ABSTRACT
African swine fever (ASF) is an acute, hemorrhagic, and severe infectious disease caused by ASF virus (ASFV) infection. At present, there are still no safe and effective drugs and vaccines to prevent ASF. Mining the important proteins encoded by ASFV that affect the virulence and replication of ASFV is the key to developing effective vaccines and drugs. In this study, ASFV pH240R, a capsid protein of ASFV, was found to inhibit the type I interferon (IFN) signaling pathway. Mechanistically, pH240R interacted with IFNAR1 and IFNAR2 to disrupt the interaction of IFNAR1-TYK2 and IFNAR2-JAK1. Additionally, pH240R inhibited the phosphorylation of IFNAR1, TYK2, and JAK1 induced by IFN-α, resulting in the suppression of the nuclear import of STAT1 and STAT2 and the expression of IFN-stimulated genes (ISGs). Consistent with these results, H240R-deficient ASFV (ASFV-∆H240R) infection induced more ISGs in porcine alveolar macrophages compared with its parental ASFV HLJ/18. We also found that pH240R enhanced viral replication via inhibition of ISGs expression. Taken together, our results clarify that pH240R enhances ASFV replication by inhibiting the JAK-STAT signaling pathway, which highlights the possibility of pH240R as a potential drug target.
IMPORTANCE
The innate immune response is the host’s first line of defense against pathogen infection, which has been reported to affect the replication and virulence of African swine fever virus (ASFV) isolates. Identification of ASFV-encoded proteins that affect the virulence and replication of ASFV is the key step in developing more effective vaccines and drugs. In this study, we found that pH240R interacted with IFNAR1 and IFNAR2 by disrupting the interaction of IFNAR1-TYK2 and IFNAR2-JAK1, resulting in the suppression of the expression of interferon (IFN)-stimulated genes (ISGs). Consistent with these results, H240R-deficient ASFV (ASFV-∆H240R) infection induces more ISGs’ expression compared with its parental ASFV HLJ/18. We also found that pH240R enhanced viral replication via inhibition of ISGs’ expression. Taken together, our findings showed that pH240R enhances ASFV replication by inhibiting the IFN-JAK-STAT axis, which highlights the possibility of pH240R as a potential drug target.
KEYWORDS: ASFV, pH240R, ISGs, IFN, JAK-STAT, viral replication
INTRODUCTION
African swine fever (ASF) is a viral and acute hemorrhagic fever caused by the African swine fever virus (ASFV) in domestic pigs and wild pigs of different species (1). ASFV is a large envelope DNA virus belonging to the Asfarviridae family (2). Previous studies have shown that the main target cells of ASFV are monocytes, macrophages, and dendritic cells, which play a key role in host immune responses (3, 4). Previous studies showed that a virulent strain of ASFV infection induces low levels of type I interferon (IFN) (5), which shows that ASFV-encoded proteins can inhibit the host antiviral immune responses. Recently, it has been reported that several ASFV proteins, such as pMGF505-7R and pMGF360-9L, are related to virulence/pathogenicity (6, 7). Therefore, it is urgent to screen and identify the ASFV-encoded proteins involved in affecting viral virulence and replication.
IFNs are important antiviral cytokines, which can be induced during virus infection and then play an indirect antiviral role by inducing the production of IFN-stimulated genes (ISGs). ASFV infection induces the expression of type I IFN by activating the cGAS-stimulator of interferon gene (STING) signaling pathway. The released type I IFN binds to its receptors (IFNAR1 and/or IFNAR2), which recruits JAK kinases JAK1 and TYK2 to phosphorylate IFNAR1 and IFNAR2. Then, TYK2 and JAK1 will also be autophosphorylated to phosphorylate signal transducer with the activator of transcription 1/2 (STAT1/2). The phosphorylated STAT1/2 and IFN regulatory factor 9 (IRF9) form a heterotrimeric complex, IFN-stimulated gene factor 3 complex (ISGF3) (8, 9). Subsequently, ISGF3 enters the nucleus and binds to the IFN-stimulated response element (ISRE) to induce the expression of hundreds of ISGs (10, 11), resulting in maintaining host antiviral status and eliminating the invasion of the virus. Previous studies have shown that human IFN-β results in a significantly reduced production and transmission of the monkeypox virus by inducing the expression of MXA (12, 13). IFN-α significantly inhibits hepatitis B virus replication by inducing the expression of MX2 (14). It also showed that IFN-α inhibits the replication of the attenuated ASFV strains but has no effect on ASFV virulent strains (15). In conclusion, the accumulated data show that type I IFN can inhibit virus replication by inducing the expression of ISGs.
ASFV have evolved multiple strategies to negatively regulate the antiviral IFN-JAK-STAT signaling pathway. For example, ASFV pMGF360-9L inhibits the IFN-JAK-STAT signaling pathway by degrading STAT1 and STAT2 through apoptosis and ubiquitin proteasome pathway (7). ASFV pMGF-505-7R degrades JAK1 and JAK2 to inhibit the IFN-JAK-STAT signaling pathway (16). ASFV CD2v disrupts IFNAR1-TYK2 and IFNAR2-JAK1 interactions and thereby inhibits the IFN-JAK-STAT axis by IFN-α (17). However, the mechanism of ASFV infection inhibiting the production of ISGs has not been clearly clarified. Therefore, it is necessary to study the underlying molecular mechanisms by which ASFV inhibits the type I IFN signaling pathway.
A previous study showed that ASFV pH240R is a capsid protein, and it was involved in the assembly of ASFV (18). Compared with its parent ASFV HLJ/18, a recombinant ASFV with the H240R gene deletion (ASFV-ΔH240R) induces higher expression levels of inflammatory cytokines in porcine alveolar macrophages (PAMs) than its parental ASFV (18). Our previous study showed that pH240R inhibited the production of type I IFN by targeting STING to inhibit the cGAS-STING signaling pathway (19). Of note, ASFV-ΔH240R is more sensitive to IFN-α compared with its parental ASFV HLJ/18. However, the mechanism is still not fully understood.
In this study, we found that ASFV pH240R inhibited IFN-α-induced activation of ISRE and expression of ISGs by suppressing the type I IFN signaling pathway. Mechanistically, pH240R significantly disrupted the interaction of IFNAR1-TYK2 as well as the interaction of IFNAR2-JAK1 by interacting with IFNAR1 and IFNAR2. Furthermore, compared with its parental ASFV HLJ/18, ASFV-∆H240R infection induced more ISGs. We also confirmed that pH240R promoted ASFV replication by inhibiting the IFN-JAK-STAT axis. Overall, our findings reveal that pH240R enhances ASFV replication via inhibition of the type I IFN signaling pathway, which provides a clue for developing live attenuated ASFV vaccines.
RESULTS
pH240R enhances ASFV replication by inhibiting the type I IFN signaling pathway
Our previous study showed that IFN-α inhibited the replication of ASFV-ΔH240R more significantly than its parent ASFV HLJ/18 (19). To detect the effect of type I IFN signaling pathway on ASFV-ΔH240R replication, PAMs were blocked with anti-IFNAR1 or anti-IFNAR2 antibodies and then treated with IFN-α and infected with ASFV-wild type (ASFV-WT) or ASFV-ΔH240R. The results showed that IFN-α inhibited the replication of ASFV-ΔH240R more significantly than its parent ASFV HLJ/18, while blocking IFNAR1 and IFNAR2 rescued the inhibition effect of IFN-α on both ASFV HLJ/18 and ASFV-ΔH240R replication, indicating that activated type I IFN signaling induced by IFN-α is necessary to inhibit the replication of ASFV (Fig. 1A). To confirm the conclusion, PAMs were treated with or without deucravacitinib, an inhibitor of TYK2. As shown in Fig. S1A, there was no obvious cytotoxicity at 10 nM concentration of deucravacitinib. Deucravacitinib significantly inhibited the promoter activation of ISRE and the mRNA level of Isg15 (Fig. S1B and C). Interestingly, we found that deucravacitinib enhanced ASFV-ΔH240R replication and attenuated the inhibition function of IFN-α on ASFV-ΔH240R replication in PAMs compared with its parent ASFV HLJ/18 (Fig. 1B).
Fig 1.
ASFV pH240R enhances ASFV replication by inhibiting the type I IFN signaling pathway. (A) PAMs were incubated with or without 6.5 µg anti-IFNAR1 and anti-IFNAR2 antibodies for 2 h and then treated with or without IFN-α (1 µg/mL) for 12 h. Subsequently, PAMs were infected with 108 copy numbers of ASFV-WT or ASFV-∆H240R for another 24 h. The genomic DNA copy numbers of ASFV-WT and ASFV-∆H240R were analyzed using quantitative PCR (qPCR). (B) PAMs were treated with or without deucravacitinib (10 nM) for 6 h and then treated with or without IFN-α (1 µg/mL) for 12 h, followed by infection with 108 copy numbers of ASFV-WT or ASFV-∆H240R for 24 h. The genomic DNA copy numbers of ASFV-WT and ASFV-∆H240R were then analyzed using qPCR. (C and D) PAMs were transfected with siRNA targeting the Ifnar2 gene, and at 48 hpt, the cells were infected with ASFV-ΔH240R or its parental ASFV-WT at the same genomic DNA copy number of 108 for 24 h. siNC, siRNA negative control. (C) The mRNA levels of Isg56 were detected by qPCR. (D) Titers of ASFV-WT or ASFV-ΔH240R infectious progeny virions were detected. Data represent three independent experiments with three biological replicates or represent three independent experiments with similar results. *0.01 < P < 0.05, **P < 0.01, and ***P < 0.001 (two-tailed Student’s t-test), NS, not significant (P > 0.05) .
To explore the effect of IFANR2 or type I IFN signaling pathway on ASFV replication, PAMs were transfected with small interfering RNAs (siRNAs) targeting IFANR2 (Fig. S1D) and then infected with ASFV-WT or ASFV-ΔH240R at the same number of genome copies of 108 for 24 h. The results showed that the mRNA levels of Isg56 induced by ASFV-WT or ASFV-ΔH240R infection were reduced in PAMs transfected with siRNA targeting IFNAR2 as well as ASFV-ΔH240R infection induced higher mRNA transcription of Isg56 than ASFV HLJ/18 infection by inhibiting the function of IFNAR2-mediated ISGs’ production (Fig. 1C). Similarly, we also found that knockdown of IFNAR2 expression increased the titers of both ASFV-WT and ASFV-ΔH240R. However, the titers of ASFV-ΔH240R were lower than those of ASFV-WT (Fig. 1D). In conclusion, our results showed that ASFV H240R gene is required for the replication of ASFV through inhibiting type I IFN signaling.
ASFV pH240R inhibits ISGs’ production
To assess the potential role of ASFV pH240R on ISGs’ production, HEK293T cells were transfected with increasing amounts of a plasmid expressing pH240R, along with one of the ISRE, ISG54, and ISG56 reporters, respectively, together with a Renilla-TK Luc for 24 h and then treated with IFN-α for another 6 h. As shown in Fig. 2A through C, pH240R inhibited the promoter activity of ISRE, ISG54, and ISG56 in a dose-dependent manner. It has been reported that ASFV pMGF360-9L and pE184L have affected the promoter activity of ISGs; the two proteins were used as a positive or negative control. Consistent with previous results, the ectopic expression of pMGF360-9L inhibited IFN-α-induced ISRE promoter activities in a dose-dependent manner (Fig. S2A) (7), and ectopic expression of pE184L has no effect on IFN-α-induced ISRE promoter activity (Fig. S2B). In addition, we also found that pH240R inhibited IFN-α-induced GAS promoter activities in a dose-dependent manner (Fig. S2C). Similarly, quantitative PCR (qPCR) results showed that pH240R inhibited the mRNA transcription of Isg15, Isg54, and Isg56 in a dose-dependent manner (Fig. 2D through F), indicating that pH240R had a strong inhibitory effect on the transcription of several ISGs upon IFN-α treatment. Subsequently, the effect of the overexpression of pH240R on the protein level of ISG15 was evaluated by immunoblotting. Consistently, overexpressed pH240R significantly reduced the protein level of endogenous ISG15 in IFN-α-treated HeLa cells (Fig. S2D and E). Taken together, our findings indicate that pH240R inhibits type I IFN signaling.
Fig 2.
ASFV-encoded pH240R inhibits type I IFN signaling. (A–C) HEK293T cells were co-transfected with 100 ng ISRE-Luc (A), ISG54-Luc (B), ISG56-Luc (C) reporters, and 5 ng pRL-TK reporter, along with an empty vector (pCAGGS-Flag) or increasing doses (100, 200, and 400 ng) of a plasmid expressing Flag-pH240R (A–C). At 24 hpt, the cells were stimulated with IFN-α (1 µg/mL) for another6 h. The cells were collected to detect the luciferase activity (upper panels). The expression of pH240R and GAPDH was analyzed by Western blotting (lower panels). (D–F) HEK293T cells were transfected with increasing doses (100, 200, and 400 ng) of a plasmid expressing Flag-pH240R or empty vector (pCAGGS-Flag) for 24 h, and then the cells were stimulated with IFN-α (1 µg/mL) for 6 h. The mRNA levels of Isg15 (D), Isg54 (E), and Isg56 (F) were analyzed by qPCR (upper panels). The expression of pH240R and GAPDH was analyzed by Western blotting (lower panels). n = 3; error bars, s.d. All assays were independently repeated at least three times. The data are shown as the mean ± SD; n = 3. NS, not significant (P > 0.05) and ***P < 0.001.
ASFV-ΔH240R induces more ISGs than ASFV-WT
To further detect the effect of the H240R gene on ISGs’ production upon ASFV infection, PAMs were infected with 108 copy numbers of ASFV-ΔH240R or its parental ASFV-WT for 12 h, and the cells were then treated with IFN-α for another 12 h. The cells were collected and the mRNA levels of several ISGs were detected by qPCR. As shown in Fig. 3A through D, ASFV-WT infection significantly inhibited the mRNA levels of ISGs induced by IFN-α, while the deletion of the H240R gene rescued the inhibition of the mRNA levels of the tested ISGs during ASFV infection. We noticed that the genomic DNA copy number of the ASFV-WT and ASFV-ΔH240R had no difference, and the genomic DNA copy number of ASFV-ΔH240R was significantly lower than that of ASFV-WT when treated with IFN-α (Fig. 3E), which rules out the possibility that the effect of ASFV-ΔH240R on ISGs was due to more viral particles rather than loss of function of the H240R gene.
Fig 3.
ASFV-ΔH240R induces more ISGs than ASFV-WT. (A-D) PAMs were infected with 108 copy number of ASFV or ASFV-∆H240R for 12 h and then treated with IFN-α (1 μg/mL) for another 12 h. mRNA levels of Isg15 (A), Isg56 (B), Mx1(C) and Oas2 (D) are shown. The DNA copy numbers of ASFV-WT and ASFV-∆H240R were then analyzed using qPCR (E). Data represent three independent experiments with three biological replicates or represent three independent experiments with similar results. *0.01 < P < 0.05, **P < 0.01, ***P < 0.001 (two-tailed Student’s t-test).
ASFV pH240R disrupts the interaction of IFNAR1-TYK2 and IFNAR2-JAK1 by interacting with IFNAR1 and IFNAR2
In order to further clarify the target of pH240R inhibiting type I IFN signaling, we first tested whether pH240R inhibits the transcription of ISGs by directly targeting ISGF3. HEK293T cells were transfected with plasmids expressing pH240R and the components of ISGF3, respectively, along with an ISRE reporter and a Renilla-TK Luc. The results showed that pH240R could not inhibit ISGF3-mediated ISRE reporter activation (Fig. 4A), suggesting that pH240R negatively regulates type I IFN signaling upstream of ISGF3 formation. To further explore the target molecules of pH240R in the type I IFN signaling, HEK293T cells were transfected with a plasmid expressing pH240R, along with a plasmid encoding IFNAR1, IFNAR2, JAK1, and TYK2, respectively. As shown in Fig. S3A through D and Fig. 4B, pH240R immunoprecipitated with IFNAR1 and IFNAR2 but not JAK1 and TYK2. Subsequently, the interaction of endogenous IFNAR1/2 and ASFV-encoded pH240R was validated in PAMs infected with ASFV (Fig. 4C). In addition, we confirmed that pH240R colocalized with IFNAR1 and IFNAR2 in CRL-2843 cells (Fig. 4D and E). To determine which domain of pH240R is responsible for its inhibition of type I IFN signaling, HEK293T cells were transfected with a plasmid expressing pH240R-WT or truncated mutants of pH240R (Fig. S4A), along with the ISRE or ISG56 reporters. As shown in Fig. S4B and C, intact pH240R, pH240R-D1, and pH240R-D2, but not pH240R-D3 and pH240R-D4, inhibited the activity of the ISRE and ISG56 reporters, which suggested that amino acids 1–157 (aa 1–157) of pH240R were required for its inhibition of the production of ISGs. Consistent with these results, we also found that IFNAR1 and IFNAR2 interacted with aa1–157 of pH240R (Fig. S4D and E). These results clearly demonstrate that aa 1–157 of pH240R were involved in the inhibition of type I IFN signaling.
Fig 4.
ASFV pH240R interacts with IFNAR1 and IFNAR2. (A) HEK293T cells were co-transfected with 200 ng of plasmids expressing either pH240R and an additional 200 ng of empty vector or HA-tagged STAT1, STAT2, or IRF9, together with 100 ng of ISRE-Luc and 5 ng of pRL-TK used as an internal control. At 24 hpt, the cells were harvested to analyze the luciferase activity (upper panels). The HA-tagged STAT1, STAT2, and IRF9, Flag-tagged pH240R and GAPDH were verified by Western blotting (lower panels). (B) HEK293T cells were transfected with a plasmid expressing HA-IFNAR1/HA-IFNAR2 or Flag-pH240R alone, or together. At 24 hpt, the interaction between pH240R and IFNAR1/HA-IFNAR2 in the HEK293T cells was detected by co-immunoprecipitation (Co-IP). (C) PAMs were infected with ASFV-WT (1 MOI) for 24 h, and then Co-IP was performed with the anti-IFNAR1/IFNAR2 antibody. Immunoglobulin G (IgG) was used as a negative control. (D) CRL-2843 cells were transfected with a plasmid expressing HA-IFNAR1/HA-IFNAR2 or Flag-pH240R alone, or together. At 24 hpt, the localization of pH240R and IFNAR1/IFNAR2 in the CRL-2843 was detected by confocal microscopy. Scale bars, 20 µm. (E) The Pearson’s correlation coefficient of the images was analyzed using the Zeiss processing system. All experiments were independently repeated at least three times. NS, not significant (P > 0.05) (two-tailed Student’s t-test).
Type I IFN binds to IFNAR1 and IFNAR2, which recruit TYK2 and JAK1, respectively, to trigger a cascade signaling (20). To test whether ASFV pH240R disrupts the interaction of IFNAR1-TYK2 or IFNAR2-JAK1, HEK293T cells were transfected with plasmids as indicated. As shown in Fig. 5A through D, overexpressed pH240R significantly reduced both the interaction of exogenous IFNAR1-TYK2 and IFNAR2-JAK1 as well as the interaction of endogenous IFNAR1-TYK2 and IFNAR2-JAK1. After recruiting TYK2 and JAK1, IFNAR1/2 was phosphorylated, and then TYK2 and JAK1 were autophosphorylated (21). Of note, we also found that tyrosine phosphorylation levels of IFNAR1, TYK2, and JAK1 were significantly reduced when pH240R was overexpressed. Taken together, these results suggest that pH240R inhibits the interaction of IFNAR1-TYK2 and IFNAR2-JAK1 by interacting with IFNAR1 and IFNAR2, and the phosphorylation levels of IFNAR1, JAK1, and TYK2 were reduced (Fig. 5E and F).
Fig 5.
ASFV pH240R disrupts the interaction of IFNAR1-TYK2 and IFNAR2-JAK1. (A) HEK293T cells were transfected with plasmids expressing Flag-pH240R alone or together with Flag-TYK2 and HA-IFNAR1 as indicated. Co-immunoprecipitation (Co-IP) and Western blot were performed to detect the interactions among IFNAR1, TYK2, and pH240R. (B) HEK293T cells were transfected with plasmids expressing Flag-pH240R alone or together with Flag-JAK1 and HA-IFNAR2 as indicated. Co-IP and Western blot were performed to detect the interactions among IFNAR2, JAK1, and pH240R. (C and D) HEK293T cells were transfected with plasmids expressing Flag-pH240R for 24 h, and then the cells were stimulated with IFN-α (1 µg/mL) for another 6 h, and then Co-IP was performed with anti-IFNAR1 (C) or IFNAR2 (D) antibody. Immunoglobulin G (IgG) was used as a negative control. (E) HEK293T cells were transfected with increasing doses (1, 2, and 4 µg) of a plasmid expressing Flag-pH240R. At 24 hpt, the cells were stimulated with IFN-α (1 µg/mL) for another 6 h. Then, the protein levels of IFNAR1, IFNAR1-p, IFNAR2, JAK1, JAK1-p, TYK2, TYK2-p, IRF9, GAPDH, and Flag-pH240R were detected by Western blotting. (F) Quantitation of IFNAR1-p/IFNAR1, JAK1-p/JAK1, and TYK2-p/TYK2 ratio from image J analysis in panel E. n = 3; error bars, s.d. The data are shown as the mean ± SD; n = 3. ***P < 0.001.
ASFV pH240R inhibits the phosphorylation of STAT1 and STAT2
The phosphorylation of STAT1 and STAT2 is a key event of type I IFN signaling transduction downstream. To determine whether ASFV pH240R inhibits IFN-α-induced phosphorylation of STAT1 or STAT2, HEK293T cells were transfected with a plasmid encoding pH240R and then stimulated with IFN-α, and the results showed that ASFV pH240R significantly inhibited the phosphorylation of STAT1 and STAT2 induced by IFN-α (Fig. 6A and B). To further test whether the phosphorylation of STAT1 and STAT2 are affected by the deletion of the H240R gene, PAMs were infected with ASFV-WT or ASFV-∆H240R and then treated with IFN-α. We found that ASFV-WT infection significantly inhibited IFN-α-induced phosphorylation levels of STAT1 and STAT2, while ASFV-ΔH240R infection alleviated the inhibition of ASFV-WT on the phosphorylation of STAT1 and STAT2 (Fig. 6C and D). These results suggested that pH240R inhibited the phosphorylation of STAT1 and STAT2 upon ASFV infection.
Fig 6.
ASFV pH240R inhibits the phosphorylation of STAT1 and STAT2. (A) HEK293T cells were transfected with 2 µg plasmid expressing Flag-pH240R or empty vector for 24 h. Then, the cells were treated with IFN-α (1 µg/mL) for 6 h. The cell lysates were collected to analyze the phosphorylation of STAT1 and STAT2 through immunoblotting using the indicated antibodies. (B) Quantitation of STAT1-p/STAT1 and STAT2-p/STAT2 ratio from image J analysis in panel A. n = 3; error bars, s.d. (C) PAMs were infected with 108 copy numbers of ASFV-WT or ASFV-∆H240R for 24 h and then treated with or without IFN-α (1 µg/mL) for 12 h. The cells were collected to test the expression of STAT1, STAT2, p54, GAPDH, and the phosphorylation of STAT1 and STAT2 via immunoblotting using the indicated antibodies. (D) Quantitation of STAT1-p/STAT1 and STAT2-p/STAT2 ratio from image J analysis in panel C.
ASFV pH240R reduced the trimerization of ISGF3
The phosphorylated STAT1 and STAT2 form a heterodimer, which recruits IRF9 to form an ISGF3 complex (22). To assess the potential role of ASFV pH240R in the formation of ISGF3 complex, HEK293T cells were transfected with different amounts of a plasmid expressing pH240R and then treated with IFN-α for another 6 h. As shown in Fig. 7A and B, pH240R significantly inhibited both the interaction of IRF9-STAT1 and IRF9-STAT2. We also found that ASFV-ΔH240R infection facilitated the interaction of endogenous IRF9-STAT1 as well as IRF9-STAT2 compared with its parent ASFV HLJ/18 in PAMs (Fig. 7C and D). In conclusion, pH240R did not interact with IRF9 but inhibited the formation of ISGF3, which leads to the disruption of the interaction of IFNAR1-TYK2 and IFNAR2-JAK1.
Fig 7.
ASFV pH240R disrupts the trimerization of ISGF3. (A) HEK293T cells were transfected with increasing doses of a plasmid (1, 2, and 4 µg) expressing Flag-pH240R. At 24 hpt, the cells were stimulated with IFN-α (1 µg/mL) for another 6 h. Then, co-immunoprecipitation (Co-IP) was performed with an anti-IRF9 antibody. Immunoglobulin G (IgG) was used as a negative control. Co-IP and Western blot were performed to detect the interactions among STAT1, STAT2, and IRF9. (B) Quantitation of STAT1/IRF9 and STAT2/IRF9 ratio from image J analysis in panel A. (C) PAMs were infected with 108 genomic copy numbers of ASFV-WT or ASFV-ΔH240R for 24 h and then treated with or without IFN-α (1 µg/mL) for 12 h. Then, Co-IP was performed with anti-IRF9 antibody. IgG was used as a negative control. Co-IP and Western blot were performed to detect the interactions among STAT1, STAT2, and IRF9. (D) Quantitation of STAT1/IRF9 and STAT2/IRF9 ratio from image J analysis in panel C.
ASFV pH240R inhibits the nuclear translocation of STAT1 and STAT2
To determine whether ASFV pH240R inhibits IFN-α-induced nuclear translocation of STAT1 and STAT2, HEK293T cells were transfected with a plasmid encoding pH240R and then stimulated with IFN-α. As shown in Fig. 8A and B, overexpression of pH240R inhibited the nuclear translocation of STAT1 and STAT2. To further test whether the nuclear translocation of STAT1, STAT2, and IRF9 are affected by the deletion of the H240R gene, PAMs were infected with ASFV-WT or ASFV-∆H240R and then treated with IFN-α. We found that deletion of the H240R gene facilitated the nuclear translocation of STAT1, STAT2, and IRF9 compared with its parental ASFV HLJ/18 (Fig. 8C and D). Confocal results also clearly showed that the overexpression of pH240R inhibited the nuclear translocation of STAT1 and STAT2 (Fig. 8E through H). These results suggest that ASFV pH240R inhibits the nuclear import of STAT1 and STAT2, resulting in the inhibition of the production of ISGs.
Fig 8.
ASFV pH240R inhibits the nuclear translocation of STAT1 and STAT2. (A) HeLa cells were transfected with 2 µg of empty vector or plasmids expressing ASFV pH240R for 24 h, and then the cells were treated with IFN-α (1 µg/mL) for 6 h. STAT1 and STAT2 in the nuclear and cytoplasmic compartments were detected by Western blotting. Lamin B and GAPDH were used as nuclear and cytoplasmic markers. (B) Quantitation of STAT1-p/STAT1 and STAT2-p/STAT2 ratio from image J analysis in panel A. n = 3; error bars, s.d. (C) PAMs were infected with 108 genomic copy numbers of ASFV-WT or ASFV-ΔH240R for 24 h and then treated with or without IFN-α (1 µg/mL) for 12 h. p30, STAT1, STAT2, and IRF9 in the nuclear and cytoplasmic compartments were detected by Western blotting. Lamin B and GAPDH were used as nuclear and cytoplasmic markers. (D) Quantitation of N-STAT1/C-STAT1, N-STAT2/C-STAT2, and N-IRF9/C-IRF9 ratio from image J analysis in panel C. (E–H) CRL-2843 cells were transfected with a plasmid expressing Flag-pH240R or an empty vector for 24 h, and the cells were stimulated with or without IFN-α (1 µg/mL) for 6 h, and the localization of STAT1 (E) and STAT2 (G) was detected by immunofluorescence microscopy. Scale bars, 20 µm. The Pearson’s correlation coefficient of the images of STAT1 (F) and STAT2 (H) was analyzed using the Zeiss processing system. n = 3; error bars, s.d. The data are shown as the mean ± SD; n = 3. NS, not significant (P > 0.05) and ***P < 0.001.
DISCUSSION
Type I IFN-induced host antiviral innate immune responses provide a powerful first line to antagonize virus infection. Previous studies showed that ASFV has evolved multiple strategies to counteract the IFNAR1/2-JAK-STAT axis (23). In this study, we found that ASFV pH240R is another negative regulator of the IFN signaling pathway. ASFV pH240R inhibited type I IFN signaling by disrupting the interactions of IFNAR1-TYK2 and IFNAR2-JAK1, resulting in the suppression of the production of ISGs. Taken together, pH240R benefits ASFV replication by antagonizing host antiviral immune responses.
A previous study demonstrated that ASFV infection prevents ISGs’ expression in IFN-treated cells by counteracting the JAK-STAT pathway, which impairs nuclear translocation of the ISGF3 complex, as well as the proteasome-dependent STAT2 degradation and caspase 3-dependent STAT1 cleavage (24). Several ASFV proteins have been well described to inhibit the type I IFN-mediated antiviral effects. Recently, Li et al. (16) reported that ASFV pMGF505-7R inhibited IFN-γ-mediated JAK-STAT1 signaling by promoting the degradation of JAK1 and JAK2 by upregulating the E3 ubiquitin ligase RNF125 expression and inhibiting the expression of Hes5. In addition, ASFV pMGF360-9L was found to interact with STAT1 and STAT2, which not only promotes STAT1 degradation through the apoptotic pathway but also induces STAT2 degradation through the ubiquitin-proteasome pathway (7). However, which host proteins are involved in the MGF360-9L-mediated degradation of STAT1 and STAT2 still remains unknown.
In this study, ASFV pH240R was found to interact with IFNAR1 and IFNAR2, which disrupted the interaction of IFNAR1-TYK2 as well as the interaction of IFNAR2-JAK1, resulting in the inhibition of ISGs’ expression. HSV-1 UL36 has been reported to block the interaction of IFNAR2-JAK1 to antagonize the activation of the IFN-JAK-STAT signaling (25). Measles virus suppresses JAK-STAT signaling through its proteins C and V, which form a complex with IFNAR1 and block JAK1 phosphorylation (26). Therefore, we speculated that pH240R binds with the intracellular parts of IFNAR1 and IFNAR2 to form complexes, disrupting the interaction of IFNAR1-TYK2 and IFNAR2-JAK1, as well as the phosphorylation of JAK1 and TYK2, thereby antagonizing IFN-JAK-STAT axis.
Zhou et al. (18) reported that pH240R is necessary for ASFV viral particle assembly, and the infectious progeny viral titers of ASFV-ΔH240R are reduced by approximately 2.0 logs compared with ASFV-WT due to the generation of noninfectious particles. However, there is no significant difference in the genomic DNA copy numbers of the two viruses when infected with the same genomic copy number of ASFV-WT or ASFV-ΔH240R. To keep the same number of virions entering the cell, we utilized the same genomic DNA copy number of ASFV-WT and ASFV-∆H240R to infect PAMs. The results ensure that ASFV-∆H240R infection induced more production of type I IFNs and ISGs’ expression than its parental ASFV HLJ/18.
In this study, we confirmed that IFN-α inhibited the replication of ASFV-ΔH240R in PAMs more significantly compared with its parental virus. In addition, we also found that blockage with anti-IFNAR1 and anti-IFNAR2 antibodies or treatment with TYK2 inhibitors rescued the inhibition of IFN-α on ASFV replication. Based on these results, we concluded that the H240R gene is required for ASFV HLJ/18 to evade the antiviral effect of IFN-α. Consistent with a previous study (18), we also found that deletion of the H240R gene reduced viral titer by about 2.0 logs compared with ASFV-WT. We speculated that there may be two reasons for the reduced viral titer of ASFV-ΔH240R. One reason is that ASFV-ΔH240R infection produced many progeny viruses that have no ability to infect, and the other one is that ASFV-ΔH240R infection induced more ISGs and was more sensitive to IFN-α than ASFV-WT.
At present, the control of ASF still relies on animal quarantine and slaughter. The development of safe and effective vaccines is becoming increasingly important. Of all the vaccines that have been tested, live attenuated vaccines are the ones with the best protective efficiency, especially attenuated ASFV generated by the deletion of genes associated with viral virulence. Therefore, identifying the virulence genes of ASFV is the key step in the design of an ASFV attenuated live vaccine. Currently, several studies have shown that the virulence genes encoded by ASFV have immunosuppressive functions. Identification of immunomodulator ASFV gene has become a new strategy for exploring new ASFV virulence-related genes. In our previous study, pH240R was identified as an immunomodulator gene of ASFV. It not only interacted with NF-kappa-B essential modulator to suppress the activity of NF-κB signaling but also bound to NLRP3 to inhibit the activation of NLRP3 inflammasome, leading to reduced inflammatory cytokines (27). We also found that pH240R interacted with STING and inhibited its oligomerization and translocation from the endoplasmic reticulum to the Golgi apparatus, ultimately inhibiting the production of type I IFN (19). pH240R was also identified as an important virulence-related factor of ASFV. H240R deficiency reduced the viral pathogenicity of pigs compared with its parent ASFV HLJ/18. Jointly deleted H240R and MGF505-7R genes, another multifunctional virulence gene (6), from the highly pathogenic ASFV HLJ/18 genome (ASFV-ΔH240R-Δ7R), lost its pathogenicity to pigs. Immunized piglets with ASFV-ΔH240R-Δ7R exhibited a 100% protective effect when challenged with virulent ASFV HLJ/18 (28). These results suggest that ASFV-ΔH240R-Δ7R may be a new live-attenuated vaccine candidate.
In summary, the new immune regulatory function of pH240R has been clarified. We found that ASFV pH240R disrupted the trimerization of ISGF3 and the phosphorylation and nucleation of STAT1 and STAT2 by disrupting the interaction of IFNAR1-TYK2 and IFNAR2-JAK1, ultimately inhibiting the production of ISGs. Our findings help to understand the functions of ASFV pH240R, which provides a new clue to elucidate the mechanism of attenuated live vaccine ASFV-ΔH240R-Δ7R protecting pigs from the highly pathogenic ASFV strain challenge.
MATERIALS AND METHODS
Cells and viruses
HEK293T cells and HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM), and CRL-2843 cells were cultured in complete growth medium RPMI 1640 medium with 2 mM L-glutamine. PAMs were isolated from the lung lavage fluid of 4-week-old healthy specific pathogen-free piglets (without ASFV, classical swine fever virus, porcine reproductive and respiratory syndrome virus, pseudorabies virus, and other 28 pathogens) cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 100 U penicillin, and 100 µg/mL streptomycin at 37°C with 5% CO2. ASFV HLJ/18 strain was isolated from a pig sample from an ASF outbreak farm in China and amplified in PAMs as previously described (29).
Reagents, plasmids, and antibodies
Anti-Flag (M2) beads (M8823) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Protease inhibitor Cocktail (4693132001) was purchased from Roche (Basel, Switzerland). DMEM (C11995500CP) and FBS (10091-148) were purchased from GIBCO (Grand Island, NE, USA). Dual-Luciferase reporter assay system (E1910) was purchased from Promega (Madison, MI, USA). PrimeScript RT Reagent Kit (RR037A) and SYBR Premix Ex Taq II (RR820A) were purchased from Takara (Shiga, Japan). Rabbit anti-Flag (F7425-2MG), mouse anti-Flag (F1804-1MG), rabbit anti-HA (SAB4300603), and mouse anti-HA (HS658-2ML) antibodies were purchased from Sigma-Aldrich (St. Louis, MO, USA). Mouse anti-GAPDH (60004-1-Ig), rabbit anti-Lamin B (12987-1-AP), rabbit anti-IFNAR1 (13083-1-AP), and rabbit anti-IFNAR2 (10522-1-AP) antibodies were purchased from Proteintech (Wuhan, China). Rabbit anti-STAT1 (9172S), rabbit anti-Phospho-STAT1 (9167S), rabbit anti-STAT2 (72604), rabbit anti-Phospho-STAT2 (88410), rabbit anti-JAK1 (3332S), rabbit anti-phospho-JAK1 (74129S), rabbit anti-TYK2 (9312S), rabbit anti-phospho-TYK2 (9321S), and rabbit anti-IRF9 (76684S) antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). The rabbit anti-Phospho-IFNAR1 (AF3717) was purchased from Affinity Biosciences (Jiangsu, China). The IRDye 800CW goat anti-rabbit IgG (H + L) (925-32211) and IRDye 800CW goat anti-mouse IgG (H + L) (925-32210) were purchased from LI-COR (Lincoln, NE, USA). Alexa Flour 488 goat anti-Rabbit IgG (H + L) (A11008) and Alexa Flour 594 goat anti-Mouse IgG (H + L) (A11032) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). The ISRE, ISG54, ISG56 reporters, and TK-Renilla reporter were obtained from Professor Hong Tang. The GAS reporters were purchased from Youbio (Hunan, China). The H240R cDNA was synthesized based on the genome of ASFV HLJ/18 isolate and cloned into pCAGGS-Flag by GenScript (Nanjing, China). To construct the plasmids expressing Flag-tagged or HA-tagged proteins involved in the IFN signaling pathways, the cDNAs corresponding to these swine genes were amplified by qPCR using total RNA extracted from PAMs as templates and cloned into the pCAGGS-Flag or pCAGGS-HA vector, respectively. All constructs were validated by DNA sequencing. The primers used in this study are listed in Table 1.
TABLE 1.
Primers used for PCR in this study
| Plasmids | Primers (5′−3′) |
|---|---|
| pCAGGS-IFNAR1 (Flag, HA) |
Forward: 5′-ATGCTCGGGCTTCTGGGTGC-3′ Reverse: 5′-TCACACGGCTGCCTGTCGCAGAA-3′ |
| pCAGGS-IFNAR2 (Flag, HA) |
Forward: 5′-ATGCTTTTGAGCCAGAATGTCTCCG-3′ Reverse: 5′-TCATCTCATGATATATCCATCCC-3′ |
| pCAGGS-JAK1 (Flag, HA) |
Forward: 5′-ATGGCTTTTTGTGCTAAAA-3′ Reverse: 5′- TTATTTTAAAAGTGCTT-3′ |
| pCAGGS-Tyk2 (Flag, HA) |
Forward: 5′- ATGCCTCTGTGCCATTGGGGAGC-3′ Reverse: 5′- TCAGCAGACACTGAACACTGAG-3′ |
| pCAGGS-STAT1 (Flag, HA) |
Forward: 5′- ATGTCCCAGTGGTATGAGCT-3′ Reverse: 5′- TTAGTCAAGGTTCATAGTTCCAG-3′ |
| pCAGGS-STAT2 (Flag, HA) |
Forward: 5′- ATGGCGCAGTGGGAGATGC-3′ Reverse: 5′- CTAGTAGTCAGAAGGAATC-3′ |
| PCAGGS-IRF9 (FLAG, HA) |
Forward: 5′- ATGGCTTCAG
GCAGGGCTCG-3′ Reverse: 5′-TCAAAGCAGATAGGAGGAGCA-3′ |
| pEGFP-H240R | Forward: 5′-AATTCTGCAGTCGACGGTACCATGGCTGCAAACATTA-3′ |
| Reverse: 5′-TTATCTAGATCCGGTGGATCCTTACTTAGACGTTTTT-3′ | |
| pEGFP-H240R-D1 | Forward: 5′-AATTCTGCAGTCGACGGTACCATGGCTGCAAACATTA-3′ |
| Reverse: 5′-TTATCTAGATCCGGTGGATCCTGGGAAATCTAGCGGTCCCG-3′ | |
| pEGFP-H240R-D2 | Forward: 5′-AATTCTGCAGTCGACGGTACCATGGCTGCAAACATTA-3′ |
| Reverse: 5′- TTATCTAGATCCGGTGGATCCATTTTTTAGTATATATAGTT-3′ | |
| pEGFP-H240R-D3 | Forward: 5′-AATTCTGCAGTCGACGGTACCATGGCTGCAAACATTA-3′ |
| Reverse: 5′- TTATCTAGATCCGGTGGATCCATTTTTTAGTATATATAGTT-3′ | |
| pEGFP-H240R-D4 | Forward: 5′-AATTCTGCAGTCGACGGTACCATGGCTGCAAACATTA-3′ |
| Reverse: 5′-TTATCTAGATCCGGTGGATCCTGGGAAATCTAGCGGTCCCG-3′ |
Confocal microscopy
CRL-2843 cells were transfected with plasmids expressing HA-tagged or Flag-tagged proteins for 24 h. These cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100. After blocking with 10% FBS, the cells were incubated with anti-Flag and anti-HA antibodies for 2 h. Samples were visualized with a Leica SP2 confocal system (Carl Zeiss AG, Oberkochen, Germany).
Co-immunoprecipitation and Western blot assay
For co-immunoprecipitation, the cells were lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 1% Triton X-100, and 10% glycerol) containing 1 mM PMSF and a 1× protease inhibitor cocktail (Roche, Basel, Switzerland). Then, cell supernatants were incubated with anti-Flag (M2) agarose or with protein G Plus-Agarose immunoprecipitation reagent (Sigma-Aldrich, St. Louis, MO, USA) together with 1 µg of the indicated antibodies at 4°C overnight on a roller. The pellets were washed five times with cell lysis buffer. For Western blot analysis, 20% of cell lysates and immunoprecipitants were resolved by 10%–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were then transferred to a polyvinylidene difluoride membrane (Sigma-Aldrich, St. Louis, MO, USA). After incubation with primary and secondary antibodies, the membranes were visualized by enhanced chemiluminescence (Thermo Fisher Scientific, Waltham, MA, USA) or an Odyssey two-color infrared fluorescence imaging system (LI-COR).
Dual-luciferase reporter assay
HEK293T cells were co-transfected with the indicated plasmids. After 24 h, the cells were treated with IFN-α (1 µg/mL) for 6 h, then the cells were harvested and lysed in lysis buffer, and luciferase activities of ISRE, ISG54, ISG56, GAS reporters, and TK-Renilla reporter were measured with a Dual-Luciferase Reporter Assay System (Promega, Madison, MI, USA) according to the manufacturer’s instructions. The data were normalized to the transfection efficiency by dividing the firefly luciferase activity by the Renilla luciferase activity. Each experiment was conducted three times independently and the representative results are shown.
Quantitative PCR
To detect the mRNA levels of Isg15, Isg54, Isg56, Mx1, and Oas2, total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA), and reverse transcription was performed with a PrimeScript RT Reagent Kit (Takara, Tokyo, Japan). Reverse transcription products were amplified using an Agilent-Strata gene Mx Real-Time qPCR system with SYBR Premix Ex Taq II (Takara, Tokyo, Japan) according to the manufacturer’s instructions. Data were normalized to the level of β-actin expression in each individual sample. For ASFV genomic DNA detection, ASFV genomic DNA was extracted by using the QIAamp DNA Mini Kit (Qiagen, Germany). qPCR was carried out on a QuantStudio5 system (Applied Biosystems, USA) according to the World Organization for Animal Health-recommended procedure. All the qPCR primers are listed in Table 2.
TABLE 2.
Primers used for qPCR in this study
| Gene name | Primers | Sequence (5′−3′) |
|---|---|---|
| Human-β-actin | h-β-actin-F | CCTTCCTGGGCATGGAGTCCTG |
| h-β-actin-R | GGAGCAATGATCTTGATCTTC | |
| Human-ISG56 | h-ISG56-F | TTGATGACGATGAAATGCCTGA |
| h-ISG56-R | CAGGTCACCAGACTCCTCAC | |
| Human-ISG15 | h-ISG15-F | CGCAGATCACCCAGAAGATCG |
| h-ISG15-R | TTCGTCGCATTTGTCCACCA | |
| Swine-IFN-β | sq-IFN-β-F | AGCACTGGCTGGAATGAAACCG |
| sq-IFN-β-R | CTCCAGGTCATCCATCTGCCCA | |
| Swine-IFN-α | sq-IFN-α-F | CTGCTGCCTGGAATGAGAGCC |
| sq-IFN-α-R | TGACACAGGCTTCCAGGTCCC | |
| Swine-β-actin | sq-β-actin-F | TGAGAACAGCTGCATCCACTT |
| sq-β-actin-R | CGAAGGCAGCTCGGAGTT | |
| Swine-ISG15 | sq-ISG15-F | GGTGCAAAGCTTCAGAGACC |
| sq-ISG15-R | GTCAGCCAGACCTCATAGGC | |
| Swine-ISG56 | sq-ISG56-F | TCAGAGGTGAGAAGGCTGGT |
| sq-ISG56-R | GCTTCCTGCAAGTGTCCTTC | |
| Swine-Mx1 | sq-Mx1-F | AGCGCAGTGACACCAGCGAC |
| sq-Mx1-R | GCCCGGTTCAGCCTGGGAAC | |
| Swine-OAS2 | sq-OAS2-F | CACAGCTCAGGGATTTCAGA |
| sq-OAS2-R | TCCAACGACAGGGTTTGTAA | |
| ASFV-B646L | ASFV-B646L-F | CTGCTCATGGTATCAATCTTATCGA |
| ASFV-B646L-R | GATACCACAAGATCAGCCGT | |
| Probe | CCACGGGAGGAATACCAACCCAGTG |
Cell viability assay
LDH assay was performed to determine the cell viability. PAMs were treated with deucravacitinib, an inhibitor of TYK2, to inhibit type I IFN-induced cellular signaling. The cell culture supernatant was harvested and cleared by centrifugation at 2,000 g for 5 min, and 50 µL was used to perform LDH assay according to the manufacturer’s instructions (absorption at 490 and 680 nm for correction).
RNA interference
The siRNAs targeting the Ifnar2 gene are listed in Table 3. The transfection of siRNAs was performed with HiPerFect transfection reagent (Qiagen, Germantown, MD, USA), following the manufacturer’s instructions. Forty-eight hours after siRNA transfection, the knockdown efficiency of IFNAR2 was assessed by Western blotting.
TABLE 3.
siRNAs targeting Ifnar2 used in this study
| Plasmid | Primer (5′–3′) |
|---|---|
| siNC | 5′-UUCUCCGAACGUGUCACGUTT-3′ |
| siIFNAR2-1 | 5′-GGAAUCAGAGUCGUCAGAATT-3′ |
| siIFNAR2-2 | 5′-GCUGCUGUCUUCAUAAGCATT-3′ |
| siIFNAR2-3 | 5′-GGAAGAAGAAAGAGUGGAATT-3′ |
Statistical analysis
All statistical analyses were performed using one-way ANOVA via the SPSS 16.0 software package (version 16.0, SPSS Inc., Chicago, IL, USA). Data were expressed as the mean ± standard deviation. A value of P < 0.05 was considered statistically significant.
ACKNOWLEDGMENTS
This study was supported by the National Natural Science Foundation of China (grant Nos. U21A20256, 32322081 and 32270156), the Natural Science Foundation of Heilongjiang Province of China (grant No. C2016061), the Central Public-interest Scientific Institution Basal Research Fund (1610302022013), and the Innovation Program of the Chinese Academy of Agricultural Sciences (CAAS-CSLPDCP-2023002).
The authors declare that they have no conflict of interest with the contents of this article.
L.H., C.W., and G.Y. conceived and coordinated the study; G.Y., Z.Z., and L.H. wrote the paper; G.Y., X.L., H.L., W.C., J.L., C.F., Q.Z., Z.Z., D.Z., S.Z., H.C., and Z.B., performed and analyzed the experiments. L.H., C.W., G.Y., and X.L. designed, modified, and corrected the article.
Contributor Information
Li Huang, Email: huangli02@caas.cn.
Changjiang Weng, Email: wengchangjiang@caas.cn.
Jae U. Jung, Lerner Research Institute, Cleveland Clinic, Cleveland, Ohio, USA
ETHICS APPROVAL
All experiments involved in ASFV HLJ/18 or ASFV-ΔH240R infection were conducted within the enhanced biosafety level 3 (P3+) in the Harbin Veterinary Research Institute (HVRI) of the Chinese Academy of Agricultural Sciences (CAAS) approved by the Ministry of Agriculture and Rural Affairs. These studies were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China.
SUPPLEMENTAL MATERIAL
The following material is available online at https://doi.org/10.1128/jvi.01834-23.
Figures S1 to S4.
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.
REFERENCES
- 1. Wang Z, Ai Q, Huang S, Ou Y, Gao Y, Tong T, Fan H. 2022. Immune escape mechanism and vaccine research progress of African swine fever virus. Vaccines (Basel) 10:44. doi: 10.3390/vaccines10030344 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Wang T, Sun Y, Huang S, Qiu HJ. 2020. Multifaceted immune responses to African swine fever virus: implications for vaccine development. Vet Microbiol 249:108832. doi: 10.1016/j.vetmic.2020.108832 [DOI] [PubMed] [Google Scholar]
- 3. Franzoni G, Graham SP, Giudici SD, Bonelli P, Pilo G, Anfossi AG, Pittau M, Nicolussi PS, Laddomada A, Oggiano A. 2017. Characterization of the interaction of African swine fever virus with monocytes and derived macrophage subsets. Vet Microbiol 198:88–98. doi: 10.1016/j.vetmic.2016.12.010 [DOI] [PubMed] [Google Scholar]
- 4. Gil S, Sepúlveda N, Albina E, Leitão A, Martins C. 2008. The low-virulent African swine fever virus (ASFV/NH/P68) induces enhanced expression and production of relevant regulatory cytokines (IFNalpha, TNFalpha and IL12p40) on porcine macrophages in comparison to the highly virulent ASFV/L60. Arch Virol 153:1845–1854. doi: 10.1007/s00705-008-0196-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Huang L, Xu W, Liu H, Xue M, Liu X, Zhang K, Hu L, Li J, Liu X, Xiang Z, Zheng J, Li C, Chen W, Bu Z, Xiong T, Weng C. 2021. African swine fever virus pI215L negatively regulates cGAS-STING signaling pathway through recruiting RNF138 to inhibit K63-linked ubiquitination of TBK1. J Immunol 207:2754–2769. doi: 10.4049/jimmunol.2100320 [DOI] [PubMed] [Google Scholar]
- 6. Li J, Song J, Kang L, Huang L, Zhou S, Hu L, Zheng J, Li C, Zhang X, He X, Zhao D, Bu Z, Weng C, Dixon LK. 2021. pMGF505-7R determines pathogenicity of African swine fever virus infection by inhibiting IL-1β and type I IFN production. PLoS Pathog 17:e1009733. doi: 10.1371/journal.ppat.1009733 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Zhang K, Yang B, Shen C, Zhang T, Hao Y, Zhang D, Liu H, Shi X, Li G, Yang J, Li D, Zhu Z, Tian H, Yang F, Ru Y, Cao WJ, Guo J, He J, Zheng H, Liu X, Gladue DP, Bahn Y-S. 2022. MGF360-9L is a major virulence factor associated with the African swine fever virus by antagonizing the JAK/STAT signaling pathway. mBio 13:e0233021. doi: 10.1128/mbio.02330-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Meyts I, Casanova JL. 2021. Viral infections in humans and mice with genetic deficiencies of the type I IFN response pathway. Eur J Immunol 51:1039–1061. doi: 10.1002/eji.202048793 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Duncan CJA, Randall RE, Hambleton S. 2021. Genetic lesions of type I interferon signalling in human antiviral immunity. Trends Genet 37:46–58. doi: 10.1016/j.tig.2020.08.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Wang W, Xu L, Su J, Peppelenbosch MP, Pan Q. 2017. Transcriptional regulation of antiviral interferon-stimulated genes. Trends Microbiol 25:573–584. doi: 10.1016/j.tim.2017.01.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Mazewski C, Perez RE, Fish EN, Platanias LC. 2020. Type I interferon (IFN)-regulated activation of canonical and non-canonical signaling pathways. Front Immunol 11:606456. doi: 10.3389/fimmu.2020.606456 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Johnston SC, Lin KL, Connor JH, Ruthel G, Goff A, Hensley LE. 2012. In vitro inhibition of monkeypox virus production and spread by interferon-β. Virol J 9:5. doi: 10.1186/1743-422X-9-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Haller O, Gao S, von der Malsburg A, Daumke O, Kochs G. 2010. Dynamin-like MxA GTPase: structural insights into oligomerization and implications for antiviral activity. J Biol Chem 285:28419–28424. doi: 10.1074/jbc.R110.145839 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Wang YX, Niklasch M, Liu T, Wang Y, Shi B, Yuan W, Baumert TF, Yuan Z, Tong S, Nassal M, Wen YM. 2020. Interferon-inducible MX2 is a host restriction factor of hepatitis B virus replication. J Hepatol 72:865–876. doi: 10.1016/j.jhep.2019.12.009 [DOI] [PubMed] [Google Scholar]
- 15. Golding JP, Goatley L, Goodbourn S, Dixon LK, Taylor G, Netherton CL. 2016. Sensitivity of African swine fever virus to type I interferon is linked to genes within multigene families 360 and 505. Virology 493:154–161. doi: 10.1016/j.virol.2016.03.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Li D, Zhang J, Yang W, Li P, Ru Y, Kang W, Li L, Ran Y, Zheng H. 2021. African swine fever virus protein MGF-505-7R promotes virulence and pathogenesis by inhibiting JAK1- and JAK2-mediated signaling. J Biol Chem 297:101190. doi: 10.1016/j.jbc.2021.101190 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Huang L, Chen W, Liu H, Xue M, Dong S, Liu X, Feng C, Cao S, Ye G, Zhou Q, Zhang Z, Zheng J, Li J, Zhao D, Wang Z, Sun E, Chen H, Zhang S, Wang X, Zhang X, He X, Guan Y, Bu Z, Weng C. 2023. African swine fever virus HLJ/18 CD2v suppresses type I IFN production and IFN-stimulated genes expression through negatively regulating cGMP-AMP synthase-STING and IFN signaling pathways. J Immunol 210:1338–1350. doi: 10.4049/jimmunol.2200813 [DOI] [PubMed] [Google Scholar]
- 18. Zhou P, Li LF, Zhang K, Wang B, Tang L, Li M, Wang T, Sun Y, Li S, Qiu HJ. 2022. Deletion of the H240R gene of African swine fever virus decreases infectious progeny virus production due to aberrant virion morphogenesis and enhances inflammatory cytokine expression in porcine macrophages. J Virol 96:e0166721. doi: 10.1128/JVI.01667-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Ye G, Liu H, Liu X, Chen W, Li J, Zhao D, Wang G, Feng C, Zhang Z, Zhou Q, Zheng J, Bu Z, Weng C, Huang L. 2023. African swine fever virus H240R protein inhibits the production of type I interferon through disrupting the oligomerization of STING. J Virol 97:e0057723. doi: 10.1128/jvi.00577-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Raftery N, Stevenson NJ. 2017. Advances in anti-viral immune defence: revealing the importance of the IFN JAK/STAT pathway. Cell Mol Life Sci 74:2525–2535. doi: 10.1007/s00018-017-2520-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Zanin N, Viaris de Lesegno C, Podkalicka J, Meyer T, Gonzalez Troncoso P, Bun P, Danglot L, Chmiest D, Urbé S, Piehler J, Blouin CM, Lamaze C. 2023. STAM and Hrs interact sequentially with IFN-α receptor to control spatiotemporal JAK-STAT endosomal activation. Nat Cell Biol 25:425–438. doi: 10.1038/s41556-022-01085-6 [DOI] [PubMed] [Google Scholar]
- 22. Ye G, Liu H, Zhou Q, Liu X, Huang L, Weng C. 2022. A tug of war: pseudorabies virus and host antiviral innate immunity. Viruses 14:547. doi: 10.3390/v14030547 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Zheng X, Nie S, Feng WH. 2022. Regulation of antiviral immune response by African swine fever virus (ASFV). Virol Sin 37:157–167. doi: 10.1016/j.virs.2022.03.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Riera E, Pérez-Núñez D, García-Belmonte R, Miorin L, García-Sastre A, Revilla Y. 2021. African swine fever virus induces STAT1 and STAT2 degradation to counteract IFN-I signaling. Front Microbiol 12:722952. doi: 10.3389/fmicb.2021.722952 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Yuan H, You J, You H, Zheng C. 2018. Herpes simplex virus 1 Ul36USP antagonizes type I interferon-mediated antiviral innate immunity. J Virol 92:e01161-18. doi: 10.1128/JVI.01161-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Yokota S, Saito H, Kubota T, Yokosawa N, Amano K, Fujii N. 2003. Measles virus suppresses interferon-alpha signaling pathway: suppression of JAK1 phosphorylation and association of viral accessory proteins, C and V, with interferon-alpha receptor complex. Virology 306:135–146. doi: 10.1016/s0042-6822(02)00026-0 [DOI] [PubMed] [Google Scholar]
- 27. Huang L, Liu H, Ye G, Liu X, Chen W, Wang Z, Zhao D, Zhang Z, Feng C, Hu L, Yu H, Zhou S, Zhang X, He X, Zheng J, Bu Z, Li J, Weng C, Jung JU. 2023. Deletion of African swine fever virus (ASFV) H240R gene attenuates the virulence of ASFV by enhancing NLRP3-mediated inflammatory responses. J Virol 97:e0122722. doi: 10.1128/jvi.01227-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Li J, Song J, Zhou S, Li S, Liu J, Li T, Zhang Z, Zhang X, He X, Chen W, Zheng J, Zhao D, Bu Z, Huang L, Weng C. 2023. Development of a new effective African swine fever virus vaccine candidate by deletion of the H240R and MGF505-7R genes results in protective immunity against the Eurasia strain. J Virol 97:e0070423. doi: 10.1128/jvi.00704-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Zhao D, Liu R, Zhang X, Li F, Wang J, Zhang J, Liu X, Wang L, Zhang J, Wu X, Guan Y, Chen W, Wang X, He X, Bu Z. 2019. Replication and virulence in pigs of the first African swine fever virus isolated in China. Emerg Microbes Infect 8:438–447. doi: 10.1080/22221751.2019.1590128 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figures S1 to S4.