Prevalence and genome features of lake sinai virus isolated from Apis mellifera in the Republic of Korea

Thi-Thu Nguyen; Mi-Sun Yoo; A-Tai Truong; So Youn Youn; Dong-Ho Kim; Se-Ji Lee; Soon-Seek Yoon; Yun Sang Cho

doi:10.1371/journal.pone.0299558

. 2024 Mar 19;19(3):e0299558. doi: 10.1371/journal.pone.0299558

Prevalence and genome features of lake sinai virus isolated from Apis mellifera in the Republic of Korea

Thi-Thu Nguyen ^1,^2,^#, Mi-Sun Yoo ^1,^#, A-Tai Truong ^1,³, So Youn Youn ¹, Dong-Ho Kim ¹, Se-Ji Lee ¹, Soon-Seek Yoon ¹, Yun Sang Cho ^1,^*

Editor: Olav Rueppell⁴

PMCID: PMC10950237 PMID: 38502683

Abstract

Lake Sinai Virus (LSV) is an emerging pathogen known to affect the honeybee (Apis mellifera). However, its prevalence and genomic characteristics in the Republic of Korea (ROK) remain unexplored. This study aimed to assess the prevalence of and analyze the LSVs by examining 266 honeybee samples from the ROK. Our findings revealed that LSV exhibited the highest infection rate among the pathogens observed in Korean apiaries, particularly during the reported period of severe winter loss (SWL) in A. mellifera apiaries in 2022. Three LSV genotypes– 2, 3, and 4 –were identified using RNA-dependent RNA polymerase gene analysis. Importantly, the infection rates of LSV2 (65.2%) and LSV3 (73.3%) were significantly higher in colonies experiencing SWL than in those experiencing normal winter loss (NWL) (p < 0.03). Furthermore, this study provides the first near-complete genome sequences of the Korean LSV2, LSV3, and LSV4 strains, comprising 5,759, 6,040, and 5,985 nt, respectively. Phylogenetic analysis based on these near-complete genome sequences demonstrated a close relationship between LSVs in the ROK and China. The high LSV infection rate in colonies experiencing a heightened mortality rate during winter suggests that this pathogen might contribute to SWL in ROK. Moreover, the genomic characteristic information on LSVs in this study holds immense potential for epidemiological information and the selection of specific genes suitable for preventing and treating LSV, including the promising utilization of RNA interference medicine in the future.

Introduction

Honeybee (Apis mellifera) pathogens play a crucial role in colony decline, with some viruses causing symptomatic infections, whereas others remain uncharacterized [1–3]. Among these, the Lake Sinai Virus (LSV) is prevalent in weak or collapsed colonies [4]. However, the specific symptoms of LSV infection remain unclear, posing challenges to its detection in apiaries [4]. LSV infections are often observed alongside other viral and bacterial infections, leading to colony loss [2]. It has been recently reported to affect honeybees [4–7], LSVs were first discovered in the United States (US) surveys [2,7] and subsequently demonstrated to be widespread in the US [4,8,9]. Since then, LSV strains have been widely reported worldwide, including in Spain, Belgium, Türkiye, Germany, Australia, Slovenia, China, Japan, and the Republic of Korea (ROK) [2,10–18]. However, limited information exists regarding LSV infections in Korean apiaries. Therefore, determining the presence of LSV in apiaries suffering from severe winter loss (SWL) is helpful for understanding the influence of this pathogen in ROK.

LSV is a positive-sense single-stranded RNA virus. The genome characteristics of LSV encompass three main genes: 1) the first non-structural protein (NS1), 2) RNA-dependent RNA polymerase (RdRp), and 3) Capsid protein (CP) [4,7,19,20]. Additionally, the genome contains a region for the second non-structural protein (NS2). The NS1 (also known as open reading frames 1 (ORF1)) has an unclear function [19]. RdRp regions (ORF2) of LSV are responsible for viral RNA replication, making it essential for viral propagation [5]. The capsid region (ORF3) plays a crucial role in the virus lifecycle, as it recognizes the host and assembles the virus capsid [19]. Meanwhile, the NS2 region (ORF4) can potentially facilitate infection in arthropod hosts, but its specific role remains under investigation [21]. Continuous molecular surveys are underway to assess the relative conservation of various LSV strains due to the significant diversity observed among them. Presently, species-specific RdRp phylogenetic analyses have led to the identification of two phylogenetic clusters known as LSV1 and LSV2 [7]. Furthermore, there exist strains labeled as sister strains, potentially representing recombinants of LSV1 and LSV2, with designations on the National Center for Biotechnology (NCBI) such as LSV3–LSV8, LSV NE, LSV SA1, LSV SA2, LSV TO. Discrimination among these strains relies heavily on molecular surveys, including PCR-based methods, RT–PCR, real–time RT–PCR, and metagenomics. It is noteworthy that the primers utilized for variant detection have, thus far, not exhibited sensitivity to all known genotypes [3,4,7,9,22]. Notably, Faurot-Daniels et al. found a correlation between LSV2 prevalence and high colony loss in honeybees [23], suggesting that this virus contributes to colony collapse [2,4,5,20,22]. Although the pathogenicity and specific symptoms of LSV infection in colonies have not been well defined [1–3], the pathogen is assumed to weaken the immune system of honeybees, making them more susceptible to other pathogens and stressors [19]. Due to the lack of symptomatic features of LSV in honeybees, molecular biological diagnosis becomes imperative for detecting the infection levels of this virus within honeybee apiaries. LSV is not only detected in honey bees but has also been identified in certain ant species [20], on pollen loads and Varroa destructor [4], and wild bumblebee hosts (namely Bombus pascuorum, Bombus lapidaries, Bombus pratorum, Bombus atratus [24,25], sweat bee (Halictus ligatus) [9], solitary bees (Andrena vaga, Osmia bicornis, Osmia cornuta) [26], mining bee (Andrena spp.) [3,27], and Vespids (Hornet) [28]. Furthermore, studies have identified LSVs in honeybee population experiencing colony collapse disorder and weakened hive conditions [2,4,6,23]. Interestingly, Daughenbaugh et al. [4] have observed discrepancies in the detection rates of LSVs between strong and weak colonies, potentially highlighting a complex association between viral presence and colony health. Therefore, understanding the prevalence of LSV in honeybee colonies is vital for identifying the factors contributing to colony collapse disorder.

Accordingly, the present study aimed to detect LSV variants (LSV2, LSV3, and LSV4) in honeybees collected from ROK and analyze the characteristic near-complete genome sequences of the identified LSV variants (LSV2, LSV3, and LSV4) within the country. This study reported the utilization of a shared LSV primer pair for variant detection and investigated the relationship between LSV variants and SWL. Furthermore, phylogenetic analyses were performed to establish the relationship between Korean LSVs and those detected in other countries.

Materials and methods

Collection of honeybee samples

The worker bees (n = 10~30) were collected from each of 266 honeybee colonies from 137 apiaries in different provinces of ROK between January and August 2022. The honeybee samples in this study were collected based on the observed decline in the vitality of adult honeybees and an unusual decrease in the population. The symptoms within honeybee colonies corresponded to the phenomenon of SWL or Colony Collapse Disorder (CCD). The number of honeybee samples collected depended on the number of lost honeybee colonies in each apiary. These honeybee colonies in apiaries are chiefly dedicated to honey harvesting, typically remaining fixed at a specific location. Among them, 141 honeybee samples from 57 apiaries in 5 provinces were collected from January to March 2022, of which 115 and 26 were suffering from SWL and normal winter loss (NWL), respectively (S1 Table). The remaining 125 samples collected from April to August were obtained from healthy colonies. Live samples were collected in 50–mL falcon tubes, and the samples were transferred to a laboratory and stored at –80°C for further analysis. This study did not require ethical approval since it did not include vertebrates or cephalopods.

Total nucleic acid extraction and detection of honeybee pathogens

The total nucleic acids of the honeybee samples were extracted following a previously reported method [29] using a Maxwell^® RSC viral total nucleic acid purification kit (Promega, Madison, WI, USA). First-strand complementary DNA (cDNA) was generated from nucleic acids using GoScript^TM Reverse Transcriptase (Promega) in conjunction with an oligo(dT) primer, according to the manufacturer’s instructions.

The presence of LSV2 in honeybee samples was confirmed by amplification of the RdRp gene from cDNA using primer pair LSV-For:5′–GCTTGTCGTGGATTCTGGTC–3′ and LSV-Rev:5′–CTCAGCACGAAATCGCTCAA–3′. The primer pairs were designed based on the LSV2 sequence (NCBI accession number: HQ888865.2). Positive detection of LSV2, LSV3, and LSV4 was confirmed using three genotype-specific primer pairs (S1 Fig and S2 Table). Finally, a sequence analysis was performed using the RdRp region of each genotype. PCR was performed using AccuPower^® PCR PreMix (Bioneer, Daejeon, ROK). The 20-μL reaction mix comprised 2 μL cDNA template (20 ng/μL), 1 μL of each primer (10 pmol), and 16 μL ddH₂O. The PCR reaction conditions were as follows: 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min, followed by a final elongation step at 72°C for 10 min. The amplified PCR products were resolved by 1% agarose gel electrophoresis. DNA bands were stained with ethidium bromide (0.5 μg/mL) and visualized under UV light. The fragment was purified using a QIAquick^® gel extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. LSVs sequencing was performed using a Sanger sequencing instrument (Macrogen, Seoul, ROK) and analyzed using BioEdit 7 and ClustalX software (Informer Technologies, Inc., Los Angeles, CA, USA) [30,31]. Specific primers for detecting each LSV genotype (LSV2, LSV3, and LSV4) (S2 Table) were designed for real–time RT–PCR. The real-time RT–PCR reaction mix comprised 10 μL of 2× SYBR Mix, 0.5 μL (10 pmol) of each primer, 1 μL of template DNA (20 ng/μL), and 8 μL of ddH₂O. The optimal cycling conditions were as follows: an initial denaturation step at 94°C for 2 min, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s. A melting curve dissociation analysis was performed to verify the specificity of PCR amplification. These positive controls utilized in this study were constructed through the amplification of RpRd gene of LSVs (LSV2, LSV3, and LSV4) from Korean honeybees, subsequently cloned into pGem–T vector and transferred to Escherichia coli DH5α cells. Negative and positive controls were included for each run. All experiments were performed in triplicate for each sample. Samples with a C_t value ≤ 35 and consistent melting curves were considered positive. To determine the correlation between LSVs (LSV2, LSV3, and LSV4) and SWL, we investigated the presence of LSVs in 141 honeybee colonies collected from 54 apiaries from January to March 2022, of which 115 were identified as having SWL and 26 with NWL. The LSV2 surveillance was then extended to another 125 honeybee colonies collected from April to August 2022

Sequence analysis and LSVs genome assembly

The nucleotide sequences of LSVs (LSV2, LSV3, and LSV4) were searched and compared to nucleotide sequence databases using the NCBI nucleotide Basic Local Alignment Search Tool (BLASTn). After confirming the presence of LSVs (LSV2, LSV3, and LSV4) using the detection primer pair described above, cDNA was used to amplify different fragments of the near-complete genomes of LSV2, LSV3, and LSV4 (Fig 1 and S3 Table). The alignment was generated and trimmed to the nucleotide sequences of LSVs (LSV2, LSV3, and LSV4) in BioEdit program [32]. Sequence assembly for each genotype was performed by comparing LSV2, LSV3, and LSV4 reference sequences with the NCBI accession numbers LR655824.1, MZ821900.1, and MZ821852.1, respectively.

Fig 1 — NS1, first nonstructural protein region; RdRp, RNA-dependent RNA polymerases; CP, Capsid protein; NS2, second nonstructural protein region. F1 to F5 denote forward primers, and R1 to R5 denote reverse primers. The details of primers are shown in S3 Table. CDS, coding sequences; ORF, open reading frame; LSVs, Lake Sinai Viruses.

Phylogenetic tree analysis

Phylogenetic analysis was performed using the overlapping RdRp region (460 nt) of LSV3 and LSV4, as previously described [18]. The overlapping RdRp region were alignment and edited and calculated after a complete alignment using the BioEdit version 7 [32]. Multiple alignments were performed using ClustalX [33]. Evolutionary distances were calculated using the Kimura two-parameter model [34]. Phylogenetic trees of LSVs were constructed based on the RdRp gene using the neighbor-joining method [35], with bootstrap values based on 1,000 replications in Mega X [36].

Data analysis

The likelihood ratio chi-square test of contingency was applied to compute the probability of equal pathogen incidence in SWL and NWL, and the prevalence of LSV2, LSV3, and LSV4 across different sampled regions was compared using the Kruskal-Wallis H test. Statistical significance was considered at p < 0.05.

Results

Detection of LSVs in Korean apiaries

LSV2 was detected in 266 honeybee colonies was 60.9% (162/266) in ROK. A comparison of the presence of LSV2 in different provinces of ROK revealed a statistically significant variation in LSV2 infection rates (p = 0.011). Among the LSV2-positive samples, the highest prevalence of LSV2 was observed in Gyeongsangbuk-do (32.5%), followed by Gyeongsangnam-do (21.6%), and Jeollanam-do (17.3%) (Fig 2).

Fig 2 — The LSV2 isolated from honeybee samples between January and August 2022, according to sampling provinces in the Republic of Korea (ROK). Provinces are shaded according to the percentage of colonies testing positive for LSV2.

Notably, when specific primers targeting LSV2 with a target size of 218 bp were employed, additional bands of varying sizes of 460 and 1,000 bp appeared in some samples on a 1% agarose gel (S2 Fig). Sequence analysis revealed that the identified sequences exhibited the greatest resemblance to LSV2 (94.5%; MZ281853), followed by LSV3 (97.6%; MZ821878) and LSV4 (98.4%; MZ281893) (S3 Fig). This lower percent of identified sequences for LSV2 compared to the others is likely due to several nucleotide mutations within the short amplified region (218 bp) compared to the reference sequence in NCBI. The RdRp region of each genotype was amplified for phylogenetic analysis using the 460 nt RdRp region of the detected LSV in the ROK, confirming that the LSV in Korean apiaries belonged to three different genotypes: LSV2, LSV3, and LSV4 (Fig 3). LSV2, LSV3, and LSV4 in the ROK were in the same cluster as lineages originating from China and Japan rather than those observed in European countries (Fig 3). Additionally, the nucleotide identities of the RdRp-encoding gene of LSV2 were 73.2 and 73.8% relative to LSV3 and LSV4, respectively. Additionally, the similarity between the RdRp-encoding genes of LSV3 and LSV4 was 76.9%.

Fig 3 — The tree was constructed using 460 nt of the RNA-dependent RNA polymerase (RdRp) region of the detected Lake Sinai Viruses (LSVs) and the NCBI reference sequences of different genotypes. The strains identified in this study–LSV2, LSV3, and LSV4 –are marked with a black dot. Genotype name, NCBI accession number, and country name of each isolate are shown.

Prevalence of LSVs in severe and normal winter loss

A comparison of the LSVs (LSV2, LSV3, and LSV4) in SWL and NWL was conducted in 141 honeybee samples (SWL: n = 115 and NWL: n = 26). The analysis revealed a significant difference in the infection rates of LSV2 (p = 0.031) and LSV3 (p = 0.001) between the samples from colonies with SWL and those with NWL. However, no significant difference was observed in LSV4 between the SWL and NWL samples (p = 0.456). The LSV genotypes among the SWL colonies were as follows: LSV2 (65.2%), LSV3 (73.9%), and LSV4 (30.4%). In contrast, NWL samples exhibited the following distributions: LSV2 (42.3%), LSV3 (38.5%), and LSV4 (23.1%) (Fig 4). The overall LSV infection rate was 83.3% (96/115) in the SWL colonies and 69.2% (18/26) in the NWL colonies.

Fig 4 — Honeybee samples were obtained from 141 honeybee colonies in 57 apiaries in the Republic of Korea. Statistical comparison of the infection rate of each LSV genotype between severe winter loss (SWL) and normal winter loss (NWL) colonies was conducted using likelihood ratio chi-square test analysis. * and ** indicate significant differences at p < 0.05 and p < 0.01, respectively. “ns” indicates not significant differences.

In 2022, five of the nine provinces in the ROK had information on SWL. All three LSV genotypes were identified in four provinces: Jeollanam-do, Jeollabuk-do, Gyeongsangnam-do, and Gyeongsangbuk-do, whereas only LSV2 was detected in Jeju-do (Fig 5). Based on observational data, two colonies exhibited a 100% LSV2 infection rate in Jeju-do. In Jeollanam-do, out of 25 colonies, the infection rates for LSV2, LSV3, and LSV4 were 48.0, 44.0, and 32.0%, respectively. Among the 35 colonies from Jeollabuk-do, the corresponding infection rates of LSV2, LSV3, and LSV4 were 51.4, 77.1, and 37.1%, respectively. In Gyeongsangnam-do, out of 32 colonies, the infection rates for LSV2, LSV3, and LSV4 were 84.4, 96.9, and 15.6%, respectively. Among the 21 colonies in Gyeongsangbuk-do, LSV2, LSV3, and LSV4 infection rates were 90.5, 95.2, and 61.9%, respectively. The Kruskal-Wallis H test indicated that there is a non-significant difference between the different provinces (p = 0.497).

Fig 5 — LSV2, Lake Sinai Virus 2; LSV3, Lake Sinai Virus 3; LSV4, Lake Sinai Virus 4.

Characteristic genome analysis of LSV

The near-complete genome of the three genotypes LSV2, LSV3, and LSV4 were sequenced and assembled; their near-complete genome sequences contained 5,759, 5,792, and 5,985 nt, respectively.

The phylogenetic variation is consistent with nucleotide similarity among the isolates. In the first main branch, the near-complete genome sequences of LSV2, LSV3 and LSV4 isolate from Korean honeybees were similarity with group isolate to China. As shown in the tree, the LSV isolates from ROK had a closer genetic relationship with a species of LSV isolated from China (Fig 6).

Fig 6 — The optimal tree is shown. The evolutionary distances were computed using the Kimura 2-parameter method. A, LSV2 genome feature (5,759 nt); B, LSV3 genome feature (6,040 nt); C, LSV4 genome feature (5,985 nt). (References strains in NCBI were shown in S4–S6 Tables).

The near-complete genome feature of LSV2 comprised 5,759 nt, containing the first nonstructural protein segment (NS1; from 39 to 2,576 nt), which overlapped with the RdRp segment (RdRp; from 1,813 to 3,681 nt), capsid protein segment (CP; from 3,700 to 5,262 nt), and the second nonstructural protein segment (NS2; from 5,307 to 5,759 nt) (S4 Table). LSV2 isolates had higher nucleotide similarity (96.4–98.6%) with Chinese isolates than with isolates from other countries (92.1–94.5%). The nucleotide length of NS1 in LSV2 was 2,538 nt, differing from those of other isolates, such as MZ821853.1 from China, KY465707.1 and KY465706.1 from Australia, KY354241.1 and NC035116.1 from Tonga, and OL803840.1 from the Czech Republic (S4 Table). The near-complete genome feature of LSV3 contained NS1 (31–2619 nt), which overlapped with RdRp (1,847–3,715 nt), CP (3,736–5,292 nt), and NS2 (5,335–5,787 nt) (S5 Table). The genome sequence of LSV3 aligned with another genome sequence of LSV3 deposited in GenBank, ranging from 84.5 to 98.7%. Multiple sequence comparisons revealed that the Korean LSV3 sequence was similar to that from China. The heterogeneity of the LSV3 genome sequence was reflected in the variance in the sequence identity of different genes: 82.2–98.7% for NS1, 85.0–98.5% for RdRp, 81.7–97.9% for CP, and 88.2–98.7% for NS2 (S5 Table). The structure of the LSV4 genome sequence was identified and included NS1 with a size of 2,549 nt (67–2,616 nt), RdRp (1,844–3,712 nt), CP (3,736–5,292 nt), and NS2 (5,334–5,786 nt). The near-complete genome sequence of LSV4 showed heterogeneity in the variance of sequence identity of different genes: 90.4–97.7% for NS1, 91.5–98.1% for RdRp, 90.3–97.9% for CP, and 90.3–98.2% for NS2 (S6 Table).

Discussion

This study was conducted to identify the prevalence of LSVs (LSV2, LSV3, and LSV4) in Korean apiaries, analyze the near-complete genome features of three LSV genotypes in the ROK, and compare the infection rates of LSV genotypes in SWL and NWL. The infection rate of LSV2 in the ROK was remarkably high (60.9% of the collected samples). The LSV2 infection rate was considerably higher than those of other prevalent honeybee pathogens in ROK, including Nosema ceranae, deformed wing virus, sacbrood virus, and black queen cell virus [29]. These results suggest that LSV2 and LSV3 may significantly impact honeybee health and influence colony decline in ROK, and control measures for this novel pathogen in Korean apiaries are needed.

The LSVs (LSV1 and LSV2) were first detected and described in honeybee colonies in the US [7]. Subsequently, its occurrence has been reported about the prevalence of LSV variants in honeybee populations in many countries, including Germany, Australia, Slovenia, the Czech Republic, Africa, Iran, and Japan [4,11,12,15,18,35,36]. While investigating the presence of LSV1 swarms within our study, we did not detect the virus in any of the collected honeybee samples. Notable, other LSV variants including LSV2, LSV3, and LSV4 were successfully identified throughout the surveyed honeybee apiaries. This observation aligns with findings from Kwon et al. [16], which employed a metagenomic approach to uncover diverse viral elements present in Korean honeybee colonies. Hou et al. [37] reported the absence of strain C (belong to LSV1 sister group) in honeybees in China to date. This highlights the potential diversity of LSV strains, which may have implications for honeybee health and disease management. The detection of LSV3 and LSV4 using LSV2-specific primers could be attributed to PCR detection bias during intermediary sapling or primer design. In the current study, the total LSV2 infection rate in honeybee samples from the ROK was 60.9% (162/266). Honeybee colonies exhibiting signs of SWL in ROK demonstrated a remarkably high rate of positive LSVs (LSV2, LSV3, and LSV4) detection, reaching approximately 83.3% of the total detected cases. This underscores the urgent need to investigate the origin of this disease and implement appropriate measures to control LSV in Korean apiaries.

Previous research by Ravoet et al. [38] suggested that LSV might be present in pollen and Varroa mites. Experimental evidence has demonstrated the potential for cross-species transmission of honeybee viruses, including LSV, via interactions with V. destructor mites [8,39,40]. These mites have been implicated as a vector in the transmission of various viruses in honeybees, such as Israeli acute paralysis virus, deformed wing virus, Kashmir bee virus, V. destructor virus-1, black queen cell virus, and LSV [4,15,35,41–43]. This study showed the presence of LSV2 and LSV3 in V. destructor mites associated with honeybee colonies but failed to detect LSV4 in any mite samples across the twelve surveyed honeybee colonies (S7 Table). This could be because LSV4 exists at very low concentrations within mites, making detection more challenging than for the identified LSV2 and LSV3 strains. Alternatively, the LSV4 might exhibit uneven distribution within bee colonies, leading to an inconsistent presence in mite populations. Additionally, the chosen sampling methodology might not have been sufficiently sensitive to detect LSV4, requiring the exploration of alternative approaches. Further research is crucial to elucidate the complex relationships between LSVs and its honeybee and mite hosts. Unraveling the primary transmission routes of LSVs will equip beekeepers with critical knowledge to implement effective disease management strategies and safeguard the health of honeybee colonies. There are many variants of LSV in honeybee apiaries, and pathogenicity varies among genotypes, making it difficult to control diseases caused by LSV in apiaries. The three LSV genotypes (LSV2, LSV3, and LSV4) and the feature near-complete genome information identified in this study are important for further studies to determine the virulence of LSV in Korean apiculture and to select highly pathogenic genotypes for viral treatments such as RNA interference. The prevalence of LSV2 is closely associated with weaker colonies [23]. In the present study, SWL colonies showed a high LSV infection rate, indicating that LSV may also contribute to SWL in the ROK. However, further studies are required to understand the interactions between LSV genotypes and other pathogens, environmental stressors, and the multifaceted, complex factors contributing to SWL and colony collapse disorder in honeybee colonies.

Analysing the RdRp nucleotide sequences of LSV2, LSV3, and LSV4, our phylogenetic trees revealed a close relationship between Korean LSV strains and those found in China. Furthermore, these Korean strains clearly differed from LSV strains obtained from the US and Belgium. These findings align with previous research by Hou et al. [37] and Kwon et al. [16], suggesting an epidemiological link between the ROK and China. Additionally, the near-completeness of our 2022 Korean LSV2, LSV3, and LSV4 strain genomes offers valuable insights into the diversity within Korean bee populations. Therefore, it is important to extend the study to the surveillance of other LSV genotypes and the impact of each genotype on beekeeping in the country.

Supporting information

S1 Fig. Primers designed for specific detection of LSV genotypes.

The positions of the forward and reverse primers inside the RdRp-encoding genes are marked. Sequences of each LSV genotype with NCBI accession numbers are shown.

(ZIP)

pone.0299558.s001.zip^{(10.4MB, zip)}

S2 Fig. Amplification of LSV from honeybee samples using LSV2-specific primers.

The PCR products were amplified using an LSV2-specific primer pair. Lanes 1–4, 5, and 7 show the PCR products of the LSV amplification of LSV2 (218 bp); lanes 6, 8, and 9 show the bands for LSV3 (460 bp); lanes 10 and 12 show bands for LSV4 (1,000 bp); lane “-”, Negative control; lane M, 100 bp DNA marker ladder (Enzynomics, Daejeon, ROK).

(TIF)

pone.0299558.s002.tif^{(8.7MB, tif)}

S3 Fig. Alignment of Lake Sinai Virus 2, 3, and 4 sequences from honeybee samples.

The sequences of LSV2, LSV3, and LSV4 isolated from honeybee samples were sequenced using forward and reverse primers of LSV2. The reference sequence of each LSV genotype with its NCBI accession number is shown.

(TIF)

pone.0299558.s003.tif^{(1.5MB, tif)}

S1 Table. Severe and normal winter loss information of honeybee colonies in the Republic of Korea, 2022.

(XLSX)

pone.0299558.s004.xlsx^{(19.3KB, xlsx)}

S2 Table. Primers used for detecting LSV2, LSV3, and LSV4.

(DOCX)

pone.0299558.s005.docx^{(15.7KB, docx)}

S3 Table. Primers used for determining the Lake Sinai Virus genome.

(DOCX)

pone.0299558.s006.docx^{(20.3KB, docx)}

S4 Table. Comparison of the near-complete genome feature of LSV2/Korea-2022 with reference strains in GenBank.

(DOCX)

pone.0299558.s007.docx^{(17.2KB, docx)}

S5 Table. Comparison of the near-complete genome feature of LSV3/Korea-2022 with reference strains in GenBank.

(DOCX)

pone.0299558.s008.docx^{(16.8KB, docx)}

S6 Table. Comparison of the near-complete genome feature of LSV4/Korea-2022 with reference strains in GenBank.

(DOCX)

pone.0299558.s009.docx^{(16.7KB, docx)}

S7 Table. Detection of Lake Sinai Virus in Varroa destructor and Apis mellifera.

(DOCX)

pone.0299558.s010.docx^{(18.6KB, docx)}

Acknowledgments

Our heartfelt thanks go to the beekeepers who facilitated the sampling. We extend our appreciation to all members of our laboratories for their unwavering dedication and diligent efforts.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

YSC N-1543081-2021-25-03 Animal and Plant Quarantine Agency https://www.qia.go.kr/listindexWebAction.do The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Beaurepaire A, Piot N, Doublet V, Antunez K, Campbell E, Chantawannakul P, et al. Diversity and global distribution of viruses of the western honey bee, Apis mellifera. Insects. 2020; 11(4):239. doi: 10.3390/insects11040239 . [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Cornman RS, Tarpy DR, Chen Y, Jeffreys L, Lopez D, Pettis JS, et al. Pathogen webs in collapsing honey bee colonies. PLoS ONE. 2012; 7(6):e43562. doi: 10.1371/journal.pone.0043562 . [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Dolezal AG, Hendrix SD, Scavo NA, Carrillo-Tripp J, Harris MA, Wheelock MJ, et al. Honey bee viruses in wild bees: viral prevalence, loads, and experimental inoculation. PLoS ONE. 2016; 11(11):e0166190. doi: 10.1371/journal.pone.0166190 . [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Daughenbaugh KF, Martin M, Brutscher LM, Cavigli I, Garcia E, Lavin M, et al. Honey bee infecting Lake Sinai viruses. Viruses. 2015; 7(6):3285–3309. doi: 10.3390/v7062772 . [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Cornman RS. Relative abundance and molecular evolution of Lake Sinai Virus (Sinaivirus) clades. PeerJ. 2019; 7:e6305. doi: 10.7717/peerj.6305 . [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Glenny W, Cavigli I, Daughenbaugh KF, Radford R, Kegley SE, Flenniken ML. Honey bee (Apis mellifera) colony health and pathogen composition in migratory beekeeping operations involved in California almond pollination. PLoS ONE. 2017; 12:e0182814. doi: 10.1371/journal.pone.0182814 . [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Runckel C, Flenniken ML, Engel JC, Ruby JG, Ganem D, Andino R, et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 2011; 6(6):e20656. doi: 10.1371/journal.pone.0020656 . [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Ravoet J, De Smet L, Wenseleers T, De Graaf DC. Genome sequence heterogeneity of Lake Sinai virus found in honey bees and Orf1/RdRP-based polymorphisms in a single host. Virus Res. 2015; 201:67–72. doi: 10.1016/j.virusres.2015.02.019 . [DOI] [PubMed] [Google Scholar]
9.Iwanowicz DD, Wu-Smart JY, Olgun T, Smart AH, Otto CR, Lopez D, et al. An updated genetic marker for detection of Lake Sinai Virus and metagenetic applications. PreerJ. 2020; 8:e9424. doi: 10.7717/peerj.9424 . [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Cepero A, Ravoet J, Gómez-Moracho T, Bernal JL, Del Nozal MJ, Bartolomé C, et al. Holistic screening of collapsing honey bee colonies in Spain: a case study. BMC Res Notes. 2014; 7:649. doi: 10.1186/1756-0500-7-649 . [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Čukanová E, Moutelíková R, Prodělalová J. First detection of Lake Sinai virus in the Czech Republic: a potential member of a new species. Arch Virol. 2022; 167(11):2213–2222. doi: 10.1007/s00705-022-05548-x . [DOI] [PubMed] [Google Scholar]
12.D’Alvise P, Seeburger V, Gihring K, Kieboom M, Hasselmann M. Seasonal dynamics and co‐occurrence patterns of honey bee pathogens revealed by high‐throughput RT‐qPCR analysis. Ecol Evol. 2019; 9(18):10241–10252. doi: 10.1002/ece3.5544 . [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Granberg F, Vicente-Rubiano M, Rubio-Guerri C, Karlsson OE, Kukielka D, Belák S, et al. Metagenomic detection of viral pathogens in Spanish honeybees: co-infection by aphid lethal paralysis, Israel acute paralysis and Lake Sinai viruses. PLoS ONE. 2013; 8(2):e57459. doi: 10.1371/journal.pone.0057459 . [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Roberts JMK, Anderson DL, Durr PA. Absence of deformed wing virus and Varroa destructor in Australia provides unique perspectives on honeybee viral landscapes and colony losses. Sci Rep. 2017; 7(1):6925. doi: 10.1038/s41598-017-07290-w . [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Kitamura Y, Asai T. First detection of Lake Sinai virus in honeybees (Apis mellifera) and wild arthropods in Japan. J Vet Med Sci. 2022; 84(3):346–349. doi: 10.1292/jvms.21-0466 . [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Kwon M, Jung C, Kil EJ. Metagenomic analysis of viromes in honey bee colonies (Apis mellifera; Hymenoptera: Apidae) after mass disappearance in Korea. Front Cell Infect Microbiol. 2023; 13:1124596. doi: 10.3389/fcimb.2023.1124596 . [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Ravoet J, Maharramov J, Meeus I, De Smet L, Wenseleers T, Smagghe G, et al. Comprehensive bee pathogen screening in Belgium reveals Crithidia mellificae as a new contributory factor to winter mortality. PLoS ONE. 2013; 8(8):e72443. doi: 10.1371/journal.pone.0072443 . [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Šimenc L, Kuhar U, Jamnikar-Ciglenečki U, Toplak I. First complete genome of Lake Sinai virus lineage 3 and genetic diversity of Lake Sinai virus strains from honey bees and bumble bees. J Econ Entomol. 2020; 113(3):1055–1061. doi: 10.1093/jee/toaa049 . [DOI] [PubMed] [Google Scholar]
19.Chen NC, Wang CH, Yoshimura M, Yeh YQ, Guan HH, Chuankhayan P, et al. Structures of honeybee-infecting lake Sinai virus reveal domain functions and capsid assembly with dynamic motions. Nat Commun. 2023; 14(1):545. doi: 10.1038/s41467-023-36235-3 . [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Bigot D, Dalmon A, Roy B, Hou C, Germain M, Romary M, et al. The discovery of Halictivirus resolves the Sinaivirus phylogeny. J Gen Virol. 2017; 98(11):2864–2875. doi: 10.1099/jgv.0.000957 . [DOI] [PubMed] [Google Scholar]
21.Karlin D. An overlooked protein domain, WIV, is found a wide number of arthropod viruses and probably facilitates infection. Preprints. 2023. 10.20944/preprints202306.0194.v1 [DOI] [PubMed] [Google Scholar]
22.Traynor KS, Rennich K, Forsgren E, Rose R, Pettis J, Kunkel G, et al. Multiyear survey targeting disease incidence in US honey bees. Apidologie. 2016; 47:325–347. 10.1007/s13592-016-0431-0 [DOI] [Google Scholar]
23.Faurot-Daniels C, Glenny W, Daughenbaugh KF, McMenamin AJ, Burkle LA, Flenniken ML. Longitudinal monitoring of honey bee colonies reveals dynamic nature of virus abundance and indicates a negative impact of Lake Sinai virus 2 on colony health. PLoS ONE. 2020; 15(9):e0237544. doi: 10.1371/journal.pone.0237544 . [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Parmentier L, Smagghe G, de Graaf DC, Meeus I. Varroa destructor Macula-like virus, Lake Sinaivirus and other new RNA viruses in wild bumblebee hosts (Bombus pascuorum, Bombus lapidarius and Bombus pratorum). J Invertebr Pathol. 2016; 134:6–11. doi: 10.1016/j.jip.2015.12.003 . [DOI] [PubMed] [Google Scholar]
25.Gamboa V, Ravoet J, Brunain M, Smagghe G, Meeus I, Figueroa J, et al. Bee pathogens found in Bombus atratus from Cambodia: a case study. J Invertebr Pathol. 2015; 129:36–39. doi: 10.1016/j.jip.2015.05.013 . [DOI] [PubMed] [Google Scholar]
26.Ravoet J, De Smet L, Meeus I, Smagghe G, Wenseleers T, de Graaf DC. Widespead occurrence of honey bee pathogens in solitary bees. J invertebr Pathol. 2014; 122:55–58. doi: 10.1016/j.jip.2014.08.007 . [DOI] [PubMed] [Google Scholar]
27.Daughenbaugh KF, Kahnonitch I, Carey CC, McMenamin AJ, Wiegand T, Erez T, et al. Metatranscriptome analysis of sympatric bee species identifies bee virus variants and a new virus, Andrena-associated bee virus-1. Viruses. 2021; 13(2):291. doi: 10.3390/v13020291 . [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Yang S, Gayral P, Zhao H, Wu Y, Jiang X, Wu Y, et al. Occurrence and molecular phylogeny of honey bee viruses in Vespids. Viruses. 2019; 12(1):6. doi: 10.3390/v12010006 . [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Truong AT, Yoo MS, Seo SK, Hwang TJ, Yoon SS, Cho YS. Prevalence of honey bee pathogens and parasites in South Korea: A five-year surveillance study from 2017 to 2021. Heliyon. 2023; 9(2):e13494. doi: 10.1016/j.heliyon.2023.e13494 . [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Hall T. BioEdit version 7.0.0; 2004. Distributed by the Author, website. Available from: www.mbio.ncsu.edu/BioEdit/bioedit.html [Google Scholar]
31.Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007; 23(21):2947–2948. doi: 10.1093/bioinformatics/btm404 . [DOI] [PubMed] [Google Scholar]
32.Kimura M. The neutral theory of molecular evolution. Sci Am. 1979; 241(5):98–100. doi: 10.1038/scientificamerican1179-98 [DOI] [PubMed] [Google Scholar]
33.Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987; 4(4):406–425. doi: 10.1093/oxfordjournals.molbev.a040454 . [DOI] [PubMed] [Google Scholar]
34.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018; 35(6):1547–1549. doi: 10.1093/molbev/msy096 . [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Amakpe F, De Smet L, Brunain M, Ravoet J, Jacobs FJ, Reybroeck W, et al. Discovery of Lake Sinai virus and an unusual strain of acute bee paralysis virus in West African apiaries. Apidologie. 2016; 47:35–47. 10.1007/s13592-015-0372-z [DOI] [Google Scholar]
36.Shojaei A, Nourian A, Khanjani M, Mahmoodi P. The first molecular characterization of Lake Sinai virus in honey bees (Apis mellifera) and Varroa destructor mites in Iran. J Apic Res. 2023; 62(5):1176–1182. 10.1080/00218839.2021.1921467 [DOI] [Google Scholar]
37.Hou C, Liang H, Chen C, Zhao H, Zhao P, Deng S, et al. Lake Sinai virus is a diverse, globally distributed but not emerging multi-strain honeybee virus. Mol Ecol. 2023; 32(14):3859–3871. doi: 10.1111/mec.16987 [DOI] [PubMed] [Google Scholar]
38.Ravoet J, De Smet L, Wenseleers T, de Graaf DC. Vertical transmission of honey bee viruses in a Belgian queen breeding program. BMC Vet Res. 2015; 11:61. doi: 10.1186/s12917-015-0386-9 . [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Fürst MA, McMahon DP, Osborne JL, Paxton RJ, Brown MJ. Disease associations between honeybees and bumblebees as a threat to wild pollinators. Nature. 2014; 506(7488):364–366. doi: 10.1038/nature12977 . [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Mazzei M, Carrozza ML, Luisi E, Forzan M, Giusti M, Sagona S, et al. Infectivity of DWV associated to flower pollen: experimental evidence of a horizontal transmission route. PLoS ONE. 2014; 9(11):e113448. doi: 10.1371/journal.pone.0113448 . [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Piou V, Schurr F, Dubois E, Vétillard A. Transmission of deformed wing virus between Varroa destructor foundresses, mite offspring and infested honey bees. Parasit Vectors. 2022; 15(1):333. doi: 10.1186/s13071-022-05463-9 . [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Posada-Florez F, Ryabov EV, Heerman MC, Chen Y, Evans JD, Sonenshine DE, et al. Varroa destructor mites vector and transmit pathogenic honey bee viruses acquired from an artificial diet. PLoS ONE. 2020; 15(11):e0242688. doi: 10.1371/journal.pone.0242688 . [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Truong A-T, Yoo M-S, Yun B-R, Kang JE, Noh J, Hwang TJ, et al. Prevalence and pathogen detection of Varroa and Tropilaelaps mites in Apis mellifera (Hymenoptera, Apidae) apiaries in South Korea. J Apic Res. 2021; 62(4):804–812. 10.1080/00218839.2021.2013425 [DOI] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0299558.r001

Decision Letter 0

Olav Rueppell

24 Oct 2023

PONE-D-23-28265Prevalence and complete genome sequence of Lake Sinai virus from Apis mellifera in the Republic of KoreaPLOS ONE

Dear Dr. Cho,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. While one reviewer was fully satisfied with your manuscript (which is highly unusual), the other reviewer was very critical and requests a number of improvements. I agree that your manuscript can be much stronger by considering these criticisms to improve the presentation of your interesting research.

Please submit your revised manuscript by Dec 08 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Olav Rueppell

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Summary:

The study reports a survey of Korean apiaries for strains of the LSV complex of viruses. The study does not appear to recognize the already existing set of assays or justify designing a new one, nor adequately determine the scope of that assay given the recognized high variation within the complex. The study does not sufficiently explain their sampling method and how it compares to other survey methods. Individual bees appear to have been used, even though pools of workers would generally be preferred to characterize colony-level health. Was sampling effort even among colonies and apiaries? Were colonies chosen in a randomized fashion from around the country? Some context as to the commercial/landscape status of the apiaries that were surveyed would be helpful, as these factors are important in colony health and disease transmission.

The reporting of the work needs improvement in several aspects. First, the authors are inconsistent and inaccurate in describing their survey target, namely LSV2 based on a single accession and without regard for other primers already in the literature. The survey prevalence of LSV3 and LSV4 types do not appear to be based on targeted primer design but on accidental amplification of those types with the LSV2 primers. Second, the prevalence data would be better presented in a geographic context (ie a map of pie charts of detection rates) and the sequence similarity data is excessive with little apparent thought given to the utility of what is being presented and why.

Specific comments:

1. Title must be modified to reflect the actual scope of LSV survey (eg LSV2), such as Prevalence and complete genome sequence of selected strains of Lake Sinai virus from Apis mellifera in the Republic of Korea. Also, how can the genomes be complete if they were generated by amplification and overlap? There is no way of knowing what sequence might be beyond the primers.

2. Line 55: The fact that nomenclature within LSV is ad hoc and does not necessarily reflect evolutionary relationships should be noted. To what extent lineages are evolutionary units comparable to species, and whether the polymerase or the whole genome should be used for phylogenetics, is not really resolved. ViralZone uses only LSV1 and LSV2, for example, whereas NCBI uses an inconsistent nomenclature (submitted by users) of numerous numbered and lettered strains. The strains were named essentially sequentially, rather than based on any comprehensive analysis of global sequence variation. LSV1 and LSV2 appear to be deep divisions within the overall variation, with other named types falling nearer one or the other of these two clades.

3. Line 53: Most authors identify four ORFs, see Bigot et al. While ORF4 has unusual properties and is not in all LSV relatives and may even be absent from some LSV, it should still be mentioned (see Shi et al., Bigot et al., Cornman, Karlin; see also https://www.uniprot.org/uniprotkb/?query=xref:embl-KX883223)

4. Lines 43-45: The first part of this sentence should be deleted as the association with colony health has already been noted. Instead, the point should just be that LSVs were first discovered in US surveys and subsequently demonstrated to be widespread in US.

5. Line 52: not accurate, many accessions are >6kb.

6. Line 63: There is no direct evidence that “LSV may cause behavioral changes in honeybees”, certainly not in the references cited for this statement.

7. Lines 66-73: this paragraph is redundant and unnecessary.

8. Line 82: “sample” does not appear to be defined. Individual worker bees? Of a particular age/caste/activity?

9. Line 97: what was the rationale for this primer design? Seems to be targeting LSV2 specifically. Why not based on an alignment of multiple LSV accessions to determine specificity? Most studies have had to use primers targeting a subset of LSV lineages due to the variability of the complex (but see Iwanowicz et al. 2020, https://doi.org/10.7717/peerj.9424).

10. Line 118: Ct < 35 is probably reasonable, but a bit arbitrary. Do the Ct values for negative and positive controls support this choice?

11. Line 127: this makes no sense as an a priori strategy. Presumably the initial amplicons were found to closely match the listed accessions rather than “LSV2”, and thus this strategy was undertaken? Please explain.

12. Line 136: searched against what database? NCBI nt database?

13. Line 139: “gaps were edited and calculated” means what? Manually aligned after initial clustal alignment?

14. Lines 259-268: At least two studies (Iwanowicz et al. 2020 and McMenamin et al. 2021) have detected LSV in other bee species as well, there may be additional reports I’m not aware of.

15. Line 149: LSV2 was targeted by primer design, but cross-amplification with other lineages was evident in the recovery of LSV3 and LSV4-like sequences. So language that reflects the limited and uncertain scope of the LSV assay needs to be used. For example, one could say “the LSV2 PCR assay was positive” rather than “LSV was present”.

16. Please show the results in their spatial context, ie a map with pie charts for each location rather than as bar plots.

17. Line 161: Earlier on line 138, the analyzed region was stated to be 460nt.

18. Line 176: what primers were used to determine LSV3 and LSV4 rates? Surely not the LSV2 primer set described in the methods, that produced the unexpected large amplicon? Primers should be designed for the purpose or else the results are potentially biased.

19. Line 82: it would be helpful to characterize the colonies in terms of use. Are these used for pollination services or honey? Are they transported during the year? Hobbyists, small commercial apiaries, large commercial apiaries? Agricultural environment?

20. I do not see the value of tables of percent identity among various accessions. Move to supplemental materials.

21. Line 252: all these cited studies used different sampling techniques, different assays, and different criteria for positives. There is no basis for directly comparing prevalence rates of the LSV complex by country, or at least the authors do not justify doing so. Nor are country borders particularly relevant to virus dispersal. Factors like economic trade zones, continents or biogeographic regions, ranges of mellifera subspecies, apicultural practice etc are probably more relevant.

Reviewer #2: This is well written manuscript, interesting for publication. The Lake Sinai virus is emerging pathogen and valuable informations are presented in this manuscript with prevalence of diffrent genotypes, related to the severe or normal honeybee winter colonies losses. The manuscript is including also complete genomes of LSV2, LSV3 and LSV4 from Republic of Korea and comparison to the published sequences.

I have no remarks. The manuscript is suitable for publication in the present form.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Mar 19;19(3):e0299558. doi: 10.1371/journal.pone.0299558.r002

Author response to Decision Letter 0

19 Dec 2023

Responses to Reviewers’ Comments

We appreciate the reviewers for their invaluable comments. As explained below, we have revised our original manuscript and materials in response to all of the reviewers’ comments. What follows are our point-by-point responses to the comments.

Reviewer #1: Summary:

Specific comments:

Response:

Thank you for your insightful comments on our article's title. We highly appreciate your feedback and concur that the title needs to be revised to accurately reflect the scope of the LSV survey on Korean honeybees.

According to previous studies the LSV2 was the most virulent genotype. To identify the reason of serious colony loss in South Korea we initially select LSV2 as the target for detection and identification. However, after analyzing sequencing result we revealed that three genotypes, LSV2, LSV3 and LSV4 existed in Korean apiaries. Therefore, we finally designed the specific primer pair for each LSV genotype (S2 Table), and the surveillance data of each LSV genotype was acquired using genotype specific primer pair. To identify the complete genome sequence of LSV the different primer pairs were designed on the conserved region of reference sequences of each genotype on NCBI, different fragments had overlap parts that were used for assembly of the whole genome.

The objective of our study is to detect LSV variants in honeybees collected from the Republic of Korea (ROK) and assess the prevalence of this virus in samples with information on winter colony loss compared to normal colonies. In addition, our research aims to comprehensively analyze the genomic features of LSV isolates from Korean honeybees in comparison to strains previously identified and isolated in different countries. These insights will provide valuable guidance for future studies aimed at enhancing the health of honeybee apiaries in the ROK.

I propose the revised title: "Prevalence and Genomic Features of Lake Sinai Virus Isolated from Apis mellifera in the Republic of Korea”.

Response:

We agree that the nomenclature used in the LSV study is particular and doesn't always accurately reflect evolutionary relationships. Based on phylogenetic analyses of RdRp, two common clades have been identified, termed LSV1 and LSV2. We acknowledge the inconsistency in nomenclature used by various databases, such as ViralZone and NCBI, as well as the lack of comprehensive sequence variant analysis guiding nomenclature. Additionally, other strains labeled as LSV have been documented.

The sentence will be revised as follows: Continuous molecular surveys are underway to assess the relative conservation of various LSV strains due to the significant diversity observed among them. Presently, species-specific RdRp phylogenetic analyses have led to the identification of two phylogenetic clusters known as LSV1 and LSV2 [7]. Furthermore, there exist strains labeled as sister strains, potentially representing recombinants of LSV1 and LSV2, with designations on the National Center for Biotechnology (NCBI) such as LSV3–LSV8, LSV NE, LSV SA1, LSV SA2, LSV TO. Discrimination among these strains relies heavily on molecular surveys, including PCR-based methods, RT-PCR, real-time RT-PCR, and metagenomics. It is noteworthy that the primers utilized for variant detection have, thus far, not exhibited sensitivity to all known gene types [3,4,7,9,22]. (Lines 57-66)

Response:

We appreciate the references you've provided, including Bigot et al. and Shi et al., which discuss the unique properties of ORF4 and its presence in some LSV relatives. While our study primarily focused on the key ORFs in LSV, we acknowledge that ORF4 is indeed an intriguing and less common feature in LSV relatives. Its variable presence among different LSV strains is a subject of interest and further investigation. We understand the importance of mentioning ORF4, and we apologize for not including it in our initial discussion.

The sentence will be revised as follows: The genome characteristics of LSV encompass three main genes: 1) the first non-structural protein (NS1), 2) RNA-dependent RNA polymerase (RdRp), and 3) Capsid protein (CP) [4,7,19,20]. Additionally, the genome contains a region for the second non-structural protein (NS2) with distinctive features that may be absent in LSV clades. The NS1 and RdRp regions of LSV are implicated in the evolutionary process [5]. The capsid region plays a crucial role in the virus lifecycle, as it recognizes the host and assembles the virus capsid [19]. Meanwhile, the NS2 region (ORF4) can facilitate arthropod infection [21]. (Lines 50-57)

Response: Modified as suggested.

LSVs were first discovered in the United States (US) surveys [2,7] and subsequently demonstrated to be widespread in the US [4,8,9]. (Lines 42-44)

5. Line 52: not accurate, many accessions are >6kb.

Response: Upon re-evaluating our data, we have identified instance where many segments are indeed larger than 6 kb. We will correct this error in our revised draft to ensure the accuracy of our findings. Additionally, we will focus our discussion only on the genes present in the LSV genome.

6. Line 63: There is no direct evidence that “LSV may cause behavioral changes in honeybees”, certainly not in the references cited for this statement.

Response: Modified as suggested.

The sentence was revised as follows: Due to the lack of symptomatic features of LSV in honeybees, molecular biological diagnosis becomes imperative for detecting the infection levels of this virus within honeybee apiaries. (Lines 70-72).

7. Lines 66-73: this paragraph is redundant and unnecessary.

Response: The paragraph was eliminated from the manuscript.

8. Line 82: “sample” does not appear to be defined. Individual worker bees? Of a particular age/caste/activity?

Response:

The worker bees (n=10~30) were collected from each of 266 colonies in 137 apiaries in the ROK. The information is added in the manuscript in Line 90. To collect the sample, the hive of each colony was opened, and then the comb was taken out after carefully observing the comb without queen bee. Ten worker bees were randomly captured using a 50mL conical tube from the comb. In the colonies that all bees are dead, 10 worker bees were collected at the bottom of the hive.

Response:

The primer pair amplification and analysis of LSV RdRp region was designed from multi sequence alignment. To do that, the LSV2 sequences (NCBI No.: HQ888865.2) was used for nucleotide blast on NCBI, and then the sequences with high identity were selected for alignment to design the primer pair.

10. Line 118: Ct < 35 is probably reasonable, but a bit arbitrary. Do the Ct values for negative and positive controls support this choice?

Response:

The positive samples utilized in this study were amplified from Korean honeybees, subsequently cloned into pGem–T vector and transferred to E. coli DH5α cells. The Ct value of positive detection was decided based on the limit detection using recombinant plasmid of each LSV genotype and the result of negative control without DNA template. The lowest DNA copy number of LSV2, LSV3, and LSV4 that the qPCR can detect were 5.10^1, 8.10^1, 4.10^1 copy with Ct value 38.32±1.99, 36.38±1.2, and 38.23±1.15, respectively. The negative control showed the Ct value after 39.08±1.59 cycle with LSV3, and could not detected with LSV2 and LSV4. Hence, we selected the Ct value ≤ 35 to detect the presence of LSV in the samples in this study. This threshold allows us to identify positive samples reliably while minimizing the risk of false positives.

Response:

After identifying the LSV2, LSV3, and LSV4 based on RdRp gene using the common primer pair LSV-For: 5′- GCT TGT CGT GGA TTC TGG TC -3′ and LSV-Rev:5′-CTC AGC ACG AAA TCG CTC AA-3′, other the specific primer pairs for segment amplification of whole genome of each LSV genotype was designed (S3 Table). The various fragments amplified from each LSV genotype were assembled by comparing to the reference genome sequence of each genotype.

12. Line 136: searched against what database? NCBI nt database?

Response:

The sentence will be revised as follows: The LSV sequences were analyzed using the NCBI nucleotide Basic Local Alignment Search Tool to identify related sequences. (Lines 153-154).

13. Line 139: “gaps were edited and calculated” means what? Manually aligned after initial clustal alignment?

Response:

After alignment using the Clustal program the aligned result showed some sequence acquired from NCBI has longer size than the generated sequences in this study. Therefore, the program Bioedit was used to trim the redundant overhang part of the reference sequence before using for the phylogenetic creating by the Mega X program.

14. Lines 259-268: At least two studies (Iwanowicz et al. 2020 and McMenamin et al. 2021) have detected LSV in other bee species as well, there may be additional reports I’m not aware of.

Response:

Thank you for highlighting the studies conducted by Iwanowicz et al. (2020) and McMenamin et al. (2021), which detected LSV in other bee species. We appreciate your valuable input, and we will incorporate your suggestions into the introduction section.

The sentence will be revised as follows: LSV is not only detected in honey bees but also has been identified in certain ant species [20], on pollen loads and Varroa destructor [4], and wild bumblebee hosts (namely Bombus pascuorum, Bombus lapidaries, Bombus pratorum, Bombus atratus [24,25], sweat bee (Halictus ligatus) [9], solitary bees (Andrena vaga, Osmia bicornis, Osmia cornuta) [26], mining bee (Andrena spp.) [3,27], and Vespids (Hornet) [28]. (Lines 73-77)

15. Line 149: LSV2 was targeted by primer design, but cross-amplification with other lineages was evident in the recovery of LSV3 and LSV4-like sequences. So, language that reflects the limited and uncertain scope of the LSV assay needs to be used. For example, one could say “the LSV2 PCR assay was positive” rather than “LSV was present”.

Response:

The sentence will be revised as follows: The LSV2 PCR assay was positive in honeybees, with a high infection rate of 60.9 % (162/266) in the ROK. A comparison of the presence of LSV2 in different provinces of the ROK revealed a statistically significant variation in LSV2 infection rates (p = 0.011). In particular, a high prevalence of LSV2 was observed in Gyeongsangbuk-do, Gyeongsangnam-do, and Jeollanam-do, with infection rates of 32.5, 21.6, and 17.3%, respectively. (Lines 149-153)

16. Please show the results in their spatial context, ie a map with pie charts for each location rather than as bar plots.

Response: Modified as suggested.

Fig 2. Infection rate of the Lake Sinai Virus 2 (LSV2) isolated from honeybee samples between January and August 2022, according to sampling provinces and cities in the Republic of Korea.

17. Line 161: Earlier on line 138, the analyzed region was stated to be 460nt.

Response: Modified as suggested. the length of RdRp region (460 nt) is now using in the sentence

Response:

The LSV2 primer set described in the methods was not specifically designed to target LSV3 and LSV4, and it indeed produced an unexpectedly large amplicon. To address this concern and ensure the accuracy of our results, we have undertaken the redesign of two new primer pairs (detailed in Supplementary S1-Fig and S2 Table), that was mentioned in Line 113 of the method section. These genotype specific primers were used for wide surveillance of the LSV in apiaries.

Response: We agree that providing more information about the colonies would be beneficial for a comprehensive understanding of the study. The colonies in our study were sourced from various types of apiaries across different provinces in ROK. Beekeepers are primarily situated in mountainous forested regions, capitalizing on abundant natural resources. These honeybee colonies in apiaries are chiefly dedicated to honey harvesting, typically remaining fixed at a specific location. Colony number in each apiary ranged from 50 to 100.

The honeybee samples in this study were collected based on the observed decline in the vitality of adult honeybees and an unusual decrease in the population. The symptoms within honeybee colonies corresponded to the phenomenon of severe winter loss or Colony Collapse Disorder (CCD). The number of honeybee samples collected depended on the number of lost honeybee colonies in each apiary. (Lines 91-97)

20. I do not see the value of tables of percent identity among various accessions. Move to supplemental materials.

Response: Thank you for your suggestion. The Table 1–3 were moved to Supplementary materials as S4–S6 Tables. A phylogenetic tree comparing the features of genomes isolated from Korean honeybees was newly added in the manuscript as Fig 6.

Fig 6. Neighbor-joining phylogenetic tree of Lake Sinai Virus based on the feature genome. The optimal tree is shown. The evolutionary distances were computed using the Kimura 2-parameter method. A, LSV2 genome feature (5,759 nt); B, LSV3 genome feature (6,040 nt); C, LSV4 genome feature (5,985 nt). (References strains in NCBI were shown in S4–S6 Tables).

The phylogenetic variation is consistent with nucleotide similarity among the isolates. In the first main branch, the genome sequences of LSV2, LSV3 and LSV4 isolate from Korean honeybees were similarity with group isolate to China. As shown in the tree, the LSV isolates from ROK had a closer genetic relationship with a species of LSV isolated from China (Fig 6). (Lines 221-224)

Response: Modified as suggested.

The LSV was first detected and described in honeybee colonies in the US [7]. Subsequently, its occurrence has been reported about the prevalence of LSV in honeybee populations in many countries, including Germany, Australia, Slovenia, the Czech Republic, Africa, Iran, and Japan [4,11,12,15,18,35,36]. (Lines 258-261)

Attachment

Submitted filename: 20231106-Responses-to-Comments-FINAL.docx

pone.0299558.s011.docx^{(1.1MB, docx)}

PLoS One. doi: 10.1371/journal.pone.0299558.r003

Decision Letter 1

Olav Rueppell

5 Jan 2024

PONE-D-23-28265R1Prevalence and Genome Features of Lake Sinai Virus Isolated from Apis mellifera in the Republic of KoreaPLOS ONE

Dear Dr. Cho,

Please carefully consider the thorough re-evaluation of the reviewer who was initially very critical. While progress has been noted, several serious issues remain to be resolved.

Please submit your revised manuscript by Feb 19 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Olav Rueppell

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

**********

6. Review Comments to the Author

Reviewer #1: Summary: I appreciate the authors’ efforts to clarify their methodology and add context to their Introduction and Discussion. I still feel that the potential for primer bias is not fully acknowledged, despite the clear potential evident in Supplemental Figure S1, for example. The authors may have felt that the LSV2 accession used for primer design well represented previous results in the ROK, and they could also cite Hou et al. 2023 https://doi.org/10.1111/mec.16987, which shows continental genetic clustering within all the major LSV clades, as justification for their approach. Nonetheless, the paper makes many statements that gloss over ascertainment issues, such as in the abstract: “This study aimed to assess the prevalence of ... the LSVs ...from the ROK”). These claims overlook the fact that LSV1 is not assayed and assays for LSV2/LSV3/LSV4 have known primer mismatches with LSV2, LSV3, or LSV4 clade members. See also lines 81-86, line 109, and line 251 as examples where LSV is used instead of the specific LSV genotypes for which an assay was developed.

Some additional comments are provided below.

The authors continue to state that they have generated “complete genome sequences of LSV” using primers that do not start at position 1 of any reference and do not end at the final position of any reference. It is a minor point of no import for any conclusions, but these overlapped sequences cannot be called “complete” genomes, even if 99% of the bases are captured by the method. Line 221, for example, would need to be changed to “near-complete genome” or “partial genome”. Similarly, in the abstract the phrase “the first genome feature of the Korean “ should be changed to “the first near-complete genome sequences of Korean”. Nor is it certain whether the overlapped amplicons all come from a single virus strain, ie the assemblies could be chimeric. It has been previously documented that single individuals can harbor diverse strains (e.g. Ravoet et al; Iwanowicz et al.).

Lines 53-54: Not correct as written, change to “with distinctive features that may be absent in some LSV clades”? Also, does “the evolutionary process” mean “replication” (line 54)?

Line 65-66: “genotypes” rather than “gene types”

The authors continue to state “LSV may cause behavioral changes in honeybees, leading to worker bees abandoning their hives” (lines 77-78). The cited references only show that LSV was found to be more prevalent in weak/collapsed hives than healthy. Nothing can be said about “behavioral changes in honeybees” caused by LSV. The fact that there may be a behavorial component to the colony collapse phenomenon does not mean LSV causes any behavior.

Lines 142-143: I think “The alignment was generated and trimmed to the RdRp gene region in Bioedit” would be clearer.

Lines 152-153: The BLASTN software is different from the database it was used to search. The default for BLASTN for the NCBI web service is the nt database, but any database can be used in principle. If nt was used, please explicitly state so for completeness/repeatability.

Line 162: As the ANOVA is performed on proportions of positives within colonies, have the authors verified that the data are reasonably distributed? If not, a Kruskal-Wallis nonparametric test could be used instead.

Line 166: “detection rate” instead of “infection rate”

Line 168-170: if the overall detection rate of LSV2 was greater than 60%, how can the values on line 170 be considered high?

Lines 176-178: the %id is lower for the LSV2 accession than the LSV3 and LSV4 accessions, in reverse order to what the text states.

Line 182: this could just be due to primer bias – European like lineages might be present in ROK apiaries but not amplified.

Line 274: What was the nature of the varroa samples? Were they collected from sticky boards, sugar roll, directly from parasitized adults or pupae? Were individual mites analyzed or pools? How were the twelve colonies selected for this assay?

Also, what is your conclusion regarding the fact that your LSV4 assay was never positive in mites, although numerous positives in honeybees were obtained? Are patterns of discordance between the two species in S7 Table a matter of chance sampling or do you believe some species-level difference in LSV host interaction is occurring? Some discussion would be appreciated.

Line 288-290: should note this is consistent with results of Hou et al. 2023, but also potentially an artifact of primer bias.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

**********

PLoS One. 2024 Mar 19;19(3):e0299558. doi: 10.1371/journal.pone.0299558.r004

Author response to Decision Letter 1

8 Feb 2024

I attach the revised manuscript with track change and raw image file as one pdf file (S1-raw-images) according to the points by editor.

Sincerely yours,

Yun Sang Cho

Attachment

Submitted filename: Response to Reviewers.docx

pone.0299558.s012.docx^{(1.7MB, docx)}

PLoS One. doi: 10.1371/journal.pone.0299558.r005

Decision Letter 2

Olav Rueppell

13 Feb 2024

Prevalence and Genome Features of Lake Sinai Virus Isolated from Apis mellifera in the Republic of Korea

PONE-D-23-28265R2

Dear Dr. Cho,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Olav Rueppell

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0299558.r006

Acceptance letter

Olav Rueppell

4 Mar 2024

PONE-D-23-28265R2

PLOS ONE

Dear Dr. Cho,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Olav Rueppell

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Primers designed for specific detection of LSV genotypes.

The positions of the forward and reverse primers inside the RdRp-encoding genes are marked. Sequences of each LSV genotype with NCBI accession numbers are shown.

(ZIP)

pone.0299558.s001.zip^{(10.4MB, zip)}

S2 Fig. Amplification of LSV from honeybee samples using LSV2-specific primers.

(TIF)

pone.0299558.s002.tif^{(8.7MB, tif)}

S3 Fig. Alignment of Lake Sinai Virus 2, 3, and 4 sequences from honeybee samples.

(TIF)

pone.0299558.s003.tif^{(1.5MB, tif)}

S1 Table. Severe and normal winter loss information of honeybee colonies in the Republic of Korea, 2022.

(XLSX)

pone.0299558.s004.xlsx^{(19.3KB, xlsx)}

S2 Table. Primers used for detecting LSV2, LSV3, and LSV4.

(DOCX)

pone.0299558.s005.docx^{(15.7KB, docx)}

S3 Table. Primers used for determining the Lake Sinai Virus genome.

(DOCX)

pone.0299558.s006.docx^{(20.3KB, docx)}

S4 Table. Comparison of the near-complete genome feature of LSV2/Korea-2022 with reference strains in GenBank.

(DOCX)

pone.0299558.s007.docx^{(17.2KB, docx)}

S5 Table. Comparison of the near-complete genome feature of LSV3/Korea-2022 with reference strains in GenBank.

(DOCX)

pone.0299558.s008.docx^{(16.8KB, docx)}

S6 Table. Comparison of the near-complete genome feature of LSV4/Korea-2022 with reference strains in GenBank.

(DOCX)

pone.0299558.s009.docx^{(16.7KB, docx)}

S7 Table. Detection of Lake Sinai Virus in Varroa destructor and Apis mellifera.

(DOCX)

pone.0299558.s010.docx^{(18.6KB, docx)}

Attachment

Submitted filename: 20231106-Responses-to-Comments-FINAL.docx

pone.0299558.s011.docx^{(1.1MB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0299558.s012.docx^{(1.7MB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0299558.ref001] 1.Beaurepaire A, Piot N, Doublet V, Antunez K, Campbell E, Chantawannakul P, et al. Diversity and global distribution of viruses of the western honey bee, Apis mellifera. Insects. 2020; 11(4):239. doi: 10.3390/insects11040239 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref002] 2.Cornman RS, Tarpy DR, Chen Y, Jeffreys L, Lopez D, Pettis JS, et al. Pathogen webs in collapsing honey bee colonies. PLoS ONE. 2012; 7(6):e43562. doi: 10.1371/journal.pone.0043562 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref003] 3.Dolezal AG, Hendrix SD, Scavo NA, Carrillo-Tripp J, Harris MA, Wheelock MJ, et al. Honey bee viruses in wild bees: viral prevalence, loads, and experimental inoculation. PLoS ONE. 2016; 11(11):e0166190. doi: 10.1371/journal.pone.0166190 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref004] 4.Daughenbaugh KF, Martin M, Brutscher LM, Cavigli I, Garcia E, Lavin M, et al. Honey bee infecting Lake Sinai viruses. Viruses. 2015; 7(6):3285–3309. doi: 10.3390/v7062772 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref005] 5.Cornman RS. Relative abundance and molecular evolution of Lake Sinai Virus (Sinaivirus) clades. PeerJ. 2019; 7:e6305. doi: 10.7717/peerj.6305 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref006] 6.Glenny W, Cavigli I, Daughenbaugh KF, Radford R, Kegley SE, Flenniken ML. Honey bee (Apis mellifera) colony health and pathogen composition in migratory beekeeping operations involved in California almond pollination. PLoS ONE. 2017; 12:e0182814. doi: 10.1371/journal.pone.0182814 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref007] 7.Runckel C, Flenniken ML, Engel JC, Ruby JG, Ganem D, Andino R, et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 2011; 6(6):e20656. doi: 10.1371/journal.pone.0020656 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref008] 8.Ravoet J, De Smet L, Wenseleers T, De Graaf DC. Genome sequence heterogeneity of Lake Sinai virus found in honey bees and Orf1/RdRP-based polymorphisms in a single host. Virus Res. 2015; 201:67–72. doi: 10.1016/j.virusres.2015.02.019 . [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref009] 9.Iwanowicz DD, Wu-Smart JY, Olgun T, Smart AH, Otto CR, Lopez D, et al. An updated genetic marker for detection of Lake Sinai Virus and metagenetic applications. PreerJ. 2020; 8:e9424. doi: 10.7717/peerj.9424 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref010] 10.Cepero A, Ravoet J, Gómez-Moracho T, Bernal JL, Del Nozal MJ, Bartolomé C, et al. Holistic screening of collapsing honey bee colonies in Spain: a case study. BMC Res Notes. 2014; 7:649. doi: 10.1186/1756-0500-7-649 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref011] 11.Čukanová E, Moutelíková R, Prodělalová J. First detection of Lake Sinai virus in the Czech Republic: a potential member of a new species. Arch Virol. 2022; 167(11):2213–2222. doi: 10.1007/s00705-022-05548-x . [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref012] 12.D’Alvise P, Seeburger V, Gihring K, Kieboom M, Hasselmann M. Seasonal dynamics and co‐occurrence patterns of honey bee pathogens revealed by high‐throughput RT‐qPCR analysis. Ecol Evol. 2019; 9(18):10241–10252. doi: 10.1002/ece3.5544 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref013] 13.Granberg F, Vicente-Rubiano M, Rubio-Guerri C, Karlsson OE, Kukielka D, Belák S, et al. Metagenomic detection of viral pathogens in Spanish honeybees: co-infection by aphid lethal paralysis, Israel acute paralysis and Lake Sinai viruses. PLoS ONE. 2013; 8(2):e57459. doi: 10.1371/journal.pone.0057459 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref014] 14.Roberts JMK, Anderson DL, Durr PA. Absence of deformed wing virus and Varroa destructor in Australia provides unique perspectives on honeybee viral landscapes and colony losses. Sci Rep. 2017; 7(1):6925. doi: 10.1038/s41598-017-07290-w . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref015] 15.Kitamura Y, Asai T. First detection of Lake Sinai virus in honeybees (Apis mellifera) and wild arthropods in Japan. J Vet Med Sci. 2022; 84(3):346–349. doi: 10.1292/jvms.21-0466 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref016] 16.Kwon M, Jung C, Kil EJ. Metagenomic analysis of viromes in honey bee colonies (Apis mellifera; Hymenoptera: Apidae) after mass disappearance in Korea. Front Cell Infect Microbiol. 2023; 13:1124596. doi: 10.3389/fcimb.2023.1124596 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref017] 17.Ravoet J, Maharramov J, Meeus I, De Smet L, Wenseleers T, Smagghe G, et al. Comprehensive bee pathogen screening in Belgium reveals Crithidia mellificae as a new contributory factor to winter mortality. PLoS ONE. 2013; 8(8):e72443. doi: 10.1371/journal.pone.0072443 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref018] 18.Šimenc L, Kuhar U, Jamnikar-Ciglenečki U, Toplak I. First complete genome of Lake Sinai virus lineage 3 and genetic diversity of Lake Sinai virus strains from honey bees and bumble bees. J Econ Entomol. 2020; 113(3):1055–1061. doi: 10.1093/jee/toaa049 . [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref019] 19.Chen NC, Wang CH, Yoshimura M, Yeh YQ, Guan HH, Chuankhayan P, et al. Structures of honeybee-infecting lake Sinai virus reveal domain functions and capsid assembly with dynamic motions. Nat Commun. 2023; 14(1):545. doi: 10.1038/s41467-023-36235-3 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref020] 20.Bigot D, Dalmon A, Roy B, Hou C, Germain M, Romary M, et al. The discovery of Halictivirus resolves the Sinaivirus phylogeny. J Gen Virol. 2017; 98(11):2864–2875. doi: 10.1099/jgv.0.000957 . [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref021] 21.Karlin D. An overlooked protein domain, WIV, is found a wide number of arthropod viruses and probably facilitates infection. Preprints. 2023. 10.20944/preprints202306.0194.v1 [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref022] 22.Traynor KS, Rennich K, Forsgren E, Rose R, Pettis J, Kunkel G, et al. Multiyear survey targeting disease incidence in US honey bees. Apidologie. 2016; 47:325–347. 10.1007/s13592-016-0431-0 [DOI] [Google Scholar]

[pone.0299558.ref023] 23.Faurot-Daniels C, Glenny W, Daughenbaugh KF, McMenamin AJ, Burkle LA, Flenniken ML. Longitudinal monitoring of honey bee colonies reveals dynamic nature of virus abundance and indicates a negative impact of Lake Sinai virus 2 on colony health. PLoS ONE. 2020; 15(9):e0237544. doi: 10.1371/journal.pone.0237544 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref024] 24.Parmentier L, Smagghe G, de Graaf DC, Meeus I. Varroa destructor Macula-like virus, Lake Sinaivirus and other new RNA viruses in wild bumblebee hosts (Bombus pascuorum, Bombus lapidarius and Bombus pratorum). J Invertebr Pathol. 2016; 134:6–11. doi: 10.1016/j.jip.2015.12.003 . [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref025] 25.Gamboa V, Ravoet J, Brunain M, Smagghe G, Meeus I, Figueroa J, et al. Bee pathogens found in Bombus atratus from Cambodia: a case study. J Invertebr Pathol. 2015; 129:36–39. doi: 10.1016/j.jip.2015.05.013 . [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref026] 26.Ravoet J, De Smet L, Meeus I, Smagghe G, Wenseleers T, de Graaf DC. Widespead occurrence of honey bee pathogens in solitary bees. J invertebr Pathol. 2014; 122:55–58. doi: 10.1016/j.jip.2014.08.007 . [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref027] 27.Daughenbaugh KF, Kahnonitch I, Carey CC, McMenamin AJ, Wiegand T, Erez T, et al. Metatranscriptome analysis of sympatric bee species identifies bee virus variants and a new virus, Andrena-associated bee virus-1. Viruses. 2021; 13(2):291. doi: 10.3390/v13020291 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref028] 28.Yang S, Gayral P, Zhao H, Wu Y, Jiang X, Wu Y, et al. Occurrence and molecular phylogeny of honey bee viruses in Vespids. Viruses. 2019; 12(1):6. doi: 10.3390/v12010006 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref029] 29.Truong AT, Yoo MS, Seo SK, Hwang TJ, Yoon SS, Cho YS. Prevalence of honey bee pathogens and parasites in South Korea: A five-year surveillance study from 2017 to 2021. Heliyon. 2023; 9(2):e13494. doi: 10.1016/j.heliyon.2023.e13494 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref030] 30.Hall T. BioEdit version 7.0.0; 2004. Distributed by the Author, website. Available from: www.mbio.ncsu.edu/BioEdit/bioedit.html [Google Scholar]

[pone.0299558.ref031] 31.Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007; 23(21):2947–2948. doi: 10.1093/bioinformatics/btm404 . [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref032] 32.Kimura M. The neutral theory of molecular evolution. Sci Am. 1979; 241(5):98–100. doi: 10.1038/scientificamerican1179-98 [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref033] 33.Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987; 4(4):406–425. doi: 10.1093/oxfordjournals.molbev.a040454 . [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref034] 34.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018; 35(6):1547–1549. doi: 10.1093/molbev/msy096 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref035] 35.Amakpe F, De Smet L, Brunain M, Ravoet J, Jacobs FJ, Reybroeck W, et al. Discovery of Lake Sinai virus and an unusual strain of acute bee paralysis virus in West African apiaries. Apidologie. 2016; 47:35–47. 10.1007/s13592-015-0372-z [DOI] [Google Scholar]

[pone.0299558.ref036] 36.Shojaei A, Nourian A, Khanjani M, Mahmoodi P. The first molecular characterization of Lake Sinai virus in honey bees (Apis mellifera) and Varroa destructor mites in Iran. J Apic Res. 2023; 62(5):1176–1182. 10.1080/00218839.2021.1921467 [DOI] [Google Scholar]

[pone.0299558.ref037] 37.Hou C, Liang H, Chen C, Zhao H, Zhao P, Deng S, et al. Lake Sinai virus is a diverse, globally distributed but not emerging multi-strain honeybee virus. Mol Ecol. 2023; 32(14):3859–3871. doi: 10.1111/mec.16987 [DOI] [PubMed] [Google Scholar]

[pone.0299558.ref038] 38.Ravoet J, De Smet L, Wenseleers T, de Graaf DC. Vertical transmission of honey bee viruses in a Belgian queen breeding program. BMC Vet Res. 2015; 11:61. doi: 10.1186/s12917-015-0386-9 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref039] 39.Fürst MA, McMahon DP, Osborne JL, Paxton RJ, Brown MJ. Disease associations between honeybees and bumblebees as a threat to wild pollinators. Nature. 2014; 506(7488):364–366. doi: 10.1038/nature12977 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref040] 40.Mazzei M, Carrozza ML, Luisi E, Forzan M, Giusti M, Sagona S, et al. Infectivity of DWV associated to flower pollen: experimental evidence of a horizontal transmission route. PLoS ONE. 2014; 9(11):e113448. doi: 10.1371/journal.pone.0113448 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref041] 41.Piou V, Schurr F, Dubois E, Vétillard A. Transmission of deformed wing virus between Varroa destructor foundresses, mite offspring and infested honey bees. Parasit Vectors. 2022; 15(1):333. doi: 10.1186/s13071-022-05463-9 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref042] 42.Posada-Florez F, Ryabov EV, Heerman MC, Chen Y, Evans JD, Sonenshine DE, et al. Varroa destructor mites vector and transmit pathogenic honey bee viruses acquired from an artificial diet. PLoS ONE. 2020; 15(11):e0242688. doi: 10.1371/journal.pone.0242688 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0299558.ref043] 43.Truong A-T, Yoo M-S, Yun B-R, Kang JE, Noh J, Hwang TJ, et al. Prevalence and pathogen detection of Varroa and Tropilaelaps mites in Apis mellifera (Hymenoptera, Apidae) apiaries in South Korea. J Apic Res. 2021; 62(4):804–812. 10.1080/00218839.2021.2013425 [DOI] [Google Scholar]

PERMALINK

Prevalence and genome features of lake sinai virus isolated from Apis mellifera in the Republic of Korea

Thi-Thu Nguyen

Mi-Sun Yoo

A-Tai Truong

So Youn Youn

Dong-Ho Kim

Se-Ji Lee

Soon-Seek Yoon

Yun Sang Cho

Roles

Abstract

Introduction

Materials and methods

Collection of honeybee samples

Total nucleic acid extraction and detection of honeybee pathogens

Sequence analysis and LSVs genome assembly

Fig 1. Amplified fragments based on the alignment of Lake Sinai Viruses.

Phylogenetic tree analysis

Data analysis

Results

Detection of LSVs in Korean apiaries

Fig 2. Provincial distribution of Lake Sinai Virus 2 in LSV2-positive honeybee colonies in ROK.

Fig 3. Neighbor-joining phylogenetic tree of Lake Sinai Viruses based on RNA-dependent RNA polymerase gene.

Prevalence of LSVs in severe and normal winter loss

Fig 4. Infection rate of Lake Sinai Viruses from severe and normal winter loss colonies.

Fig 5. Lake Sinai Virus prevalence from severe winter loss in Korean provinces.

Characteristic genome analysis of LSV

Fig 6. Neighbor-joining phylogenetic tree of Lake Sinai Virus based on the near-complete genome feature.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Olav Rueppell

Roles

Author response to Decision Letter 0

Decision Letter 1

Olav Rueppell

Roles

Author response to Decision Letter 1

Decision Letter 2

Olav Rueppell

Roles

Acceptance letter

Olav Rueppell

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases