Revisiting host identification of bacteriophage Enc34: from biochemical to molecular

ABSTRACT

In our 2012 genome announcement (J Virol 86:11403–11404, 2012, https://doi.org/10.1128/JVI.01954-12), we initially identified the host bacterium of bacteriophage Enc34 as Enterobacter cancerogenus using biochemical tests. However, later in-house DNA sequencing revealed that the true host is a strain of Hafnia alvei. Capitalizing on our new DNA-sequencing capabilities, we also refined the genomic termini of Enc34, confirming a 60,496-bp genome with 12-nucleotide 5′ cohesive ends.

IMPORTANCE

Our correction reflects the evolving landscape of bacterial identification, where molecular methods have supplanted traditional biochemical tests. This case underscores the significance of revisiting past identifications, as seemingly known bacterial strains may yield unexpected discoveries, necessitating essential updates to the scientific record. Despite the host identity correction, our genome announcement retains importance as the first complete genome sequence of a Hafnia alvei bacteriophage.

MATTERS ARISING

In our 2012 genome announcement (1), we reported the discovery and genome sequencing of bacteriophage Enc34, identifying its host bacterium as Enterobacter cancerogenus using the BD BBL Crystal Enteric/Nonfermenter Identification System, a widely used biochemical identification kit. The results showed that E. cancerogenus was the top match with a biotype validity of 3, a confidence score of 0.9980, and no reported unusual reactions. Notably, Hafnia alvei appeared as the third likely match with a biotype validity of 2,412 and a confidence score of 0.0008, with two unusual reactions (Bgl+ and Pro−). At that time, given the strong biotype validity, confidence score, and the absence of unusual biochemical reactions, we had little doubt about annotating the Enc34 host bacterium as E. cancerogenus.

However, with the introduction of in-house DNA-sequencing capabilities, we revisited this identification and discovered that the true host of Enc34 is, in fact, a strain of H. alvei. Initially, we conducted 16S rRNA Sanger sequencing, following standard procedures (2) and using the primers listed in Table 1. Subsequent EzBioCloud (3) analysis indicated a 99.86% and 99.79% similarity with H. alvei strains ATCC 13337(T) and GB001, respectively, both with 100% completeness. Additionally, standard nucleotide BLAST (4) confirmed 100% identity over 100% query coverage with H. alvei strains PCM 1200, 3.8.4, FB1, and Colony388. These findings were further corroborated with rpoB sequencing, the results of which likewise revealed 100% identity over 100% query coverage with the sequence from H. alvei strain HUMV-5920, as summarized in Table 2. Notably, both 16S rRNA and rpoB analyses failed to detect any matches to E. cancerogenus or other known Enterobacter species. We believe that our results provide robust molecular evidence for the correction of Enc34 host identity to H. alvei.

TABLE 1.

Primers used in the study

Genomic target	Primer name	Sequence (5′–3′)	Purpose
16S rRNA	27F	AGAGTTTGATC MTGGCTCAG	For amplifying and sequencing the 16S rRNA gene (5)
16S rRNA	1492R	TACGGYTACCTTGTTACGACTT	For amplifying and sequencing the 16S rRNA gene
rpoB	rpoB-Fw	GGTTACAACTTCGAAGACTCC	For amplifying and sequencing the rpoB gene (6)
rpoB	rpoB-Rv	CACCAGGCTGGATCTGACG	For amplifying and sequencing the rpoB gene
Genomic terminus	Enc_N_Rv	GAGGTATGATGATAGCTATCTAC	For amplifying and sequencing the genomic termini
Genomic terminus	Enc_C_Fw	CTAGTGTGTATTGTGGTCATAC	For amplifying and sequencing the genomic termini

TABLE 2.

Sequence-identical BLAST matches for the Enc34 host bacterium

Target gene	BLAST match strain	GenBank ID	Genomic coordinates	Sequence identity (%)	Query coverage (%)
16S rRNA	H. alvei PCM_1220	CP036514	886,778–888,188	100	100
16S rRNA	H. alvei 3.8.4	CP134154	261,295–262,705	100	100
16S rRNA	H. alvei FB1	CP009706	449,089–450,499	100	100
16S rRNA	H. alvei Colony388	CP078562	449,089–450,499	100	100
rpoB	H. alvei HUMV-5920	CP015379	1,193,619–1,194,349	100	100

H. alvei is a Gram-negative bacterium in the Hafniaceae family, within the Enterobacterales order (7). In our study, the bacterium and its phage were isolated as part of an environmental sampling effort aimed at phage discovery. The specific sample that led to their isolation contained dead Drosophilidae fruit flies, collected on our institute’s premises. The methodological approach employed was analogous to that detailed in our study of Mimir87, a phage we isolated from honey bees (8). Considering the complexity of the insect sample, pinpointing the precise origin of Enc34 and its host is challenging. Nonetheless, given H. alvei’s established role as a commensal organism in the gut microbiota of various animals (9), it is plausible that they originated from the gastrointestinal tract of these insects. Besides its commensal presence, H. alvei is also known for causing opportunistic human infections (10) and has been associated with diseases in other species, such as bees and fish (11).

The disparity between our original biochemical tests and later sequencing results may have several underlying causes. Biochemical analyses, while historically valuable, may lack the specificity and resolution of molecular methods (12). Additionally, inconsistencies in bacterial taxonomy nomenclature could also contribute to such variations (13). This case underscores the necessity of transitioning toward molecular methods in bacterial identification and 16S rRNA characterization of laboratory collections. As molecular techniques continue to advance, reevaluating and rectifying previous identifications becomes imperative to preserve the accuracy and integrity of the scientific record.

Additionally, we conducted Sanger DNA sequencing to refine the genomic termini of Enc34, addressing the limitation that complete genome sequencing often does not fully resolve these terminal regions (14). We employed a run-off sequencing technique using primers designed to hybridize near the predicted genome ends, as detailed in Table 1. Through this analysis, we determined that the genome is, in fact, 60,496 bp in length, possesses 12-nucleotide 5′ cohesive (cos) ends, and has a G + C content of 51.08%. These updates provide a more accurate representation of the phage’s genetic makeup. Importantly, the genomic organization and contents remain consistent with what was originally reported in our announcement.

To our knowledge, the first report of an H. alvei phage dates back to 1968 (15), yet a complete genomic sequence for this early isolate remains unavailable. Our 2012 genome announcement represented a significant advancement, being the first to detail the complete genome sequence of an H. alvei bacteriophage. Progress has since continued with the characterization of H. alvei phages HP-T19 (16) and vB_HalM_SPARTY (17). A phage infecting the closely related Hafnia paralvei has also been described (18). We ourselves have recently sequenced two more phages specific to Hafnia sp., Pocis76 and Pocitis76 (GenBank IDs: MW689258 and OL512804), isolated from bees. As research in this field continues to flourish, we are confident that an even broader range of Hafnia bacteriophages will be discovered, further enriching our understanding of viral abundance and diversity in nature.

DATA AVAILABILITY

The complete genome sequence of bacteriophage Enc34 is available in the GenBank repository under the accession number JQ340774. Any additional data sets supporting the conclusions of this article are available from the corresponding author upon reasonable request. Furthermore, the host bacterium of Enc34 is preserved at the Microbial Strain Collection of Latvia under the accession number MSCL 797.