Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2024 Feb 27;98(3):e01897-23. doi: 10.1128/jvi.01897-23

Oncolytic Newcastle disease virus induced degradation of YAP through E3 ubiquitin ligase PRKN to exacerbate ferroptosis in tumor cells

Yifan Sun 1,2, Lanlan Tang 1,2, Xianjin Kan 2, Lei Tan 2, Cuiping Song 2, Xusheng Qiu 2, Ying Liao 2, Venugopal Nair 3, Chan Ding 2,4,, Xiufan Liu 1,4,5,, Yingjie Sun 2,
Editor: Martin Schwemmle6
PMCID: PMC10949840  PMID: 38411946

ABSTRACT

Ferroptosis, a form of programmed cell death characterized by iron-dependent lipid peroxidation, has recently gained considerable attention in the field of cancer therapy. There is significant crosstalk between ferroptosis and several classical signaling pathways, such as the Hippo pathway, which suppresses abnormal growth and is frequently aberrant in tumor tissues. Yes-associated protein 1 (YAP), the core effector molecule of the Hippo pathway, is abnormally expressed and activated in a variety of malignant tumor tissues. We previously proved that the oncolytic Newcastle disease virus (NDV) activated ferroptosis to kill tumor cells. NDV has been used in tumor therapy; however, its oncolytic mechanism is not completely understood. In this study, we demonstrated that NDV exacerbated ferroptosis in tumor cells by inducing ubiquitin-mediated degradation of YAP at Lys90 through E3 ubiquitin ligase parkin (PRKN). Blocking YAP degradation suppressed NDV-induced ferroptosis by suppressing the expression of Zrt/Irt-like protein 14 (ZIP14), a metal ion transporter that regulates iron uptake. These findings demonstrate that NDV exacerbated ferroptosis in tumor cells by inducing YAP degradation. Our study provides new insights into the mechanism of NDV-induced ferroptosis and highlights the critical role that oncolytic viruses play in the treatment of drug-resistant cancers.

IMPORTANCE

The oncolytic Newcastle disease virus (NDV) is being developed for use in cancer treatment; however, its oncolytic mechanism is still not completely understood. The Hippo pathway, which is a tumor suppressor pathway, is frequently dysregulated in tumor tissues due to aberrant yes-associated protein 1 (YAP) activation. In this study, we have demonstrated that NDV degrades YAP to induce ferroptosis and promote virus replication in tumor cells. Notably, NDV was found to induce ubiquitin-mediated degradation of YAP at Lys90 through E3 ubiquitin ligase parkin (PRKN). Our study reveals a new mechanism by which NDV induces ferroptosis and provides new insights into NDV as an oncolytic agent for cancer treatment.

KEYWORDS: Newcastle disease virus, oncolytic viruses, ferroptosis, Hippo pathway

INTRODUCTION

Ferroptosis is a form of nonapoptotic cell death characterized by iron-dependent lipid peroxidation (1). Mass production of reactive oxygen species (ROS) and accumulation of phospholipid peroxides are essential drivers of ferroptosis, and both are closely related to intracellular iron levels (2). Hence, iron homeostasis is critical for cellular function and survival. There are two sources of intracellular iron: transferrin-bound iron (TBI) and non-transferrin-bound iron (NTBI). TBI enters cells via endocytosis mediated by the transferrin receptor (TFRC), while NTBI enters cells through metal transporters, such as divalent metal transporter 1 (DMT1) and Zrt/Irt-like protein 14 (ZIP14) (3, 4). Ferroportin (FPN), the only known mammalian iron-export protein, regulates the release of intracellular iron into the extracellular space (5). Intracellular iron is stored in ferritin, which consists of ferritin heavy chain (FTH1) and ferritin light chain (FTL) subunits. When intracellular iron accumulates through an iron overload and/or ferritinophagy, it can form a labile iron pool (LIP) and react with peroxo compounds to generate highly toxic free radicals via the Fenton reaction (6). Polyunsaturated fatty acids (PUFAs) undergo phospholipid peroxidation in the presence of free radicals, resulting in the formation of phospholipid hydroperoxide (PLOOH). This process ultimately compromises the integrity of the cell membrane, impairs the function of membrane proteins, and leads to cell death (7).

Although several pathways involved in ferroptosis have been elucidated, many of the details of its regulatory mechanisms are unknown due to the complexity of the process. It is known, however, that there is considerable crosstalk between ferroptosis and several classical signaling pathways, such as the p53, Hippo, and mitogen-activated protein kinase (MAPK) pathways (810). Notably, it was recently reported that the Hippo pathway regulates ferroptosis, especially in cancer cells (1113). This signaling pathway plays a critical role in suppressing abnormal growth and is frequently aberrant in tumor tissues. Yes-associated protein 1 (YAP) is the core downstream effector of the Hippo pathway; it is a transcriptional co-activator that shuttles between the nucleus and cytoplasm (14). The Hippo pathway regulates cell growth and death by altering the subcellular localization and transcriptional activity of YAP, and recent reports have documented the involvement of YAP in ferroptosis. In general, the subcellular localization and transcriptional activity of YAP have been shown to regulate the transcription of ferroptosis-related genes (1519). However, there are conflicting reports about YAP-mediated ferroptosis. For example, it has been reported that YAP promotes ferroptosis via the E3 ligase S-phase kinase-associated protein 2 (SKP2) in breast cancer cells (20). By contrast, reduced levels of YAP in lung adenocarcinoma cells were found to increase sensitivity to ferroptosis (19). These contradictory reports hint at the complexity of the YAP-related regulatory mechanism of ferroptosis. Despite these conflicting reports, ferroptosis has been extensively studied in terms of its association with cancer, and the development of ferroptosis-inducing cancer therapies is being actively pursued (2, 14, 21).

Newcastle disease virus (NDV) belongs to the Orthoavulavirus genus (22) and is a highly contagious avian pathogen. It is also a known oncolytic agent, demonstrating a high tumoricidal capacity and low systemic cytotoxicity in both preclinical and clinical studies (2325). Previous studies have shown that NDV can kill tumor cells by inducing apoptosis, necroptosis, autophagy, DNA double-strand-break response, and other processes (2629). In our most recent study, we showed that NDV can activate ferroptosis to kill tumor cells (30). Here, we have demonstrated that NDV degrades YAP to exacerbate ferroptosis in tumor cells. More specifically, NDV induced ubiquitin-mediated degradation of YAP through PRKN, and blocking YAP degradation suppressed NDV-induced ferroptosis.

MATERIALS AND METHODS

Cells and viral strains

HeLa, H1299, A549, HepG2, and DF-1 cells were purchased from the American Type Culture Collection (Manassas, VA, USA). HeLa, HepG2, and DF‐1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM), and H1299 and A549 cells were cultured in RPMI‐1640 medium supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, MA, USA) at 37°C in an atmosphere containing 5% CO2.

NDV strains Herts/33 and La Sota were obtained from the China Institute of Veterinary Drug Control (Beijing, China), and the Mukteswar NDV strain was obtained from Yangzhou University (Yangzhou, China). Unless otherwise stated, the default NDV strain used in this study was Herts/33. The UV-inactivated NDV Herts/33 strain was prepared as previously described (31). Cells were infected with NDV at a multiplicity of infection (MOI) of 1 at 37°C. Following a 1-h absorption period, the unattached virions were removed, and the cells were then washed three times with phosphate-buffered saline (PBS) and cultured in a maintenance medium at 37°C. Viral titers in DF-1 cells were determined using median tissue culture infective dose (TCID50) values, as described previously (32).

Reagents and antibodies

Erastin (S7242), RSL3 (S8155), liproxstatin-1 (Lip-1; S7699), deferoxamine (DFO; S5742), MG-132 (S2619), and bafilomycin A1 (Baf-1; S1413) were purchased from Selleck Chemicals (Houston, TX, USA). Chloroquine (CQ; C6628) was purchased from Sigma-Aldrich (St. Louis, MO, USA). FerroOrange (F374), Liperfluo (L248), and the MDA Assay Kit (S0131M) were purchased from Dojindo Molecular Technologies (Dojindo, Tokyo, Japan). The Iron Assay Kit (ab83366) was purchased from Abcam (Cambridge, UK). BODIPY 581/591 C11 (D3861) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). Finally, 6-carboxy-2′,7′dichlorodihydrofluorescein diacetate (DCFH-DA; S0033), Hoechst 33342 (C1022), the Cell Counting Kit-8 (CCK-8; C0038), and the LDH Cytotoxicity Assay Kit (C0016) were purchased from Beyotime (Shanghai, China).

Antibodies specific for the following molecules were used: β-actin (AC026), DMT1 (A10231), and ZIP14 (A10413) from ABclonal Technology (Wuhan, China); YAP (#14074), phospho-YAP (S127; #13008), HA-tag (#3724), lamin B1 (#12586), TFRC (#13208), and FTH1 (#4393) from Cell Signaling Technology (Beverly, MA, USA); tubulin (ab7291) and Myc-tag (ab9106) from Abcam; Ferroptosis suppressor protein 1 (FSP1) (sc-377120) from Santa Cruz Biotechnology (Dallas, TX, USA); FPN (NBP1-21502) from NOVUS Biologicals (Centennial, CO, USA); Flag-tag (F9291) from Sigma-Aldrich; and NDV NP from our laboratory.

