RBM14 inhibits the replication of porcine epidemic diarrhea virus by recruiting p62 to degrade nucleocapsid protein through the activation of autophagy and interferon pathway

ABSTRACT

Porcine epidemic diarrhea virus (PEDV) results in PED, which is an infectious intestinal disease with the representative features of diarrhea, vomiting, and dehydration. PEDV infects neonatal piglets, causing high mortality rates. Therefore, elucidating the interaction between the virus and host in preventing and controlling PEDV infection is of immense significance. We found a new antiviral function of the host protein, RNA-binding motif protein 14 (RBM14), which can inhibit PEDV replication via the activation of autophagy and interferon (IFN) signal pathways. We found that RBM14 can recruit cargo receptor p62 to degrade PEDV nucleocapsid (N) protein through the RBM14-p62-autophagosome pathway. Furthermore, RBM14 can also improve the antiviral ability of the hosts through interacting with mitochondrial antiviral signaling protein to induce IFN expression. These results highlight the novel mechanism underlying RBM14-induced viral restriction. This mechanism leads to the degradation of viral N protein via the autophagy pathway and upregulates IFN for inhibiting PEDV replication; thus, offering new ways for preventing and controlling PED.

IMPORTANCE

Porcine epidemic diarrhea virus (PEDV) is a vital reason for diarrhea in neonatal piglets, which causes high morbidity and mortality rates. There is currently no effective vaccine or drug to treat and prevent infection with the PEDV. During virus infection, the host inhibits virus replication through various antiviral factors, and at the same time, the virus antagonizes the host’s antiviral reaction through its own encoded protein, thus completing the process of virus replication. Our study has revealed that the expression of RNA-binding motif protein 14 (RBM14) was downregulated in PEDV infection. We found that RBM14 can recruit cargo receptor p62 to degrade PEDV N protein via the RBM14-p62-autophagosome pathway and interacted with mitochondrial antiviral signaling protein and TRAF3 to activate the interferon signal pathway, resulting in the inhibition of PEDV replication.

INTRODUCTION

Porcine epidemic diarrhea (PED) occurs owing to the PED virus (PEDV) of the genus Coronavirus A of the family Coronaviridae. PED refers to an infectious enteric disease with the usual features of diarrhea, vomiting, and dehydration, which causes infection and high mortality in neonatal piglets (1). Originally, PEDV was discovered in the 1970s in the United Kingdom (2) and Belgium. Presently, it is endemic globally (1). PEDV undergoes a mutation that produces strains with increased virulence, pathogenicity, and infectivity. Long-term transmission of mutant strains generates significant financial losses in the swine industry (3). PEDV is a positive-sense single-stranded RNA virus with around 28 kb genome. Its genome consists of one 5′-end cap, one 5′-untranslated region (UTR), seven open reading frames (ORFs), one 3′-UTR, and one 3′-end polyadenylated (polyA) tail in succession (4). Furthermore, over seven ORFs are present in its genome that encode 4 structural proteins and 16 non-structural proteins (nsp1–nsp16), which can be classified as spike (S), envelope (E), membrane (M), nucleocapsid (N), as well as accessory (ORF3) type (5). Among them, the N protein has a high conservation degree and exerts a critical effect on viral transcription and replication. Furthermore, a complex can be formed by the viral RNA genome and N protein, which forms the core of PEDV (6–8).

Autophagy is a conservative intracellular degradation that is important for eliminating aggregated or misfolded proteins, intracellular pathogens, and impaired organelles (9). While targeting pathogens, autophagy can inhibit viral replication via a selective mechanism of viral protein degradation (10–12). Viral proteins are under the ubiquitination of E3 ubiquitination ligases, subsequent recognition via cargo receptors, and degradation in autophagosome; thus, inhibiting viral replication by autophagy process (13). Autophagy is the cell pathway with a high evolutionary conservation degree, which can cause selective substrate degradation in lysosomes. During viral infection, autophagy exerts a dual role in accordance with viral replication cycle stage and virus type, and it functions as either pro-viral or antiviral (14). Consequently, it is of great importance to balance the pro-viral and antiviral effects of autophagy on viral infection.

RNA-binding motif protein 14 (RBM14) was first discovered in 2001 (15). It is responsible for encoding one ribonucleoprotein functioning as the general nuclear co-activator and regulator of RNA splicing. It includes two RNA recognition motifs at its N-terminal, along with several hexapeptide repeat domains at its C-terminal, which interact with thyroid hormone receptor binding protein and plays a crucial role in transcriptional activation (15, 16). RBM14 is typical of nuclear (17) material that is recognized to be a part of nuclear paraplasmids (18). It can interact with restricted human viruses, which include human immunodeficiency virus type 1 (HIV-1) (19, 20) and Epstein-Barr virus (EBV) (21). The present work investigated the antiviral activity of RBM14 that triggered the cargo receptor p62-autophagy degradation pathway and interferon (IFN)-induced antiviral immunity to inhibit PEDV replication.

RESULTS

PEDV infection downregulates RBM14 expression

The co-immunoprecipitation (co-IP) and peptide sequencing by mass spectrometry were used to screen the potential proteins to inhibit PEDV replication. We found that PEDV N protein efficiently co-immunoprecipitated with RBM14. For analyzing RBM14 expression in PEDV infection, PEDV at a multiplicity of infection (MOI) of 0.1 was supplemented to the infection of LLC-PK1 cells. At 24 h and 28 h after virus infection, we harvested cells. Reverse transcription quantitative PCR (qRT-PCR) and western blotting results indicated that RBM14 RNA and protein levels decrease in PEDV infection (Fig. 1A and B). With the purpose of confirming the results of qRT-PCR, PEDV at different MOI was used to infect LLC-PK1 cells; therefore, protein and RNA levels of RBM14 gradually decreased accompanied by the increase of virus (Fig. 1C and D). Therefore, RBM14 expression decreased in PEDV infection.

Fig 1.

RBM14 downregulation following PEDV infection. (A and B) Analysis of RBM14 mRNA and protein expression in PEDV-infected LLC-PK1 cells (MOI = 0.1) at 24 h and 28 h using qRT-PCR and western blotting. (C and D) LLC-PK1 cells subject to infection with PEDV at varying MOIs were harvested at 28-h post-infection. RBM14 mRNA and protein levels were explored through qRT-PCR and western blotting. The obtained data indicate the mean ± standard deviation from three independent experiments. *P < 0.05, **P < 0.01, and ***P < 0.001 (two-tailed Student’s t-test).

The RBM14 expression inhibits PEDV infection

To ascertain whether RBM14 modulated PEDV replication, an RBM14 plasmid was transfected into LLC-PK1 cells for a whole day, followed by PEDV infection at an MOI of 0.1. At 24-h and 28-h post-viral infection, cells and supernatant were collected, and the accumulated PEDV N expression was assessed via qRT-PCR and western blot analysis. The findings showed a substantial reduction in PEDV N mRNA and protein expression after PEDV infection when compared with the control group (Fig. 2A and B). Furthermore, the level of PEDV N lowered with an elevation in the transfection amount of Flag-RBM14 plasmid (Fig. 2C and D), implying that RBM14 could suppress PEDV replication within LLC-PK1 cells. To validate RBM14’s inhibitory effect on PEDV replication, an interfering RNA targeting RBM14 was designed and transfected into LLC-PK1 cells. According to western blotting and qRT-PCR results, there existed an increase in PEDV replication when RBM14 was silenced in the cells (Fig. 2E and F). In summary, these findings establish that RBM14 inhibits PEDV replication.

Fig 2.

RBM14 suppression of PEDV Infection. (A and B) LLC-PK1 cells were transfected with RBM14 plasmid and then infected with PEDV (MOI = 0.1) 24-h post-transfection. PEDV N mRNA and protein levels were evaluated using qRT-PCR and western blotting. (C and D) Gradient transfection of RBM14 plasmid into LLC-PK1 cells. PEDV N mRNA and protein levels were evaluated using qRT-PCR and western blotting. (E and F) LLC-PK1 cells were exposed to transfection with RBM14-siRNA and then infected with PEDV (MOI = 0.1). Cells and supernatants were investigated by adopting qRT-PCR and western blotting. Results are suggested to be means ± standard deviation from three independent experiments. *P < 0.05, **P < 0.01, and ***P < 0.001 (two-tailed Student’s t-test).

RBM14 induces PEDV N protein degradation by means of autophagy

With the aim of exploring the mechanism through which RBM14 inhibits PEDV replication, we initially conducted an immunoprecipitation assay, which revealed that RBM14 interacted with the PEDV N protein independently of RNase (Fig. 3A). A GST affinity separation assay demonstrated a direct correlation between RBM14 and PEDV N (Fig. 3B). As a ribonucleoprotein, RBM14 serves as an RNA splicing regulator and a general nuclear co-activator. To study the interaction of RBM14 with PEDV N within cells, we performed a confocal immunofluorescence assay. Our results indicated that RBM14 was solely localized in the nucleus in the absence of PEDV N protein expression, but it translocated from the nucleus to the cytoplasm to interact with the N protein in the presence of PEDV N protein (Fig. 3C). This implies that RBM14 makes interactions with PEDV N. To investigate whether RBM14 inhibits PEDV replication by interacting with and regulating the expression of PEDV N, RBM14 and N encoding plasmids were co-transfected into human embryonic kidney cells (HEK 293T cells). Based on the result, RBM14 degraded PEDV N protein within HEK 293T cells, and the extent of degradation was determined by the concentration of RBM14 protein (Fig. 3D). To examine the degradation mechanism responsible for N degradation by RBM14, we employed MG132 (a protease inhibitor) and autophagy inhibitors, 3-methyladenine (3-MA), bafilomycin A1 (Baf A1), and chloroquine (CQ). According to Fig. 3E, PEDV N protein degradation by RBM14 was obviously inhibited in the presence of autophagy inhibitors, but not by the protease inhibitor MG132, indicating that RBM14 degrades PEDV N protein based on the autophagy process. Based on the above-mentioned findings, RBM14 targets and degrades PEDV N protein via autophagy.

Fig 3.

RBM14 induces PEDV N protein degradation through autophagy. (A) HEK 293T cells were subject to transfection with HA-N and Flag-RBM14 plasmids. Co-IP assay was carried out with the use of anti-Flag beads, and western blotting was performed to analyze the precipitated proteins. (B) Separate insertion of pCold TF and pCold GST plasmids into RBM14 and PEDV N, followed by transformation into BL21 (DE3) bacterial strain for a GST affinity-isolation assay. (C) HeLa cells were co-transformed with HA-N and Flag-RBM14 plasmids and labeled with corresponding antibodies. DAPI (4′,6-diamidino-2-phenylindole) was used for nuclear staining, and fluorescence signals were observed under a confocal immunofluorescence microscope (scale bars = 100 µm). (D) HEK 293T cells were co-transfected with Flag-RBM14 and HA-N plasmids at varying concentrations. We performed western blotting to analyze cellular lysates. (E) HEK 293T cells were co-transfected with Flag-RBM14 and HA-N plasmids and treated with MG132, CQ, Baf A1, and 3-MA. To analyze cellular lysates, western blotting was used.

RBM14 inhibits PEDV replication via cargo receptor p62

Autophagy exerts a crucial role in targeting viruses and initiating host immunity, making it important for antiviral defense. During the autophagy process, cargo receptors including SQSTM1/p62 and NDP52 are essential for selective autophagy, as they target specific pathogens or substrate proteins for degradation within autophagosomes (22). To study which cargo receptor is involved in PEDV N protein degradation by RBM14 through autophagy, plasmids encoding the cargo receptor and Flag-RBM14 were subject to co-transfection into HEK 293T cells. Co-immunoprecipitation experiments revealed that the cargo receptor p62 co-immunoprecipitated with RBM14 protein (Fig. 4A), and the direct correlation between RBM14 and p62 was confirmed by GST affinity separation assays (Fig. 4B). The nuclear-to-cytoplasmic translocation of RBM14 was observed, and it colocalized with p62 (Fig. 4C), indicating that RBM14 interacts with p62. To investigate PEDV N protein degradation by RBM14 through p62 (a cargo receptor), LLC-PK1 cells were co-transfected with Flag-RBM14 plasmids and p62 siRNA, followed by PEDV infection at an MOI of 0.1. Western blotting and qRT-PCR analysis showed that interfering with p62 inhibited RBM14-induced PEDV N protein degradation and virus replication inhibition (Fig. 4D and E). These studies suggest that RBM14 impedes PEDV replication through the RBM14-p62-autophagy pathway.

Fig 4.

RBM14 inhibits PEDV replication via cargo receptor p62. (A) HEK 293T cells were exposed to transfection with Flag-RBM14 and HA-p62 plasmids, and Co-IP was carried out with anti-Flag beads at 24-h post-transfection. In addition, western blotting was conducted to analyze precipitated proteins with RBM14. (B) GST affinity-isolation assay was carried out to assess GST-RBM14 and p62. (C) HeLa cells were co-transfected with Flag-RBM14 and HA-p62 plasmids and labeled with antibodies before observation under the confocal immunofluorescence microscope. Scale bars: 100 µm. (D and E) LLC-PK1 cells were co-transfected with Flag-RBM14 plasmids and p62 siRNA, followed by PEDV infection (MOI = 0.1). PEDV N mRNA and protein levels were evaluated using qRT-PCR and western blotting.

RBM14 upregulates IFN through interacting with MAVS and TRAF3

The innate immune system plays the role of the primary defense against viral infections. IFN, a pivotal component of the host’s antiviral immune response, exerts a crucial function in regulating immune cell subsets, enhancing antiviral immunity, and safeguarding the host against viral harm (23). To investigate whether RBM14 suppresses PEDV replication by activating the IFN signaling pathway, we conducted assays involving the IFN-β promoter and the IFN stimulated response element (ISRE)-driven luciferase reporter gene. Based on Fig. 5A and B, overexpression of RBM14 elevated luciferase activity in a manner dependent on RBM14 protein expression. The level of IFN mRNA also exhibited a gradient increase with rising RBM14 expression, which concurred with the luciferase reporter findings (Fig. 5C). To elucidate the mechanism through which RBM14 stimulates IFN expression, we co-transfected the RBM14 expression plasmid with plasmids encoding key signaling proteins associated with the innate antiviral response into HEK 293T cells. Consequently, RBM14 elevated the luciferase reporter activity induced by mitochondrial antiviral signaling protein (MAVS) and TRAF3 (Fig. 5D), implying that RBM14 might activate the IFN pathway by modulating the upstream regulators MAVS and TRAF3. Furthermore, co-immunoprecipitation and confocal immunofluorescence assays suggested that RBM14 interacted and co-localized with MAVS and TRAF3 within the cytoplasm (Fig. 5E through G). Upon overexpressing RBM14 in HEK 293T cells, RBM14 significantly upregulated the levels of MAVS, TRAF3, IRF7, and phosphorylated IRF7 proteins in a dose-dependent manner (Fig. 5H). Nevertheless, this upregulation by RBM14 was impeded when co-transfected with MAVS siRNA (Fig. 5I). Moreover, RBM14 was co-transfected with siRNA targeting MAVS, TRAF3, or IRF7 in HEK 293T cells to analyze IFN expression. According to the IFN-driven luciferase reporter gene assay, reducing the expression of MAVS, TRAF3, and IRF7 inhibited the expression of IFN-β activated by RBM14, indicating that MAVS, TRAF3, and IRF7 are essential components in RBM14-induced IFN expression (Fig. 5J). In conclusion, RBM14 interacts with MAVS and TRAF3 proteins and activates the IFN signaling pathway through phosphorylated IRF7 in order to prevent PEDV infection.

Fig 5.

RBM14 upregulates IFN through interaction with MAVS and TRAF3. (A and B) IFN-β or ISRE luciferase reporter was co-transfected with Flag-RBM14 at increasing concentrations (wedge) into HEK 293T cells, and dual luciferase activities were measured. (C) Flag-RBM14 was subject to transfection into HEK 293T cells, and cells were gathered at 24-h post-transfection. IFN mRNA expression was measured by qRT-PCR. (D) RBM14 or IFN-β luciferase reporter was co-transfected with plasmids encoding MYD88, IRF3, MAD5, RIGI, MAVS, TRAF3, TRAF6, TBK1, or IKK in HEK 293T cells to identify dual luciferase activities. (E) Flag-RBM14 and MYC-MAVS or MYC-TRAF3 plasmids were co-transfected into HeLa cells and labeled with specific antibodies. Fluorescent signals were found under a confocal immunofluorescence microscope (scale bars = 100 µm). (F and G) Flag-RBM14 was co-transfected with plasmids encoding Myc-MAVS or Myc-TRAF3 into HEK 293T cells in a Co-IP assay. Western blotting was carried out to detect precipitated proteins. (H and I) Increasing amounts of RBM14 plasmids and MAVS siRNA were co-transfected into HEK 293T cells, and protein expression was analyzed through western blot. (J) Flag-RBM14, MAVS siRNA, TRAF3 siRNA, or IRF7 siRNA were subject to co-transfection into HEK 293T cells in a dual luciferase assay.

DISCUSSION

Within the global swine industry, PEDV represents a significant threat due to substantial economic losses (1). Existing vaccines offer incomplete protection against PEDV infection, primarily because of ongoing genomic mutations in PEDV (24) and their limited ability to induce mucosal immunity. Therefore, this study focused on identifying new host factors that could counteract PEDV infection. Our results indicate that the host factor RBM14 suppresses PEDV replication via the degradation of the viral N protein via the autophagy pathway. Additionally, RBM14 interacts with MAVS and TRAF3 to enhance the phosphorylation of IRF7 and induce IFN expression, further countering PEDV infection (Fig. 6).

Fig 6.

RBM14 suppresses PEDV replication through activation of autophagy and IFN pathways. The host antiviral protein RBM14 activates autophagy to inhibit PEDV replication by recruiting the cargo receptor p62 for translocating viral N protein into the autophagosome for autophagy degradation. Additionally, RBM14 promotes IFN expression which interacts with MAVS and TRAF3 to stimulate host antiviral defense responses against PEDV infection.

RBM14 plays a role in regulating host gene splicing and transcription, particularly in response to steroid hormone signaling (16). It is also involved in modulating DNA repair by interacting with non-homologous end-joining proteins (25). RBM14 has been implicated in the replication and gene expression mechanisms of various viruses, including HIV-1 (19, 20, 26, 27), EBV (21), and influenza A virus (28). In our observations, RBM14 was downregulated during PEDV infection, and its inhibitory effect on PEDV replication was evident.

Autophagy serves as a vital mechanism in host defense and constitutes a central molecular pathway for preserving cellular and organismal equilibrium (29). This process involves the transport of invading microorganisms to restrictive lysosomes, where they undergo lysosomal degradation. Our prior investigation revealed that PEDV infection substantially triggers the transition of LC3-I to LC3-II, indicating a marked upregulation of autophagy (22). Throughout the autophagy process, cargo receptors play a pivotal role in recognizing specific substrate proteins and delivering them to the autophagosome. Among these receptors, p62 stands out as a versatile junction protein associated with various biological processes, including cell signaling, differentiation, and especially the clearance of toxic protein aggregates (30). Notably, p62 directly binds to LC3 through the LIR motif of the latter and acts as a selective autophagy receptor, responsible for transporting ubiquitinated protein aggregates into the autophagosome, where they undergo degradation (31, 32). Our current investigation indicates that RBM14 inhibits PEDV replication by enlisting p62 to recognize and transport PEDV N protein to the autophagosome via the autophagy pathway.

Innate immunity exerts a critical role as the host’s primary defense against pathogen intrusion. Upon viral infection, host cells identify conserved pathogen structures through multiple pattern recognition receptors (33–36), which form homo-oligomers while recruiting MAVS when RIGI-MDA5 (37) is activated. These proteins are also responsible for activating TBK1/IB kinase (IKK) through TRAFs and phosphorylating IRF3/IRF7, ultimately resulting in increased expression of type I IFN (38). Based on our findings, RBM14 interacts with MAVS to upregulate MAVS, TRAF3, and IRF7, consequently enhancing the phosphorylation of IRF7 and inducing the IFN pathway.

In summary, RBM14 can degrade the viral N protein and trigger the IFN pathway to hinder PEDV replication. Upon viral infection, RBM14 recruits the autophagy receptor protein p62 to determine and transport the viral N protein to the autophagosome for degradation via autophagy. Furthermore, in response to host innate immunity, RBM14 can activate the IFN pathway by interacting with MAVS proteins, effectively countering PEDV infection.

MATERIALS AND METHODS

Antibodies and reagents

Antibodies against RBM14 (10196-1-AP), ACTB/β-actin (66009-1-lg), GST-tag (10,000-0-AP), TRAF3 (66310-1-lg), TRAF6 (66498-1-lg), RIGI (67556-1-lg), in addition to horseradish peroxidase (HRP)-conjugated anti-mouse (SA00001-1) and anti-rabbit (SA00001-2) IgG antibodies, were provided by Proteintech Group. Moreover, anti-HA-tag antibody (3724) and bafilomycin A1 (Baf A1; 54645) were provided by Cell Signaling Technology. The preparation of siRNA was handled by GenePharma (Table 1). Sigma-Aldrich supplied 3-methyladenine (3-MA; M9281), chloroquine phosphate (CQ; PHR1258), and the antibody against Flag-tag (F1804), as well as MG132 (M7449). Beyotime Biotechnology provided 4′,6-diamidino-2-phenylindole (DAPI; C1002). Biotech Co., Ltd supplied the Dual-Glo Luciferase Assay System (DL101) and ClonExpress II One Step Cloning Kit (C112-02). In the provided laboratory, the monoclonal antibody against the PEDV (JS-2013) N protein was synthesized and stored (39).

TABLE 1.

Sequences of primers and siRNAs applied in this study

Purpose	Names	Sequences (5′−3′)
Real-time PCR primers	PEDV N forward	GAGGGTGTTTTCTGGGTTG
	PEDV N reverse	CGTGAAGTAGGAGGTGTGTTAG
	RBM14 forward	CCAGGCGGCTTCTTACAATG
	RBM14 reverse	CCACATAGGCAGCAGGTTGA
	ACTB forward	TCCCTGGAGAAGAGCTACGA
	ACTB reverse	AGCACTGTGTTGGCGTACAG
siRNA sequences	si-RBM14 sense	GCCUCUUAUAAUGCCCAGUTT
	si-RBM14 antisense	ACUGGGCAUUAUAAGAGGCTT
	si-MAVS sense	CAGAGGAGAAUGAGUAUAATT
	si-MAVS antisense	UUAUACUCAUUCUCCUCUGTT
	si-TRAF3 sense	GGCCGUUUAAGCAGAAAGUTT
	si-TRAF3 antisense	ACUUUCUGCUUAAACGGCCTT
	NC sense	UUCUCCGAACGUGUCACGUTT
	NC antisense	ACGUGACACGUUCGGAGAATT

Cell culture and transfection

HEK 293T cells (CRL-11268, ATCC) were cultivated in Dulbecco's modified eagle medium (DMEM) (Sigma-Aldrich, D6429) which had a 10% concentration of fetal bovine serum (Gibco, 10099141). LLC-PK1 cells were provided by Dr. Rui Luo who came from Huazhong Agricultural University and cultivated in MEM (Invitrogen, 11095080). Under the condition of 37°C with 5% CO₂, cells were seeded within six-well plates and preserved. Transfection of plasmids into cells at 80%–90% confluence was carried out with the application of Lipofectamine 3000 (Invitrogen, L3000015). Lipofectamine RNAiMAX (Invitrogen, 13778150) was adopted for transfecting siRNA into cells with 50%–60% confluence. RT-qPCR was used to determine the efficiency of siRNA interference.

PEDV infection

Kept in the provided laboratory, the PEDV variant strain JS-2013 (MH910099) was isolated (40). LLC-PK1 cells were cultivated to 90% confluence within culture plates, rinsed with phosphate-buffered saline (PBS) (Gibco, C20012500BT), and later subjected to the infection with PEDV at MOI 1 or 0.01, followed by treatment with trypsin (4 µg/mL, Invitrogen, 15050065). After washing with PBS, cells were gathered for analyzing viral replication based on qRT-PCR and western blotting.

qRT-PCR

Following the provided guidance, the extraction of total RNA was performed in accordance with the RNeasy Mini Kit (Qiagen, 74104) or QIAamp Viral RNA Mini Kit (Qiagen, 52906). cDNA synthesis was carried out with the PrimeScript RT reagent Kit (Takara, RRO47A), and qRT-PCR was conducted through SYBR Premix Ex Taq (Vazyme Biotech Co., Ltd, q711-03) with β-actin as the reference gene. Table 1 shows primer sequences for qRT-PCR.

Western blotting

Cell lysis was performed on ice using RIPA Lysis and Extraction Buffer (Thermo Fisher Scientific, 89901) including protease/phosphatase inhibitor cocktail (Bimake, B14001, B15001). The denaturation of cell lysates was carried out in an SDS-PAGE sample loading buffer for 10 min. Subsequently, SDS-PAGE electrophoresis was carried out to separate proteins, which were transferred onto nitrocellulose membranes (GE Healthcare, 10600001). We blocked the membranes with 5% non-fat milk (BD, 232100) in 0.2% Tween 20 (Sigma-Aldrich, P1379). Primary antibodies and HRP-conjugated secondary antibodies were used to perform protein incubation. Using enhanced chemiluminescence (Share-bio, SB-WB012), the detection of protein bands was performed.

Co-immunoprecipitation assay

At 24-h post-transfection with plasmids, cells were lysed with NP40 cell lysis buffer (Life Technologies, FNN0021) including the protease inhibitor cocktail. Then, the lysates were harvested, centrifuged, and subjected to incubation with Dynabeads Protein G coupled with anti-Flag antibody (Life Technologies, 10004D). The mixture was rinsed with 0.02% PBST and eluted in 50 mM glycine elution buffer (pH 2.8). In addition, through immunoblotting with specific antibodies, proteins were examined.

GST affinity-isolation assay

The full-length p62, RBM14, and PEDV N sequences were inserted into pCold TF (3365) and pCold GST (3372) plasmids (Clontech Laboratories, Inc). The expressions of these genes were found in BL21 competent cells (Vazyme Biotech, C504-03). In addition, GST Protein Interaction Pull-Down Kits (Thermo, 21516) were adopted for evaluating protein interactions.

Confocal immunofluorescence assay

Based on transfection, cells were fixed in 4% paraformaldehyde (Sigma-Aldrich, P6148) and subject to permeabilization with 0.1% Triton X-100 (Sigma-Aldrich, T9284). Then, cells were blocked with 5% bovine serum albumin (Cell Signaling Technology, 9998) before incubation with primary antibodies. After three rinses with PBS, cells were exposed to incubation with fluorescently labeled secondary antibodies in the dark for 1 h (22). DAPI was added for nuclear staining. Meanwhile, fluorescence images were obtained through a laser-scanning confocal immunofluorescence microscope (Carl Zeiss, Oberkochen, Germany).

Luciferase reporter assay

HEK 293T cells in 24-well plates were transfected with plasmids encoding the target. After 24 h, we gathered the cells. The measurement of luciferase activities was made through the application of the Dual-Glo Luciferase Assay System (Vazyme Biotech Co., Ltd, DL101), with Renilla luciferase being a control.

Statistical analysis

Statistical analysis was made based on GraphPad Prism 5 software (GraphPad Software, USA) by adopting a two-tailed Student’s t-test. Significance levels were shown to be *P < 0.05, **P < 0.01, and ***P < 0.001, while “ns” indicated non-significance. Data presented are the averages from three independent assays.

DATA AVAILABILITY

All data are contained within the manuscript.