Flip the switch: the role of FleQ in modulating the transition between the free-living and sessile mode of growth in Pseudomonas aeruginosa

ABSTRACT

Pseudomonas aeruginosa is a Gram-negative, opportunistic pathogen causing chronic infections that are associated with the sessile/biofilm mode of growth rather than the free-living/planktonic mode of growth. The transcriptional regulator FleQ contributes to both modes of growth by functioning both as an activator and repressor and inversely regulating flagella genes associated with the planktonic mode of growth and genes contributing to the biofilm mode of growth. Here, we review findings that enhance our understanding of the molecular mechanism by which FleQ enables the transition between the two modes of growth. We also explore recent advances in the mechanism of action of FleQ to both activate and repress gene expression from a single promoter. Emphasis will be on the role of sigma factors, cyclic di-GMP, and the transcriptional regulator AmrZ in inversely regulating flagella and biofilm-associated genes and converting FleQ from a repressor to an activator.

INTRODUCTION

The opportunistic human pathogen Pseudomonas aeruginosa has been linked to a variety of chronic infections, including chronic lung infections in individuals with cystic fibrosis (CF), community-acquired pneumonia, burn wounds, chronic catheter-associated infections, foot ulcers, and corneal and mechanical ventilation-related infections (1–9). P. aeruginosa has been estimated to cause over 51,000 infections annually (10), with 32,600 infections among hospitalized patients (10) and 2,700 estimated deaths in the United States alone (10). Worldwide, this pathogen has been attributed to 10%–15% of nosocomial infections and more than 500,000 deaths, highlighting its negative impact on public health (7, 10–13).

It is now well established that bacteria display two different types of lifestyles: the planktonic, free-living mode of growth that is associated with acute infections and increased vulnerability to antimicrobial agents (14–18), and the sessile mode of growth, characterized by bacteria growing in surface-associated or non-adherent aggregates of cells enclosed in a self-produced exopolysaccharide matrix. The sessile or biofilm mode of growth is grossly associated with chronic infections (19). Not surprisingly, the chronicity of these infections has been attributed to P. aeruginosa growing in these sessile biofilm communities (20).

Chronic infections are associated with the sessile mode of growth due to the heightened tolerance of biofilm cells, relative to planktonic cells, to antimicrobial agents and the host immune response (3, 16, 18, 21, 22). This characteristic is a trade-off, with biofilm cells experiencing high cell density (23), reduced metabolic rates (14, 24, 25), reduced growth rates/dormancy (14, 24, 26), and nutrient limitation (27) relative to the free-living lifestyle. Additionally, biofilm cells are characterized by increased production of extracellular polymeric matrix (28, 29) with the matrix contributing to sequestration of both nutrients and xenobiotics (27).

Despite (or because of) this trade-off, the sessile mode of growth is considered the most prevalent and predominant mode of bacterial growth (30, 31). In P. aeruginosa, the transition between these two modes of growth is highly regulated (32–34) and coincides with the inverse regulation of genes encoding flagella and matrix components, including exopolysaccharide (Pel, Psl, and alginate) and adhesins (CdrAB) (35–43). Regulators controlling the expression of the aforementioned genes include the GacS/GacA two-component regulatory system (TCS), BfiS/BfiR TCS, RsmA, and SagS to mention a few, which have been reviewed previously (33, 44, 45). Among these regulatory proteins, FleQ stands out by inversely regulating genes encoding flagella and exopolysaccharides in a manner dependent on two sigma factors and the secondary messenger cyclic di-GMP (c-di-GMP). More importantly, FleQ is considered to play a central role in mediating the transition between planktonic and biofilm lifestyles (36), with its role not being limited to P. aeruginosa but extending to other Pseudomonas species, including Pseudomonas putida (46, 47), Pseudomonas fluorescens (47–49), and Pseudomonas syringae (50). The goal of this review is to provide an overview of the mechanisms by which FleQ contributes to the transition between these two modes of growth. We also explore how FleQ affects the inverse regulation of motility and matrix production.

FleQ AND THE HIERARCHICAL REGULATION OF THE EXPRESSION OF FLAGELLAR GENES

FleQ was first reported by Arora and colleagues in 1997 (51) as a transcriptional activator that, similar to FleR (51), is involved in the regulation of flagellar gene expression in P. aeruginosa. Flagellar biogenesis in P. aeruginosa involves more than 40 genes, many of which are positively regulated by FleQ (51). These include flhA and fliLMNOPQRflhB, which are involved in flagellar export; flhF, which is involved in the localization of the flagellar apparatus; fleSR, a two-component sensor and regulator involved in flagellin synthesis; flgFGHIJKL and flgBCDE operons which encodes the hook basal body (HBB); fliEFGHIJ, which encodes the flagellar basal body MS ring and motor switch complex; fliDS, which encodes the flagellar cap and export proteins; and flgA, which encodes the basal body P-ring protein (Fig. 1; Table 1).

Fig 1.

Flagella structural proteins and hierarchical regulation of flagella-associated genes in Pseudomonas species. (A) Location of flagella proteins in assembled flagella complex and order of assembly (Class I–IV indicate the order of the assembly). The protein export apparatus is composed of a transmembrane export gate complex (indicated as an Export gate). Components contributing to the C, MS, P, and L-ring are color-coded. OM, outer membrane; PG, peptidoglycan; IM, inner membrane. (B) Hierarchical expression of flagella genes. The cascade is initiated by FleQ, with fleQ expression being dependent on σ⁷⁰. FleQ activates class II genes including fleSR in a σ⁵⁴-dependent manner. FleR, in turn, regulates class III genes encoding components of the HBB in a σ⁵⁴-dependent manner. Class IV genes are expressed in a FliA-dependent manner. The sigma factor FliA is sequestered by FlgM. Once the HBB is assembled, FlgM is exported, freeing FliA to enable the expression of class IV genes encoding the, e.g., flagellin filament (fliC) and flagellin cap (fliD). Moreover, FliK is exported during hook assembly and acts as a ruler to measure the hook length. When the hook length reaches about 55 nm, the export of FlgE and FliK is terminated, and the export of filament-type export substrates, such as FlgK, FlgL, FliC, and FliD, is initiated. Genes highlighted in yellow belong to both class II (directly regulated by FleQ) and IV [as the export of these gene products is dependent on the assembly of the HBB (52)]. The regulation of FliA for these genes is unknown.

TABLE 1.

Summary of P. aeruginosa genes directly regulated by FleQ and their expression under varying levels of intracellular c-di-GMP

Gene	Function	FleQ-dependent regulation		References
		Low c-di-GMP	High c-di-GMP
fleN	Anti-activator of FleQ	Unknown	Unknown	52 – 55
fleS	Two-component sensor kinase	Activated	Repressed	52–54, 56
fleR	Two-component response regulator	Activated	Repressed	52–54, 56
fliD	Flagellin cap protein	Activated	Repressed	52, 53
fliE	Rod adaptor protein	Activated	Repressed	52, 53
fliF	MS-ring protein	Activated	Repressed	52, 53
fliG	C-ring protein	Activated	Repressed	52, 53
fliHIJ	ATPase complex	Activated	Repressed	52, 53
fliL	Flagellum-associated protein	Activated	Repressed	52, 53
fliMN	C-ring proteins	Activated	Repressed	52, 53, 56
fliOPQR	Export gate proteins	Activated	Repressed	52, 53
fliS	Flagellin chaperone protein	Activated	Repressed	52, 53
flhF	Polar landmark protein	Activated	Repressed	52, 53
flgA	Flagella basal body P-ring formation protein	Activated	Repressed	52, 53
flgZ	C-di-GMP effector	Activated	Repressed	52
fliT	Flagellin cap chaperone protein	Activated	Repressed	52
fleP	Flagellin cap chaperone protein	Activated	Repressed	52, 53
flgM	Anti-sigma 28 factor	Activated	Repressed	52, 53
flgN	Hook-filament junction chaperone protein	Activated	Repressed	52, 53
flhAB	Export gate protein	Activated	Repressed	52, 53
pel	Pel exopolysaccharide	Repressed	Activated	36, 37, 40, 42, 57
psl	Psl exopolysaccharide	Repressed	Activated	36, 37
cdrAB	Fibrillar adhesin protein	Repressed	Activated	36

The regulation of these flagellar biogenesis genes is intertwined in a complex regulatory cascade. It is now apparent that the cascade is headed by FleQ, an NtrC/NifA-type activator (53) (Fig. 1). Transcriptional activators belonging to the NtrC superfamily have been reported to work in concert with RpoN, the alternate sigma factor, sigma 54 (σ⁵⁴), to activate a variety of genes that are regulated in response to external cues. Some of the genes regulated by σ⁵⁴ are involved in RNA modification (58), the transition of Chlamydia from reticulate bodies to infectious bodies (59), response to heat shock in Escherichia coli (60), nitrogen utilization in E. coli (61), and the expression of alternate sigma factor σ^S (rpoS) (61).

As a NtrC/NifA-type activator, FleQ is no exception and works in concert with σ⁵⁴ to regulate the expression of fleSR, which encodes the two-component regulatory system FleSR (class II) (53) (Fig. 1). This is supported by promoter fusion experiments showing that fleSR expression is regulated by σ⁵⁴ and FleQ. It is of interest to note that while fleSR requires σ⁵⁴ and FleQ for activation, the expression of fleQ is independent of σ⁵⁴ and FleR; hence, fleQ is classified as a class I gene. Other class II genes include fleN, fliD encoding the flagella cap proteins, fliHIJ, fliL, genes encoded by the fliLMNOPQR operon (genes involved in flagella export), flgMN, fliS, fliT, flhG, and fleP. Additional Class II genes include flhAF (encoding flagellar biosynthesis proteins) and fliEFG-PA1103-fliIJ (encoding the structural parts of the flagellar basal body and flagellum-specific ATP synthase FliI) (56) (Fig. 1; Table 1).

Genes in class III are required for the assembly of the HBB (Fig. 1A) and are positively regulated by the class II response regulator FleR in a σ⁵⁴-dependent manner (Fig. 1B). These genes include flgB and flgC encoding the flagellar basal-body rod proteins FlgB and FlgC, flgD the flagellar basal-body rod modification protein FlgD, and flgE encoding the flagella hook protein, flgF encoding the proximal rod protein, flgG encoding the distal rod protein, flgH encoding the L-ring protein, flgl encoding the P-ring protein, flgJ encoding the distal rod cap protein, flgKL encoding the hook-filament junction proteins, and fliK encoding the hook length control protein (47, 51–54) (Table 1). Assembly of the HBB enables the export of the anti-sigma factor FlgM (52).

Class IV genes have in common that they require the sigma factor FliA (RpoF or σ²⁸) instead of σ⁵⁴ for expression. The expression of fliA appears to be constitutive, independent of FleQ, σ⁵⁴, or any known flagella genes but is, however, left as unclassified as seen in a previous review (52, 53). However, during flagella biosynthesis, FliA is sequestered by its anti-sigma factor FlgM, until the flagella hook (HBB) is fully assembled. As indicated above, completion of the HBB induces the export of FlgM (52, 53) (Fig. 1), thus freeing FliA. Class IV genes regulated by FliA include fliC, fleL, cheAB, motAB, cheW, cheVR, flgMN, cheYZ, and fliC encoding the flagella filament protein (Fig. 1; Table 1). In P. aeruginosa, the sequestration of FliA by FlgM is antagonized by the HptB-HsbR-HsbA system by a mechanism described by Bhuwan et al. (62). Specifically, HsbR and HptB regulate the anti-sigma factor antagonist, HptA (in response to an unknown cue), to prevent the sequestration of FliA by FlgM through a partner switching mechanism (62).

REGULATION OF FleQ AND ITS ACTIVITY

FleQ directly regulates flhA, fliE, fliL, and fleSR (Fig. 1). However, the promoter regions of these genes can be distinguished based on the location of FleQ-binding sites. In fact, analysis of the transcription start site (TSS) by primer extension revealed two distinct FleQ-binding sites. For the fleSR promoter, the FleQ-binding site was located 67 bp upstream of the TSS of fleSR (56), with the upstream position being typical for NtrC-like regulators (63–65). For flhA, fliE, and fliL, FleQ was determined to bind to the leader sequence of the flhA, fliE, and fliL promoters, in close proximity to the σ⁵⁴ RNA polymerase (RNAP)-binding sites (56). The difference in the location of FleQ binding relative to the TSS and the σ⁵⁴ RNAP-binding sites furthermore suggests two modes of σ⁵⁴-dependent activation by FleQ, and thus, two modes of flagellar regulation in P. aeruginosa. The first mode refers to the typical model of transcription initiation from a distance for NtrC-like regulators (56, 66) via looping in the fleSR promoter and involves upstream binding of FleQ and interaction with bound RNAP via looping (Fig. 2A). In the second mode, FleQ binding occurs downstream of class II promoters adjacent to the RNAP-binding site. In this mode, FleQ likely contacts RNAP directly to activate transcription, without looping (Fig. 2B). This mode of FleQ binding is uncommon in NtrC-like regulators.

Fig 2.

FleQ regulates class II flagella-associated genes through distinct mechanisms. (A) FleQ binds upstream of the TSS of fleSR resulting in DNA looping and a subsequent initiation of transcription. (B) FleQ binds the leader sequence of flhA, fliE, and fliL and initiates transcription in a manner that does not result in DNA looping. Sizes of DNA sites or proteins are not drawn to scale.

Despite the differences in binding to class II promoters, FleQ binding and FleQ-dependent regulation of flagella-associated genes require the ATPase activity of FleQ (39, 55). The ATPase activity is thought to facilitate the production of energy (through ATP hydrolysis) required for the remodeling of the σ⁵⁴ RNAP complex, from a closed σ⁵⁴ RNAP/DNA complex to an open σ⁵⁴ RNAP/DNA complex, with the remodeling switching the complex from inactive to active for transcription of downstream genes (67). Specifically, the central AAA+ ATPase domain of FleQ is necessary for ATP hydrolysis (66–68).

Although FleQ (in)directly regulates and activates more than 40 genes involved in flagellar biogenesis (53), an important element in the regulation of flagellar gene expression is FleN. FleN is an anti-sigma factor (54) that post-transcriptionally modulates the activity of FleQ by binding directly to the ATPase AAA+ binding site, thus blocking the ATPase activity of FleQ and, in turn, reducing or impairing FleQ-dependent initiation of transcription (54, 55, 69) (Fig. 3). This is apparent considering that P. aeruginosa fleN deletion mutants display a multiflagellate phenotype (54, 69). The findings suggested FleN ensured the monoflagellated P. aeruginosa. Thus, FleN functions like a brake of FleQ to ensure the correct number of flagella per bacterium. This brake is reversible, as FleQ activates the expression of fleN (Fig. 1), suggesting a feedback mechanism to modulate the activity of both proteins to ensure the maintenance of the monoflagellated state under planktonic growth conditions (51, 55, 70).

Fig 3.

Transcriptional and post-transcriptional regulation of FleQ. (A) Transcription of fleQ is negatively regulated by AmrZ and Vfr. (B) The ATPase activity of FleQ is negatively affected by c-di-GMP and FleN. Post-transcriptional regulation of FleQ by FleN functions to maintain a monoflagellate P. aeruginosa. Rec, receiver domain; ATPase, ATPase domain; HTH, helix-turn-helix DNA-binding domain.

TRANSITION TO THE SESSILE MODE OF GROWTH COINCIDES WITH A SWITCH IN SIGMA FACTORS

While several studies have highlighted the role of flagella in attachment and the initial stages of biofilm formation (71, 72), later biofilm developmental stages coincide with the loss of flagellar-driven motility (35, 73) and the production of biofilm matrix components, such as exopolysaccharides (Pel, Psl, and alginate) and adhesins (CdrA) (19, 42, 43, 74–78).

FleQ contributes to the transition from the planktonic to the sessile mode of growth in two ways: by repressing flagellar biogenesis genes and by activating the expression of genes contributing to the biofilm matrix, including genes involved in the biosynthesis of exopolysaccharides (Pel, Psl, and alginate) and adhesins (CdrAB) (36–38, 40). Unlike the expression of flagellar genes, however, FleQ-dependent expression of genes related to the biofilm matrix (pel and psl or cdrA) is independent of σ⁵⁴, ATPase activity of FleQ, and the FleQ σ⁵⁴-binding domain (36–38, 40, 79) (Fig. 4). Moreover, Baraquet and Harwood (36) reported that the cdrA promoter lacks the typical σ⁵⁴ RNAP-binding site.

Fig 4.

Inverse regulation of flagella- and biofilm matrix-associated genes by FleQ. Under planktonic growth conditions and/or at low c-di-GMP levels, FleN-bound FleQ binds σ⁵⁴-dependent promoters (flagella-associated genes) and activates expression in a σ⁵⁴ and ATP-dependent manner. At the same time, expression of biofilm matrix-associated genes (e.g., pel) is repressed. FleQ binds to at least two boxes in the promoter region of biofilm matrix-associated genes. FleN (bound to FleQ) dimerizes in the presence of ATP, inducing a bend or kink in the intervening DNA. FleQ-dependent repression of extracellular polysaccharide (EPS) genes does not require ATPase activity and σ⁵⁴. Under biofilm growth conditions and/or at high c-di-GMP levels, FleQ binds c-di-GMP which impairs its ATPase activity and association with σ⁵⁴, resulting in FleQ ceasing to activate σ⁵⁴-dependent promoters (e.g., of flagella-associated genes). C-di-GMP binding by FleQ relieves DNA bending, resulting in de-repression of biofilm matrix-associated genes (e.g., pel). The oligomerization state of FleQ is not addressed.

The findings suggest a transition to the biofilm mode of growth to coincide with FleQ regulating promoters that rely on sigma factors other than σ⁵⁴. Interestingly, Baraquet and Harwood (36) identified putative −10 (CATATT) and −35 (TTAAAA) boxes, indicative of control by σ⁷⁰ RNAP in the promoter region of cdrAB (Fig. 4). It is of note that P. aeruginosa PAO1 encodes 24 putative RNAP sigma factors, 19 of which are classified as σ⁷⁰-like extra-cytoplasmic function sigma factors (80). It is possible that one of these σ⁷⁰-like sigma factors participates in FleQ-mediated regulation of biofilm-related genes. While promoters of other FleQ-regulated biofilm genes have not been explored in such detail, the findings suggest that the two opposing behaviors, motility and biofilm, coincide with FleQ switching from regulating the expression of flagella-associated genes and dependence on σ⁵⁴ to the expression of biofilm-related genes that are dependent on σ⁷⁰-like sigma factors (or at least sigma factors other than σ⁵⁴), suggesting a sigma factor-specific mechanism of regulation by FleQ. It is important to point out, however, that the change of FleQ, transitioning from a repressor to an activator (or vice versa), occurs in response to c-di-GMP and in the presence of FleN. The pivotal role of c-di-GMP levels in modulating FleQ activity is discussed in further detail below.

c-di-GMP-DEPENDENT REGULATION OF GENE EXPRESSION BY FleQ

The two different types of lifestyles have been associated with differing cellular levels of the secondary messenger c-di-GMP, with high c-di-GMP levels favoring the biofilm mode of growth, while low levels favor the motile, planktonic mode of growth (81). FleQ has been characterized as a c-di-GMP-responsive transcription factor that inversely regulates flagellar-driven motility and matrix production in response to the cellular levels of the secondary messenger c-di-GMP (36–40, 79, 82). Specifically, at low c-di-GMP, FleQ positively regulates flagellar genes (39, 40, 51, 56) while repressing genes encoding the biofilm matrix components (36–38). FleQ repressing pel expression is supported by a 2.8–20-fold increase in pel transcript abundance in a fleQ mutant relative to the wild-type strain (36–38). At high c-di-GMP, FleQ ceases to activate flagellar genes but upregulates genes encoding biofilm matrix components including pel and psl and the adhesin cdrA (36–40, 79, 82). The findings indicate that in addition to a switch in sigma factors, FleQ is furthermore subject to an additional level of control by c-di-GMP (Fig. 4). C-di-GMP enables FleQ to regulate genes resulting in opposing behaviors—motility and adhesiveness—enabling a switch in the modes of growth. FleQ binds to the promoters of genes encoding matrix-associated components regardless of c-di-GMP levels. However, FleQ binds to at least two sites on the promoters of the pel, psl, and cdrA promoters (36), with the binding to the promoter varying depending on the presence of FleN, ATP (hydrolysis), and c-di-GMP. In fact, FleQ, acting as a repressor or activator of genes encoding biofilm matrix components, is linked to the c-di-GMP level (37). These sites, referred to as boxes 1 and 2, have been identified in the pel promoter as CGCCTAAAAATTGACAGTT and TCATTAGATTGACGTTAAT located −62 and −5 bp, respectively, relative to the TSS (36). At one site (box 2), FleQ functions to repress pel gene expression, and at the other site (box 1), FleQ functions to activate pel expression in response to c-di-GMP (37). The importance of the FleQ boxes is reversed in the psl operon, where the box upstream of the TSS is required for activation and the FleQ box that overlaps the TSS is required for repression (36). Similar to the pel promoter, FleQ binds to the cdrA promoter. However, the cdrA promoter is characterized by three FleQ-binding sites, with one site located upstream of the TSS (ATTGTCGGTTTTTTGACGGTATT) and two sites located side-by-side downstream of the TSS (GTCATTTAACTGACGAATGCA and TGCTGGAAAACTGACGTGCGC). The upstream box is required for FleQ-mediated cdrAB repression in the absence of c-di-GMP, whereas the downstream boxes are required for FleQ-mediated cdrAB activation in the presence of c-di-GMP (36). The mechanism by which FleQ inversely regulates the expression of psl genes is not known (36).

The c-di-GMP-dependent switch of FleQ from a repressor to the activator and, thus, de-repression of biofilm-related genes, particularly pel, has been elucidated by Baraquet et al. (37, 40). At low c-di-GMP levels, FleQ binds to its two FleQ-binding sites on the pel promoter simultaneously. FleQ binding to both boxes promotes the DNA backbone between the first and second both to bend or kink, with the distortion preventing RNAP to bind to pel promoter, either by impairing the binding of the RNAP or by preventing RNAP bound to the pel promoter from forming an open complex, leading to pel repression (37) (Fig. 4). The DNA bending was found to be stimulated by FleN, occurs only when ATP is present, and disappears in the presence of c-di-GMP (37). In the presence of ATP, FleN (bound to FleQ) has been proposed to form dimers inducing a bending of the pel promoter by bridging the bound FleQ proteins. While direct evidence is lacking, it is possible that a similar distortion affects the transcription of genes encoding matrix-associated components other than pel, as inactivation of fleQ has likewise been shown to coincide with increased transcript abundance of psl, relative to the wild-type strain (36–38).

In the presence of high c-di-GMP, FleQ undergoes a conformational change that probably induces a cascade of conformational changes in the FleQ/FleN/DNA complex such that the bending is relaxed (37, 40). The relief of the bending has been proposed to either induce RNAP binding or remodel RNAP binding. Moreover, FleQ is switched to an activator, with FleQ bound to pel box 1 favoring transcription initiation and binding of FleQ to pel box 2 favoring repression. Thus, c-di-GMP binding to FleQ relieves DNA distortion and activates gene expression without affecting the apparent protein occupancy on the DNA. The findings suggest that the conformation of the DNA intervening the two FleQ-binding sites (Box 1 and 2) plays a crucial role in the FleQ-dependent regulation of biofilm matrix-related genes, with bound FleQ acting as an activator or repressor depending on the DNA bending and the level of c-di-GMP (37). It is of interest to note that, unlike other regulators, FleQ switches from a repressor to an activator of biofilm genes without engaging/disengaging from the respective promoters but instead, by taking advantage of separate binding sites for each function, repression and activation.

While FleQ needs to bind to only one of its two binding sites (e.g., FleQ box 2 of pel promoter) for repression, evidence suggests that FleQ requires FleN for full activation of pel expression in response to c-di-GMP. FleQ forms a complex in the presence as well as in the absence of c-di-GMP with its antagonist FleN (37), with FleN continuing to exert its influence on FleQ concerning the expression of biofilm matrix-associated genes. This is apparent by the inactivation of fleN coinciding with decreased transcript abundance of pel and psl transcript abundance (38), while the inactivation of fleQ has the opposite effect, resulting in increased transcript abundance of pel and psl relative to the wild-type strain. The findings indicate that while flagellar gene expression by FleQ is regulated by FleN (FleN modulates FleQ activity), the activation of biofilm matrix-associated genes (pel, psl, and cdrAB) by FleQ is dependent on FleN (38, 83). It is of interest to note that while FleN remains complexed to FleQ regardless of the c-di-GMP levels, c-di-GMP induces conformational changes. For one, trypsin digestion profiles of FleQ and FleN differed in the presence and in the absence of c-di-GMP (37), suggesting c-di-GMP to induce a conformational change of a FleQ/FleN complex. Likewise, FleQ has been shown to undergo a conformational change when it binds c-di-GMP (37, 40). In contrast, FleQ does not undergo an obvious conformational change upon ATP binding, and ATP does not affect the conformational change of FleQ due to c-di-GMP binding (37, 40). FleQ and FleN interact irrespective of the presence of ATP hydrolysis (37). Moreover, while the ATPase activity of FleQ was required for flagellar gene expression, repression or activation of biofilm matrix-associated genes does not require ATP hydrolysis. Thus, FleQ functions as a repressor of pel and psl genes at low c-di-GMP levels in a manner dependent of FleN but independent of ATP hydrolysis, which further supports the σ⁵⁴-independent mechanism of FleQ in the regulation of genes encoding exopolysaccharides and adhesins. In turn, at high c-di-GMP levels, activation of FleQ coincides with a conformational change.

c-di-GMP-BINDING SITES AND OLIGOMERIZATION STATE

FleQ harbors three domains, an N-terminal REC receiver domain, a central AAA+ ATPase central domain that contains a σ⁵⁴ binding site, and a C-terminal helix-turn-helix DNA-binding domain (40, 51). The crystal structure of FleQ revealed three distinct motifs that are important for the binding of dimeric c-di-GMP to FleQ. These motifs include (i) amino acid residues LFRS at position 142–145 located at the N terminus of the AAA+ ATPase central domain, (ii) residues R¹⁸⁵N¹⁸⁶ located within the AAA+ ATPase central domain, past the Walker A motif, and (iii) the ExxxR³³⁴ motif located C-terminally of the helix-turn-helix DNA-binding domain of FleQ (40).

Upon c-di-GMP binding, the ATPase activity of FleQ is reduced, suggesting c-di-GMP to bind to the ATPase central domain to affect the ATPase activity of FleQ (38, 39). As a consequence, the expression of FleQ- and σ⁵⁴-dependent flagellar genes is reduced upon c-di-GMP binding (38, 39) (Fig. 4). Moreover, c-di-GMP binding has been reported to coincide with the relief in the DNA distortion (37).

Additionally, c-di-GMP binding by FleQ has been linked to a change in the oligomerization state of FleQ. The transcriptional regulator FleQ belongs to the AAA+ family of bacterial enhancer-binding proteins (bEBPs). Members of this family undergo conformational changes in dimeric bEBPs forming a ring-shaped hexamer capable of binding upstream of the TSS of target genes upon phosphorylation (at the Rec domain). The conformational change results in the recruitment of the σ⁵⁴-RNAP–promoter complex and the initiation of transcription in an ATPase-dependent manner (67, 84, 85). Despite a similar domain architecture, FleQ lacks both cognate sensor kinase and conserved REC domain residues that are crucial for phospho-transfer and phosphorylation-dependent conformational changes. Specifically, FleQ lacks the highly conserved phospho-acceptor residues (aspartate) present in NtrC subfamily of proteins and instead has a serine residue, and while it is possible that phosphorylation occurs at the serine residue, evidence is lacking to that effect (51). Despite the lack of apparent phospho-acceptor sites, FleQ has been reported to form dimers, trimers, tetramers, and hexamers in the presence or absence of ATP (40) and, unlike other bEBPs, spontaneously hexamerizes in solution, suggesting that FleQ appears to use a drastically different mechanism of regulation (40). While it is not known whether the dimeric form or a higher order oligomer (trimer, tetramer, or hexamer) is the stable form of FleQ to regulate flagella-associated genes, recent evidence suggests that at low c-di-GMP levels, hexameric FleQ is the functional pel transcriptional repressor and the target for c-di-GMP (40). As revealed by the crystal structure of c-di-GMP-complexed FleQ, c-di-GMP interacts with the AAA+ ATPase domain (40). The interactions lead to active site obstruction at the ATP-binding pocket, resulting in allosteric inhibition of the ATPase activity and inhibition of ATP-dependent activation of flagella genes (40). The interaction has furthermore been shown to result in the destabilization of the hexameric state of FleQ (40). The change in the oligomerization state likely results in the relief of DNA distortion at the promoter site and subsequent activation of genes encoding matrix exopolysaccharides and adhesins. At the same time, inhibition of the ATPase activity upon c-di-GMP binding results in the cessation of flagellar gene expression by FleQ.

c-di-GMP provides an additional level of control on the production of matrix polysaccharides. However, the regulation appears to be strain specific. For example, the main exopolysaccharide Psl by P. aeruginosa strain PAO1 is only regulated at the transcriptional level by c-di-GMP (42, 86). In contrast, the synthesis of Pel, the primary matrix polysaccharide in P. aeruginosa strain PA14, is regulated by c-di-GMP at the transcriptional and post-transcriptional levels (38, 57). Post-transcriptional regulation occurs by c-di-GMP binding to the PelD protein, with c-di-GMP binding activating the production of Pel polysaccharide (57, 87). The biosynthesis of the alginate polysaccharide has likewise been linked to c-di-GMP, with increased c-di-GMP levels positively affecting the expression of alginate biosynthesis genes (88). In addition to alginate biosynthesis being regulated by c-di-GMP at the transcriptional level, evidence suggests that c-di-GMP also affects alginate at the post-transcriptional level (89).

AmrZ PROVIDES AN ADDITIONAL LEVEL OF FleQ CONTROL TO FINE-TUNE MATRIX COMPOSITION AND MOTILITY

Early studies demonstrated that the fleQ promoter is not autoregulated by FleQ (51, 82). However, at the transcriptional level, fleQ expression is likely positively regulated by σ⁷⁰-like sigma factors (82) and negatively regulated by the global regulator of virulence factor expression, Vfr (82), and the quorum sensing regulatory protein LasR (82) (Fig. 3). An additional level of control of fleQ expression is conferred by the Alginate and Motility Regulator Z, AmrZ (Fig. 3). AmrZ (previously known as AlgZ) is a global transcriptional regulator of genes involved in exopolysaccharide production (Pel, Psl, and alginate), motility (flagella and twitching motility), and c-di-GMP metabolism (35, 41, 90–96). Similar to FleQ, AmrZ acts as both, an activator and a repressor, and inversely regulates genes involved in alginate exopolysaccharide production and motility (flagella and pili-associated genes) (92, 95, 96). AmrZ has been reported to repress the psl operon-encoding genes required for Psl exopolysaccharide production by binding the psl promoter and repressing its transcription (96, 97). Jones et al. showed AmrZ to increase the expression of pelB by 6.64 in an RNA-seq experiment, while chromatin immunoprecipitation (ChIP-seq) confirmed AmrZ binding to the pelB promoter (95). However, a later study showed an enhanced level of Pel polysaccharide in ΔamrZ with transcript levels of pelA and pelG not being different in the ΔamrZ vs the wild type, suggesting that AmrZ might be inhibiting the production of Pel through a mechanism that is non-transcriptional (98).

RNA-seq studies demonstrated AmrZ to contribute to the expression of fleQ (95), with RNA-seq, ChiP-seq, and electrophoretic mobility shift assays confirming AmrZ to be a direct repressor of fleQ expression (95). Biochemical characterization of ArmZ furthermore demonstrated that two amino acid residues (Lys18 and Arg22), located in the β-sheet of AmrZ DNA-binding domain, are important for DNA-binding to the fleQ promoter as well as the repressive function by AmrZ on fleQ expression (35, 41, 91).

Similar to FleQ, AmrZ functions in concert with two sigma factors. However, while FleQ works in concert with σ⁵⁴ to regulate flagellar-gene expression and σ⁷⁰ (or sigma70-like sigma factors) to regulate biofilm-associated genes, AmrZ works in concert with the AlgT sigma factor σ²² (35, 73). Additionally, σ⁷⁰-binding sites were found close to the amrZ-binding site on psl (96), suggesting AmrZ also works in concert with σ⁷⁰ to regulate psl transcription. In non-mucoid P. aeruginosa strains, AlgT (also known as AlgU) activity is modulated by the anti-sigma factor, MucA, with full sequestration of AlgT by MucA inhibiting AmrZ activity and resulting in the overall repression of alginate production and de-repression of fleQ (Fig. 5). It is of interest to note that the psl promoter activity was found to be reduced by 30% in a mucA mutant overexpressing alginate, suggesting an inverse correlation in the expression of psl and alginate polysaccharide by AmrZ (37, 96, 97). In contrast, deregulation resulting in free AlgT, as in response to environmental conditions or mutation of mucA, leads to the activation of amrZ and subsequent expression of alginate genes (Fig. 5).

Fig 5.

Regulation of amrZ gene expression and fine-tuning of the exopolysaccharide composition by P. aeruginosa biofilms (high c-di-GMP levels). Expression of amrZ is dependent on the availability of the AlgT sigma factor. When AlgT (also known as AlgU) is sequestered by the anti-sigma factor, MucA, amrZ gene expression is repressed. However, under stressful conditions (e.g., biofilm and CF lung environment), AlgT is released from MucA and becomes available to enable amrZ gene expression. AmrZ directly represses psl but enhances alg and cdrAB expression directly and gcbA gene expression indirectly. AmrZ may or may not activate the expression of pel under conditions of high c-di-GMP. In contrast, FleQ activates the expression of psl, pel, and cdrAB at high levels of c-di-GMP. The expression of fleQ and post-transcriptional activation via c-di-GMP of FleQ is AmrZ dependent. The availability of AmrZ and FleQ and their distinct effects on Pel, Psl, and alginate production enables fine-tuning the composition of the exopolysaccharides present in the biofilm matrix. Arrows indicate activation while blunt-ended lines indicate repression of gene expression. Solid lines indicate direct regulation, while dashed lines indicate indirect regulation. Red lines indicate unknown regulations.

AmrZ also regulates FleQ at the post-translational level by modulating the intracellular levels of c-di-GMP. Relative to the wild type, strains inactivated in amrZ are characterized by significantly higher levels of c-di-GMP (98). RNA-seq and qRT-PCR indicated AmrZ to regulate the expression of gcbA encoding the diguanylate cyclase GcbA (PA4843, also known as AdcA) (98). gcbA was not only found to be among the most highly expressed genes by ΔamrZ, but the diguanylate cyclase GcbA was also determined to be the main cause for the elevated c-di-GMP levels present in ΔamrZ (98). Elevated c-di-GMP has several consequences. For one, an increase in c-di-GMP contributes to FleQ switching from activating flagellar-associated genes to de-repressing biofilm-associated genes. Second, GcbA-generated c-di-GMP is sensed by two effector relay proteins, FlgZ and PA4324 (95, 98). While the mechanism for PA4324 is not known, FlgZ interacts with the flagellar stator MotC upon c-di-GMP binding, impairing flagella rotation. Lastly, both FlgZ and PA4324 mediate the repression of swarming motility (98), indicating AmrZ and GcbA to regulate swarming motility through a c-di-GMP-dependent mechanism (98).

Overall, both AmrZ and FleQ contribute to the expression of genes encoding exopolysaccharides but somewhat in an opposing manner under determined environmental circumstances. For example, at high c-di-GMP levels, AmrZ activates alginate production and represses psl but may or may not activate pel expression. FleQ activates both psl and pel expression without affecting alginate gene expression at high c-di-GMP levels. Considering the effect of the two proteins on exopolysaccharides, AmrZ regulating fleQ provides fine-tuning to FleQ activity at high c-di-GMP levels, with the fine-tuning affecting the overall composition of the biofilm matrix (Fig. 5). This is apparent by the matrix of mucoid strains primarily being composed of alginate (99) polysaccharide, whereas in non-mucoid strains, Pel and/or Psl polysaccharides appear to be the predominant polysaccharide (100–102) (Fig. 5).

CONCLUSION

The FleQ-mediated transition of P. aeruginosa from a free-living, planktonic mode of growth to a sessile, communal mode of growth coincides with FleQ undergoing many changes at the transcriptional and post-transcriptional level. Under planktonic, low c-di-GMP conditions, FleQ (post-transcriptionally regulated by FleN) works in concert with σ⁵⁴ to regulate flagella synthesis and motility in P. aeruginosa, while repressing biofilm matrix-associated genes. Transition by P. aeruginosa to the sessile mode of growth coincides with FleQ-binding c-di-GMP and ceasing ATPase activity, changing oligomerization state, and switching sigma factors (σ⁵⁴–σ⁷⁰). As a result, FleQ ceases to activate flagella genes and switches from a repressor to an activator of biofilm matrix-associated genes.

FleQ function is affected by various factors in a hierarchical manner that also contribute to the transition in growth modes. For example, FleQ is regulated by Vfr and AmrZ at the transcriptional level, as well as c-di-GMP, FleN, and AmrZ at the post-transcriptional level with AmrZ contributing to the cellular levels of c-di-GMP, via the diguanylate cyclase GcbA (AdcA). Additionally, FleQ regulates the activity of RNAPs bearing two separate sigma factors, σ⁵⁴ and σ⁷⁰.

FleQ is not specific to P. aeruginosa alone (Fig. 6), with FleQ having been identified to play similar roles of flagella biosynthesis in other Pseudomonas species such as P. fluorescens (47), P. syringae (103), Pseudomonas stutzeri (104), and P. putida (47, 105, 106). Additionally, FleQ inversely regulates flagella and biofilm matrix genes in P. putida (107) and in P. syringae (104, 108). FleQ is also found to act as a transcriptional regulator of flagella biosynthesis in Legionella pneumophila (109). Moreover, homologs of FleQ (Fig. 6) have been identified in other Gram-negative bacteria like Helicobacter pylori (FlgR) (110), Caulobacter crescentus (FlbD) (111), Vibrio cholerae (FlrA) (112, 113), and Shewanella putrefaciens (FlrA) (114). The alignment of FleQ and FleQ homologs in other species shows the N- and C-terminal regions to be highly variable, with amino acid residues toward the center of these proteins being generally conserved (Fig. 6). These FleQ homologs play similar roles in motility and regulation of gene expression (51). However, their role in biofilm formation and regulation of biofilm matrix-associated genes remains unknown.

Fig 6.

Rooted phylogenetic tree of FleQ and its homologs. (A) Alignment of FleQ and FleQ homologs. The alignment was carried out using Clustal Omega (116). Cc, C. crescentus; Hp, H. pylori; Vc, V. cholerae; Sp, S. putrefaciens; Pa, P. aeruginosa; Lp, L. pneumophila. *, highly conserved amino acid residues; : and ., moderately conserved amino acid residues. (B) Phylogenetic tree derived from Clustal Omega-generated alignment (115).

Additional questions regarding FleQ remain open. For example, it is unclear if all genes regulated by FleQ at high c-di-GMP levels are σ⁷⁰-dependent. Likewise, while FleQ has been reported to bind as a hexamer to the pel promoter at low c-di-GMP, the oligomerization state of FleQ when bound to flagella gene promoters at low c-di-GMP and promoters of biofilm matrix-associated genes at high and low levels of c-di-GMP is not well understood. Moreover, the role of AmrZ in fine-tuning FleQ is being challenged. While AmrZ acts upstream of FleQ and represses its transcription in P. aeruginosa, a recent study suggested FleQ to repress the expression of amrZ in P. putida and P. fluorescens (47), indicating a feedback loop. Whether FleQ likewise acts as a repressor of amrZ in P. aeruginosa is as of yet unknown and requires unraveling of the molecular mechanism of repression.