Plasmids

Flag-tagged YAP (Flag-YAP) and HA-tagged YAP (HA-YAP) were constructed by inserting the open reading frame (ORF) of human YAP (NM_001130145.3) into plasmid p3XFLAG-CMV-14 (Sigma-Aldrich) and pCMV-HA (Clonetech), respectively. Flag-tagged point mutants of YAP (K76R, K90R, K97R, K102R, K181R, K204R, K252R, K254R, K280R, K315R, K321R, K342R, K494R, and K497R) were generated by site-directed mutagenesis using Mut Express II Fast Mutagenesis Kit V2 (Vazyme, China). Flag-tagged chicken YAP (Flag-chYAP) was constructed by inserting the ORF of chicken YAP (NM_001396969.1) into plasmid p3XFLAG-CMV-14 (Sigma-Aldrich). Flag-tagged and Myc-tagged PRKN were constructed by inserting the ORF of PRKN (NM_004562.3) into plasmid p3XFLAG-CMV-14 (Sigma-Aldrich) and pCMV-Myc (Clonetech), respectively. HA-tagged ZIP14 was constructed by inserting the ORF of ZIP14 (NM_001128431.4) into plasmid pCMV-HA (Clonetech). pRK5-HA-ubiquitin-WT (#17608), pRK5-HA-ubiquitin-K63 (#17606), and pRK5-HA-ubiquitin-K48 (#17605) were obtained from Addgene.

Cell viability assay

Cell viability was measured using the Cell Counting Kit-8 (CCK-8) as directed by the manufacturer. In brief, HeLa cells were cultured in 96-well plates at a density of 1 × 105 cells/well and in a medium volume of 100 µL. After 24 h of treatment with different combinations of virus and reagents, 10 µL of CCK-8 solution was added to each well, and the cells were incubated at 37°C for 1 h. Absorbance at 450 nm was measured to assess cell viability.

Lactate dehydrogenase release assay

Released lactate dehydrogenase (LDH) was measured using the LDH Cytotoxicity Assay Kit as directed by the manufacturer. In brief, HeLa cells were cultured in 96-well plates at a density of 1 × 105 cells/well and in a medium volume of 100 µL. After 24 h of treatment with different combinations of virus and reagents, the medium was transferred to a new plate and mixed with the kit’s Reaction Mixture. After a 30-min incubation at room temperature, reactions were stopped by adding the kit’s Stop Solution. Absorbance at 490 nm was measured to assess LDH release.

Intracellular ROS and lipid ROS assay

Intracellular ROS and lipid ROS levels were determined by staining with DCFH-DA and BODIPY 581/591 C11, respectively. Cells were washed twice with PBS and then labeled with DCFH-DA (1 µM) or BODIPY 581/591 C11 (1 µM) for 30 min at 37°C, according to the manufacturer’s instructions. The excitation and emission wavelengths of both DCFH-DA and BODIPY 581/591 C11 (oxidized state) are 488 nm and 525 nm, respectively. In addition, FSC-A/SSC-A gating was used for dead cell and debris discrimination; FSC-A/FSC-H gating was used for doublet discrimination. Finally, samples were analyzed using a CytoFLEX Flow Cytometer (Beckman Coulter) to detect green fluorescence. The data were analyzed using FlowJo software (BD Bioscience).

Lipid peroxidation assay

HeLa cells were seeded on glass slides in 12-well cell-culture plates and then infected with NDV. At 18 h post-infection (hpi), the cells were incubated with Liperfluo (1 µM) for 30 min at 37°C and then washed with PBS. The excitation and emission wavelengths of Liperfluo are 488 nm and 525 nm, respectively. Then, the cell nuclei were labeled with Hoechst 33342 (1 μg/mL) for 10 min at 37°C, and then the cells were washed with PBS. Finally, the cells were examined using fluorescence microscopy to detect green fluorescence. The fluorescence intensity of 20 cells was quantified using ImageJ software (NIH, Bethesda, MD, USA).

Intracellular iron detection

Intracellular iron was detected using a FerroOrange probe and an Iron Assay Kit. The HeLa cells that were to be incubated with FerroOrange were first seeded on glass slides in 12-well cell-culture plates and then infected with NDV. At 18 hpi, the cells were incubated with FerroOrange (1 µM) for 30 min at 37°C and then washed with PBS. The excitation and emission wavelengths of FerroOrange are 561 nm and 570–620 nm, respectively. Then, the cell nuclei were labeled with Hoechst 33342 (1 μg/mL) for 10 min at 37°C, and then the cells were washed with PBS. Finally, the cells were examined using fluorescence microscopy to detect orange fluorescence. The fluorescence intensity of 20 cells was quantified using ImageJ software. The Iron Assay Kit was used in accordance with the manufacturer’s instructions. The absorbance of the samples was measured at 593 nm using a microplate reader (BioTech, Sunnyvale, CA, USA).

Malondialdehyde assay

A malondialdehyde (MDA) assay kit was used to detect MDA. Thiobarbituric acid from the kit was added to supernatants obtained from cell homogenates. Thiobarbituric acid–MDA complexes were detected spectrophotometrically at 535 nm.

RNA interference

The small interfering RNA (siRNA) oligonucleotides were purchased from GenePharma (Shanghai, China). Cells were transfected with the indicated siRNA or control siRNA as described previously (28). At 6 h post-transfection (hpt), the medium containing the transfection reagents was replaced by a fresh medium. The siRNA sequences are shown in Table 1. At 48 hpt, the knockdown efficiency was validated by quantitative real-time polymerase chain reaction (RT-qPCR) or western blot.

TABLE 1.

SiRNA sequences

siRNA Sense sequence (5´–3´) Antisense sequence (5´–3´)
siYAP#1 GCAUCUUCGACAGUCUUCUTT AGAAGACUGUCGAAGAUGCTT
siYAP#2 GGUCAGAGAUACUUCUUAATT UUAAGAAGUAUCUCUGACCTT
siYAP#3 GGUAGCGCUUUGUAUGCAUTT AUGCAUACAAAGCGCUACCTT
siTrcp GUGGAAUUUGUGGAACAUCTT GAUGUUCCACAAAUUCCACUU
siSTUB1 GGCAAUCGUCUGUUCGUGGGCCGAA UUCGGCCCACGAACAGACGAUUGCC
siFBXW7 CACAAAGCUGGUGUGUGCATT UGCACACACCAGCUUUGUGUU
siRNF187 CACUGAGCGGUUCAGGUCATT UGACCUGAACCGCUCAGUGTT
siPRKN CCUUCUGCCGGGAAUGUAAAGAAGCGUAC GUACGCUUCUUUACAUUCCCGGCAGAAGG
siFBXW11 GGUUGUUAGUGGAUCAUCATT UGAUGAUCCACUAACAACCTT
siSKP2 CCUAUCGAACUCAGUUAUATT UAUAACUGAGUUCGAUAGGTT
siZIP14 GGAGGAAUGUUCUUGUAUATT UAUACAAGAACAUUCCUCCTT
siTFRC GUAGGAUGGUAACCUCAGATT UCUGAGGUUACCAUCCUACTT
siFPN CAAGAAUGCUAGACUUAAATT UUUAAGUCUAGCAUUCUUGTT
siDMT1 GUUGCUCUGGAUCCUUCUGTT CAGAAGGAUCCAGAGCAACTT
siFTH1 UACGUUUACCUGUCCAUGUTT ACAUGGACAGGUAAACGUATT

SDS-PAGE and western blot analysis

Total protein was extracted from the cells using RIPA lysis buffer (Beyotime) with protease and phosphatase inhibitors (Beyotime) on ice. The lysates were denatured and then subjected to SDS-PAGE. The resolved proteins were transferred to nitrocellulose membranes (Whatman, Little Chalfont, UK). The membranes were blocked and reacted with primary antibodies overnight at 4°C and with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. The immunoblot bands were visualized using ECL kits (Share-Bio, Shanghai, China).

Co-immunoprecipitation

HeLa cells were seeded in 6 cm dishes, cultured to a confluence rate of 80–90%, transfected with related plasmids for 24 h, and then infected with NDV. At 18 hpi, the cells were lysed on ice for 30 min with RIPA lysis buffer. The lysates were incubated with anti-Flag immunomagnetic beads (Bimake, Houston, TX, USA) or anti-HA immunomagnetic beads (Share-Bio, Shanghai, China) overnight at 4°C with gentle rotation. After the beads were washed with PBST three times, proteins were eluted using SDS sample buffer (10 mM Tris, pH 7.8, 3% SDS, 5% glycerol, and 0.02% bromophenol blue) and detected by western blot.

Ubiquitination assay

The HA-Ub K48 and K63 plasmids encode HA-tagged Lys48- and Lys63-only ubiquitin mutants, respectively (i.e., all lysine residues are mutated except Lys48 or Lys63). HeLa cells were transfected with HA-Ub WT, K48, K63, and Flag-YAP plasmids for 24  h and then infected with NDV. At 18 hpi, the cells were lysed and subjected to co-immunoprecipitation (Co-IP) using an anti-Flag antibody.

Quantitative real-time polymerase chain reaction

Total RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. cDNA was reverse transcribed from total RNA using Hiscript III Reverse Transcriptase (Vazyme Biotech, Nanjing, China) and oligo-dT primers. RT-qPCR was performed by adding cDNA, primers, and AceQ qPCR SYBR Green Master Mix (Vazyme Biotech). The ΔΔCT method was used to calculate the relative mRNA levels, which were normalized using β-actin mRNA. The primer sequences are shown in Table 2.

TABLE 2.

Primers used for qPCR

Gene Forward primers (5´–3´) Reverse primers (5´–3´)
Actin TGTGGCCGAGGACTTTGATT CCTGTGTGGACTTGGGAGAG
NDV-NP AGTGTGCCCCAGTTCAACAA GTACCATTGCTGCATGCTCG
YAP TAGCCCTGCGTAGCCAGTTA TCATGCTTAGTCCACTGTCTGT
Trcp CTGCAGGGACACTCTGTCTAC GAAGTCCCAGATGAGGATTGTG
STUB1 AGCAGGGCAATCGTCTGTTC AAGGCCCGGTTGGTGTAATA
FBXW7 CGTTGCAGGGGCATACTAAT ATGCAATTCCCTGTCTCCAC
RNF187 AGGACTTGAATGACGCCCG TCCATCACGTGTCCCTTCCA
PRKN GTGCAGAGACCGTGGAGAAA GGTGAGTCCTTCCTGCTGTC
FBXW11 TCACCCGTTTCAGGGTTTTCT GAGCCGGAATCAGAGGTGAG
SKP2 GGTGTTTGTAAGAGGTGGTATCGC CACGAAAAGGGCTGAAATGTTC

Statistical analysis

All data are presented as the mean ± standard deviation (SD) of at least three independent replicates. Western blot results and fluorescence intensity were quantified using Image J software. Significant differences among groups were determined with an one-way analysis of variance using GraphPad Prism 8 software (GraphPad, San Diego, CA, USA). Differences were considered statistically significant when the value of P was less than 0.05.

RESULTS

NDV induces ferroptosis in tumor cells

It has been proven that there are significant differences in the susceptibility of different types of cancer cells to ferroptosis (33). We previously demonstrated that NDV can induce ferroptosis in U251 glioma cells (30), and in this study, we investigated whether NDV can induce ferroptosis in other cancer cell types. Initially, we focused on the HeLa cell line, a cervical cancer tumor model that is widely used to study programmed cell death, including ferroptosis (34, 35). Given that increased intracellular labile free iron and lipid peroxidation are two critical features of ferroptosis, intracellular ferrous ion (Fe2+) was first detected by FerroOrange staining. Erastin, a classical ferroptosis inducer, was used as a positive control. As expected, increasing levels of intracellular Fe2+ were detected in NDV-infected and erastin-treated HeLa cells. Treating the cells with DFO, a ferroptosis inhibitor, significantly suppressed the accumulation of intracellular Fe2+ after NDV infection (Fig. 1A). In addition, intracellular Fe2+ was quantitated using an iron assay, and the results showed that there was a significant increase in the Fe2+ concentration upon NDV infection (Fig. 1B).

Fig 1.

Fig 1

NDV induces ferroptosis in tumor cells. (A) Analysis of Fe2+ levels in HeLa cells after treatment with erastin (20 mM) or NDV infection for 18 h using the fluorescent probe FerroOrange. NDV-infected cells were treated with DFO (100 µM) for 18 h. Scale bars = 20 µm. (B) Analysis of Fe2+ levels in HeLa cells after NDV infection for 18 h using the iron assay kit. (C) Analysis of lipid peroxidation levels in HeLa cells after treatment with erastin (20 mM) or NDV infection for 18 h using the fluorescent probe Liperfluo. NDV-infected cells were treated with Lip-1 (1 µM) for 18 h. Scale bars = 20 µm. (D) Detection of MDA concentrations in cell lysates. The manufacturer’s protocol was followed. (E-F) Detection of intracellular ROS (E) and lipid ROS (F) levels in HeLa cells after erastin (20 mM) treatment or NDV infection for 18 h. (G-H) HeLa, H1299, A549, and HepG2 cells were infected with NDV (MOI = 3). At 24 hpi, cell viability (G) and lipid ROS (H) were detected. (I-J) Detection of cell viability (I) and LDH release (J) in HeLa cells after NDV infection alone or NDV infection combined with Lip-1 treatment.

Next, we detected lipid peroxidation by confocal laser microscopy using Liperfluo, which reacts directly with lipid peroxide (LPO). Exposure to NDV resulted in the accumulation of LPO in cells, and this was inhibited by co-treatment with Lip-1, which inhibits ferroptosis by preventing the build-up of lipid ROS (Fig. 1C). We then used an MDA assay to assess the presence of MDA, the final product of the peroxidation reaction between free radicals and unsaturated fatty acids and thus the hallmark of lipid peroxidation (36). Massive quantities of MDA were detected in NDV-infected and erastin-treated cells compared with control cells (Fig. 1D). We then proceeded to stain the intracellular ROS and lipid ROS with DCFH-DA and C11-BODIPY 581/591, respectively, and determine their levels based on the mean fluorescence intensity (MFI) of the resultant green fluorescence. Flow cytometry revealed that the levels of both intracellular ROS and lipid ROS increased after NDV infection (Fig. 1E and F). In addition, we examined whether cells from other tumor cell lines (e.g., H1299, A549, and HepG2 cells) were susceptible to NDV-induced ferroptosis. The results of the cell viability and lipid ROS assays showed that NDV could induce cell death and lipid peroxidation in a range of tumor cells (Fig. 1G and H).

To elucidate the significance of ferroptosis among the multiple forms of cell death induced by NDV, Lip-1 was used to treat HeLa cells upon NDV infection. The results of the cell viability and LDH release assays showed that the cell viability increased from 41% to 56% and that the LDH release decreased from 100% to 67% after Lip-1 treatment (Fig. 1I and J). These results indicated that ferroptosis accounted for approximately 30% of the NDV-induced cell death observed in the HeLa cells and thus that ferroptosis is crucial for the oncolytic activity of NDV. Collectively, these data suggest that NDV induced ferroptosis in tumor cells.

YAP negatively regulates ferroptosis

Dysregulation of the Hippo pathway, represented by the abnormal expression or translocation of YAP, is frequently observed in human cancer cells (37). YAP has been shown to enhance ferroptosis when it is localized in the nucleus (13). Thus, we aimed to determine whether NDV induces ferroptosis in tumor cells through the Hippo pathway. To begin, we assessed whether YAP regulates ferroptosis in HeLa cells using XMU-MP-1, an MST1/2 inhibitor, to facilitate the nuclear localization of YAP. The increased expression of connective tissue growth factor (CTGF) and cysteine-rich protein 61 (Cyr61) mRNA, two proteins encoded by downstream target genes of YAP, indicated the effective activation of YAP by XMU-MP-1 (Fig. 2A). In addition, XMU-MP-1 induced elevated levels of ROS and lipid ROS in a dose-dependent manner, and co-treatment with XMU-MP-1 and RSL3 enhanced cell death (Fig. 2B through D). These results suggested that the nuclear import of YAP promoted ferroptosis in the HeLa cells.

Fig 2.

Fig 2

YAP negatively regulates ferroptosis. (A) mRNA levels of YAP downstream target genes after treatment with XMU-MP-1 (10 µM). (B) Detection of cell viability after treatment with RSL3 alone or in combination with RSL3 (5 µM) and XMU-MP-1 (10 µM). (C-D) Detection of intracellular ROS (C) and lipid ROS (D) levels after treatment with different concentrations of XMU-MP-1. (E) Western blot analysis of YAP levels in the cytoplasm and nucleus at 18 hpi. Tubulin is the cytoplasmic loading control and Lamin B1 is the nuclear loading control. (F) Western blot analysis of the interference efficiency of YAP. (G) HeLa cells transfected with siYAP for 48 h were treated with erastin (50 µM), RSL3 (5 µM), or were infected with NDV (MOI = 1) in the presence or absence of Lip-1 (5 µM). At 18 hpi, cell viability was determined by the CCK8 kit. (H) HeLa cells transfected with siYAP for 48 h were infected with NDV (MOI = 1). At 18 hpi, the Fe2+ level was determined by Iron Assay Kit. (I-J) HeLa cells transfected with siYAP for 48 h were infected with NDV (MOI = 3). At 18 hpi, intracellular ROS (I) and lipid ROS (J) levels were determined by flow cytometry. (K) Western blot analysis of the overexpression efficiency of YAP. (L) HeLa cells transfected with plasmid YAP for 24 h were treated with erastin (50 µM), RSL3 (5 µM), or were infected with NDV (MOI = 1) in the presence or absence of Lip-1 (5 µM). At 18 hpi, cell viability was determined by the CCK8 kit. (M) HeLa cells transfected with plasmid YAP for 24 h were infected with NDV (MOI = 1). At 18 hpi, the Fe2+ level was determined by Iron Assay Kit. (N-O) HeLa cells transfected with plasmid YAP for 24 h were infected with NDV (MOI = 3). At 18 hpi, intracellular ROS (N) and lipid ROS (O) levels were determined by flow cytometry.

We then investigated whether NDV triggers ferroptosis via the same mechanism. Interestingly, NDV infection appeared to have no effect on the translocation of YAP. Instead, the quantity of YAP was significantly reduced in both the cytoplasm and nucleus upon NDV infection (Fig. 2E).

Since NDV infection appeared to suppress the expression of YAP rather than alter its subcellular localization, our subsequent investigations focused on the role that YAP expression plays in NDV-induced ferroptosis. To determine whether YAP deficiency affects the susceptibility of tumor cells to ferroptosis, three siRNAs were designed to knock down YAP and used to create an experimental system that mimicked the reduction in YAP triggered by NDV infection. The western blot results showed that effective knockdown of YAP was achieved with siYAP#2 and #3; thus, we used a mixture of siYAP#2 and #3 in the subsequent experiments (Fig. 2F). The cell viability assay results revealed that in HeLa cells, YAP knockdown enhanced cell death in the presence of ferroptosis inducers (erastin and RSL3) and NDV and that treatment with Lip-1 partially rescued the cells (Fig. 2G). The iron assay results showed that YAP knockdown significantly increased intracellular Fe2+ levels in NDV-infected cells (Fig. 2H). In addition, in mock-infected cells, an increase in intracellular ROS, but not lipid ROS, was observed in the YAP-knockdown (siYAP) group compared with the control (siNC) group, indicating that the YAP deficiency partially elevated the oxidative stress level under normal conditions (Fig. 2I and J). However, in the presence of NDV, both intracellular ROS and lipid ROS levels were significantly elevated in the siYAP group, suggesting that YAP depletion could promote NDV-induced oxidation and lipid peroxidation.

Next, we investigated whether overexpression of YAP could rescue cells from undergoing NDV-induced ferroptosis. The transfection efficiencies of the YAP-overexpression plasmids in HeLa cells were verified by western blot (Fig. 2K). It was found that YAP overexpression inhibited ferroptosis in cells treated with a ferroptosis inducer or NDV (Fig. 2L) and the accumulation of Fe2+, intracellular ROS, and lipid ROS upon NDV infection (Fig. 2M through O). Taken together, these results demonstrated that abundant YAP negatively regulated NDV-induced ferroptosis.

NDV inhibits the accumulation of YAP in tumor cells

Since our results indicated that NDV infection only decreased the amount of YAP in the cytoplasm and nucleus and did not affect its translocation (Fig. 2E), we systematically investigated the impact of NDV infection on the amount of endogenous YAP in tumor cells. It is known that cytoplasmic localization of YAP is facilitated by binding to 14-3-3 protein when phosphorylation occurs at serine 127 (S127) of YAP. Significant downregulation of YAP and p-YAPs127 was detected at 18 and 24 hpi (Fig. 3A). NDV also reduced the amount of YAP and p-YAPs127 in a dose-dependent manner (Fig. 3B). Similar results were observed in H1299 cells, where NDV also reduced the amount of YAP in a time- and dose-dependent manner (Fig. 3C and D). Furthermore, we examined the abundance of YAP in tumor cells from different sources. The western blot results showed that NDV reduced the amount of YAP in the A549 lung cancer cell line and the HepG2 liver cancer cell line, indicating that NDV can reduce the amount of YAP in different types of tumor cells (Fig. 3E). In the tested cell lines, the degree of ferroptosis and YAP reduction induced by NDV positively correlated with cell death.

Fig 3.

Fig 3

NDV inhibits the abundance of YAP in tumor cells. (A-D) Western blot analysis of the levels of p-YAPS127 and total YAP in NDV-infected HeLa cells at 6, 12, 18, and 24 hpi (A), in NDV-infected HeLa cells at an MOI of 0.1, 1, 5, and 10 (B), in NDV-infected H1299 cells at 6, 12, 18, and 24 hpi (C), in NDV-infected H1299 cells at an MOI of 0.1, 1, 5, and 10 (D). (E) HeLa, H1299, A549, and HepG2 cells were infected with NDV (MOI = 3). At 24 hpi, the abundance of YAP was detected. (F-H) Western blot analysis of the levels of p-YAPS127 and total YAP in NDV-infected HeLa cells infected with NDV Herts/33 strain, Mukteswar strain, and La Sota strain at 12 and 24 hpi (F), in HeLa cells infected with NDV (MOI = 1) and UV-treated NDV (MOI = 10) (G), and in NDV-infected DF1 cells at 12, 24, 36, and 48 hpi (H). (I) HeLa cells and DF-1 cells were transfected with chicken YAP and human YAP, respectively. At 24 hpt, cells were infected with NDV (MOI = 3) and harvested at 24 hpi. Western blot analysis of the levels of HA-chYAP (left) and HA-hYAP (right). In panels A-I, β-actin was used as the loading control.

To identify whether the observed downregulation of YAP was dependent on the virulence of the utilized virus, we conducted experiments with NDV strains of varying virulence (i.e., lentogenic, mesogenic, and velogenic strains). The mesogenic Mukteswar strain, lentogenic La Sota strain, and velogenic Herts/33 strain (which was used in the above experiments) were used to infect HeLa cells at the same MOI. The western blot results showed that the velogenic Herts/33 strain reduced YAP to the greatest extent, followed by the mesogenic Mukteswar strain and the lentogenic La Sota strain. These results indicated that the observed downregulation of YAP was dependent on the virulence of the NDV strain (Fig. 3F). UV-inactivated NDV did not impact the abundance of YAP, which indicated that NDV replication was essential for reducing the abundance of YAP (Fig. 3G).

As NDV is an avian virus, we investigated its effect on the abundance of YAP in DF-1 chicken fibroblast cells. Similar to the findings in the human cell lines, NDV also reduced the amount of YAP in DF-1 cells during late-stage infection (Fig. 3H). Furthermore, we expressed chicken YAP in HeLa cells and human YAP in DF-1 cells and infected the respective cells with NDV. The results showed that NDV suppressed the heterologous expression of chicken and human YAP; hence, the suppression of YAP by NDV is not a species-specific phenomenon (Fig. 3I). Overall, these results indicated that oncolytic NDV inhibited the expression of YAP and phosphorylated YAP (S127) in tumor cells.

NDV degrades YAP through E3 ubiquitin ligase parkin-mediated K48-linked polyubiquitination at K90

The ubiquitin–proteasome and autophagy–lysosome pathways are major pathways in the process of protein degradation. To determine the role that each of these pathways plays in NDV-triggered YAP inhibition, we used the proteasome inhibitor MG132, the lysosome inhibitor CQ, and the autophagy inhibitor Baf-1. In the presence of MG132, but not CQ or Baf-1, NDV-triggered YAP degradation was partially rescued, suggesting that NDV induced YAP degradation through the ubiquitin–proteasome pathway (Fig. 4A). Furthermore, MG132 restored YAP degradation in both the cytoplasm and the nucleus, and a more pronounced rescue effect was observed in the cytoplasm compared to the nucleus (Fig. 4B). Co-IP experiments revealed that NDV infection significantly increased the ubiquitination of YAP at 18 hpi (Fig. 4C). It was also found that NDV induced YAP ubiquitination with ubiquitin-K48 but not with ubiquitin-K63 (Fig. 4D).

Fig 4.

Fig 4

NDV degrades YAP through PRKN-mediated K48-linked polyubiquitination at the K90 site. (A) Western blot analysis of the levels of p-YAPS127 and total YAP in NDV-infected HeLa cells in the presence or absence of MG132, CQ, and Baf-1. (B) Western blot analysis of the level of YAP in the cytoplasm and nucleus at 18 hpi in the presence or absence of the proteasome inhibitor MG132. (C) HeLa cells cotransfected with Flag-YAP and HA-ubiquitin (Ub) for 24 h were infected with NDV (MOI = 1) and maintained in the presence or absence of the proteasome inhibitor MG132 (20 µM). At 18 hpi, cells were harvested and anti-Flag immunoprecipitants (IP: Flag) were analyzed by western blot. (D) HeLa cells were cotransfected with Flag-YAP, HA-Ub (K48), and HA-Ub (K63). At 24 hpt, cells were infected with NDV (MOI = 1). At 18 hpi, cells were harvested and anti-Flag immunoprecipitants (IP: Flag) were analyzed by western blot. (E) Schematic diagram of potential ubiquitination sites of YAP. (F) HeLa cells were transfected with Flag-YAP (K76R, K90R, K97R, K102R, K181R, K204R, K252R, K254R, K280R, K315R, K321R, K342R, K494R, or K497R). At 24 hpt, cells were infected with NDV (MOI = 1). Cells were harvested at 18 hpi and the levels of Flag-YAP were determined. (G) HeLa cells were transfected with either scrambled siRNA or specific siRNA targeting Trcp, STUB1, FBXW7, RNF187, PRKN, FBXW11, or SKP2. At 48 hpt, knockdown efficiency was validated by RT-qPCR. (H) HeLa cells were transfected with either scrambled siRNA or specific siRNA targeting Trcp, STUB1, FBXW7, RNF187, PRKN, FBXW11, or SKP2. At 48 hpt, cells were infected with NDV (MOI = 1). Cells were harvested at 18 hpi and the levels of p-YAPS127 and total YAP were determined by western blot. (I) HeLa cells cotransfected with HA-YAP and Flag-PRKN for 24 h were infected with NDV (MOI = 1). At 18 hpi, cells were harvested and anti-HA immunoprecipitants (IP: HA) were analyzed by western blot. (J) HeLa cells cotransfected with Flag-YAP, Myc-PRKN, and HA-Ub for 24 h were infected with NDV (MOI = 1). At 18 hpi, cells were harvested and anti-Flag immunoprecipitants (IP: Flag) were analyzed by western blot.

In addition, we investigated the ubiquitin ligation sites of YAP by constructing 14 YAP-mutant plasmids (K to R), as YAP contains 14 lysine residues (Fig. 4E). Only the K90R mutant plasmid could reduce the degradation of YAP caused by NDV (Fig. 4F). To identify the E3 ligases involved in this process, we designed and utilized siRNAs specific for seven E3 ligases reportedly associated with YAP degradation (http://ubibrowser.bio-it.cn/ubibrowser_v3/). The knockdown efficiency was validated using RT-qPCR (Fig. 4G). Knocking down PRKN, but not the other E3 ligases, restored NDV-triggered YAP degradation (Fig. 4H). Furthermore, PRKN was identified to interact with YAP, and the interaction was enhanced by NDV infection (Fig. 4I). In addition, we examined whether PRKN regulates the level of YAP ubiquitination and found that PRKN overexpression resulted in a significant increase in YAP polyubiquitination (Fig. 4J). Taken together, these results indicate that NDV induces the degradation of YAP through PRKN-mediated K48-linked polyubiquitination at K90 of YAP.

Zrt/Irt-like protein 14 (ZIP14) plays a crucial role in the YAP-mediated regulation of ferroptosis

YAP can regulate ferroptosis by adjusting the abundance of iron-related proteins and therefore control the intracellular LIP (10, 18, 19). Thus, we explored the potential relationships between YAP and iron-related proteins, which are involved in the import, storage, and export of iron ions (Fig. 5A). NDV infection had different regulatory effects on several iron-related proteins, including the upregulation of TFRC and ZIP14, as well as the downregulation of FPN and FTH1 (Fig. 5B). In addition, overexpression of YAP had no significant effect on TFRC, DMT1, FPN, and FTH1. Notably, YAP inhibited the expression of ZIP14, which mediates the intracellular transport of NTBI and significantly suppressed the NDV-induced upregulation of ZIP14. It was also found that NDV infection also enhanced the expression of ZIP14, suggesting that NDV increased the uptake of NTBI by upregulating ZIP14 (Fig. 5C).

Fig 5.

Fig 5

ZIP14 plays a crucial role in YAP regulation of ferroptosis. (A) Schematic diagram of iron-related proteins involved in iron import, storage, and export. (B) Western blot analysis of the levels of iron-related proteins in NDV-infected HeLa cells overexpressing YAP. (C) Western blot analysis of the levels of ZIP14 in NDV-infected HeLa cells at 12 and 24 hpi. (D) HeLa cells were transfected with either scrambled siRNA or specific siRNA targeting ZIP14, TFRC, FPN, DMT1, or FTH1. At 48 hpt, knockdown efficiency was validated by western blot. HeLa cells were transfected with specific siRNA targeting iron-related proteins alone or co-transfected with specific siRNA targeting YAP. At 48 hpt, cells were infected with NDV (MOI = 3). At 18 hpi, Fe2+ levels (E), intracellular ROS levels (F), and intracellular lipid ROS levels (G) were determined. (H) HeLa cells were cotransfected with Flag-YAP and HA-ZIP14. At 24 hpt, cells were harvested and analyzed by western blot for anti-HA immunoprecipitants (IP: HA) and anti-Flag immunoprecipitants (IP: Flag).

Furthermore, we wished to determine (i) whether YAP-mediated ferroptosis regulation is dependent on ZIP14 rather than other iron-related proteins and (ii) the impact of knocking down iron-related proteins on the regulation of ferroptosis by YAP. First, we evaluated the efficiency of a series of siRNAs that targeted the expression of specific iron-related proteins (ZIP14, TFRC, FPN, DMT1, and FTH1) via western blot (Fig. 5D). The intracellular iron, intracellular ROS, and lipid ROS assays were then performed, and the results showed that knocking down ZIP14 rather than other iron-related proteins involved in ferroptosis prevented YAP regulation of ferroptosis (Fig. 5E through G).

To further explore how YAP regulates ZIP14, we explored whether the two proteins interact. HA-ZIP14 and Flag-YAP plasmids were transfected into HeLa cells, and Co-IP was performed. The results obtained with both anti-HA and anti-Flag immunomagnetic beads showed that YAP interacted with ZIP14 (Fig. 5H).

The above results indicate that YAP suppresses the expression of ZIP14 in an interactive manner, ZIP14 is the downstream protein regulated by YAP, and NDV can regulate the level of ZIP14 by degrading YAP, thereby increasing the uptake of NTBI and inducing ferroptosis in tumor cells.

Stabilization of YAP enhances the inhibition of NDV replication and NDV-induced ferroptosis

The results presented in Fig. 4 showed that knocking down PRKN (Fig. 4H) or transfecting cells with the YAP-K90R plasmid (Fig. 4F) significantly reduced the level of NDV NP, indicating that the stable expression of YAP inhibited NDV replication. We then conducted verification experiments to confirm this finding, and the results showed that transfection with plasmids encoding wild-type (WT) YAP significantly inhibited both the protein and mRNA levels of NDV NP (Fig. 6A and B). Likewise, knocking down YAP enhanced NDV replication (Fig. 6C and D). To further investigate the role of YAP in viral replication and ferroptosis, the mutant-YAP (K90R) plasmid was transfected into cells to inhibit NDV-induced degradation of YAP. The western blot results showed that YAP (K90R) further inhibited NDV replication and the upregulation of ZIP14 triggered by NDV without further suppressing the expression of ZIP14 under normal conditions (Fig. 6E). In addition, it was found that the intracellular Fe2+ level was further suppressed by YAP (K90R) (Fig. 6F), and flow cytometry revealed that YAP (K90R) further inhibited the levels of NDV-induced intracellular ROS and lipid ROS compared to YAP (WT) (Fig. 6G and H). Collectively, the above results indicated that the stabilization of YAP not only enhanced the inhibition of NDV replication but also the inhibition of ferroptosis by suppressing the upregulation of ZIP14 triggered by NDV infection.

Fig 6.

Fig 6

Stabilization of YAP aggravates the inhibition of NDV replication and NDV-induced ferroptosis. (A and B) Protein and mRNA levels of NP in NDV-infected HeLa cells overexpressing YAP. (C and D) Protein and mRNA levels of NP in NDV-infected HeLa cells with YAP knockdown. HeLa cells were transfected with Flag-YAP and Flag-YAP (K90R). At 24 hpt, cells were infected with NDV (MOI = 1). At 18 hpi, intracellular ROS levels (E), intracellular lipid ROS levels (F), Fe2+ levels (G), and abundance of ZIP14 (H) were determined.

DISCUSSION

Oncolytic viruses have attracted much attention in the field of cancer treatment due to their curative effects and limited side effects (38). Oncolytic viruses can kill tumor cells by inducing programmed cell death, such as apoptosis, autophagy, pyroptosis, and necroptosis (39, 40). It is generally recognized that the induction of tumor cell death is an effective measure of the success of a cancer treatment modality. In a recent study, we showed that NDV can induce ferroptosis in U251 glioma cells (30), and in this study, we have demonstrated that NDV can infect various types of tumor cells and induce ferroptosis. NDV is reportedly capable of inducing various forms of cell death in tumor cells, including apoptosis, necroptosis, and ferroptosis (26, 30, 41). However, the predominant form of cell death triggered by NDV may vary and depend on factors such as the viral strain, host cell type, infectious dose, and duration of infection. In this study, approximately 30% of the NDV-induced cell death in HeLa cells was attributed to ferroptosis. To date, only limited research has been conducted on oncolytic virus-induced ferroptosis, which could potentially become a new target in cancer treatment.

Tumorigenesis is a highly complex process that involves many interrelated and intersecting signaling pathways (42). In the past few decades, the importance of the Hippo pathway in cancer development has been recognized and intensively researched (43). The Hippo pathway is frequently dysregulated in various types of cancer, resulting in tumor cell proliferation, migration, and invasion (44, 45). YAP is the key downstream effector of the Hippo pathway, and overexpression and overactivation of YAP have been observed in several types of cancer, including liver, breast, cervical, and lung cancer (4649). Notably, most oncogenic viruses, such as human papillomavirus, hepatitis B virus, and metapneumovirus, tend to enhance YAP expression and increase its nuclear localization while exerting tumorigenic effects (5052). In this study, we found that the oncolytic NDV induced YAP ubiquitination and degradation. Recent studies have shown that Zika virus (ZIKV) infection reduces the levels of YAP and p-YAP in human neural progenitor cells (53). Interestingly, since ZIKV can infect and destroy cancer cells in central nervous system (CNS) tumors, it is also considered an oncolytic virus (54). These findings imply that the abundance of YAP seems to be related to the occurrence and growth of tumor cells during viral infections.

Several groups have reported that YAP affects viral infection by acting as a proviral protein that antagonizes the host’s antiviral response by inhibiting the function of TANK binding kinase 1 (TBK1), a key signal transducer of the cytosolic RNA-sensing retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) pathway (5558). However, a recent study showed that YAP inhibited human cytomegalovirus (HCMV) gene expression by reducing the nuclear translocation of the HCMV genome during the early stages of the viral life cycle (59). The findings of these studies suggest that YAP affects the replication of various viruses in complex and variable ways. Here, we found that YAP negatively regulated NDV replication. Stabilizing YAP expression, either by knocking down PRKN or transfecting cells with YAP (K90R), further inhibited NDV infection. The specific mechanism by which YAP inhibits NDV replication remains unclear; thus, further research is required to elucidate the mechanism.

To combat the (as yet unknown) antiviral mechanism of YAP, it seems that NDV has developed the capacity to induce YAP degradation. While it was noted that the YAP mRNA levels were slightly upregulated upon NDV infection (data not shown), it is well known that transcriptome changes do not always correlate with protein abundance (60, 61). The discrepancy between the mRNA and protein levels suggests that there was a post-translational modification of YAP. The downregulation of YAP was found to occur at the protein level, rather than at the mRNA level, and via the ubiquitin–proteasome pathway. It is also worth noting that the discordance between the mRNA and protein levels may have been reflecting a compensatory increase in mRNA in response to the degradation of YAP at the protein level (6266).

It has long been recognized that YAP has two different effects on programmed cell death. On the one hand, YAP exhibits anti-apoptotic activity in several cell types. It has been shown to upregulate jagged canonical Notch ligand 1 (Jag-1) in hepatocellular carcinoma cells and thus activate the Notch pathway and promote cell proliferation and reduce apoptosis. In addition, YAP has been shown to enhance breast cancer antiestrogen resistance 4 (BCAR4) expression in breast cancer cells and thus reduce apoptosis (67, 68). However, when cells are exposed to DNA damage stress, Akt and c-Abl can phosphorylate YAP to inhibit the transcription of pro-apoptotic genes following cell damage (69, 70). On the other hand, YAP plays a role in promoting apoptosis. For example, YAP promotes multidrug resistance and inhibits autophagy-associated cell death in hepatocellular carcinoma (71). YAP also promotes glioma progression by enhancing autophagy (72). Likewise, the relationship between YAP and ferroptosis is complex. It was recently demonstrated that YAP promotes ferroptosis by upregulating multiple ferroptosis regulators, including acyl-CoA synthetase long-chain family member 4 (ACSL4) and TFRC (10). Subsequently, SKP2 was identified as a downstream protein of YAP that positively regulates ferroptosis (20). Alternatively, YAP can also inhibit ferroptosis. In sorafenib-resistant hepatocellular carcinoma cells, YAP/TAZ was found to stabilize activating transcription factor 4 (ATF4) and direct it into the nucleus to transcribe solute carrier family 7 member 11 (SLC7A11), a key transporter for maintaining the stability of intracellular glutathione (73). Furthermore, reduction of YAP in lung adenocarcinoma cells has been shown to increase sensitivity to ferroptosis by affecting FTH1 and hence increasing intracellular iron levels (19). Our data indicate that the degradation of YAP by NDV promotes ferroptosis in HeLa cells and thus that infection with this oncolytic virus results in YAP negatively regulating ferroptosis in these tumor cells.

ZIP14, a metal ion transporter located in the cell membrane, is involved in the transport of extracellular metal ions into cells. The function of ZIP14 in ferroptosis has been confirmed in vitro and in vivo. Overexpression of ZIP14 in HeLa cells was found to enhance the uptake of NTBI (74). In a rat model of diabetic nephropathy, ZIP14 was reportedly involved in iron deposition and triggered ferroptosis (75). In hepatocyte-specific telomere binding protein (TRF1) knockout mice, ferroptosis-induced liver fibrosis was reduced after deletion of ZIP14 (76). Here, the knockdown of ZIP14 and TFRC reduced the levels of ferroptosis indicators upon NDV infection, while the knockdown of FPN and FTH1 had the opposite effect, as expected (Fig. 5E through G, red columns). Moreover, knocking down DMT1 did not affect the levels of the ferroptosis indicators, which may have been because NDV infection did not change the expression of DMT1 (Fig. 5B). In addition, we have shown that YAP and ZIP14 interact and that ZIP14 expression was suppressed by YAP. More importantly, we identified that NDV degrades YAP to promote ZIP14 expression and ferroptosis. However, the details of the mechanism need to be determined.

In conclusion, the findings of this study provide insights into how an oncolytic virus manipulates YAP expression to induce ferroptosis in tumor cells. Based on the findings, we have proposed the following hypothesis: that oncolytic NDV induces the degradation of abnormally highly expressed YAP via the ubiquitin-proteasome pathway by activating PRKN. YAP degradation promotes both virus replication and tumor cell ferroptosis (Fig. 7). Hence, we have revealed a novel mechanism by which an oncolytic virus induces ferroptosis in tumor cells, providing new insights into the treatment of drug-resistant cancers.

Fig 7.

Fig 7

Schematic diagram of the molecular mechanism of NDV-induced ferroptosis by degrading YAP in tumor cells. Upon infecting tumor cells, the oncolytic virus NDV recruits the E3 ligase PRKN, which promotes YAP K48-linked ubiquitination at the K90 site, resulting in YAP degradation through the ubiquitin-proteasome pathway. Degradation of YAP not only facilitates NDV replication but also alleviates inhibition of ZIP14. The accumulation of labile iron pools triggers the Fenton reaction, resulting in excessive generation of ROS and causing lipid peroxidation on the cell membrane. Ultimately, this process induces ferroptosis.

ACKNOWLEDGMENTS

We thank International Science Editing (http://www.internationalscienceediting.com) for editing this manuscript.

This work was supported by the International Cooperation Project of the National Natural Science Foundation of China (32220103012), the National Natural Science Foundation of China (32122085 and 32030108), and the National Key Research and Development Program of China (2022YFD1801500).

C.D., X.L., and Y.S. conceived of and designed the experiments. Y.S. and L.T. performed the experiments and analyzed the data. Y.S. prepared the figures and wrote the manuscript. X.K., L.T., C.S., X.Q., and Y.L. contributed reagents, materials, analysis tools, and discussions. C.D., X.L., and Y.S. revised the manuscript. All authors read and approved the final manuscript.

Contributor Information

Chan Ding, Email: shoveldeen@shvri.ac.cn.

Xiufan Liu, Email: xfliu@yzu.edu.cn.

Yingjie Sun, Email: sunyingjie@shvri.ac.cn.

Martin Schwemmle, University Medical Center Freiburg, Freiburg, Germany.

DATA AVAILABILITY

All data of this study are available from the corresponding author upon request, without undue reservation.

REFERENCES

  • 1. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B, Stockwell BR. 2012. Ferroptosis: an iron-dependent form of non-apoptotic cell death. Cell 149:1060–1072. doi: 10.1016/j.cell.2012.03.042 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Jiang X, Stockwell BR, Conrad M. 2021. Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol 22:266–282. doi: 10.1038/s41580-020-00324-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Candelaria PV, Leoh LS, Penichet ML, Daniels-Wells TR. 2021. Antibodies targeting the transferrin receptor 1 (TfR1) as direct anti-cancer agents. Front Immunol 12:607692. doi: 10.3389/fimmu.2021.607692 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Knutson MD. 2019. Non-transferrin-bound iron transporters. Free Radic Biol Med 133:101–111. doi: 10.1016/j.freeradbiomed.2018.10.413 [DOI] [PubMed] [Google Scholar]
  • 5. Lakhal-Littleton S, Wolna M, Carr CA, Miller JJJ, Christian HC, Ball V, Santos A, Diaz R, Biggs D, Stillion R, Holdship P, Larner F, Tyler DJ, Clarke K, Davies B, Robbins PA. 2015. Cardiac ferroportin regulates cellular iron homeostasis and is important for cardiac function. Proc Natl Acad Sci U S A 112:3164–3169. doi: 10.1073/pnas.1422373112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Lin L, Wang S, Deng H, Yang W, Rao L, Tian R, Liu Y, Yu G, Zhou Z, Song J, Yang H-H, Chen Z-Y, Chen X. 2020. Endogenous labile iron pool-mediated free radical generation for cancer chemodynamic therapy. J Am Chem Soc 142:15320–15330. doi: 10.1021/jacs.0c05604 [DOI] [PubMed] [Google Scholar]
  • 7. Fearnhead HO, Vandenabeele P, Vanden Berghe T. 2017. How do we fit ferroptosis in the family of regulated cell death? Cell Death Differ 24:1991–1998. doi: 10.1038/cdd.2017.149 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Liu Y, Gu W. 2022. p53 in ferroptosis regulation: the new weapon for the old guardian. Cell Death Differ 29:895–910. doi: 10.1038/s41418-022-00943-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Wang X, Zhang C, Zou N, Chen Q, Wang C, Zhou X, Luo L, Qi H, Li J, Liu Z, Yi J, Li J, Liu W. 2022. Lipocalin-2 silencing suppresses inflammation and oxidative stress of acute respiratory distress syndrome by Ferroptosis via inhibition of MAPK/ERK pathway in neonatal mice. Bioengineered 13:508–520. doi: 10.1080/21655979.2021.2009970 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Wu J, Minikes AM, Gao M, Bian H, Li Y, Stockwell BR, Chen Z-N, Jiang X. 2019. Intercellular interaction dictates cancer cell ferroptosis via NF2-YAP signalling. Nature 572:402–406. doi: 10.1038/s41586-019-1426-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Fang K, Du S, Shen D, Xiong Z, Jiang K, Liang D, Wang J, Xu H, Hu L, Zhai X, Jiang Y, Xia Z, Xie C, Jin D, Cheng W, Meng S, Wang Y. 2022. SUFU suppresses ferroptosis sensitivity in breast cancer cells via Hippo/YAP pathway. iScience 25:104618. doi: 10.1016/j.isci.2022.104618 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Qin Y, Pei Z, Feng Z, Lin P, Wang S, Li Y, Huo F, Wang Q, Wang Z, Chen Z-N, Wu J, Wang Y-F. 2021. Oncogenic activation of YAP signaling sensitizes ferroptosis of hepatocellular carcinoma via ALOXE3-mediated lipid peroxidation accumulation. Front Cell Dev Biol 9:751593. doi: 10.3389/fcell.2021.751593 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Sun T, Chi J-T. 2021. Regulation of ferroptosis in cancer cells by YAP/TAZ and Hippo pathways: the therapeutic implications. Genes Dis 8:241–249. doi: 10.1016/j.gendis.2020.05.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Moroishi T, Hansen CG, Guan K-L. 2015. The emerging roles of YAP and TAZ in cancer. Nat Rev Cancer 15:73–79. doi: 10.1038/nrc3876 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Yang W-H, Ding C-KC, Sun T, Rupprecht G, Lin C-C, Hsu D, Chi J-T. 2019. The Hippo pathway effector TAZ regulates ferroptosis in renal cell carcinoma. Cell Rep 28:2501–2508. doi: 10.1016/j.celrep.2019.07.107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Lin C-C, Yang W-H, Lin Y-T, Tang X, Chen P-H, Ding C-KC, Qu DC, Alvarez JV, Chi J-T. 2021. DDR2 upregulation confers ferroptosis susceptibility of recurrent breast tumors through the Hippo pathway. Oncogene 40:2018–2034. doi: 10.1038/s41388-021-01676-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Ye S, Xu M, Zhu T, Chen J, Shi S, Jiang H, Zheng Q, Liao Q, Ding X, Xi Y. 2021. Cytoglobin promotes sensitivity to ferroptosis by regulating p53-YAP1 axis in colon cancer cells. J Cell Mol Med 25:3300–3311. doi: 10.1111/jcmm.16400 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Zhu G, Murshed A, Li H, Ma J, Zhen N, Ding M, Zhu J, Mao S, Tang X, Liu L, Sun F, Jin L, Pan Q. 2021. O-Glcnacylation enhances sensitivity to Rsl3-induced Ferroptosis via the YAP/TFRC pathway in liver cancer. Cell Death Discov 7:83. doi: 10.1038/s41420-021-00468-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Zhang X, Yu K, Ma L, Qian Z, Tian X, Miao Y, Niu Y, Xu X, Guo S, Yang Y, Wang Z, Xue X, Gu C, Fang W, Sun J, Yu Y, Wang J. 2021. Endogenous glutamate determines ferroptosis sensitivity via ADCY10-dependent YAP suppression in lung adenocarcinoma. Theranostics 11:5650–5674. doi: 10.7150/thno.55482 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Yang W-H, Lin C-C, Wu J, Chao P-Y, Chen K, Chen P-H, Chi J-T. 2021. The Hippo pathway effector YAP promotes ferroptosis via the E3 ligase SKP2. Mol Cancer Res 19:1005–1014. doi: 10.1158/1541-7786.MCR-20-0534 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Chen X, Kang R, Kroemer G, Tang D. 2021. Broadening horizons: the role of ferroptosis in cancer. Nat Rev Clin Oncol 18:280–296. doi: 10.1038/s41571-020-00462-0 [DOI] [PubMed] [Google Scholar]
  • 22. Amarasinghe GK, Ayllón MA, Bào Y, Basler CF, Bavari S, Blasdell KR, Briese T, Brown PA, Bukreyev A, Balkema-Buschmann A, et al. 2019. Taxonomy of the order mononegavirales: update 2019. Arch Virol 164:1967–1980. doi: 10.1007/s00705-019-04247-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Ganar K, Das M, Sinha S, Kumar S. 2014. Newcastle disease virus: current status and our understanding. Virus Res 184:71–81. doi: 10.1016/j.virusres.2014.02.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Tayeb S, Zakay-Rones Z, Panet A. 2015. Therapeutic potential of oncolytic Newcastle disease virus: a critical review. Oncolytic Virother 4:49–62. doi: 10.2147/OV.S78600 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Burman B, Pesci G, Zamarin D. 2020. Newcastle disease virus at the forefront of cancer immunotherapy. Cancers (Basel) 12:3552. doi: 10.3390/cancers12123552 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Li Y, Jiang W, Niu Q, Sun Y, Meng C, Tan L, Song C, Qiu X, Liao Y, Ding C. 2019. eIF2α-CHOP-BCl-2/JNK and IRE1α-XBP1/JNK signaling promote apoptosis and inflammation and support the proliferation of Newcastle disease virus. Cell Death Dis 10:891. doi: 10.1038/s41419-019-2128-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Liao Y, Wang H-X, Mao X, Fang H, Wang H, Li Y, Sun Y, Meng C, Tan L, Song C, Qiu X, Ding C. 2017. RIP1 is a central signaling protein in regulation of TNF-α/TRAIL mediated apoptosis and necroptosis during Newcastle disease virus infection. Oncotarget 8:43201–43217. doi: 10.18632/oncotarget.17970 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Gong Y, Tang N, Liu P, Sun Y, Lu S, Liu W, Tan L, Song C, Qiu X, Liao Y, Yu S, Liu X, Lin S-H, Ding C. 2022. Newcastle disease virus degrades SIRT3 via PINK1-PRKN-dependent mitophagy to reprogram energy metabolism in infected cells. Autophagy 18:1503–1521. doi: 10.1080/15548627.2021.1990515 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Ren S, Ur Rehman Z, Gao B, Yang Z, Zhou J, Meng C, Song C, Nair V, Sun Y, Ding C. 2020. ATM-mediated DNA double-strand break response facilitated oncolytic Newcastle disease virus replication and promoted syncytium formation in tumor cells. PLoS Pathog 16:e1008514. doi: 10.1371/journal.ppat.1008514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Kan X, Yin Y, Song C, Tan L, Qiu X, Liao Y, Liu W, Meng S, Sun Y, Ding C. 2021. Newcastle-disease-virus-induced ferroptosis through nutrient deprivation and ferritinophagy in tumor cells. iScience 24:102837. doi: 10.1016/j.isci.2021.102837 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Sun Y, Yu S, Ding N, Meng C, Meng S, Zhang S, Zhan Y, Qiu X, Tan L, Chen H, Song C, Ding C. 2014. Autophagy benefits the replication of Newcastle disease virus in chicken cells and tissues. J Virol 88:525–537. doi: 10.1128/JVI.01849-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Römer-Oberdörfer A, Werner O, Veits J, Mebatsion T, Mettenleiter TC. 2003. Contribution of the length of the HN protein and the sequence of the F protein cleavage site to Newcastle disease virus pathogenicity. J Gen Virol 84:3121–3129. doi: 10.1099/vir.0.19416-0 [DOI] [PubMed] [Google Scholar]
  • 33. Mou Y, Wang J, Wu J, He D, Zhang C, Duan C, Li B. 2019. Ferroptosis, a new form of cell death: opportunities and challenges in cancer. J Hematol Oncol 12:34. doi: 10.1186/s13045-019-0720-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Gryzik M, Asperti M, Denardo A, Arosio P, Poli M. 2021. NCOA4-mediated ferritinophagy promotes ferroptosis induced by erastin, but not by RSL3 in HeLa cells. Biochim Biophys Acta Mol Cell Res 1868:118913. doi: 10.1016/j.bbamcr.2020.118913 [DOI] [PubMed] [Google Scholar]
  • 35. Tang Q, Chen H, Mai Z, Sun H, Xu L, Wu G, Tu Z, Cheng X, Wang X, Chen T. 2022. Bim- and Bax-mediated mitochondrial pathway dominates abivertinib-induced apoptosis and ferroptosis. Free Radic Biol Med 180:198–209. doi: 10.1016/j.freeradbiomed.2022.01.013 [DOI] [PubMed] [Google Scholar]
  • 36. Ayala A, Muñoz MF, Argüelles S. 2014. Lipid peroxidation: production, metabolism, and signaling mechanisms of malondialdehyde and 4-hydroxy-2-nonenal. Oxid Med Cell Longev 2014:360438. doi: 10.1155/2014/360438 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Ma S, Tang T, Probst G, Konradi A, Jin C, Li F, Gutkind JS, Fu X-D, Guan K-L. 2022. Transcriptional repression of estrogen receptor alpha by YAP reveals the Hippo pathway as therapeutic target for ER+ breast cancer. Nat Commun 13:1061. doi: 10.1038/s41467-022-28691-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Huang Z, Guo H, Lin L, Li S, Yang Y, Han Y, Huang W, Yang J. 2023. Application of oncolytic virus in tumor therapy. J Med Virol 95:e28729. doi: 10.1002/jmv.28729 [DOI] [PubMed] [Google Scholar]
  • 39. Kooti W, Esmaeili Gouvarchin Ghaleh H, Farzanehpour M, Dorostkar R, Jalali Kondori B, Bolandian M. 2021. Oncolytic viruses and cancer, do you know the main mechanism? Front Oncol 11:761015. doi: 10.3389/fonc.2021.761015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Schirrmacher V. 2022. Molecular mechanisms of anti-neoplastic and immune stimulatory properties of oncolytic Newcastle disease virus. Biomedicines 10:562. doi: 10.3390/biomedicines10030562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Ding Y, Chen X, Liu C, Ge W, Wang Q, Hao X, Wang M, Chen Y, Zhang Q. 2021. Identification of a small molecule as inducer of ferroptosis and apoptosis through ubiquitination of GPX4 in triple negative breast cancer cells. J Hematol Oncol 14:19. doi: 10.1186/s13045-020-01016-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Yang L, Shi P, Zhao G, Xu J, Peng W, Zhang J, Zhang G, Wang X, Dong Z, Chen F, Cui H. 2020. Targeting cancer stem cell pathways for cancer therapy. Signal Transduct Target Ther 5:8. doi: 10.1038/s41392-020-0110-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Zanconato F, Cordenonsi M, Piccolo S. 2016. YAP/TAZ at the roots of cancer. Cancer Cell 29:783–803. doi: 10.1016/j.ccell.2016.05.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Li F-L, Guan K-L. 2022. The two sides of Hippo pathway in cancer. Semin Cancer Biol 85:33–42. doi: 10.1016/j.semcancer.2021.07.006 [DOI] [PubMed] [Google Scholar]
  • 45. Ma S, Meng Z, Chen R, Guan K-L. 2019. The Hippo pathway: biology and pathophysiology. Annu Rev Biochem 88:577–604. doi: 10.1146/annurev-biochem-013118-111829 [DOI] [PubMed] [Google Scholar]
  • 46. Zender L, Spector MS, Xue W, Flemming P, Cordon-Cardo C, Silke J, Fan S-T, Luk JM, Wigler M, Hannon GJ, Mu D, Lucito R, Powers S, Lowe SW. 2006. Identification and validation of oncogenes in liver cancer using an integrative oncogenomic approach. Cell 125:1253–1267. doi: 10.1016/j.cell.2006.05.030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Zhang J, Ji J-Y, Yu M, Overholtzer M, Smolen GA, Wang R, Brugge JS, Dyson NJ, Haber DA. 2009. YAP-dependent induction of amphiregulin identifies a non-cell-autonomous component of the Hippo pathway. Nat Cell Biol 11:1444–1450. doi: 10.1038/ncb1993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. He C, Mao D, Hua G, Lv X, Chen X, Angeletti PC, Dong J, Remmenga SW, Rodabaugh KJ, Zhou J, Lambert PF, Yang P, Davis JS, Wang C. 2015. The Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression. EMBO Mol Med 7:1426–1449. doi: 10.15252/emmm.201404976 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Lo Sardo F, Strano S, Blandino G. 2018. YAP and TAZ in lung cancer: oncogenic role and clinical targeting. Cancers (Basel) 10:137. doi: 10.3390/cancers10050137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. He C, Lv X, Huang C, Angeletti PC, Hua G, Dong J, Zhou J, Wang Z, Ma B, Chen X, Lambert PF, Rueda BR, Davis JS, Wang C. 2019. A human papillomavirus-independent cervical cancer animal model reveals unconventional mechanisms of cervical carcinogenesis. Cell Rep 26:2636–2650. doi: 10.1016/j.celrep.2019.02.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Wu Y, Zhang J, Zhang H, Zhai Y. 2016. Hepatitis B virus X protein mediates yes-associated protein 1 upregulation in hepatocellular carcinoma. Oncol Lett 12:1971–1974. doi: 10.3892/ol.2016.4885 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Hwang JH, Pores Fernando AT, Faure N, Andrabi S, Adelmant G, Hahn WC, Marto JA, Schaffhausen BS, Roberts TM. 2014. Polyomavirus small t antigen interacts with yes-associated protein to regulate cell survival and differentiation. J Virol 88:12055–12064. doi: 10.1128/JVI.01399-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Kandilya D, Maskomani S, Shyamasundar S, Tambyah PA, Shiao Yng C, Lee RCH, Hande MP, Mallilankaraman K, Chu JJH, Dheen ST. 2019. Zika virus alters DNA methylation status of genes involved in Hippo signaling pathway in human neural progenitor cells. Epigenomics 11:1143–1161. doi: 10.2217/epi-2018-0180 [DOI] [PubMed] [Google Scholar]
  • 54. Kaid C, Madi R, Astray R, Goulart E, Caires-Junior LC, Mitsugi TG, Moreno ACR, Castro-Amarante MF, Pereira LR, Porchia B, de Andrade TO, Landini V, Sanches DS, Pires CG, Tanioka RKO, Pereira MCL, Barbosa IN, Massoco CO, Ferreira L de S, Okamoto OK, Zatz M. 2020. Safety, tumor reduction, and clinical impact of Zika virus injection in dogs with advanced-stage brain tumors. Mol Ther 28:1276–1286. doi: 10.1016/j.ymthe.2020.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Garcia G, Jeyachandran AV, Wang Y, Irudayam JI, Cario SC, Sen C, Li S, Li Y, Kumar A, Nielsen-Saines K, French SW, Shah PS, Morizono K, Gomperts BN, Deb A, Ramaiah A, Arumugaswami V. 2022. Hippo signaling pathway activation during SARS-CoV-2 infection contributes to host antiviral response. PLoS Biol 20:e3001851. doi: 10.1371/journal.pbio.3001851 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Garcia G, Paul S, Beshara S, Ramanujan VK, Ramaiah A, Nielsen-Saines K, Li MMH, French SW, Morizono K, Kumar A, Arumugaswami V. 2020. Hippo signaling pathway has a critical role in Zika virus replication and in the pathogenesis of neuroinflammation. Am J Pathol 190:844–861. doi: 10.1016/j.ajpath.2019.12.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Zhang Q, Meng F, Chen S, Plouffe SW, Wu S, Liu S, Li X, Zhou R, Wang J, Zhao B, Liu J, Qin J, Zou J, Feng X-H, Guan K-L, Xu P. 2017. Hippo signaling governs cytosolic nucleic acid sensing through YAP/TAZ-mediated TBK1 blockade. Nat Cell Biol 19:362–374. doi: 10.1038/ncb3496 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Luo X, Zhang R, Lu M, Liu S, Baba HA, Gerken G, Wedemeyer H, Broering R. 2021. Hippo pathway counter-regulates innate immunity in hepatitis B virus infection. Front Immunol 12:684424. doi: 10.3389/fimmu.2021.684424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Lee JH, Kwon M, Lim WY, Yoo CR, Yoon Y, Han D, Ahn J-H, Yoon K. 2022. YAP inhibits HCMV replication by impairing STING-mediated nuclear transport of the viral genome. PLoS Pathog 18:e1011007. doi: 10.1371/journal.ppat.1011007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Liu Y, Beyer A, Aebersold R. 2016. On the dependency of cellular protein levels on mRNA abundance. Cell 165:535–550. doi: 10.1016/j.cell.2016.03.014 [DOI] [PubMed] [Google Scholar]
  • 61. Becker K, Bluhm A, Casas-Vila N, Dinges N, Dejung M, Sayols S, Kreutz C, Roignant J-Y, Butter F, Legewie S. 2018. Quantifying post-transcriptional regulation in the development of Drosophila melanogaster. Nat Commun 9:4970. doi: 10.1038/s41467-018-07455-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Taylor X, Cisternas P, You Y, You Y, Xiang S, Marambio Y, Zhang J, Vidal R, Lasagna-Reeves CA. 2020. A1 reactive astrocytes and a loss of TREM2 are associated with an early stage of pathology in a mouse model of cerebral amyloid angiopathy. J Neuroinflammation 17:223. doi: 10.1186/s12974-020-01900-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Liu K, Yu W, Wei W, Zhang X, Tian Y, Sherif M, Liu X, Dong C, Wu W, Zhang L, Chen J. 2019. Melatonin reduces intramuscular fat deposition by promoting lipolysis and increasing mitochondrial function. J Lipid Res 60:767–782. doi: 10.1194/jlr.M087619 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Rajkowska G, Mahajan G, Maciag D, Sathyanesan M, Iyo AH, Moulana M, Kyle PB, Woolverton WL, Miguel-Hidalgo JJ, Stockmeier CA, Newton SS. 2015. Oligodendrocyte morphometry and expression of myelin – related mRNA in ventral prefrontal white matter in major depressive disorder. J Psychiatr Res 65:53–62. doi: 10.1016/j.jpsychires.2015.04.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Rurek M, Czołpińska M, Pawłowski TA, Staszak AM, Nowak W, Krzesiński W, Spiżewski T. 2018. Mitochondrial biogenesis in diverse cauliflower cultivars under mild and severe drought. Impaired coordination of selected transcript and proteomic responses, and regulation of various multifunctional proteins. Int J Mol Sci 19:1130. doi: 10.3390/ijms19041130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Tseng C-C, Stanciauskas R, Zhang P, Woo D, Wu K, Kelly K, Gill PS, Yu M, Pinaud F, Lee AS. 2019. GRP78 regulates CD44V membrane homeostasis and cell spreading in tamoxifen-resistant breast cancer. Life Sci Alliance 2:e201900377. doi: 10.26508/lsa.201900377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Tschaharganeh DF, Chen X, Latzko P, Malz M, Gaida MM, Felix K, Ladu S, Singer S, Pinna F, Gretz N, Sticht C, Tomasi ML, Delogu S, Evert M, Fan B, Ribback S, Jiang L, Brozzetti S, Bergmann F, Dombrowski F, Schirmacher P, Calvisi DF, Breuhahn K. 2013. Yes-associated protein upregulates jagged-1 and activates the NOTCH pathway in human hepatocellular carcinoma. Gastroenterology 144:1530–1542. doi: 10.1053/j.gastro.2013.02.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Zheng X, Han H, Liu G-P, Ma Y-X, Pan R-L, Sang L-J, Li R-H, Yang L-J, Marks JR, Wang W, Lin A. 2017. LncRNA wires up Hippo and hedgehog signaling to reprogramme glucose metabolism. EMBO J 36:3325–3335. doi: 10.15252/embj.201797609 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Basu S, Totty NF, Irwin MS, Sudol M, Downward J. 2003. Akt phosphorylates the yes-associated protein, YAP, to induce interaction with 14-3-3 and attenuation of p73-mediated apoptosis. Mol Cell 11:11–23. doi: 10.1016/s1097-2765(02)00776-1 [DOI] [PubMed] [Google Scholar]
  • 70. Levy D, Adamovich Y, Reuven N, Shaul Y. 2008. Yap1 phosphorylation by c-Abl is a critical step in selective activation of proapoptotic genes in response to DNA damage. Mol Cell 29:350–361. doi: 10.1016/j.molcel.2007.12.022 [DOI] [PubMed] [Google Scholar]
  • 71. Zhou Y, Wang Y, Zhou W, Chen T, Wu Q, Chutturghoon VK, Lin B, Geng L, Yang Z, Zhou L, Zheng S. 2019. YAP promotes multi-drug resistance and inhibits autophagy-related cell death in hepatocellular carcinoma via the RAC1-ROS-mTOR pathway. Cancer Cell Int 19:179. doi: 10.1186/s12935-019-0898-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72. Zhao M, Zhang Y, Jiang Y, Wang K, Wang X, Zhou D, Wang Y, Yu R, Zhou X. 2021. YAP promotes autophagy and progression of gliomas via upregulating HMGB1. J Exp Clin Cancer Res 40:99. doi: 10.1186/s13046-021-01897-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Gao R, Kalathur RKR, Coto-Llerena M, Ercan C, Buechel D, Shuang S, Piscuoglio S, Dill MT, Camargo FD, Christofori G, Tang F. 2021. YAP/TAZ and ATF4 drive resistance to sorafenib in hepatocellular carcinoma by preventing ferroptosis. EMBO Mol Med 13:e14351. doi: 10.15252/emmm.202114351 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Gao J, Zhao N, Knutson MD, Enns CA. 2008. The hereditary hemochromatosis protein, HFE, inhibits iron uptake via down-regulation of Zip14 in HepG2 cells. J Biol Chem 283:21462–21468. doi: 10.1074/jbc.M803150200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. Wu K, Fei L, Wang X, Lei Y, Yu L, Xu W, Chen J, Zhu E, Zhong M, Huang M, Xi J, Yin F, Yan Z, Zhao X, Tang C, Patzak A, Liu X, Zheng Z. 2022. ZIP14 is involved in iron deposition and triggers ferroptosis in diabetic nephropathy. Metallomics 14:mfac034. doi: 10.1093/mtomcs/mfac034 [DOI] [PubMed] [Google Scholar]
  • 76. Yu Y, Jiang L, Wang H, Shen Z, Cheng Q, Zhang P, Wang J, Wu Q, Fang X, Duan L, Wang S, Wang K, An P, Shao T, Chung RT, Zheng S, Min J, Wang F. 2020. Hepatic transferrin plays a role in systemic iron homeostasis and liver ferroptosis. Blood 136:726–739. doi: 10.1182/blood.2019002907 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data of this study are available from the corresponding author upon request, without undue reservation.


Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES