Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2024 Feb 15;98(3):e01923-23. doi: 10.1128/jvi.01923-23

An intranasal influenza virus vector vaccine protects against Helicobacter pylori in mice

Longyu Nie 1, Yu Huang 1, Zhikui Cheng 1, Hao Luo 1, Yuxin Zhan 1, Kaiwen Dou 1, Caijiao Ma 1, Chen Yu 1, Chuanjin Luo 1, Zhiqiang Liu 1, Shi Liu 1, Ying Zhu 1,
Editor: Anice C Lowen2
PMCID: PMC10949480  PMID: 38358289

ABSTRACT

Helicobacter pylori is a human pathogen that infects almost half of the population. Antibiotic resistance in H. pylori threatens health and increases the demand for prophylactic and therapeutic vaccines. Traditional oral vaccine research faces considerable challenges because of the epithelial barrier, potential enterotoxicity of adjuvants, and the challenging conditions of the gastric environment. We developed an intranasal influenza A virus (IAV) vector vaccine based on two live attenuated influenza viruses with modified acidic polymerase protein (PA) genes encoding the A subunit of H. pylori neutrophil-activating protein (NapA), named IAV-NapA, including influenza virus A/WSN/33 (WSN)-NapA and A/Puerto Rico/8/34 (PR8)-NapA. These recombinant influenza viruses were highly attenuated and exhibited strong immunogenicity in mice. Vaccination with IAV-NapA induced antigen-specific humoral and mucosal immune responses while stimulating robust Th1 and Th17 cell immune responses in mice. Our findings suggest that prophylactic and therapeutic vaccination with influenza virus vector vaccines significantly reduces colonization of H. pylori and inflammation in the stomach of mice.

IMPORTANCE

Helicobacter pylori is the most common cause of chronic gastritis and leads to severe gastroduodenal pathology in some patients. Many studies have shown that Th1 and Th17 cellular and gastric mucosal immune responses are critical in reducing H. pylori load. IAV vector vaccines can stimulate these immune responses while overcoming potential adjuvant toxicity and antigen dosing issues. To date, no studies have demonstrated the role of live attenuated IAV vector vaccines in preventing and treating H. pylori infection. Our work indicates that vaccination with IAV-NapA induces antigen-specific humoral, cellular, and mucosal immunity, producing a protective and therapeutic effect against H. pylori infection in BALB/c mice. This undescribed H. pylori vaccination approach may provide valuable information for developing vaccines against H. pylori infection.

KEYWORDS: Helicobacter pylori, vaccine, recombinant influenza A virus, virus vector, Th cells

INTRODUCTION

Helicobacter pylori is a microaerobic, gram-negative bacterium discovered by Marshall and Warren in the 1980s (1). Over the next 40 years, H. pylori infected nearly half of the world’s population (2). Although nearly 90% of infected people are asymptomatic carriers, research has shown that the H. pylori infection can increase the risk of developing duodenal or gastric ulcers, gastric cancer, and mucosa-associated lymphoid tissue lymphoma (35). Due to this association, chronic infection with H. pylori has been deemed a human carcinogen (6).

If untreated, H. pylori infection usually occurs in infancy and often leads to lifelong infection. Although the host can mount an immune response, this response cannot eliminate H. pylori due to its immune evasion strategies (7). The mainstream approach for eradication is a bismuth quadruple therapy (proton pump inhibitor, bismuth salt, tetracycline, and metronidazole) or non-bismuth concomitant quadruple therapy (proton pump inhibitor, amoxicillin, clarithromycin, and metronidazole) (8). However, due to the high treatment costs, risk of reinfection, and the emergence of antibiotic resistance, there is a need for protective and therapeutic vaccines (9).

Recent research suggested that H. pylori lysates and recombinant proteins (including but not limited to urease, CagA, VacA, HpaA, and catalase) could potentially serve as avenues for treating infections (1014). Research focused on oral vaccines that contain antigen and mucosal adjuvants such as cholera toxin or Escherichia coli heat-labile enterotoxin. Most of these studies have been validated in animal models (10, 11, 15, 16). However, the degradation of most epitopes delivered to the harsh gut environment and the potential enterotoxicity of adjuvants used in oral vaccines represent significant obstacles to their clinical translation to humans (17).

Influenza A virus (IAV) is a member of the Orthomyxoviridae family, characterized by its segmented genome and single-stranded RNA structure with negative-sense polarity. The surface glycoproteins hemagglutinin and neuraminidase of IAV exhibit antigenic variation, which allows the viruses to be classified into distinct subtypes. Reverse genetics technology has enabled researchers to engineer influenza viruses as viral vectors carrying foreign pathogen genes for vaccine development (1823). Given that infection with IAV typically results in robust immune responses, it is expected that immunization with recombinant IAV carrying a transgene inserted into its genome will also elicit potent antibodies and T cell responses against the transgene products (24). Modifying influenza viruses results in attenuation (2527). Therefore, influenza viral vectors that are attenuated in this way are relatively safer options for vaccine development and gene therapy applications. Immunization through the intranasal route triggers a protective immune response in the upper respiratory tract and lungs and distant areas like the mucosa of the genital and gastric tracts (17). An influenza virus vector vaccine may have significant development potential in the H. pylori vaccine.

The H. pylori neutrophil-activating protein (HP-NAP) was named due to its potent ability to induce neutrophils to generate highly reactive oxygen species while promoting adhesion to endothelial cells (28). HP-NAP consists of 12 neutrophil-activating protein A subunit (NapA), also known as DNA starvation phase protection protein (29). During H. pylori infection, HP-NAP has been shown to activate immune cells such as neutrophils, macrophages, and mast cells, leading to the production and release of pro-inflammatory cytokines like interleukin-6 (IL-6), IL-12, macrophage inflammatory protein-1α (MIP-1α), and MIP-1β (30, 31). In an environment enriched with IL-12, HP-NAP has been found to stimulate the production of interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) and promote Th1 immune response and cytotoxic T lymphocyte activity (31). Due to its immune-stimulatory properties, several studies have considered HP-NAP a candidate component in H. pylori vaccine development (11, 3234).

In this study, we employed IAV vectors to express H. pylori NapA. Recombinant IAVs were attenuated in vitro and in vivo while inducing antigen-specific humoral, cellular, and mucosal immunity in mice. Prophylactic and therapeutic vaccination with IAV-vectored vaccine significantly reduced H. pylori colonization and inflammation in murine stomachs. Our findings represent a novel approach to H. pylori vaccine design and provide evidence for the effectiveness of this approach.

RESULTS

Generation and characterization of WSN-NapA

The PA fragment was modified to rescue recombinant influenza WSN virus expressing H. pylori NapA protein. The fragment of optimized NapA with a stop codon was inserted downstream of the open reading frame (ORF) of the WSN PA protein. Porcine teschovirus 1 2A autoproteolytic cleavage site sequence was inserted between the PA and NapA genes to generate individual PA and NapA proteins after translation (35). The native packaging sequences were restored by duplicating the final 51 nucleotides of the PA ORF, which includes the stop codon. These duplicated nucleotides were inserted after the NapA stop codon adjacent to the native untranslated region (UTR) for viral packaging (36). To prevent potential recombination events, synonymous mutations were introduced into the end of PA ORF, eliminating the original packaging signal (Fig. 1A) (37). We then used influenza reverse genetics approaches to generate a recombinant IAV based on WSN named WSN-NapA (Fig. 1A).

Fig 1.

Fig 1

Generation and characterization of WSN-NapA. (A) The native and recombinant WSN PA viral segments (left) and the native and recombinant virion (right). PS, packaging signal; PS SM, packaging signals for synonymous mutations. (B) Analysis of the NapA and viral protein expressions. Madin-Darby Canine Kidney (MDCK) cells were respectively infected with WSN-wild type (Wt) or WSN-NapA at a multiplicity of infection (MOI) of 0.01. Thirty-six hours later, protein samples were analyzed by western blot analysis by applying anti-PA, anti-IAV nonstructural proteins 1 (NS1), anti-β-tubulin antibodies, and mouse anti-NapA serum. (C) Plaque phenotype. MDCK cells were infected with WSN-Wt or WSN-NapA at the same MOI. Forty-eight hours later, we performed the plaque assay and analyzed the cell supernatants. Three days later, MDCK cells were fixed and stained with crystal violet. The plaques formed by cell supernatants at the same dilution were photographed. (D) Viral genome stability analysis. MDCK cells were consecutively infected with WSN-NapA for 10 passages. Reverse transcription-PCR (RT-PCR) detected PA and NapA genes. Samples of MDCK cells infected with WSN-Wt were used as a control; MDCK cells were infected with the cell supernatants from P1, P5, and P10 passages, respectively. The expressions of NapA and PA proteins in MDCK cells were analyzed by western blot analysis. Protein samples of MDCK cells infected with WSN-Wt were used as a control. (E) Analysis of viral growth in MDCK cells. MDCK cells were infected with WSN-Wt or WSN-NapA at an MOI of 0.001. Supernatants were collected at indicated times after infection. The virus titers of the supernatants were determined by plaque assay. (F) Analysis of viral growth in A549 cells. Data in (E) and (F) are presented as means ± SEM and determined in three independent experiments.

The verification and titers of mouse anti-NapA serum prepared by our lab were evaluated by western blotting and enzyme-linked immunosorbent assay (ELISA) (Fig. S2A and B). NapA protein (~17 kDa) and PA-P2A protein (~85 kDa) were only detected in MDCK cells infected with WSN-NapA. In contrast, the complex of PA-NapA protein (~102 kDa) was not detected, which means the high cleavage efficiency of P2A linker in this strategy (Fig. 1B) (38). In addition, the expressions of viral proteins were lower in MDCK cells infected with WSN-NapA compared to wild-type (Wt) WSN virus as shown in Fig. 1B. MDCK cells were respectively infected with WSN-Wt or WSN-NapA at the same multiplicity of infection (MOI) and the cell supernatants were collected at 48 h post-infection. Plaque assay of cell supernatants indicated that compared to WSN-Wt, WSN-NapA formed smaller and fewer plaques in MDCK cells (Fig. 1C). MDCK cells were consecutively infected with WSN-NapA for 10 passages. Electrophoresis and western blotting revealed that the NapA fragment was stably maintained in the chimeric PA viral RNA (vRNA). The sequential passages of WSN-NapA in MDCK cells had no noticeable effect on the expressions of NapA and PA protein (Fig. 1D). There was significantly less replication capacity in WSN-NapA than in WSN-Wt viruses in MDCK and A549 cells, consistent with the results of the viral protein expression levels and plaque assay described above (Fig. 1E and F). These findings suggest that we rescued the stable recombinant WSN viruses expressing H. pylori NapA protein, and WSN-NapA was attenuated in MDCK and A549 cells.

Generation and characterization of PR8-NapA

To enhance immunogenicity, we rescued another recombinant IAV expressing H. pylori NapA protein as the boost vaccine using the method above (Fig. 2A). Western blotting revealed that PR8-NapA expressed NapA protein in infected MDCK cells. The expressions of viral proteins were lower in MDCK cells infected with PR8-NapA compared to PR8-Wt (Fig. 2B). Like WSN-NapA, the complex of PA-NapA protein was not detected in MDCK cells infected with PR8-NapA as shown in Fig. 2B. MDCK cells were respectively infected with PR8-Wt or PR8-NapA at the same MOI and cell supernatants were collected 48 h post-infection. Plaque assay of cell supernatants showed that PR8-NapA formed smaller and fewer plaques in MDCK cells compared to Wt PR8 virus (Fig. 2C). Electrophoresis and western blot analysis displayed that the NapA fragment was consistently sustained within the chimeric PA vRNA. Furthermore, the consecutive passages of PR8-NapA in MDCK cells exhibited no noticeable influence on the expression of NapA or PA protein (Fig. 2D). The replication of PR8-NapA was significantly attenuated compared with PR8-Wt viruses in MDCK and A549 cells, and this phenomenon is also consistent with the results of viral protein expression levels and plaque assay described above (Fig. 2E and F). These findings suggest we rescued the stable PR8-NapA, which was attenuated in MDCK and A549 cells like WSN-NapA.

Fig 2.

Fig 2

Generation and characterization of PR8-NapA. (A) Scheme depicting the native and recombinant PR8 PA viral segments (left) and the native and recombinant virion (right). PS, packaging signal; PS SM, packaging signals for synonymous mutations. (B) Analysis of the NapA and viral protein expressions. MDCK cells were infected with PR8-Wt or PR8-NapA at an MOI of 0.01. Thirty-six hours later, protein samples were analyzed by western blot analysis by applying anti-PA, anti-NS, anti-β-tubulin antibodies, and mouse anti-NapA serum. (C) Plaque phenotype. MDCK cells were infected with PR8-Wt or PR8-NapA at the same MOI. Forty-eight hours later, the plaque assay was performed, and the cell supernatants were analyzed. Three days later, MDCK cells were fixed and stained with crystal violet. The plaques formed by cell supernatants at the same dilution were photographed. (D) Viral genome stability analysis. MDCK cells were consecutively infected with PR8-NapA for 10 passages. RT-PCR detected PA and NapA genes. Samples of MDCK cells infected with PR8-Wt were used as control; MDCK cells were infected with the cell supernatants from P1, P5, and P10 passages. The expressions of NapA and PA proteins in MDCK cells were analyzed by western blot analysis. Protein samples of MDCK cells infected with PR8-Wt were used as a control. (E) Analysis of viral growth in MDCK cells. MDCK cells were infected with PR8-Wt or PR8-NapA at an MOI of 0.001. Supernatants were collected at indicated times after infection. The virus titers of the supernatants were determined by plaque assay. (F) Analysis of viral growth in A549 cells. Data in (E) and (F) are presented as means ± SEM and determined in three independent experiments.

Pathogenicity of IAV-NapA in BALB/c mice

Next, we evaluated the pathogenicity of IAV-NapA in BALB/c mice. The mice were challenged with 105 plaque-forming units (PFU) of WSN-NapA at 6 weeks, and body weights were measured. Mice infected with phosphate-buffered saline (PBS) or 105 PFU of WSN-Wt were used as controls. Mice infected with 105 PFU of WSN-NapA did not experience significant weight loss or mortality, unlike those infected with WSN-Wt viruses (Fig. 3A and B). In a separate experiment, mice were infected with the indicated doses of WSN-Wt or WSN-NapA, respectively. Three days post-infection, mice infected with WSN-NapA exhibited significantly lower levels of viral titers in the lungs than those infected with WSN-Wt (Fig. 3C).

Fig 3.

Fig 3

Pathogenicity of recombinant IAV in BALB/c mice. (A) Body weights of mice infected with WSN-Wt or WSN-NapA. BALB/c mice were challenged with an indicated dose of WSN-NapA at 6 weeks of age and monitored daily for body weight. Mice infected with PBS or WSN-Wt were used as controls. (B) Survival of the mice infected with WSN-Wt or WSN-NapA. Mice that lost more than 25% of their initial body weight or displayed severe symptoms were considered deceased and euthanized. (C) Viral titers of WSN-Wt or WSN-NapA in mouse lungs. BALB/c mice were infected with 105 PFU of WSN-NapA or 105 PFU of WSN-Wt at 6 weeks of age. Mice incubated with PBS were used as controls. Three days following infection, mice were sacrificed, and the lung tissues were homogenized in PBS. The viral titers of the homogenates were determined using a plaque assay. (D) Body weights of the mice infected with PR8-Wt or PR8-NapA. BALB/c mice were challenged with indicated doses of PR8-NapA at 6 weeks of age and monitored daily for body weight. Mice infected with PBS or PR8-Wt were used as controls. (E) Survival of the mice infected with PR8-Wt or PR8-NapA. (F) Viral titers of PR8-Wt or PR8-NapA in mouse lung. BALB/c mice were infected 10-fold-increasing doses from 103 to 105 PFU of PR8-NapA or 103 PFU of PR8-Wt at 6 weeks of age. Mice infected with PBS were used as controls. Five days following infection, mice were sacrificed, and the lung tissues were homogenized in PBS. The viral titers of the homogenates were determined using a plaque assay. Data are presented as means ± SEM, n = 5 mice per condition. The dotted lines indicate the limit of detection. All values below the detection line are identified as 0.5 for plotting purposes. Comparisons were analyzed using one-way analysis of variance. **, P<0.01; ***, P<0.001; ns, no significance.

BALB/c mice were challenged with dose ranges of 103–105 PFU of PR8-NapA and weighed daily. Mice infected with PBS or 103 PFU of PR8-Wt viruses were used as controls. Mice inoculated with 105 PFU of PR8-NapA exhibited fatal infection. In contrast, mice infected with dose ranges of 103–104 PFU of PR8-NapA survived, and the 104 PFU of PR8-NapA resulted in nearly 10% of body weight loss in the early stages of infection (Fig. 3D and E). In a separate experiment, mice were infected with the indicated doses of PR8-Wt or PR8-NapA, respectively. Five days post-infection, mice infected with 103 PFU and 104 PFU of PR8-NapA exhibited significantly lower levels of viral titers in the lungs compared to those infected with 103 PFU of PR8-Wt (Fig. 3F). These findings suggest that IAV-NapA is highly attenuated in BALB/c mice and the pathogenicity of PR8-NapA in mice is higher than that of WSN-NapA at the identical titers. Therefore, the less pathogenic WSN-NapA was chosen as the primary immunization vaccine in the following immune experiments to avoid potential unsafe events in mice. Furthermore, we determined the safe immune doses of the WSN-NapA (105 PFU per mouse) and PR8-NapA (104 PFU per mouse) for the subsequent mouse experiments.

Vaccination with IAV-NapA induces NapA-specific humoral and mucosal responses in BALB/c mice

To determine whether IAV-NapA induces antigen-specific humoral and mucosal immune responses, BALB/c mice are immunized. As shown in Fig. 4A and B, 6-week-old female BALB/c mice were intranasally primed with WSN-NapA at 105 PFU per mouse. Three weeks later, the mice were intranasally boosted with PR8-NapA at 104 PFU per mouse. Mice infected with PBS or IAV-Wt were used as controls. Recombinant His-NapA protein was expressed in E. coli BL21 and purified for further experiments. His-NapA protein was confirmed by Coomassie Blue staining and western blotting (Fig. S2C and D). According to an ELISA, IAV-NapA increased NapA-specific IgG in mouse serum, and the titers of NapA-specific IgG were elevated after boost vaccination (Fig. 4C). Although the doses of immunization were different, IAV-NapA induced similar IAV-specific antibody titers as IAV-Wt did in mice (Fig. 4D). In addition, ELISA showed significantly more NapA-specific secretory IgA (sIgA) in mouse stomachs than in controls (Fig. 4E). IgG1 and IgG2a were used as markers for Th2 and Th1 responses, correspondingly (39). The IgG isotypes suggested that vaccination with IAV-NapA induced more NapA-specific IgG2a than IgG1 in mice (Fig. 4F and G), which means the NapA-specific immune response is directed toward the Th1 immune response. These findings suggest that vaccination with IAV-NapA induces antigen-specific humoral and mucosal immune responses in mice, and the specific immune response is directed toward the Th1-predominant response.

Fig 4.

Fig 4

Humoral and mucosal responses induced by IAV-NapA immunization regimens. (A) Schematic diagram of the IAV-NapA immunization regimens. BALB/c mice at 6 weeks of age were immunized with WSN-NapA and PR8-NapA at 3-week intervals. Two weeks after the boost vaccination, mouse serum, stomachs, and spleens were collected for analysis. (B) The doses and modality of immunization used. i.n. means intranasal infection. (C) NapA-specific IgG in serum from immunized mice. Serum samples were serially diluted and detected by ELISA. (D) WSN and PR8-specific IgG in serum from immunized mice. ELISA plates were coated with inactivated WSN or PR8 viruses (104 PFU each well). Serum samples were serially diluted and measured using ELISA. (E) NapA-specific IgA in the stomach from immunized mice. Stomach samples were serially diluted and measured using ELISA. (F and G) NapA-specific IgG1 (F) and IgG2a (G) in serum from immunized mice. Serum samples were serially diluted and detected by ELISA. Data are presented as means ± SEM, n = 5 mice per condition. The dotted lines indicate the limit of detection. All values below the detection line are identified as 0.5 for plotting purposes. Comparisons were analyzed by one-way analysis of variance. ***, P<0.001.

Vaccination with IAV-NapA induces NapA-specific Th1 and Th17 cell responses in BALB/c mice

The literature suggests that the Th1 and Th17 cellular immune responses are critical for decreasing the H. pylori load (11, 40, 41). To analyze the specific cellular responses in mice vaccinated with IAV-NapA, lymphocytes from the spleen of mice were isolated, stimulated with purified NapA protein, and analyzed using flow cytometry. An intracellular cytokine staining assay revealed that vaccination with IAV-NapA significantly increased the levels of NapA-specific CD4+ T cells. These T cells predominantly secreted cytokines of the Th1 and Th17 types (such as IFN-γ and IL-17A, respectively) while not producing the Th2-type cytokine IL-4 (Fig. 5A through D). These results are consistent with the above conclusion of the IgG subtype assay in vaccinated mice. The secretion of IFN-γ and IL-17A in lymphocyte culture supernatants was also elevated compared to the control group (Fig. 5E and F). These findings suggest that vaccination with IAV-NapA induces NapA-specific Th1- and Th17-polarized cell responses in BALB/c mice.

Fig 5.

Fig 5

Cellular responses induced by IAV-NapA immunization regimens. (A) NapA-specific cytokine-secreting CD4+ T cells in the spleen of the immunized mice. Mouse lymphocytes were stimulated with purified NapA (5 µg/mL). The proportion of NapA-specific IFN-γ (top), IL-4 (central), and IL-17A (bottom) producing CD4+ T cells were determined by intracellular cytokine staining and flow cytometry analysis. (B) NapA-specific IFN-γ-secreting CD4+ T cells in the spleen. (C) NapA-specific IL-4-secreting CD4+ T cells in the spleen. (D) NapA-specific IL-17A-secreting CD4+ T cells in the spleen. (E) IFN-γ concentrations in the splenocytes supernatant. The supernatants were diluted, and IFN-γ concentrations were determined using ELISA kits. (F) IL-17A concentrations in the splenocytes supernatant. The supernatant was diluted, and ELISA kits determined IL-17A concentrations. Data are presented as means ± SEM, n = 5 mice per condition. Comparisons were analyzed by one-way analysis of variance. ***, P<0.001; ns, no significance.

Vaccination with IAV-NapA leads to protective immunity against H. pylori challenge

To determine the effects of prophylactic vaccination with IAV-NapA on H. pylori infection, BALB/c mice were treated according to the schematic diagram (Fig. 6A and B). In brief, BALB/c mice at 6 weeks of age were sequentially vaccinated with 105 PFU of WSN-NapA and 104 PFU of PR8-NapA at 3-week intervals. Mice immunized with PBS or IAV-Wt were used as controls. Two weeks after the boost vaccination, mice were infected with H. pylori SS1. Compared to mice vaccinated with PBS or IAV-Wt, prophylactic vaccination with IAV-NapA resulted in a 95% and 95% reduction in bacterial load within the mouse stomach, respectively (Fig. 6C and D; Table 1). Much research showed that H. pylori is rich in urease, which can convert urea into ammonia and carbon dioxide. The ammonia around H. pylori neutralizes the stomach’s acidity, enabling the bacterium to withstand low pH (42). Therefore, urease activity is highly related to the loads of H. pylori in the stomach. The result indicated that urease activity in mice vaccinated with IAV-NapA was significantly lower than the controls (Fig. 6E). ELISA showed that high levels of NapA-specific IgG and sIgA retained in the mice vaccinated with IAV-NapA after the H. pylori challenge (Fig. 6F and G). The histological analysis showed that vaccination with IAV-NapA reduced the grade of gastritis manifested as a lower level of lymphocyte infiltration in H. pylori-infected mice than in the control groups (Fig. 6H and I). These findings suggest that prophylactic vaccination with IAV-NapA reduces mice’s H. pylori infection and gastritis grade.

Fig 6.

Fig 6

Prophylactic vaccination with IAV-NapA against H. pylori infection. (A) Schematic diagram of the prophylactic vaccination. BALB/c mice were vaccinated at 6 weeks of age with 105 PFU of WSN-NapA and 104 PFU of PR8-NapA at 3-week intervals. Mice immunized with PBS or IAV-Wt were used as controls. Two weeks later, mice were infected with H. pylori SS1. Four weeks later, mice were sacrificed. Mouse serum and stomachs were collected for analysis. (B) The doses and modality of immunization used. i.n., intranasal immunization; i.g., intragastric gavage. (C) Viable H. pylori in mice stomachs. Each mouse’s stomach homogenates were plated on the H. pylori-selective plate at the same dilution. The magnification of the small image is 3.5×. (D) H. pylori load in mouse stomachs. Colonies on the plates were counted, and the colony-forming units (CFUs) in the stomach were calculated. (E) The H. pylori urease activity assay. The stomach homogenates were incubated with urease activity assay buffer, and the absorbances were read at 550 nm. (F and G) NapA-specific IgG in serum (F) and IgA in the stomach (G) from mice. Samples were serially diluted and detected using ELISA. (H) Gastric histology analysis. Mouse stomachs were stained with hematoxylin and eosin. The scale bar in the original pictures measures 100 µm, while the scale bar in the enlarged images measures 25 µm. (I) Gastritis score of the stomachs. The gastric inflammatory levels of the mice were graded. Data are presented as means ± SEM, n = 7 mice per condition. The dotted lines indicate the limit of detection. All values below the detection line are identified as 0.5 for plotting purposes. Comparisons were analyzed using one-way analysis of variance. *, P<0.05; **, P<0.01; ***, P<0.001.

TABLE 1.

The rates of decreased H. pylori load in the IAV-NapA group compared to the control groups (prophylactic vaccination)a

Groups
(n = 7)
CFU/g stomach Log10
(Mean ± SEM)
Percent of decreased H. pylori load compared to the control groups
PBS 5.510 ± 0.098        
IAV-Wt 5.457 ± 0.162        
IAV-NapA 4.177 ± 0.279 To PBS To IAV-Wt
95% 95%
a

The formula for calculating the percent of decreased H. pylori load is as follows: Percent of decreased H. pylori load = (H. pylori load of the control group − H. pylori load of the IAV-NapA group) / H. pylori load of the control group. Data are presented as means ± SEM, n = 7 mice per group.

Vaccination with IAV-NapA leads to therapeutic immunity against H. pylori challenge

To confirm the effects of therapeutic vaccination with IAV-NapA on H. pylori infection, BALB/c mice were treated according to the schematic diagram (Fig. 7A and B). In brief, BALB/c mice were infected with H. pylori SS1 at 5 weeks of age. One month later, mice infected were sequentially immunized with 105 PFU of WSN-NapA and 104 PFU of PR8-NapA at 3-week intervals. Mice immunized with PBS or IAV-Wt were used as controls. As shown in Fig. 7C and D; Table 2, therapeutic vaccination with IAV-NapA led to a 79% and 85% decrease in bacterial load within the mouse stomach relative to mice vaccination with PBS or IAV-Wt, respectively. In addition, reduced urease activity in mice vaccinated with IAV-NapA was consistent with bacterial load results (Fig. 7E). ELISA showed that the levels of NapA-specific IgG and sIgA were more significant than the controls after therapeutic vaccination (Fig. 7F and G). After conducting a histological analysis, we found that therapeutic immunization with IAV-NapA reduced lymphocyte infiltration in the stomachs of mice infected with H. pylori compared to the control groups (Fig. 7H). Consistently, the decrease in lymphocyte infiltration in the stomachs suggests that IAV-NapA reduces mouse gastritis grades caused by H. pylori infection (Fig. 7I). These findings suggest that therapeutic vaccination with IAV-NapA reduces mice’s H. pylori infection and gastritis grade.

Fig 7.

Fig 7

Therapeutic vaccination with IAV-NapA against H. pylori infection. (A) Schematic diagram of the therapeutic vaccination. BALB/c mice at 5 weeks of age were infected with H. pylori SS1. One month later, mice infected were immunized with WSN-NapA and PR8-NapA at 3-week intervals. Mice immunized with PBS or IAV-Wt were used as controls. (B) The doses and modality of immunization used in the experiment. i.n., intranasal immunization; i.g., intragastric gavage. (C) Viable counts of H. pylori in mouse stomachs. Each stomach homogenate was plated on H. pylori-selective plates at the same dilution. The magnification of the small image is 3.5×. (D) H. pylori load in infected mouse stomachs. Colonies on the plates were counted, and the colony-forming units (CFUs) in the stomach were calculated. (E) The H. pylori urease activity in the stomach of mice. The stomach homogenate was incubated with urease activity assay buffer, and the absorbance was read at 550 nm. (F and G) NapA-specific IgG in serum (F) and IgA in the stomach (G) from mice. Samples were serially diluted and measured using ELISA. (H) Gastric histology analysis. Mouse stomachs were stained with hematoxylin and eosin. The scale bar in the original pictures measures 100 µm, while the scale bar in the enlarged images measures 25 µm. (I) Gastritis scores. The gastric inflammatory levels of the mice were graded. Data are presented as means ± SEM, n = 7 mice per condition. The dotted lines indicate the limit of detection. All values below the detection line are identified as 0.5 for plotting purposes. Comparisons were analyzed by one-way analysis of variance. *, P<0.05; **, P<0.01; ***, P<0.001.

TABLE 2.

The rates of decreased H. pylori load in the IAV-NapA group compared to the control groups (therapeutic vaccination)a

Groups
(n = 7)
CFU/g stomach Log10
(Mean ± SEM)
Percent of decreased H. pylori load compared to the control groups
PBS 5.356 ± 0.082        
IAV-Wt 5.219 ± 0.135        
IAV-NapA 4.549 ± 0.218 To PBS To IAV-Wt
79% 85%
a

The formula for calculating the percent of decreased H. pylori load is as follows: Percent of decreased H. pylori load = (H. pylori load of the control group − H. pylori load of the IAV-NapA group) / H. pylori load of the control group. Data are presented as means ± SEM, n = 7 mice per group.

DISCUSSION

Live attenuated vaccines have great potential for application because they offer a significant level of antigen exposure and possess inherent adjuvanticity (17). The application of live attenuated vaccines in preventing and treating H. pylori has been limited, with most efforts focused on attenuated bacterial strains like Shigella flexneri and Lactococcus lactis (34, 43, 44). No studies have demonstrated the role of live attenuated virus vaccines in preventing and treating H. pylori infection.

Many researchers reported that intranasal immunization with influenza virus vector vaccines induced potent systemic and mucosal immune responses against pathogens in mouse models (18, 19, 45, 46). Our study demonstrated similar points in preventing and treating H. pylori infection. In this study, we developed a previously undescribed vaccination approach. The fragment encoding the H. pylori NapA protein was inserted into the IAV genome to generate live attenuated IAV. We demonstrated that intranasal vaccination with recombinant IAV expressing NapA protein significantly reduces H. pylori infection in BALB/c mice. In addition to inducing humoral immunity, it is critical to induce potent mucosal immunity and cellular immunity in mice after vaccination with IAV-NapA, including Th1 and Th17 cell responses, which protect against H. pylori infection in mice (Fig. 8). This vaccine may also play a role in preventing other IAV infections by replacing hemagglutinin (HA) and neuraminidase (NA) fragments of seasonal influenza viruses because the skeleton of the vaccine is an attenuated virus, and IAV-NapA might induce IAV-specific antibody titers as IAV-Wt did in mice (47).

Fig 8.

Fig 8

Schematic diagram summarizing vaccination with IAV-NapA against H. pylori infection in BALB/c mice. Following vaccination with IAV-NapA, a significant surge was observed in the levels of mouse NapA-specific IgG in serum and NapA-specific IgA in the stomach. The proportion of NapA-specific Th1 and Th17 cells increased significantly in the spleen. Overall, vaccination with IAV-NapA induced antigen-specific humoral, cellular, and mucosal immunity in mice, forming a barrier against H. pylori infection.

A self-cleaving 2A peptide has been reported as an excellent candidate to replace the internal ribosomal entry site due to its small size and high cleavage efficiency between genes upstream and downstream of the 2A peptide (48). Research has shown that among four different 2A peptides, a 2A peptide derived from porcine teschovirus-1 (P2A) has the highest cleavage efficiency in three human cell lines, zebrafish embryos, and mouse liver and P2A splicing efficiency cannot reach 100% in most cases (38). In this study, we chose P2A as the strategy for constructing recombinant IAV PA-NapA plasmids. Interestingly, our results indicated that the efficiency of the P2A in this strategy appeared to be 100% (Fig. 1B and 2B ). A similar result was shown in other related articles (37). Another study indicated that when P2A was inserted between the IAV NA and the gene of HIV-P24, the efficiency of the P2A was not 100% efficient (19). This phenomenon is indeed an exciting result that needs further exploration.

Regarding influenza virus vector vaccines, there remain some areas for improvement. First, there are limits to the tolerance of inserted fragments in the influenza virus genome because of its small virus segments. Inserting excessively long fragments into the genome of influenza viruses can affect the packaging and replication stability of influenza viruses (49). This limitation may affect the selection of target antigens. In subsequent studies, selecting multi-epitope antigens may be an ideal solution. Many studies demonstrated that it is possible to engineer multiple influenza virus fragments simultaneously, providing another solution (25, 26). Second, a common concern is that pre-existing immunity against the viral vector may interfere with its efficacy (24). Due to multiple infections with IAV throughout their lives, humans have generated antibodies against the H1N1 and H3N2 subtypes of the virus (50). Designing recombinant IAV vaccines using HA or NA antigens different from those to which humans have been previously exposed may significantly decrease the risk of interference by pre-existing antibodies.

The NapA sequence is highly conserved in multiple H. pylori strains, including human and mouse-adapted strains (Fig. S1). In addition to being the vaccine antigen, H. pylori NapA has been applied in other areas because it modulates the immune response. Promoting Th1/Tc1 immune response and inducing a significant production of IFN-γ is a potential approach for cancer immunotherapy (51). In preclinical studies using mouse cancer models, administering chimeric antigen receptor (CAR) NAP T cells led to a deceleration in tumor growth and improved survival rates, regardless of the tumor type or target antigen, compared to conventional CAR T cells (52). In addition, using chitosan nanoparticles loaded with NapA significantly reduced the growth of breast cancer tumors in a mouse model (53). HP-NAP was used to treat Th2-mediated inflammatory diseases like atopic dermatitis; administration of HP-NAP via intraperitoneal injection showed a significant reduction in the secretion of IgE and IL-4, leading to a substantial alleviation of symptoms associated with atopic dermatitis, including erythema and swelling (54). These findings suggested that IAV-NapA may play a role in multiple therapeutic areas in the future.

The present study demonstrated the immunogenicity and protective ability of recombinant IAV-NapA, which offers a basis for developing a novel vaccine against H. pylori.

MATERIALS AND METHODS

Animals

Female specific pathogen-free (SPF) BALB/c mice were purchased from the Animal Research Center of China Three Gorges University at 6 weeks old. Mice were housed in a pathogen-free barrier facility.

Cell lines and viruses

A549, MDCK, and HEK293 cells were obtained from the China Center for Type Culture Collection and cultured in Dulbecco’s modified Eagle medium (Thermo Fisher Scientific) containing 1% penicillin-streptomycin and 10% fetal bovine serum (Thermo Fisher Scientific) at 37°C with 5% CO2.

Influenza virus A/WSN/33 (WSN), A/Puerto Rico/8/34 (PR8), and recombinant IAV were rescued by the influenza virus reverse genetics system, grown in MDCK cells, and the viral titers were determined by standard plaque assay in MDCK cells (55).

Strains and cultural conditions

The mouse-adapted H. pylori strain SS1 was obtained from the National Center for Disease Control and Prevention. H. pylori SS1 was cultured on Columbia blood agar plates enriched with 7% defibrinated sheep blood, polymyxin B (5 µg/mL), vancomycin (10 µg/mL), amphotericin B (2.5 µg/mL), and trimethoprim (5 µg/mL) under microaerobic conditions at 37°C for 2–3 days.

Generation of recombinant influenza viruses

The coding sequence for the NapA gene of H. pylori SS1 (GenBank: CP009259.1) was codon-optimized and synthesized. The gene of NapA was inserted into the pHW-WSN-PA and pHW-PR8-PA plasmid to obtain pHW-WSN-PA-NapA and pHW-PR8-PA-NapA, as previously described (37). Recombinant influenza virus WSN-NapA and PR8-NapA were rescued as described previously (23). In brief, 293T/MDCK (1:1) cell cultures (six-well plates, 106 cells/well) were transfected with pHW-WSN-PA-NapA and the other seven IAV genomic plasmids. Twelve hours after transfection, cells were added with 1 µg/mL of tosylamido phenylalanyl chloromethyl ketone (TPCK)-treated trypsin (Sigma-Aldrich). Two days after transfection, culture media were harvested. Recombinant viruses were obtained by plaque purification from the supernatants. Viruses were propagated in MDCK cells at 37°C with 5% CO2 for 2 to 3 days. Finally, virus stocks were harvested and purified by sucrose density gradient centrifugation (27). Purified viruses were suspended with PBS containing 0.5% bovine serum albumin (BSA; Sigma-Aldrich) and stored at –80°C. PR8-NapA virus was rescued, propagated, and purified similarly.

Plaque-forming assay

Monolayer-dense MDCK cells (six-well plates, 106 cells/well) were infected with serially diluted influenza viruses for 1 h at 37°C. Then, the cells were washed by PBS and overlaid with 1× Eagle’s Minimal Essential Medium (Thermo Fisher Scientific) containing 0.6% agarose, 0.42% BSA (Sigma-Aldrich), 0.45% NaHCO3, 20 mM HEPES, and 1 µg/mL of TPCK-treated trypsin (Sigma-Aldrich) (56). After adding the overlay, the plates were incubated at 37°C with 5% CO2. Two to 3 days later, cells were fixed with 10% paraformaldehyde and stained with crystal violet. To calculate the viral titer (PFU per milliliter), the number of plaques was counted and multiplied by the dilution factor.

Analysis of viral growth in cells

Monolayer-dense MDCK cells or A549 cells (12-well plates, 5 × 105 cells/well) were infected with IAV-Wt or recombinant IAV at a MOI of 0.001, and the supernatants were collected at 12 h, 24 h, 48 h, and 72 h after infection. The virus titers in the supernatants were determined using a plaque assay.

Western blot analysis

Confluent monolayers of MDCK cells were infected with IAV-Wt or recombinant IAV at an MOI of 0.01. At 36 h after infection, MDCK cells were harvested. Cell lysates were extracted using NP-40 lysis solution containing the protease inhibitor cocktail (TargetMol, USA). Protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes (Millipore). Membranes were blocked and incubated with antibodies against IAV PA (GeneTex), IAV NS1 (Santa Cruz), β-tubulin (Proteintech), His (Abclonal), or mouse anti-NapA serum (prepared by our laboratory) at 4°C overnight and incubated with horseradish peroxidase (HRP)-conjugated secondary antibody the following day. Immunoblotting results were photographed on a LAS-4000 Imaging System (FUJIFILM).

Viral genome stability analysis

MDCK cells were infected with IAV-NapA at an MOI of 0.001. When significant cytopathic effect (CPE) was observed in MDCK cells, cell supernatants were collected and diluted 10-fold. Then, monolayer-dense MDCK cells were infected with the diluted cell supernatants, and the experiments described above were repeated nine more times.

Total RNAs from the cells infected with IAV-NapA in each passage were extracted using RNAiso Plus (Takara). cDNAs were prepared by ABScript III RT Master Mix for qPCR with gDNA Remover (Abclonal). IAV PA and NapA genes were amplified by PCR. Primer pairs for PA and NapA target sequences are listed in Table 3. The PCR products were visualized using electrophoresis.

TABLE 3.

Primers used in PCR

Genes Primers Sequences (5´−3´)
WSN PA Forward CAACAAGGCATGTGAACTGACCGAT
Reverse GCATGTGTGAGGAAGGAGTTGAACC
PR8 PA Forward TAACAAGGCATGCGAACTGACAGAT
Reverse GCATGTGTAAGGAAGGAGTTGAACC
NapA Forward ATGAAAACCTTCGAGATTCTGAAGCAC
Reverse CTAGGCCAGGTGAGCTTCCAG

The confluent monolayers of MDCK cells were infected with the diluted cell supernatants. When significant CPE was observed in MDCK, MDCK cells were collected, and protein samples from the cells infected with IAV-NapA in the P1, P5, and P10 passages were analyzed by western blot analysis.

Viral pathogenicity in mice

For WSN-Wt and WSN-NapA, SPF female BALB/c mice (n = 5, each group) were infected with 105 PFU of WSN-NapA or 105 PFU of WSN-Wt per mouse in 40 µL PBS at 6 weeks of age. For PR8-Wt and PR8-NapA, SPF female BALB/c mice (n = 5, each group) were infected 10-fold-increasing doses from 103 to 105 PFU of PR8-NapA or 103 PFU of PR8-Wt per mouse in 40 µL PBS at 6 weeks of age. Mice infected with 40 µL PBS were used as controls. Following infection, body weight and survival were monitored daily for 14 days. Mice that lost more than 25% of their initial body weight or displayed severe symptoms were considered deceased and were euthanized.

SPF female BALB/c mice (n = 5, each group) were infected with 105 PFU of WSN-NapA or 105 PFU of WSN-Wt per mouse in 40 µL PBS at 6 weeks of age. Mice incubated with 40 µL PBS were used as controls. On the 3rd day post-infection, mice from each group were sacrificed, and their lungs were removed and homogenized. SPF female BALB/c mice (n = 5, each group) were infected 10-fold-increasing doses from 103 to 105 PFU of PR8-NapA or 103 PFU of PR8-Wt per mouse in 40 µL PBS at 6 weeks of age. Mice infected with 40 µL PBS were used as controls. On the 5th day post-infection, mice from each group were sacrificed, and their lungs were removed and homogenized. The viral titers in the supernatants from the homogenates were measured using plaque-forming assays.

Immunization and infection

SPF female BALB/c mice (n = 7, each group) were immunized with 105 PFU of WSN-NapA viruses at 6 weeks of age for prophylactic vaccination. Mice immunized with 104 PFU of WSN-Wt or PBS were used as controls. Mice were vaccinated 3 weeks post-immunization with 104 PFU of PR8-NapA viruses. Mice from the control groups were immunized with 102 PFU of PR8-Wt or PBS. Two weeks after the second vaccination, mice were infected with 109 colony-forming units (CFUs) of H. pylori SS1 by gastric gavage administered four times in 1 week.

For therapeutic vaccination, SPF BALB/c female mice (n = 7, each group) at 5 weeks of age were infected with 109 CFU of H. pylori SS1 by gastric gavage administered four times in 1 week. Four weeks later, mice were vaccinated with recombinant IAV using the abovementioned method. Mice immunized with IAV-Wt or PBS were used as controls.

ELISA

Serum and gastric antibody levels were measured using ELISA. His-NapA proteins were expressed in E.coli BL21 (DE3) and purified by Ni2+-NTA affinity chromatography. ELISA plates were coated with purified NapA protein (200 ng, each well) at 4°C overnight. The next day, the plates were blocked with 3% BSA. After washing, serum or gastric samples were serially diluted and added to the ELISA plates. HRP-conjugated goat anti-mouse IgG, IgG1, IgG2a, or IgA antibodies (Southern Biotech) were used to detect NapA-specific antibodies. The substrate tetramethylbenzidine was then added. The reaction was stopped with 2 M H2SO4. The absorbance was read at 450 nm using a Bio-Tek elx800 microplate reader. The endpoint titer was determined as a dilution 2.1 times greater than the control value.

Cytokine concentrations in the splenocytes supernatant were quantified using ELISA kits. Briefly, splenocytes were cultured with purified NapA protein (10 µg/mL). At 72 h, the supernatants were collected and stored at –80°C for subsequent assays. Commercial ELISA kits (ELK Biotechnology) were utilized to measure IFN-γ and IL-17A in the supernatants.

Flow cytometry

Lymphoid cells from mouse spleen were collected as previously described (57). Splenocytes were seeded into 96-well plates and incubated with purified NapA protein (5 µg/mL) for 8 h at 37°C. Monensin (Biolegend) was added 2 h after adding NapA protein. Unstimulated cells were used as controls. After stimulation, splenocytes were harvested, washed, and blocked. Then, cells were stained with PE anti-mouse CD3 (Biolegend) or fluorescein isothiocyanate (FITC) anti-mouse CD4 (Biolegend). After fixation and permeabilization, cells were stained with Alexa Fluor 647 anti-mouse IFN-γ (Biolegend), Alexa Fluor 647 anti-mouse IL-4 (Biolegend), or Alexa Fluor 647 anti-mouse IL-17A (Biolegend) and analyzed on a Beckman CytoFLEX. Data were analyzed using the CytExpert (Beckman) and FlowJo software (BD Biosciences).

H. pylori quantification and urease activity determination

Four weeks after therapeutic vaccination or H. pylori SS1 infection (prophylactic vaccination routine), mice were sacrificed to measure colonization and urease activity in the stomach. The stomach of each mouse was weighed and homogenized in 1 mL PBS. The homogenates were serially diluted and plated on H. pylori-selective plates (58). After culture, colonies were counted, and the number of CFUs in the stomach was calculated; 100 µL homogenate of the stomach was placed in 3 mL of a solution containing 1 mg/mL glucose, 1 mg/mL peptone, 2 mg/mL KH2PO4, 5 mg/mL NaCl, 1% urea, and phenol red for urease activity assay (59). The samples were then incubated at 37°C for 4 h. After incubation, the absorbance of the supernatant was read at 550 nm using the Bio-Tek elx800 microplate reader.

Histological analysis

One-fourth of the tissue was fixed with formalin, embedded in paraffin, and sectioned. Hematoxylin and eosin staining was performed according to the standard procedure. For evaluation of gastritis level, the slides were graded as described previously (32).

Statistical analysis

The data were expressed as means ± SEM. The specific details of the statistical tests are described in the figure legends. Statistical analysis was performed using GraphPad Prism 9.0 analytical software (GraphPad, San Diego, CA, USA).

ACKNOWLEDGMENTS

This work was funded by the National Nature Science Foundation of China (U22A20335, 81971494), the National Key Research and Development Program of China (2021YFC2701800, 2021YFC2701804), the Fundamental Research Funds for the Central Universities (2042022dx0003), and the Science Fund for Distinguished Young Scholars of Hubei Province (2021CFA054).

Y.Z. conceived and designed the experiment. L.N., Y.H., and Z.C. performed the experiments. H.L., Y.Z., K.D., and C.M. analyzed the data. C.Y., C.L., and Z.L. processed and typeset the figures. L.N., S.L., and Y.Z. wrote the manuscript. All authors read and approved the final manuscript.

Contributor Information

Ying Zhu, Email: yingzhu@whu.edu.cn.

Anice C. Lowen, Emory University School of Medicine, Atlanta, Georgia, USA

ETHICS APPROVAL

The Ethical Committee for Animal Research of Wuhan University approved the animal experimental protocol used in this study.

DATA AVAILABILITY

All data associated with this study are presented in the paper or supplemental material. Data sets and code were not used in these experiments or studies.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/jvi.01923-23.

Supplemental material. jvi.01923-23-s0001.docx.

Supplemental figures and notes.

jvi.01923-23-s0001.docx (1.8MB, docx)
DOI: 10.1128/jvi.01923-23.SuF1

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

  • 1. Marshall BJ, Warren JR. 1984. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1:1311–1315. doi: 10.1016/s0140-6736(84)91816-6 [DOI] [PubMed] [Google Scholar]
  • 2. Tshibangu-Kabamba E, Yamaoka Y. 2021. Helicobacter pylori infection and antibiotic resistance — from biology to clinical implications. Nat Rev Gastroenterol Hepatol 18:613–629. doi: 10.1038/s41575-021-00449-x [DOI] [PubMed] [Google Scholar]
  • 3. Hatakeyama M. 2014. Helicobacter pylori CagA and gastric cancer: a paradigm for hit-and-run carcinogenesis. Cell Host Microbe 15:306–316. doi: 10.1016/j.chom.2014.02.008 [DOI] [PubMed] [Google Scholar]
  • 4. Moss SF. 2017. The clinical evidence linking Helicobacter pylori to gastric cancer. Cell Mol Gastroenterol Hepatol 3:183–191. doi: 10.1016/j.jcmgh.2016.12.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Wroblewski LE, Peek RM. 2021. Helicobacter pylori: a stealth assassin. Trends Cancer 7:807–808. doi: 10.1016/j.trecan.2021.05.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. 15th Report on Carcinogens . 2023. Natl toxicol program. Available from: https://ntp.niehs.nih.gov/whatwestudy/assessments/cancer/roc
  • 7. Lina TT, Alzahrani S, Gonzalez J, Pinchuk IV, Beswick EJ, Reyes VE. 2014. Immune evasion strategies used by Helicobacter pylori. World J Gastroenterol 20:12753–12766. doi: 10.3748/wjg.v20.i36.12753 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Malfertheiner P, Megraud F, O’Morain CA, Gisbert JP, Kuipers EJ, Axon AT, Bazzoli F, Gasbarrini A, Atherton J, Graham DY, Hunt R, Moayyedi P, Rokkas T, Rugge M, Selgrad M, Suerbaum S, Sugano K, El-Omar EM, European Helicobacter and Microbiota Study Group and Consensus panel . 2017. Management of Helicobacter pylori infection—the Maastricht V/Florence consensus report. Gut 66:6–30. doi: 10.1136/gutjnl-2016-312288 [DOI] [PubMed] [Google Scholar]
  • 9. Megraud F, Bruyndonckx R, Coenen S, Wittkop L, Huang T-D, Hoebeke M, Bénéjat L, Lehours P, Goossens H, Glupczynski Y, European Helicobacter pylori Antimicrobial Susceptibility Testing Working Group . 2021. Helicobacter pylori resistance to antibiotics in Europe in 2018 and its relationship to antibiotic consumption in the community. Gut 70:1815–1822. doi: 10.1136/gutjnl-2021-324032 [DOI] [PubMed] [Google Scholar]
  • 10. Longet S, Abautret-Daly A, Davitt CJH, McEntee CP, Aversa V, Rosa M, Coulter IS, Holmgren J, Raghavan S, Lavelle EC. 2019. An oral alpha-galactosylceramide adjuvanted Helicobacter pylori vaccine induces protective IL-1R- and IL-17R-dependent Th1 responses. NPJ Vaccines 4:45. doi: 10.1038/s41541-019-0139-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Liu M, Zhong Y, Chen J, Liu Y, Tang C, Wang X, Zhang Y, Wang P, Logan SM, Chen W, Wei B. 2020. Oral immunization of mice with a multivalent therapeutic subunit vaccine protects against Helicobacter pylori infection. Vaccine 38:3031–3041. doi: 10.1016/j.vaccine.2020.02.036 [DOI] [PubMed] [Google Scholar]
  • 12. Malfertheiner P, Selgrad M, Wex T, Romi B, Borgogni E, Spensieri F, Zedda L, Ruggiero P, Pancotto L, Censini S, Palla E, Kanesa-Thasan N, Scharschmidt B, Rappuoli R, Graham DY, Schiavetti F, Del Giudice G. 2018. Efficacy, immunogenicity, and safety of a parenteral vaccine against Helicobacter pylori in healthy volunteers challenged with a Cag-positive strain: a randomised, placebo-controlled phase 1/2 study. Lancet Gastroenterol Hepatol 3:698–707. doi: 10.1016/S2468-1253(18)30125-0 [DOI] [PubMed] [Google Scholar]
  • 13. Yang W-C, Sun H-W, Sun H-Q, Yuan H-M, Li B, Li H-B, Hu J, Yang Y, Zou Q-M, Guo H, Wu C, Chen L. 2018. Intranasal immunization with immunodominant epitope peptides derived from HpaA conjugated with CpG adjuvant protected mice against Helicobacter pylori infection. Vaccine 36:6301–6306. doi: 10.1016/j.vaccine.2018.09.007 [DOI] [PubMed] [Google Scholar]
  • 14. Kotiw M, Johnson M, Pandey M, Fry S, Hazell SL, Netter HJ, Good MF, Olive C. 2012. Immunological response to parenteral vaccination with recombinant hepatitis B virus surface antigen virus-like particles expressing Helicobacter pylori KatA epitopes in a murine H. pylori challenge model. Clin Vaccine Immunol 19:268–276. doi: 10.1128/CVI.05295-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Holmgren J, Nordqvist S, Blomquist M, Jeverstam F, Lebens M, Raghavan S. 2018. Preclinical Immunogenicity and protective efficacy of an oral Helicobacter pylori inactivated whole cell vaccine and multiple mutant cholera toxin: a novel and non-toxic mucosal adjuvant. Vaccine 36:6223–6230. doi: 10.1016/j.vaccine.2018.07.073 [DOI] [PubMed] [Google Scholar]
  • 16. Pan X, Ke H, Niu X, Li S, Lv J, Pan L. 2018. Protection against Helicobacter pylori infection in BALB/C mouse model by oral administration of multivalent epitope-based vaccine of cholera toxin B subunit-HUUC. Front Immunol 9:1003. doi: 10.3389/fimmu.2018.01003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Lycke N. 2012. Recent progress in mucosal vaccine development: potential and limitations. Nat Rev Immunol 12:592–605. doi: 10.1038/nri3251 [DOI] [PubMed] [Google Scholar]
  • 18. Tan H-X, Gilbertson BP, Jegaskanda S, Alcantara S, Amarasena T, Stambas J, McAuley JL, Kent SJ, De Rose R. 2016. Recombinant influenza virus expressing HIV-1 p24 capsid protein induces mucosal HIV-specific CD8 T-cell responses. Vaccine 34:1172–1179. doi: 10.1016/j.vaccine.2016.01.030 [DOI] [PubMed] [Google Scholar]
  • 19. Wang J, Shu T, Deng W, Zheng Y, Liao M, Ye X, Han L, He P, Zheng X, Li T, Feng Y, Hu F, Li P, Sun C, Chen L, Li F, Feng L. 2021. Mucosal priming with a recombinant influenza A virus-vectored vaccine elicits T-cell and antibody responses to HIV-1 in mice. J Virol 95:e00059-21. doi: 10.1128/JVI.00059-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. He Q, Martinez-Sobrido L, Eko FO, Palese P, Garcia-Sastre A, Lyn D, Okenu D, Bandea C, Ananaba GA, Black CM, Igietseme JU. 2007. Live-attenuated influenza viruses as delivery vectors for Chlamydia vaccines. Immunology 122:28–37. doi: 10.1111/j.1365-2567.2007.02608.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Bian C, Liu S, Liu N, Zhang G, Xing L, Song Y, Duan Y, Gu H, Zhou Y, Zhang P, Li Z, Zhang K, Wang Z, Zhang S, Wang X, Yang P. 2014. Influenza virus vaccine expressing fusion and attachment protein epitopes of respiratory syncytial virus induces protective antibodies in BALB/C mice. Antiviral Res 104:110–117. doi: 10.1016/j.antiviral.2014.01.022 [DOI] [PubMed] [Google Scholar]
  • 22. Wang P, Zheng M, Lau S-Y, Chen P, Mok B-Y, Liu S, Liu H, Huang X, Cremin CJ, Song W, Chen Y, Wong Y-C, Huang H, To K-W, Chen Z, Xia N, Yuen K-Y, Chen H, Bennink JR, Yewdell J, Digard P. 2019. Generation of DelNS1 influenza viruses: a strategy for optimizing live attenuated influenza vaccines. mBio 10:e02180-19. doi: 10.1128/mBio.02180-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Hoffmann E, Neumann G, Kawaoka Y, Hobom G, Webster RG. 2000. A DNA transfection system for generation of influenza A virus from eight plasmids. Proc Natl Acad Sci U S A 97:6108–6113. doi: 10.1073/pnas.100133697 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Gerlach T, Elbahesh H, Saletti G, Rimmelzwaan GF. 2019. Recombinant influenza A viruses as vaccine vectors. Expert Rev Vaccines 18:379–392. doi: 10.1080/14760584.2019.1582338 [DOI] [PubMed] [Google Scholar]
  • 25. Hamilton JR, Vijayakumar G, Palese P. 2018. A recombinant antibody-expressing influenza virus delays tumor growth in a mouse model. Cell Reports 22:1–7. doi: 10.1016/j.celrep.2017.12.025 [DOI] [PubMed] [Google Scholar]
  • 26. Nogales A, Ávila-Pérez G, Rangel-Moreno J, Chiem K, DeDiego ML, Martínez-Sobrido L. 2019. A novel fluorescent and bioluminescent bireporter influenza A virus to evaluate viral infections. J Virol 93:e00032-19. doi: 10.1128/JVI.00032-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Pan W, Dong Z, Li F, Meng W, Feng L, Niu X, Li C, Luo Q, Li Z, Sun C, Chen L. 2013. Visualizing influenza virus infection in living mice. Nat Commun 4:2369. doi: 10.1038/ncomms3369 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Evans DJ, Evans DG, Takemura T, Nakano H, Lampert HC, Graham DY, Granger DN, Kvietys PR. 1995. Characterization of a Helicobacter pylori neutrophil-activating protein. Infect Immun 63:2213–2220. doi: 10.1128/iai.63.6.2213-2220.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Codolo G, Coletta S, D’Elios MM, de Bernard M. 2022. HP-NAP of Helicobacter pylori: the power of the immunomodulation. Front Immunol 13:944139. doi: 10.3389/fimmu.2022.944139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Polenghi A, Bossi F, Fischetti F, Durigutto P, Cabrelle A, Tamassia N, Cassatella MA, Montecucco C, Tedesco F, de Bernard M. 2007. The neutrophil-activating protein of Helicobacter pylori crosses endothelia to promote neutrophil adhesion in vivo. J Immunol 178:1312–1320. doi: 10.4049/jimmunol.178.3.1312 [DOI] [PubMed] [Google Scholar]
  • 31. Amedei A, Cappon A, Codolo G, Cabrelle A, Polenghi A, Benagiano M, Tasca E, Azzurri A, D’Elios MM, Del Prete G, de Bernard M. 2006. The neutrophil-activating protein of Helicobacter pylori promotes Th1 immune responses. J Clin Invest 116:1092–1101. doi: 10.1172/JCI27177 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Guo L, Yang H, Tang F, Yin R, Liu H, Gong X, Wei J, Zhang Y, Xu G, Liu K. 2017. Oral immunization with a multivalent epitope-based vaccine, based on NAP, Urease, Hsp60, and HpaA, provides therapeutic effect on H. pylori infection in mongolian gerbils. Front Cell Infect Microbiol 7:349. doi: 10.3389/fcimb.2017.00349 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Satin B, Del Giudice G, Della Bianca V, Dusi S, Laudanna C, Tonello F, Kelleher D, Rappuoli R, Montecucco C, Rossi F. 2000. The neutrophil-activating protein (Hp-Nap) of Helicobacter pylori is a protective antigen and a major virulence factor. J Exp Med 191:1467–1476. doi: 10.1084/jem.191.9.1467 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Peng X, Zhang R, Duan G, Wang C, Sun N, Zhang L, Chen S, Fan Q, Xi Y. 2018. Production and delivery of Helicobacter pylori NapA in Lactococcus lactis and its protective efficacy and immune modulatory activity. Sci Rep 8:6435. doi: 10.1038/s41598-018-24879-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Donnelly MLL, Luke G, Mehrotra A, Li X, Hughes LE, Gani D, Ryan MD. 2001. “Analysis of the aphthovirus 2A/2B polyprotein ‘cleavage’ mechanism indicates not a proteolytic reaction, but a novel translational effect: a putative ribosomal ‘skip”. J Gen Virol 82:1013–1025. doi: 10.1099/0022-1317-82-5-1013 [DOI] [PubMed] [Google Scholar]
  • 36. Li X, Gu M, Zheng Q, Gao R, Liu X. 2021. Packaging signal of influenza A virus. Virol J 18:36. doi: 10.1186/s12985-021-01504-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Tran V, Moser LA, Poole DS, Mehle A. 2013. Highly sensitive real-time in vivo imaging of an influenza reporter virus reveals dynamics of replication and spread. J Virol 87:13321–13329. doi: 10.1128/JVI.02381-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Kim JH, Lee S-R, Li L-H, Park H-J, Park J-H, Lee KY, Kim M-K, Shin BA, Choi S-Y, Thiel V. 2011. High cleavage efficiency of a 2A peptide derived from porcine Teschovirus-1 in human cell lines. PLoS ONE 6:e18556. doi: 10.1371/journal.pone.0018556 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Cêtre C, Pierrot C, Cocude C, Lafitte S, Capron A, Capron M, Khalife J. 1999. Profiles of Th1 and Th2 cytokines after primary and secondary infection by Schistosoma mansoni in the semipermissive rat host. Infect Immun 67:2713–2719. doi: 10.1128/IAI.67.6.2713-2719.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Velin D, Favre L, Bernasconi E, Bachmann D, Pythoud C, Saiji E, Bouzourene H, Michetti P. 2009. Interleukin-17 is a critical mediator of vaccine-induced reduction of Helicobacter infection in the mouse model. Gastroenterology 136:2237–2246. doi: 10.1053/j.gastro.2009.02.077 [DOI] [PubMed] [Google Scholar]
  • 41. Sayi A, Kohler E, Hitzler I, Arnold I, Schwendener R, Rehrauer H, Müller A. 2009. The CD4 + T cell-mediated IFN-γ response to Helicobacter infection is essential for clearance and determines gastric cancer risk. J Immunol 182:7085–7101. doi: 10.4049/jimmunol.0803293 [DOI] [PubMed] [Google Scholar]
  • 42. Castellote J, Guardiola J, Porta F, Falcó A. 2001. Rapid urease test: effect of preimmersion of biopsy forceps in formalin. Gastrointest Endosc 53:744–746. doi: 10.1067/mge.2001.114786 [DOI] [PubMed] [Google Scholar]
  • 43. Zhang X, Sang S, Guan Q, Tao H, Wang Y, Liu C. 2022. Oral administration of a Shigella 2aT32-based vaccine expressing UreB-HspA fusion antigen with and without parenteral rUreB-HspA boost confers protection against Helicobacter pylori in mice model. Front. Immunol 13:894206. doi: 10.3389/fimmu.2022.894206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Li X, Xing Y, Guo L, Lv X, Song H, Xi T. 2014. Oral immunization with recombinant Lactococcus lactis delivering a multi-epitope antigen CTB-UE attenuates Helicobacter pylori infection in mice. Pathog Dis 72:78–86. doi: 10.1111/2049-632X.12173 [DOI] [PubMed] [Google Scholar]
  • 45. Deng S, Liu Y, Tam R-Y, Chen P, Zhang AJ, Mok B-Y, Long T, Kukic A, Zhou R, Xu H, Song W, Chan J-W, To K-W, Chen Z, Yuen K-Y, Wang P, Chen H. 2023. An intranasal influenza virus-Vectored vaccine prevents SARS-CoV-2 replication in respiratory tissues of mice and Hamsters. Nat Commun 14:2081. doi: 10.1038/s41467-023-37697-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Matyushenko V, Kotomina T, Kudryavtsev I, Mezhenskaya D, Prokopenko P, Matushkina A, Sivak K, Muzhikyan A, Rudenko L, Isakova-Sivak I. 2020. Conserved T-cell epitopes of respiratory syncytial virus (RSV) delivered by recombinant live attenuated influenza vaccine viruses efficiently induce RSV-specific lung-localized memory T cells and augment influenza-specific resident memory T-cell responses. Antiviral Res 182:104864. doi: 10.1016/j.antiviral.2020.104864 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Smith A, Rodriguez L, El Ghouayel M, Nogales A, Chamberlain JM, Sortino K, Reilly E, Feng C, Topham DJ, Martínez-Sobrido L, Dewhurst S. 2020. A live attenuated influenza vaccine elicits enhanced heterologous protection when the internal genes of the vaccine are matched to those of the challenge virus. J Virol 94:e01065-19. doi: 10.1128/JVI.01065-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. de Felipe P, Luke GA, Hughes LE, Gani D, Halpin C, Ryan MD. 2006. E unum pluribus: multiple proteins from a self-processing polyprotein. Trends Biotechnol 24:68–75. doi: 10.1016/j.tibtech.2005.12.006 [DOI] [PubMed] [Google Scholar]
  • 49. Breen M, Nogales A, Baker SF, Martínez-Sobrido L. 2016. Replication-competent influenza A viruses expressing reporter genes. Viruses 8:179. doi: 10.3390/v8070179 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Bodewes R, de Mutsert G, van der Klis FRM, Ventresca M, Wilks S, Smith DJ, Koopmans M, Fouchier RAM, Osterhaus ADME, Rimmelzwaan GF. 2011. Prevalence of antibodies against seasonal influenza A and B viruses in children in Netherlands. Clin Vaccine Immunol 18:469–476. doi: 10.1128/CVI.00396-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Waldman AD, Fritz JM, Lenardo MJ. 2020. A guide to cancer immunotherapy: from T cell basic science to clinical practice. Nat Rev Immunol 20:651–668. doi: 10.1038/s41577-020-0306-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Jin C, Ma J, Ramachandran M, Yu D, Essand M. 2022. CAR T cells expressing a bacterial virulence factor trigger potent bystander antitumour responses in solid cancers. Nat Biomed Eng 6:830–841. doi: 10.1038/s41551-022-00875-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Mohabati Mobarez A, Soleimani N, Esmaeili S-A, Farhangi B. 2020. Nanoparticle-based immunotherapy of breast cancer using recombinant Helicobacter pylori proteins. Eur J Pharm Biopharm 155:69–76. doi: 10.1016/j.ejpb.2020.08.013 [DOI] [PubMed] [Google Scholar]
  • 54. Guo X, Ding C, Lu J, Zhou T, Liang T, Ji Z, Xie P, Liu X, Kang Q. 2020. HP-NAP ameliorates OXA-induced atopic dermatitis symptoms in mice. Immunopharmacol Immunotoxicol 42:416–422. doi: 10.1080/08923973.2020.1806869 [DOI] [PubMed] [Google Scholar]
  • 55. Eisfeld AJ, Neumann G, Kawaoka Y. 2014. Influenza A virus isolation, culture and identification. Nat Protoc 9:2663–2681. doi: 10.1038/nprot.2014.180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Perez JT, García-Sastre A, Manicassamy B. 2013. Insertion of a GFP reporter gene in influenza virus. Curr Protoc Microbiol Chapter 15:15G. doi: 10.1002/9780471729259.mc15g04s29 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Velin D, Bachmann D, Bouzourene H, Michetti P. 2005. Mast cells are critical mediators of vaccine-induced Helicobacter clearance in the mouse model. Gastroenterology 129:142–155. doi: 10.1053/j.gastro.2005.04.010 [DOI] [PubMed] [Google Scholar]
  • 58. D’Costa K, Chonwerawong M, Tran LS, Ferrero RL. 2018. Mouse models of Helicobacter infection and gastric pathologies. J Vis Exp 56985:56985. doi: 10.3791/56985 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Song Z, Li B, Zhang Y, Li R, Ruan H, Wu J, Liu Q. 2020. Outer membrane vesicles of Helicobacter pylori 7.13 as adjuvants promote protective efficacy against Helicobacter pylori infection. Front Microbiol 11:1340. doi: 10.3389/fmicb.2020.01340 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material. jvi.01923-23-s0001.docx.

Supplemental figures and notes.

jvi.01923-23-s0001.docx (1.8MB, docx)
DOI: 10.1128/jvi.01923-23.SuF1

Data Availability Statement

All data associated with this study are presented in the paper or supplemental material. Data sets and code were not used in these experiments or studies.


Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES