Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2024 Feb 8;98(3):e01731-23. doi: 10.1128/jvi.01731-23

Revisiting host identification of bacteriophage Enc34: from biochemical to molecular

Elina Cernooka 1, Andris Dislers 1, Andris Kazaks 1,
Editor: Kristin N Parent2
PMCID: PMC10949441  PMID: 38329345

ABSTRACT

In our 2012 genome announcement (J Virol 86:11403–11404, 2012, https://doi.org/10.1128/JVI.01954-12), we initially identified the host bacterium of bacteriophage Enc34 as Enterobacter cancerogenus using biochemical tests. However, later in-house DNA sequencing revealed that the true host is a strain of Hafnia alvei. Capitalizing on our new DNA-sequencing capabilities, we also refined the genomic termini of Enc34, confirming a 60,496-bp genome with 12-nucleotide 5′ cohesive ends.

IMPORTANCE

Our correction reflects the evolving landscape of bacterial identification, where molecular methods have supplanted traditional biochemical tests. This case underscores the significance of revisiting past identifications, as seemingly known bacterial strains may yield unexpected discoveries, necessitating essential updates to the scientific record. Despite the host identity correction, our genome announcement retains importance as the first complete genome sequence of a Hafnia alvei bacteriophage.

MATTERS ARISING

In our 2012 genome announcement (1), we reported the discovery and genome sequencing of bacteriophage Enc34, identifying its host bacterium as Enterobacter cancerogenus using the BD BBL Crystal Enteric/Nonfermenter Identification System, a widely used biochemical identification kit. The results showed that E. cancerogenus was the top match with a biotype validity of 3, a confidence score of 0.9980, and no reported unusual reactions. Notably, Hafnia alvei appeared as the third likely match with a biotype validity of 2,412 and a confidence score of 0.0008, with two unusual reactions (Bgl+ and Pro−). At that time, given the strong biotype validity, confidence score, and the absence of unusual biochemical reactions, we had little doubt about annotating the Enc34 host bacterium as E. cancerogenus.

However, with the introduction of in-house DNA-sequencing capabilities, we revisited this identification and discovered that the true host of Enc34 is, in fact, a strain of H. alvei. Initially, we conducted 16S rRNA Sanger sequencing, following standard procedures (2) and using the primers listed in Table 1. Subsequent EzBioCloud (3) analysis indicated a 99.86% and 99.79% similarity with H. alvei strains ATCC 13337(T) and GB001, respectively, both with 100% completeness. Additionally, standard nucleotide BLAST (4) confirmed 100% identity over 100% query coverage with H. alvei strains PCM 1200, 3.8.4, FB1, and Colony388. These findings were further corroborated with rpoB sequencing, the results of which likewise revealed 100% identity over 100% query coverage with the sequence from H. alvei strain HUMV-5920, as summarized in Table 2. Notably, both 16S rRNA and rpoB analyses failed to detect any matches to E. cancerogenus or other known Enterobacter species. We believe that our results provide robust molecular evidence for the correction of Enc34 host identity to H. alvei.

TABLE 1.

Primers used in the study

Genomic target Primer name Sequence (5′–3′) Purpose
16S rRNA 27F AGAGTTTGATC MTGGCTCAG For amplifying and sequencing the 16S rRNA gene (5)
16S rRNA 1492R TACGGYTACCTTGTTACGACTT For amplifying and sequencing the 16S rRNA gene
rpoB rpoB-Fw GGTTACAACTTCGAAGACTCC For amplifying and sequencing the rpoB gene (6)
rpoB rpoB-Rv CACCAGGCTGGATCTGACG For amplifying and sequencing the rpoB gene
Genomic terminus Enc_N_Rv GAGGTATGATGATAGCTATCTAC For amplifying and sequencing the genomic termini
Genomic terminus Enc_C_Fw CTAGTGTGTATTGTGGTCATAC For amplifying and sequencing the genomic termini

TABLE 2.

Sequence-identical BLAST matches for the Enc34 host bacterium

Target gene BLAST match strain GenBank ID Genomic coordinates Sequence identity (%) Query coverage (%)
16S rRNA H. alvei PCM_1220 CP036514 886,778–888,188 100 100
16S rRNA H. alvei 3.8.4 CP134154 261,295–262,705 100 100
16S rRNA H. alvei FB1 CP009706 449,089–450,499 100 100
16S rRNA H. alvei Colony388 CP078562 449,089–450,499 100 100
rpoB H. alvei HUMV-5920 CP015379 1,193,619–1,194,349 100 100

H. alvei is a Gram-negative bacterium in the Hafniaceae family, within the Enterobacterales order (7). In our study, the bacterium and its phage were isolated as part of an environmental sampling effort aimed at phage discovery. The specific sample that led to their isolation contained dead Drosophilidae fruit flies, collected on our institute’s premises. The methodological approach employed was analogous to that detailed in our study of Mimir87, a phage we isolated from honey bees (8). Considering the complexity of the insect sample, pinpointing the precise origin of Enc34 and its host is challenging. Nonetheless, given H. alvei’s established role as a commensal organism in the gut microbiota of various animals (9), it is plausible that they originated from the gastrointestinal tract of these insects. Besides its commensal presence, H. alvei is also known for causing opportunistic human infections (10) and has been associated with diseases in other species, such as bees and fish (11).

The disparity between our original biochemical tests and later sequencing results may have several underlying causes. Biochemical analyses, while historically valuable, may lack the specificity and resolution of molecular methods (12). Additionally, inconsistencies in bacterial taxonomy nomenclature could also contribute to such variations (13). This case underscores the necessity of transitioning toward molecular methods in bacterial identification and 16S rRNA characterization of laboratory collections. As molecular techniques continue to advance, reevaluating and rectifying previous identifications becomes imperative to preserve the accuracy and integrity of the scientific record.

Additionally, we conducted Sanger DNA sequencing to refine the genomic termini of Enc34, addressing the limitation that complete genome sequencing often does not fully resolve these terminal regions (14). We employed a run-off sequencing technique using primers designed to hybridize near the predicted genome ends, as detailed in Table 1. Through this analysis, we determined that the genome is, in fact, 60,496 bp in length, possesses 12-nucleotide 5′ cohesive (cos) ends, and has a G + C content of 51.08%. These updates provide a more accurate representation of the phage’s genetic makeup. Importantly, the genomic organization and contents remain consistent with what was originally reported in our announcement.

To our knowledge, the first report of an H. alvei phage dates back to 1968 (15), yet a complete genomic sequence for this early isolate remains unavailable. Our 2012 genome announcement represented a significant advancement, being the first to detail the complete genome sequence of an H. alvei bacteriophage. Progress has since continued with the characterization of H. alvei phages HP-T19 (16) and vB_HalM_SPARTY (17). A phage infecting the closely related Hafnia paralvei has also been described (18). We ourselves have recently sequenced two more phages specific to Hafnia sp., Pocis76 and Pocitis76 (GenBank IDs: MW689258 and OL512804), isolated from bees. As research in this field continues to flourish, we are confident that an even broader range of Hafnia bacteriophages will be discovered, further enriching our understanding of viral abundance and diversity in nature.

Contributor Information

Andris Kazaks, Email: andris@biomed.lu.lv.

Kristin N. Parent, Michigan State University, East Lansing, Michigan, USA

DATA AVAILABILITY

The complete genome sequence of bacteriophage Enc34 is available in the GenBank repository under the accession number JQ340774. Any additional data sets supporting the conclusions of this article are available from the corresponding author upon reasonable request. Furthermore, the host bacterium of Enc34 is preserved at the Microbial Strain Collection of Latvia under the accession number MSCL 797.

REFERENCES

  • 1. Kazaks A, Dislers A, Lipowsky G, Nikolajeva V, Tars K. 2012. Complete genome sequence of the Enterobacter cancerogenus bacteriophage Enc34. J Virol 86:11403–11404. doi: 10.1128/JVI.01954-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Green MR, Sambrook J. 2012. Molecular cloning: a laboratory manual. 4th ed. Cold Spring Harbor, New York, NY. [Google Scholar]
  • 3. Yoon SH, Ha SM, Kwon S, Lim J, Kim Y, Seo H, Chun J. 2017. Introducing EzBioCloud: a taxonomically united database of 16S rRNA gene sequences and whole-genome assemblies. Int J Syst Evol Microbiol 67:1613–1617. doi: 10.1099/ijsem.0.001755 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL. 2009. BLAST+: architecture and applications. BMC Bioinformatics 10:421. doi: 10.1186/1471-2105-10-421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Janda JM, Abbott SL. 2007. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: pluses, perils, and pitfalls. J Clin Microbiol 45:2761–2764. doi: 10.1128/JCM.01228-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Ogier JC, Pagès S, Galan M, Barret M, Gaudriault S. 2019. rpoB, a promising marker for analyzing the diversity of bacterial communities by amplicon sequencing. BMC Microbiol 19:171. doi: 10.1186/s12866-019-1546-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Adeolu M, Alnajar S, Naushad S, S Gupta R. 2016. Genome-based phylogeny and taxonomy of the 'Enterobacteriales': proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Int J Syst Evol Microbiol 66:5575–5599. doi: 10.1099/ijsem.0.001485 [DOI] [PubMed] [Google Scholar]
  • 8. Zrelovs N, Cernooka E, Dislers A, Kazaks A. 2020. Isolation and characterization of the novel Virgibacillus-infecting bacteriophage Mimir87. Arch Virol 165:737–741. doi: 10.1007/s00705-019-04516-2 [DOI] [PubMed] [Google Scholar]
  • 9. Song HS, Kim JY, Kim YB, Jeong MS, Kang J, Rhee JK, Kwon J, Kim JS, Choi JS, Choi HJ, Nam YD, Roh SW. 2017. Complete genome sequence of a commensal bacterium, Hafnia alvei CBA7124, isolated from human feces. Gut Pathog 9:41. doi: 10.1186/s13099-017-0190-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Ionescu MI, Neagoe D Ș, Crăciun AM, Moldovan OT. 2022. The Gram-negative bacilli isolated from caves – Sphingomonas paucimobilis and Hafnia alvei and a review of their involvement in human infections. Int J Environ Res Public Health 19:2324. doi: 10.3390/ijerph19042324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Padilla D, Acosta F, Ramos-Vivas J, Grasso V, Bravo J, El Aamri F, Real F. 2015. The pathogen Hafnia alvei in veterinary medicine: a review. J Appl Anim Res 43:231–235. doi: 10.1080/09712119.2014.963086 [DOI] [Google Scholar]
  • 12. Franco-Duarte R, Černáková L, Kadam S, Kaushik KS, Salehi B, Bevilacqua A, Corbo MR, Antolak H, Dybka-Stępień K, Leszczewicz M, Relison Tintino S, Alexandrino de Souza VC, Sharifi-Rad J, Coutinho HDM, Martins N, Rodrigues CF. 2019. Advances in chemical and biological methods to identify microorganisms–from past to present. Microorganisms 7:130. doi: 10.3390/microorganisms7050130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Hugenholtz P, Chuvochina M, Oren A, Parks DH, Soo RM. 2021. Prokaryotic taxonomy and nomenclature in the age of big sequence data. ISME J 15:1879–1892. doi: 10.1038/s41396-021-00941-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Casjens SR, Gilcrease EB. 2009. Determining DNA packaging strategy by analysis of the termini of the chromosomes in tailed-bacteriophage virions. Methods Mol Biol 502:91–111. doi: 10.1007/978-1-60327-565-1_7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Guinée PA, Valkenburg JJ. 1968. Diagnostic value of a Hafnia-specific bacteriophage. J Bacteriol 96:564. doi: 10.1128/jb.96.2.564-.1968 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Ture M, Altinok I, Cebeci A, Caliskan N. 2022. Characterization of novel bacteriophage HP-T19 that targets Hafnia alvei. Aquac Res 53:694–699. doi: 10.1111/are.15592 [DOI] [Google Scholar]
  • 17. Bullen A, Grahe A, Kassolis P, Singleton DR. 2022. Complete genome sequence of a novel Hafnia alvei bacteriophage. Microbiol Resour Announc 11:e0004922. doi: 10.1128/mra.00049-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Pan L, Li D, Sun Z, Lin W, Hong B, Qin W, Xu L, Liu W, Zhou Q, Wang F, Cai R, Qian M, Tong Y. 2021. First characterization of a Hafnia phage reveals extraordinarily large burst size and unusual plaque polymorphism. Front Microbiol 12:754331. doi: 10.3389/fmicb.2021.754331 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The complete genome sequence of bacteriophage Enc34 is available in the GenBank repository under the accession number JQ340774. Any additional data sets supporting the conclusions of this article are available from the corresponding author upon reasonable request. Furthermore, the host bacterium of Enc34 is preserved at the Microbial Strain Collection of Latvia under the accession number MSCL 797.


Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES