐6, IL‐8, and MCP‐1 24 h post‐infection (Figure 10) in U937 macrophages and hGFBs, respectively. The production of inflammatory mediators by the host cells upon bacterial stimulation is most probably mediated through various pattern recognition receptors, particularly toll‐like receptor (TLR) family members, which recognize different pathogen‐associated molecular patterns (PAMPs) (Underhill & Ozinsky, 2002). Specifically, TLR‐2 recognizes peptidoglycan and lipoproteins as PAMPs, whereas TLR‐4 recognizes lipopolysaccharides (LPS) of Gram‐negative bacteria (Behm et al., 2020; Di Lorenzo et al., 2020; Nativel et al., 2017). For P. gingivalis LPS, TLR‐4 signaling was only recently confirmed (Nativel et al., 2017), while it was previously assumed that P. gingivalis LPS can act as a TLR2 or TLR4 agonist, depending on the TLR expression of the host cell, that is, TLR‐4 on endothelial cells versus TLR‐2 on epithelial cells (Kocgozlu et al., 2009). Regarding this present work, it is important to note it was previously shown that U937 macrophages as well as hGFBs express both TLR‐2 and TLR‐4 (Andrukhov, 2021; Jin et al., 2011). Determining the distinct contribution of TLRs to the host response to different Tannerella species remains an important subject of future studies. Additionally, differences in S‐layer glycosylation of the investigated Tannerella species might be of immunological relevance. There are indications that Mincle (Macrophage inducible C‐type lectin) recognizes the S‐layer glycoprotein of T. forsythia and thus is involved in the modulation of the cytokine response of macrophages against the bacterium (Chinthamani et al., 2017).

The immune response is a double‐edged sword: on the one hand, it is directed to eliminate overgrowing bacteria; on the other hand, it can cause collateral host tissue damages. The inflammatory mediators investigated in our study are involved in various stages of the host immune response—IL‐1β, TNF‐α, and IL‐6 promote the immune response and might directly induce tissue destruction (Palmqvist et al., 2008), whereas IL‐8 and MCP‐1 are chemokines stimulating the infiltration of neutrophils and monocytes, respectively (Baggiolini et al., 1994; Silva et al., 2007). Considering that T. serpentiformis is considered health‐associated and putatively balancing the oral biofilm, an increased inflammatory host response could be essential for its effective elimination in case of overgrowth. Particularly, a higher production of IL‐8 and MCP‐1 induced by T. serpentiformis might attract more leukocytes in vivo, which could be essential for the growth control of this bacterium, and for the biofilm growth in general.

The reasons for the higher inflammatory response to T. serpentiformis compared to T. forsythia remain to be investigated. It might involve the differences in the S‐layer and its glycosylation in the two Tannerella species (Figure 1c,d) (Frey et al., 2018; Tomek et al., 2018; Zwickl et al., 2020). As shown by our previous study, the S‐layer of T. forsythia delays the inflammatory response of macrophages and hGFs to this bacterium (Sekot et al., 2011). Furthermore, the absence of several KLIKK proteases in T. serpentiformis, which are considered important virulence factors of T. forsythia possessing proteolytic ability against several host proteins (Ksiazek et al., 2015) might play a role. Interestingly, in some cases, differences in the inflammatory response between the Tannerella species were observed only on the protein but not on the gene level. This is probably due to the fact that gene expression level reflects the response at a certain time point, whereas proteins accumulate in the conditioned media during the whole coculture time.

Oral health is characterized by symbiotic interactions between the oral microbiome and the host immune system, whereas periodontitis is considered a dysbiotic state (Hajishengallis et al., 2020). For a long time, subgingival biofilms were considered an important etiological factor in the development of periodontitis (Curtis et al., 2020). However, the studies of the last decade revealed that the etiology of periodontitis is highly complex involving several ecological and genetic factors (Loos & Van Dyke, 2020; Rosier et al., 2018). Although the involvement of bacterial biofilms in the initiation of periodontitis is debated (Bartold & Van Dyke, 2019), microbiological studies using 16S rRNA sequencing showed that periodontitis is associated with both a qualitative and a quantitative alteration of the oral microbiome, particularly with a higher total biomass and increased prevalence of several Gram‐negative anaerobic bacteria, including the “red‐complex” bacteria P. gingivalis, T. denticola, and T. forsythia (Abusleme et al., 2021; Costalonga & Herzberg, 2014). The transition from a health‐associated, symbiotic to periodontitis‐associated dysbiotic state could be driven by biofilm‐associated, host‐associated, or ecological factors (Loos & Van Dyke, 2020; Van Dyke et al., 2020), but in most cases, by combinations of those. The data of the present study showed that predictably health‐associated T. serpentiformis and periodontitis‐associated T. forsythia are markedly different regarding their behavior in a multispecies oral model biofilm and their interaction with the host immune system. Biofilm overgrowth, which is a characteristic of periodontitis, can be hindered by T. serpentiformis. Furthermore, T. serpentiformis exhibits a low invasion and survival potential in oral epithelial cells and induces a higher inflammatory response, implicating an effective control of this species by the host immune system. These findings emphasize the role of this species in periodontal health maintenance. A competitive relationship between T. serpentiformis and T. forsythia could play an important role in the transition from a symbiotic to dysbiotic state and thus the progression of periodontitis.

In summary, this study contributes to our understanding of the biological role of closely related Tannerella species with different pathogenicity potential, pointing toward a nonpathogenic lifestyle of T. serpentiformis as a member of the commensal oral biofilm consortium which may be harnessed for pathogen inhibition and future therapeutic approaches.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Supporting information

Supp Information

Kendlbacher, F. L. , Bloch, S. , Hager‐Mair, F. F. , Bacher, J. , Janesch, B. , Thurnheer, T. , Andrukhov, O. , & Schäffer, C. (2023). Multispecies biofilm behavior and host interaction support the association of Tannerella serpentiformis with periodontal health. Molecular Oral Microbiology, 38, 115–133. 10.1111/omi.12385

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.