Skip to main content
Technology in Cancer Research & Treatment logoLink to Technology in Cancer Research & Treatment
. 2024 Mar 22;23:15330338241241245. doi: 10.1177/15330338241241245

Determination of In Vitro and In Vivo Effects of Taxifolin and Epirubicin on Epithelial–Mesenchymal Transition in Mouse Breast Cancer Cells

Muhammet Ocak 1, Duygu Deniz Usta 1, Gokce Nur Arik Erol 2, Gulnur Take Kaplanoglu 2, Ece Konac 1, Atiye Seda Yar Saglam 1,
PMCID: PMC10958820  PMID: 38515396

Abstract

Background: One of the most significant characteristics of cancer is epithelial–mesenchymal transition and research on the relationship between phenolic compounds and anticancer medications and epithelial–mesenchymal transition is widespread. Methods: In order to investigate the potential effects of Taxifolin on enhancing the effectiveness of Epirubicin in treating breast cancer, specifically in 4T1 cells and an allograft BALB/c model, the effects of Taxifolin and Epirubicin, both individually and in combination, were examined. Cell viability assays and cytotoxicity assays in 4T1 cells were performed. In addition, 4T1 cells were implanted into female BALB/c mice to conduct in vivo studies and evaluate the therapeutic efficacy of Taxifolin and Epirubicin alone or in combination. Tumor volumes and histological analysis were also assessed in mice. To further understand the mechanisms involved, we examined the messenger RNA and protein levels of epithelial–mesenchymal transition-related genes, as well as active Caspase-3/7 levels, using quantitative real-time polymerase chain reaction, western blot, and enzyme-linked immunosorbent assays, respectively. Results: In vitro results demonstrated that the coadministration of Taxifolin and Epirubicin reduced cell viability and cytotoxicity in 4T1 cell lines. In vivo, coadministration of Taxifolin and Epirubicin suppressed tumor growth in BALB/c mice with 4T1 breast cancer cells. Additionally, this combination treatment significantly increased the levels of active caspase-3/7 and downregulated the messenger RNA and protein levels of N-cadherin, β-catenin, vimentin, snail, and slug, but upregulated the E-cadherin gene. It significantly decreased the messenger RNA levels of the Zeb1 and Zeb2 genes. Conclusion: The in vitro and in vivo results of our study indicate that the concurrent use of Epirubicin with Taxifolin has supportive effects on breast cancer treatment.

Keywords: epirubicin, taxifolin, breast cancer, 4T1 cells, epithelial–mesenchymal transition

Introduction

Breast cancer (BC) is one of the most common cancers in the world, particularly among women, and it has an important place among the causes of death from cancer.1,2 Triple Negative BC (TNBC) is the most studied and least curable subtype of BC. Triple Negative BC, which lacks the expression of estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2, tends to respond well to chemotherapy, which is commonly used as neoadjuvant therapy.13

Nowadays, it is believed that a combined approach to treatment will be more successful in fighting cancer. Since combined therapy will increase the efficiency of the treatment, it may help to reduce the dose of the agents used. Thus, the cytotoxic effect of the agent used is reduced, and possible drug resistance can be prevented. 4

Metastasis is a pathway that has been extensively studied and continues to be subject of research in cancer patients, and information about coping with it expands daily through clinical reports. This is why in vivo and in vitro studies on metastasis hold the key to establishing a model and molecular mechanism and testing new therapeutic agents. 5

Epithelial–mesenchymal transition (EMT) is a migration movement process in which the epithelial characteristics of the cells are lost, and many morphological and biochemical changes occur in the cells. 6 Epithelial–mesenchymal transition pathway needs specific cellular processes to function properly including cell polarity differentiation, cell migration, and cytoskeletal remodeling. 7 Cancer cells lose characterized markers of epithelial membranes such as beta-catenin and e-cadherin. Additionally, they obtain new attributes such as vimentin and N-cadherin. 8 Besides the hallmarks of cancer induced by the activated EMT mechanism in the surrounding, cells are more tolerant to the apoptotic pathways as they trigger tumoral aggression. Therefore, chemotherapeutic agents do not show the expected effect due to the mesenchymal cell phenotype exhibited.58

Anthracyclines are chemotherapeutic agents that are frequently used in the treatment of many different types of cancer. Anthracycline agents used for remedial purposes are daunorubicin, doxorubicin, epirubicin (EPI), idarubicin, and mitoxantrone.9,10 Epirubicin, 4′ epimer of doxorubicin, is a chemotherapeutic drug commonly used in cancer treatment. Its mechanism of action includes DNA intercalation, topoisomerase II inhibition, and helicase inhibition. 11

In the literature, it is shown that the combination of phytochemicals with chemotherapeutic agents decreases the dose needed, reducing the appearing side effects and toxicity, and therefore enhancing the therapeutic response.1218

Flavonoids are taken place in preclinical cancer studies with adjuvants and therapeutic agents.1921 Most recent studies have revealed that organic compounds, when combined with flavonoids, exhibit the same effect with significantly improved outcomes. Furthermore, flavonoids have been reported to alleviate the burden of anthracycline treatment. Accordingly, it could be thought that flavonoids also subdue the effects of anthracycline-mediated cytotoxicity. 22 Taxifolin (Tax; 3,5,7,3,4-pentahydroxy flavanone or dihydroquercetin), a subspecies of flavonoids, is found in citrus and onions, as well as in the roots of Larix olgensis.23,24 It is generally used as a supplement to standard chemotherapy agents for BC treatment.25,26 In light of this information, the aim of our study is to investigate the effects of the coadministration of Tax with EPI to enhance the effectiveness of EPI in 4T1 cells and its allograft BALB/c model.

Materials and Methods

Reagents and Chemicals

Epirubicin, Tax, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich. Fetal bovine serum (FBS), L-glutamine, Roswell Park Memorial Institute (RPMI) 1640, penicillin, and streptomycin were obtained from HyClone. Cytotoxicity Detection Kit Plus was purchased from Roche Applied Science, and SensoLyte® Homogeneous AMC Caspase-3/7 Assay kit was purchased from AnaSpec Inc. Transcriptor High Fidelity cDNA Synthesis Kit and Light Cycler® 480 Probes Master kit were purchased from Roche Applied Science. BCA™ Protein Assay Kit was from Thermo Scientific. All western blot antibodies were obtained from Cell Signaling Technology (CST; #9782). Reagents for protein gel electrophoresis were procured from Bio-Rad and Luminata Forte HRP chemiluminescence detection reagent was bought from EMD Millipore. All other reagents, unless otherwise specified, were purchased from Sigma-Aldrich in the highest purity available.

Cell Culture

4T1 cells are a type of cell line commonly used in BC research, particularly in the study of TNBC. Murine TNBC (4T1) cells were obtained from American Type Culture Collection. The cells were cultured in RPMI-1640 medium supplemented with 10% heat-inactivated FBS containing 100 U/mL penicillin, 100 µg/mL streptomycin, and 2 mM L-glutamine in a humidified atmosphere (95% humidity) at 37 °C with 5% CO2. The cells in passages 2 to 6 were used for testing. Experiments were performed using cells in the exponential growth phase. Both agents were dissolved in DMSO to prepare proper stock solutions, which were then diluted to the desired concentrations to be used in analyses. The cells were treated with 0.1% DMSO as a control in all experiments.

Cell Viability Assay

The proliferation of cells treated with various concentrations of Tax and EPI was determined by the 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay based on the detection of mitochondrial dehydrogenase activity in living cells.27,28 An MTT assay was conducted to determine the viability of 4T1 cells after treatment with Tax, EPI, and their combination, and the IC50 was defined as the concentration of the agent required to block 50% cell viability. For this purpose, an equal number of 4T1 cells (5 × 103 cells/well) were cultured in 96-well plates and allowed to attach overnight. The cells were then treated with Tax or EPI in various concentrations or the vehicle (DMSO, final concentration 0.2%) and incubated at 37 °C for 24, 48, and 72 h. At the end of the time, 10 µL of 5 mg/mL MTT was added to each well and incubated at 37 °C for 4 h. Subsequently, the cell culture medium was removed, and 100 µL DMSO was added to dissolve formazan crystals and the absorbance of each well was measured at 570 nm using a Spectramax M3 microplate reader (Molecular Devices). The percentage of cell growth inhibition was calculated as follows: cell inhibition percentage (%): (mean absorbance in test wells/mean absorbance in control wells) ×100. All experiments were repeated 6 times for each concentration and independently replicated for a minimum of 3 times.

Cytotoxicity Assay

Cytotoxicity was evaluated by lactate dehydrogenase (LDH) release assay. 29 The Cytotoxicity Detection Kit Plus (Roche Applied Science) was used to determine whether Tax and/or EPI have any cytotoxic effect on 4T1 cell lines. Briefly, 4T1 cells were cultured in a 96-well plate at 1 × 104 cells/well for 24 h. Then, the cells were exposed to selected concentrations of Tax and EPI for an additional 24 and 48 h. This assay was performed according to the manufacturer's protocol. The optical density was measured at 490 nm with a Spectramax M3 microplate reader (Molecular Devices). The percentage of LDH release was calculated according to the formula provided in the manufacturer's protocol. All experiments were performed in 3 replicates in 3 independent experiments.

Animals and Ethics

Six to 8-week-old female BALB/c mice weighing 18 to 22 g were purchased from Laboratory Animal Center, Bilkent University. The mice were housed under controlled laboratory conditions in groups of 10 per cage for a week prior to the beginning of the experiment and given unimpeded access to food and water. The experimental protocol was performed in accordance with the Turkish Law for the protection of animals. This study was performed under Gazi University Animal Research Ethics Committee approval in March 2021 (Approval number G.U.ET-21.016).

Tumor Formation and Experimental Protocol

Tumor inoculation was carried out according to the modified method of Pulaski et al. 30 For tumor inoculation, firstly, the cultured 4T1 cells were harvested and resuspended in serum-free media. Then, 5 × 104 cell suspensions prepared in phosphate-buffered saline (PBS) were injected subcutaneously into the left inguinal mammary fat pad of female mice. The animals’ weight and tumor size were measured weekly. Tumor size was evaluated with the help of a caliper. The caliper was held parallel to the head–thorax–abdomen line, which was confirmed as length, then it was held at 90° to the head–thorax–abdomen line, which was confirmed as width, and tumor volume was calculated using the following formula: tumor size (mm3) = ((width)2 × length)/2. After the development of palpable tumors for 10 days, the mice were randomly divided into 6 groups, each containing 10 animals as follows: (1) vehicle control 1 (DMSO, intragastric (i.g.), once every 4 days for 30 days), (2) vehicle control 2 (PBS, intravenous (i.v.), once daily for 16 days), (3) vehicle control 3 (DMSO, i.g., once every 4 days for 30 days and PBS, i.v., once daily for 16 days), (4) Tax (100 mg/kg body weight (BW), i.g., once every 4 days for 30 days) (5) EPI (2.5 mg/kg BW i.v., once daily for 16 days), and (6) combined group (100 mg/kg BW Tax i.g., once every 4 days for 30 days and 2.5 mg/kg BW i.v. EPI, once daily for 16 days). At the end of the experiment, all mice (10 animals in each group) were sacrificed with collected blood by cardiac puncture under ketamine hydrochloride (45 mg/kg body weight, Ketalar, Pfizer) and xylazine hydrochloride (5 mg/kg body weight, Rompun, Bayer) anesthesia. Animals were euthanized using the intracardiac blood collection method described in the previous studies.31,32 The breast tumor tissues and blood samples were collected for further analysis.

Detection of Caspase-3/7 Activity

To detect whether apoptosis is caspase-dependent, cleaved (active) caspase-3 levels were evaluated by SensoLyte® Homogeneous AMC Caspase-3/7 Assay kit (AnaSpec Inc.), according to the manufacturer's instructions. 33 Total proteins of tumor tissues were extracted according to the standard protocol. Protein content was detected by bicinchoninic acid (BCA)™ protein assay kit (Pierce). The same protein amount of each sample was applied to coated wells of the provided plate. Then, caspase 3/7 substrate solution was added to each well and incubated before measuring fluorescence on a microplate reader (Molecular Devices) at Ex/Em wavelengths of 350/440 nm. Caspase-3/7 activity levels were analyzed by subtracting the fluorescence levels of each well-containing medium only. Each experiment was performed in triplicate in 3 independent experiments.

Hematoxylin–Eosin

Tissue samples were fixed with 10% buffered formaldehyde for 72 h at room temperature until they hardened. After fixation, those that were used for light microscopic evaluations were washed under running water for 24 h. Increasing degrees of alcohol series (70%, 80%, 90%, 100%, soaked for 1 h for each density) was used to remove the tissues from the water. Afterward, they were passed from xylene textures, and paraffin-embedded blocks were prepared. A 5-µm thick sections were obtained from each paraffin block. Sections were deparaffinized using xylene and rehydrated using a graded ethanol series. Then they were stained with hematoxylin for 10 min and with eosin for 10 min at room temperature. The slides prepared were examined with a photo-light microscope (DCM 4000 Image Analyze System with Q Vin program, Leica, Microsystems, Heidelberg GmbH).

RNA Isolation and Quantitative Real-Time PCR Analysis

TriReagent (peqGOLD TriFast™, peqlab) was used to extract total RNA from excised tumor tissues (∼100 mg) per the manufacturer's instructions. Total RNA concentration was then quantified at 260 nm and 280 nm using Nano-Drop 1000 spectrophotometer (Thermo Fisher Scientific). cDNA synthesis was performed from 1 µg of total RNA with a Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics), following the manufacturer's protocols. The cDNA samples were stored at −80 °C until use. Quantitative PCR reactions were then performed using the Light Cycler® 480 real-time PCR system (Roche Diagnostics) with a Light Cycler 480 Probes Master mix kit (Roche Diagnostics) according to the manufacturers’ instructions. The qPCR primers for each target gene were designed using the NCBI Primer-Blast database search program. Table 1 shows the gene-specific primer sequences (in the 5′-3′ direction) for each gene used for the qPCR reaction. The messenger RNA (mRNA) level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used to normalize the levels of the target genes. Thermal cycling conditions were as follows: denaturation at 95 °C for 10 min, 45 cycles of amplification: 95 °C for 10 s, 60 °C for 20 s, and cooling at 40 °C for 30 s Expression levels of target genes were quantified employing the 2−ΔΔCT method.34,35 Each experiment was performed using triplicate samples.

Table 1.

Gene-Specific Primer Sequences Used in qPCR.

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
E-cadherin GTCTCCTCATGGCTTTGC CTTTAGATGCCGCTTCAC
β-catenin TCTGAGGACAAGCCACAGGA GCACCAATGTCCAGTCCAAG
N-cadherin GCCTATGAAGGAACCACATGA CTGTATCTCAGGGAAAGGT
Snail CCACTGCAACCGTGCTTT CTTGGTGCTTGTGGAGCAA
Slug TTCGGACCCACACATTACCT GCAGTGAGGGCAAGAAAAAG
Zeb1 GGAGCCTTGATGTGGTAGGA GCTTGACTTTCAGCCCTGTC
Zeb2 GGAGCAGGTAATCGCAAGT CGCAGGTGTTCTTTCAGATG
Vimentin TGTGAGGTGGAGCGGGAC ACATCGATCTGGACATGCTG
GAPDH GTTGTCTCCTGCGACTTCA GGTGGTCCAGGGTTTCTTA

Abbreviations: UPL, Universal Probe Library; qPCR, quantitative real-time polymerase chain reaction.

Western Blot Analysis

Western blotting was carried out as described previously using a standard protocol.36,37 A western blotting assay was conducted to evaluate the expression of EMT-related protein expressions in tumor tissues. Total proteins were extracted from tumor tissues by using RIPA buffer (Thermo Fisher Scientific) supplemented with protease inhibitors, according to the standard protocol, and their concentrations were detected by a BCA protein assay kit. Both procedures followed the manufacturer's instructions. Equal amounts of protein (30 μg) of each lysate were separated by 8%, 10%, and 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto a polyvinylidene fluoride membrane (Millipore). After blocking with 3% (w/v) bovine serum albumin (Bioshop, Canada) dissolved in Tris-Buffered Saline containing 0.1% Tween 20 (TBST) for 1 h at room temperature, the membranes were incubated with specific primary antibodies (E-cadherin (24E10) Rabbit mAb 1:1000 #3195, β-catenin (6B3) Rabbit mAb 1:1000 #9582, N-cadherin Antibody 1:1000 #4061, Snail (C15D3) Rabbit mAb 1:1000 #3879, Slug (C19G7) Rabbit mAb 1:1000 #9585, Vimentin (R28) Antibody 1:1000 #3932) overnight at +4 °C. After being washed with TBST 3 times, the membranes were probed with appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (Antirabbit IgG, HRP-linked Antibody 1:2000 #7074) for 2 h at room temperature. Immunoblots were detected with an enhanced chemiluminescence reagent using the Gel Logic 2200 Pro Carestream software. The target genes were identified by using EMT Antibody Sampler Kit #9782 (CST). The relative density of the bands was quantitated by comparison to the vehicle control using the Image J Software (NIH Image). Triplicate experiments were performed with triplicate samples.

Statistical Analyses

Statistical analyses were performed with the help of SigmaStat v3.5 software (Systat Software, Inc.). The concentration which produced 50% cytotoxicity (IC50) was determined using GraphPad Prism 6 software (GraphPad Software Inc.). 38 Viability assay, qPCR analysis, and LDH release assay (with Bonferroni post hoc test) results were analyzed using analysis of variance test. Combination Index curves calculated and visualized using Compusyn (BioSoft). 33 The mRNA levels of EMT-related genes were analyzed by the Relative Expression Software Tool (REST® 2009 v2.013) and confirmed by the GeneGlobe Data Analysis Center (Qiagen). 39 All data were presented as mean ± standard deviation, and values of P < .05 was considered statistically significant. The reporting of this study conforms to ARRIVE 2.0 guidelines. 40

Results

Effects of Tax and EPI on Cell Viability

The 4T1 cell viability was determined by the MTT assay (Figure 1). 4T1 cells were treated with Tax and EPI alone for 24, 48, and 72 h. The administration of Tax for 24, 48, and 72 h did not alter the viability of the cells at the concentrations up to 500 µM (P > .05). Administration of EPI (0.1-0.5 µM) alone to 4T1 cells resulted in a slightly diminished cell viability, (P < .05), but it significantly decreased at higher concentrations (1, 2.5, 5, 10, 25, 50, and 100 µM) for 24, 48, and 72 h (P < .001). The effects of Tax and EPI combined treatments on cell viability are shown in Figure 1C. After 24 h treatment, the lowest cell viability (56.39%) was observed in the combined treatments of 50 µM Tax and 1 µM EPI. It was determined that 5, 10, 25, and 50 µM Tax with 5 µM EPI treatments significantly decreased cell viability below 50% in both 24 and 48 h. The combined treatments of Tax and EPI led to a further decrease in cell viability compared to individual use of the inhibitors. According to the results obtained from the combination index analysis, Tax and EPI showed synergy in the treatment of 4T1 mouse BC cells (Figure 2).

Figure 1.

Figure 1.

Cell viability of 1 to 500 µM Tax (A), 0.1 to 100 µM EPI treated 4T1 cells (B) at 24, 48 and 72 h. Effects of selected concentrations of Tax and EPI combination (C) on 4T1 cell viability at 24 and 48 h. Data were expressed as mean ± standard deviation. *P < .05 compared with the control groups; **P < .01 compared with the control groups; ***P < .001 compared with the control groups; EPI, Epirubicin; 5 Tax, 5 µM Taxifolin; 10 Tax, 10 µM Taxifolin; 25 Tax, 25 µM Taxifolin; 50 Tax, 50 µM Taxifolin; 0.1 EPI, 0.1 µM Epirubicin; 0.5 EPI, 0.5 µM Epirubicin; 1 EPI, 1 µM Epirubicin; 5 EPI, 5 µM Epirubicin.

Figure 2.

Figure 2.

Combination index (CI) analysis for the Tax and EPI synergistic effects. CI values were generated by linear regression. Trendlines demonstrates CI values for any expected effect (Fa, fraction affected, 0 to 1; 0-%100 inhibition), and CI values <1, =1, >1 indicates synergy, additivity, or antagonism, respectively.

Effects of Tax and EPI on Cytotoxicity

The cytotoxic effects of Tax and EPI on 4T1 cells were evaluated by LDH release assay. The individual administration of EPI induced cytotoxicity in 4T1 cells treated for 24 h. Cytotoxicity was very low and similar in 4T1 cells exposed to a selected concentrations of Tax (10, 25, and 50 µM) at 24 h. The percentages of LDH release at 0.5 and 1 µM were as follows: 3.50% and 5.07% (P < .05), respectively. The treatment of 4T1 cells with Tax decreased EPI induced LDH release in a dose-dependent manner (0.1, 0.5, and 1 µM) (P < .05). Our results show that combined treatment of Tax and EPI markedly decreased the cytotoxic effects of EPI alone in 4T1 cells (Figure 3).

Figure 3.

Figure 3.

Effect of Tax and/or EPI on cytotoxicity determined by LDH release in 4T1 cells. Data were expressed as mean ± standard deviation. *P < .05 compared with the control groups; ***P < .001 compared with the control groups; 5 Tax, 5 µM Taxifolin; 10 Tax, 10 µM Taxifolin; 25 Tax, 25 µM Taxifolin; 50 Tax, 50 µM Taxifolin; 0.1 EPI, 0.1 µM Epirubicin; 0.5 EPI, 0.5 µM Epirubicin; 1 EPI, 1 µM Epirubicin; 5 EPI, 5 µM Epirubicin; LDH, lactate dehydrogenase.

Evaluation of Body Weights and Tumor Volumes

The tumors were collected from the 6 groups of Balb/c mice at the end of the treatments (Figures 4A and 4B). No statistical significance was detected in weekly measurements of tumor volume readings except for the combination group (Figure 5). No significant change in body weight was observed between the control groups and the treatment groups (P > .05, Figure 6A). The average tumor volume initial of the experiment and at the end of the experiment between groups was not significantly different (Figure 6B) (P > .05). The percentage of tumor volume changes was increased in all groups. When compared to the sham control groups, the percentage of tumor volume in the treatment groups including Tax- and EPI-alone treated groups (87.91% and 72.03%, respectively) was lower but all these changes do not reach the significant level (P > .05). In contrast, it was observed that the tumor volume in the combined group (53.64%) significantly decreased compared to the control groups (P < .05, Figure 6B).

Figure 4.

Figure 4.

Photographs of 4T1 cell-bearing BALB/c mice with different treatments (A). Photographs of tumor tissues extracted from groups at the end of the experiment, Group 1: vehicle control (treated with DMSO); Group 2: vehicle control (treated with PBS); Group 3: vehicle control: (treated with DMSO and PBS); Group 4: treated with Tax; Group 5: treated with EPI; Group 6: treated with Tax and EPI combination (B). EPI, Epirubicin; Tax, Taxifolin; DMSO, dimethyl sulfoxide; PBS, phosphate-buffered saline.

Figure 5.

Figure 5.

Demonstration of tumor volume change measured once a week in vehicle controls and treatment groups. Group 1: vehicle control (treated with DMSO); Group 2: vehicle control (treated with PBS); Group 3: vehicle control: (treated with DMSO and PBS); Group 4: treated with Tax; Group 5: treated with EPI; Group 6: treated with Tax and EPI combination. EPI, Epirubicin; Tax, Taxifolin; DMSO, dimethyl sulfoxide; PBS, phosphate-buffered saline.

Figure 6.

Figure 6.

Effects of Tax and/or EPI on body weights (A) and tumor volumes (B) in BALB/c mice. *P < .05, Student t test. Group 1: vehicle control (treated with DMSO); Group 2: vehicle control (treated with PBS); Group 3: vehicle control: (treated with DMSO and PBS); Group 4: treated with Tax; Group 5: treated with EPI; Group 6: treated with Tax and EPI combination. EPI, Epirubicin; Tax, Taxifolin; DMSO, dimethyl sulfoxide; PBS, phosphate-buffered saline.

Effects of Tax and EPI on Caspase-3/7 Levels In Vivo

To verify the presence of apoptosis in tumor tissues, the levels of caspase-3/7 activity were determined. The levels of caspase-3/7 activity significantly increased in the Tax- and EPI-alone treated groups compared to the control group (P < .05). Additionally, the caspase-3/7 activity level significantly increased in the combined group when compared to control groups (P < .05). Furthermore, the caspase-3/7 activity level significantly increased in the combined group when compared to alone Tax- and EPI-treated groups (P < .05; Figure 7).

Figure 7.

Figure 7.

Effects of Tax and/or EPI on caspase-3/7 activity levels in tumor tissues. Data were expressed as mean ± standard deviation. The results shown are representative of the 3 independent experiments. *P < .05 compared with the control groups; ***P < .001 compared with the control groups. G1: Group 1; G2: Group 2; G3: Group 3; G4: Group 4; G5: Group 5; G6: Group 6. EPI, Epirubicin; Tax, Taxifolin.

Hematoxylin–Eosin Results

In the breast tumor samples taken from the sham control group, a centrally located tumor area without the characteristic duct structure of the breast was observed. While the infiltration was very evident in the surrounding areas, it was noted that the ducts of the breast tissue remained in the areas close to the surface (Figure 8A). In the group treated with Tax, the tumor focus was prominent especially in the central area, while apart from the sham group, the presence of ducts in the focal area of the tumor in addition to the peripheral area attracted attention. Infiltration was more pronounced in this group (Figure 8B). In the tumor tissue treated with EPI, the tumor structure was centrally located as in the other groups, but the presence of duct structures in normal breast tissue within the focus was evident. The periphery of the entire tumor focus contained clumps of infiltrative cells (Figure 8C). The presence of normal breast tissue attracted attention in the group in which Tax + EPI was applied together for the treatment of tumorous breast tissue. Ducts were observed in the whole area. The areas containing infiltrative cells were prominent in the peripheral region (Figure 8D). As a result, it was concluded that the most effective treatment method for the tumoral histomorphological transformation observed in the sham control group was the combined application of Tax and EPI.

Figure 8.

Figure 8.

Breast tumor tissue sections for each group demonstrating (A) Control group, (B) Tax treated group, (C) EPI treated group, and (D) Tax + EPI treated group. Region within the dashed circle: Tumor area, (◉): Infiltrative area, (Du): Normal duct structure (Hematoxylin–eosin ×40). EPI, Epirubicin, Tax, Taxifolin.

Effects of Tax and EPI on mRNA Levels of EMT-Related Genes In Vivo

The mRNA levels of E-cadherin, N-cadherin, β-catenin, Vimentin, Snail, Slug, zinc finger E-box binding homeobox 1 (Zeb1), and Zeb2 genes were evaluated by qPCR. The levels of E-cadherin mRNA significantly increased in the EPI treated group (G5) and Tax + EPI group (G6) compared to the control groups (P < .05). The mRNA levels of N-cadherin, β-catenin, Vimentin, Snail, Slug, Zeb1, and Zeb2 genes in G5 and G6 were significantly lower than those in the control groups (P < .05). Besides, N-cadherin, β-catenin, Vimentin, Snail, Slug, Zeb1, and Zeb2 mRNA expression levels were observed to be lower in G6 compared to G5 (P < .001) (Figure 9).

Figure 9.

Figure 9.

Effects of Tax and/or EPI on EMT-related mRNA levels in tumor tissues. Data were expressed as mean ± standard deviation. The results shown are representative of the 3 independent experiments. *P < .05 compared with the control groups; ***P < .001 compared with the control groups. G1: Group 1; G2: Group 2; G3: Group 3; G4: Group 4; G5: Group 5; G6: Group 6. EPI, Epirubicin, Tax, Taxifolin; EMT, epithelial–mesenchymal transition; mRNA, messenger RNA.

Effects of Tax and EPI on Protein Levels of EMT-Related Proteins

Western blot assay was used to analyze the effects of Tax and EPI treatment applied to tumor tissues on EMT-related proteins such as N-cadherin, E-cadherin, β-catenin, Vimentin, Snail, and Slug levels (Figure 10). Consistent with qPCR results, E-cadherin protein level was significantly higher in EPI treated group (G5) and Tax + EPI group (G6) compared to the control groups (G1, G2, and G3). Similarly, the levels of N-cadherin, β-catenin, Vimentin, Snail, and Slug proteins significantly decreased in EPI treated group (G5) and Tax + EPI group (G6) compared to the control groups (G1, G2, and G3), as seen in qPCR results (P < .05). In addition, Tax treatment did not change the levels of these proteins in tumor tissues (P > .05).

Figure 10.

Figure 10.

Effects of Tax and/or EPI on EMT-related protein levels in tumor tissues. Western blot images of the EMT-related protein levels in tumor tissue (A). Relative protein expressions in tumor tissues from mice treated with Tax, EPI and Tax + EPI (B). Data were expressed as mean ± standard deviation. Graphs represent fold change of the indicated proteins in at least 3 different mice for each group. The results shown are representative of the 3 independent experiments. *P < .05 compared with the control groups. G1: Group 1; G2: Group 2; G3: Group 3; G4: Group 4; G5: Group 5; G6: Group 6. EPI, Epirubicin; Tax, Taxifolin; EMT, epithelial–mesenchymal transition.

Discussion

Breast cancer is a significant health concern and a leading cause of cancer-related deaths among women. Common treatment modalities for BC include surgery, radiation therapy, chemotherapy, hormone therapy, and immunotherapy. Epirubicin is a chemotherapy drug that is commonly used in the treatment of early-stage, advanced-stage, and metastatic BC. 11 It works by interfering with the DNA of cancer cells, thereby inhibiting their growth and proliferation, and leading to cell death. 11 Epirubicin is often used in combination with other chemotherapy drugs or as part of a broader treatment regimen. While it is a potent chemotherapy drug with broad-spectrum antitumor efficacy, its clinical utility can be limited by dose-dependent toxicity in tissues such as the heart, liver, and kidney.41,42

Chemosensitization is a strategy used in cancer treatment to enhance the effectiveness of chemotherapy drugs. The goal is to make cancer cells more susceptible to the toxic effects of these drugs, ultimately improving the overall treatment outcome. Chemosensitizers are nontoxic molecules, which can be either naturally occurring or synthetic. They work by modifying the cellular environment or signaling pathways in cancer cells, which in turn makes them more vulnerable to the cytotoxic effects of chemotherapy drugs. By combining chemosensitizers with chemotherapy drugs, it is possible to achieve a synergistic effect, where the combined treatment is more effective than either treatment alone. This approach can potentially increase the effectiveness of chemotherapy treatment and reduce the likelihood of drug resistance or cancer recurrence.12,13,43 Possible chemosensitizers are often natural substances, such as flavonoids. 38 Tax, also known as dihydroquercetin, is a flavonoid compound that has shown promise as a chemosensitizer in cancer treatment.4447 Some studies have suggested that Tax may enhance the efficacy of chemotherapy drugs by sensitizing cancer cells to their cytotoxic effects. On the other hand, numerous studies have investigated the potential of flavonoids to neutralize free radicals and reduce the formation of free radicals. Among these flavonoids, Tax has garnered particular attention due to its capacity to alleviate oxidative stress, decrease LDH secretion, and exhibit antioxidant properties.48,49 In their study, Najeb et al examined the antioxidant effects of Tax on myocardial injury induced by combinations of diazinon and Vitamin C in rats. Tax demonstrated its antioxidant property by effectively reducing LDH secretion rates in myocardial cells under conditions of stress. 50 In their investigation, Lin et al conducted LDH cytotoxicity assays on mouse cochlear UB/OC-2 cells exposed to gentamicin either alone or in conjunction with Tax. Their findings demonstrated that Tax's antioxidative properties mitigated the oxidative stress induced by gentamicin, resulting in a dose-dependent decrease in LDH release with the administration of Tax. 51 In the in vivo experiment conducted by Akagündüz et al, Pazopanib, a chemotherapeutic drug used against metastatic renal cell carcinoma, was administered alone or in combination with Tax. LDH levels were measured in the livers obtained from mice, and it was observed that LDH levels decreased in the groups treated with the combination of Pazopanib and Tax. 52 In their investigation, Luo et al examined the effects of 12 different flavonoids on cell proliferation in OVCAR-3 ovarian cancer cells. The LDH testing results revealed that Tax did not induce cytotoxicity in the studied cells. 53 In a separate study conducted by Zai et al, the detrimental impact of acetaminophen on the liver and the potential of Tax to counteract these effects were examined. Through LDH cytotoxicity testing on cells derived from C57BL/6 mice, Tax demonstrated its ability to mitigate the cytotoxic effects induced by acetaminophen, as evidenced by a reduction in LDH secretion. 54 In our study, the treatment of 4T1 cells with Tax at different doses resulted in a dose-dependent reduction of LDH release induced by EPI. Our findings demonstrate that the combined treatment of Tax and EPI significantly reduced the cytotoxic effects of EPI alone in 4T1 cells. The key aspect lies in the reduction of EPI-induced cytotoxicity through the antioxidative properties of Tax, which has been previously reported in other studies. Epirubicin, known for its chemotherapeutic properties, binds to DNA through intercalation and activates various mechanisms, including oxidative stress, leading to cell death. During this process, Tax's antioxidative functions contribute to the improvement of mechanisms triggering LDH release, leading to a dose-dependent decrease in LDH levels observed in the LDH cytotoxicity test. Although Tax has shown promise as a chemosensitizer in cancer treatment, further research is necessary to fully elucidate its potential benefits and risks before it can be widely adopted as a treatment strategy. 55 The aim of this study is to investigate the potential effects of Tax on EPI to enhance the effectiveness of EPI in treating BC in 4T1 cells and its allograft BALB/c model and to determine the underlying mechanisms involved.

In the present in vitro study conducted with the highly aggressive BC cell line, 4T1, we observed concentration- and time-dependent decreases in cell viability and cytotoxicity with the combined administration of Tax and EPI. It is vital that different cell lines can exhibit varying responses to experimental conditions, treatments, and stimuli. But we were unable to add another cell line to our in vitro part of the study due to a limited budget. Therefore, the experiments were carried out only in one cell line. However, we expanded the scope of our research by developing an in vivo tumor model. As this is the first study on this subject, no reports are available in the literature for us to compare our obtained data. However, there are numerous studies available where Tax has been investigated in different combinations.11,5156 The tumor-suppressive role of Tax has been shown across various cell lines and in vivo studies. In one of these studies, Tax exhibited anticancer effects on U-2 OS and Saos-2 osteosarcoma cell lines by inhibiting cell viability. 57 Similarly, another study suggested that the viability and cytotoxicity of BC cells (MDA-MB-231 and 4T1) treated with Tax significantly decreased after 48 and 72 h, while no significant changes were observed at 24 h of exposure. 26 A study exploring the effects of various flavonoids, including Tax, on BC (MDA-MB-231) and prostate cancer (LNCaP) cell lines indicated that the application of increasing concentrations and durations of Tax to the cells resulted in a decrease in cell viability and cytotoxicity. 58 Additionally, in vivo studies demonstrated that Tax treatment significantly inhibited tumor growth and lung metastasis in mice bearing 4T1 cell-derived allograft tumors. 26 Our results, which were also supported by MTT and LDH assays, showed that coadministration of Tax and EPI increased the antiproliferative effect of EPI. These results suggest that Tax may serve as a potential therapeutic agent in the treatment of BC and attenuate the effect of EPI on cell viability. Furthermore, we can say that the coadministration of Tax with EPI makes 4T1 cell lines more sensitive to EPI.

Monitoring and investigation of alterations occurring in cell death pathways in cancer cells hold significant importance in treatment protocols. Apoptosis, one of these pathways, involves 2 main mechanisms: the extrinsic pathway, which triggers caspase-8 activation, and the intrinsic pathway, which triggers caspase-9 activation. Both apoptotic pathways ultimately induce the activation of caspase-3, a primary executor responsible for the cleavage of multiple substrates.5962 While it is known that EPI induces an apoptotic process in tumor cells through the intrinsic pathway, our study demonstrated how its combined administration with Tax affects this process. 63 The enhanced level of cleaved caspase-3 in the cotreated group compared to the group treated solely with EPI suggests that Tax might improve the susceptibility of EPI-induced apoptosis in 4T1 tumors. Besides, in coherence with our findings, the administration of Tax alone has been shown to increase caspase-3 and caspase-9 levels in the xenograft BC model. 64 Similarly, another study investigating the effects of individually administered Tax on hepatocellular carcinoma observed an increase in caspase-3 levels. 65 Additionally, in a different study focusing on Tax administration in a colorectal carcinoma xenograft model, increased caspase-3 activity levels were seen in groups receiving Tax therapy. 66 In addition to the aforementioned findings, various studies have demonstrated that Tax exhibits apoptosis-inducing effects on lung, osteosarcoma, and BCs.56,66,67 Furthermore, it has been observed that Tax enhances the apoptotic properties of other chemotherapeutic agents against colon, gastric, and liver cancer.44,46,66 These findings are consistent with our results, suggesting that Tax may have the potential to serve as a promising therapeutic approach to cancer treatment.

4T1 mouse BC cells are known for their high invasiveness and ability to spontaneously form metastases. This characteristic makes them a valuable model for studying BC metastasis in preclinical research. 26 Epithelial–mesenchymal transition plays a crucial role in cancer cell metastasis and progression. The process of EMT, which transforms epithelial cells into mesenchymal cells, is a highly intricate and multifaceted process that involves numerous molecular mechanisms and regulatory pathways. 8 When EMT is aberrantly regulated, it can contribute to various pathological conditions such as cancer, fibrosis, and tissue damage.8,68 In cancer, aberrant EMT can promote tumor invasion and metastasis, which is one of the main causes of cancer-related deaths. 69 Several studies have indicated that Tax has potent anticancer effects, including inhibition of cancer cell proliferation and migration. Tax has been shown to impede the EMT process, which is a critical step in cancer metastasis, by reducing the manifestation of mesenchymal markers, and fostering the mesenchymal-to-epithelial transition.8,68,69

In our study, we deliberately selected key genes associated with EMT to elucidate the molecular mechanisms influenced by Taxifolin and EPI in BC cells. E-cadherin, a fundamental epithelial marker, plays a critical role in maintaining cell–cell adhesion and suppressing EMT. Loss of E-cadherin expression is a well-established hallmark of EMT and is correlated with heightened invasiveness.70,71 N-cadherin, a mesenchymal marker, exhibits increased expression during EMT initiation, facilitating enhanced cellular motility. Recent studies emphasize the dynamic interplay between E-cadherin and N-cadherin in orchestrating EMT processes.72,73 Vimentin, a cytoskeletal protein, undergoes upregulation during EMT, contributing to increased cell motility and invasion.74,75 β-catenin, a component of the Wnt signaling pathway, exerts dual roles in EMT regulation by influencing both epithelial and mesenchymal gene expression.76,77 Snail and Slug, transcription factors recognized for directly repressing E-cadherin expression, play crucial roles in promoting the transition to a mesenchymal phenotype. Recent research has elucidated intricate regulatory networks involving Snail and Slug in EMT progression.7881 Our choice of these genes was grounded in their well-established roles and interactions, providing a comprehensive view of the EMT process and its modulation in response to Taxifolin and EPI.

In order to explore the effect of the combination of Tax and EPI on EMT or MET, qPCR and western blot analysis were performed. For this purpose, expression levels of key proteins involved in the pathways, including E-cadherin, N-cadherin, Vimentin, β-catenin, Snail, and Slug, were evaluated. In addition to these proteins, mRNA levels within the group including Zeb1 and Zeb2 transcription factors were also assessed. 82 Our results showed that coadministration of Tax and EPI decreases N-cadherin, β-catenin, vimentin, snail, and slug protein levels while increasing the E-cadherin level, suggesting that it reverses the process of EMT. Moreover, their coadministration led to an increase in the mRNA levels of E-cadherin and a decrease in the mRNA levels of N-cadherin, β-catenin, Vimentin, Slug, Snail, Zeb1, and Zeb2. According to a study in the literature, the treatment of the BC xenograft model with Tax resulted in a decrease in protein expression of vimentin and N-cadherin.83,84 Other studies have shown that BC xenografts exposed to Tax exhibited increased levels of E-cadherin and decreased concentration of β-catenin.8285 In one of these studies investigating the impact of flavonoids on transcription factors involved in the EMT pathway in BC xenografts revealed that upon an increase in E-cadherin gene expression, there was a concurrent decrease in the gene expression levels of Zeb1 and Zeb2. This decrease indirectly resulted in reduced gene expression of Snail1 and Snail2/Slug, consequently affecting the expression of N-cadherin, Vimentin, and β-catenin.85,86 The results of our study demonstrated that coadministration of Tax and EPI had promising antimetastatic efficacy, suggesting that it is a novel and unique strategy to enhance EPI's anticancer effectiveness.

As a flavonoid, Tax has been demonstrated to have the ability to suppress primary tumor growth in animal cancer cells. The in vivo studies conducted on BALB/c mice bearing metastatic 4T1 cells showed a deliberate decrease in tumor growth rate in mice cotreated with Tax and EPI compared to control animals. Tax has been studied for its potential anticancer properties due to their antioxidant and anti-inflammatory effects. These properties can help inhibit the growth and spread of cancer cells.23,25,26,4446,55,57,6468,87,88 These data establish the in vivo effect of coadministration of Tax and EPI in reducing tumor size and growth via apoptosis induction without any significant change in animal body weight.

Conclusion

Our findings provide evidence that the combined treatment of Tax and EPI is effective against 4T1 BC cells as well as 4T1-bearing tumors by inducing apoptosis and inhibiting the EMT pathway. While EPI is commonly employed as a chemotherapeutic agent, our study elucidates that the coadministration of Tax with EPI sensitizes the 4T1 cell lines and 4T1-bearing tumor model to EPI. This sensitization is achieved through changes in gene and protein expression levels, leading to the reversal of EMT progression. These findings highlight the potential of Tax as adjunctive therapy to enhance the efficacy of EPI in BC treatment. Our study, which presents novel findings to the literature, successfully demonstrates that Tax effectively enhances the therapeutic efficacy of EPI in terms of cancer cell eradication and metastasis reduction. The results of our study may highlight Tax as a promising therapeutic approach and a novel strategy for the treatment of BC. Finally, it is suggested that the association between Tax and different chemotherapy drugs be investigated in BC models in future studies.

Abbreviations

BC

breast cancer

BCA

bicinchoninic acid

ECL

enhanced chemiluminescence

EMT

epithelial–mesenchymal transition

EPI

epirubicin

ER

estrogen receptor

DMSO

dimethyl sulfoxide

FBS

fetal bovine serum

HER2

human epidermal growth factor receptor 2

HRP

horseradish peroxidase

LDH

lactate dehydrogenase

mRNA

messenger RNA

MTT

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

PBS

phosphate-buffered saline

PR

progesterone receptor

PVDF

polyvinylidene fluoride

SDS-PAGE

sodium dodecyl sulfate–polyacrylamide gel electrophoresis

Tax

Taxifolin

TBST

Tween 20

TBS

Tris-Buffered Saline

TNBC

triple negative breast cancer.

Footnotes

Availability of Data and Materials: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' Contributions: ASYS and MO designed the study. ASYS designed the qPCR primers. ASYS, DDU, and MO acquired the data and analyzed and interpreted the data. ASYS, DDU, GTK, and MO drafted the manuscript. ASYS, DDU, MO, GAE, GTK, and EK critically revised the manuscript and gave their approval of the final manuscript.

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Ethics Approval: The animal study was reviewed and approved by Gazi University Animal Experiments Local Ethics Committee. This study was performed under Gazi University Animal Research Ethics Committee approval in March 2021 (Approval number G.U.ET-21.016).

Funding: The author(s) declared the following potential conflicts of interest with respect to the research, authorship, and/or publication of this article: This study was supported by the Gazi University Projects of Scientific Investigation, with the project code number TDK-2021-7081.

ORCID iD: Atiye Seda Yar Saglam https://orcid.org/0000-0002-9201-8464

References

  • 1.Park M, Kim D, Ko S, Kim A, Mo K, Yoon H. Breast cancer metastasis: mechanisms and therapeutic implications. Int J Mol Sci. 2022;23(12):6806. doi: 10.3390/ijms23126806 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Garrido-Castro AC, Lin NU, Polyak K. Insights into molecular classifications of triple-negative breast cancer: improving patient selection for treatment. Cancer Discov. 2019;9(2):176-198. doi: 10.1158/2159-8290.CD-18-1177 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Dent R, Trudeau M, Pritchard KIet al. Triple-negative breast cancer: clinical features and patterns of recurrence. Clin Cancer Res. 2007;13(15 Pt 1):4429-4434. 10.1158/1078-0432.CCR-06-3045 [DOI] [PubMed] [Google Scholar]
  • 4.Wang X, Zhang H, Chen X. Drug resistance and combating drug resistance in cancer. Cancer Drug Resist. 2019;2(2):141-160. doi: 10.20517/cdr.2019.10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zeeshan R, Mutahir Z. Cancer metastasis—tricks of the trade. Bosn J Basic Med Sci. 2017;17(3):172-182. doi: 10.17305/bjbms.2017.1908 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Williams ED, Gao D, Redfern A, Thompson EW. Controversies around epithelial-mesenchymal plasticity in cancer metastasis. Nat Rev Cancer. 2019;19(12):716-732. doi: 10.1038/s41568-019-0213-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest. 2009;119(6):1420-1428. doi: 10.1172/JCI39104. Erratum in: J Clin Invest. 2010 May 3;120(5):1786. doi:10.1172/JCI39104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Nieto MA, Huang RY, Jackson RA, Thiery JP. EMT: 2016. Cell. 2016;166(1):21-45. 10.1016/j.cell.2016.06.028 [DOI] [PubMed] [Google Scholar]
  • 9.Broder H, Gottlieb RA, Lepor NE. Chemotherapy and cardiotoxicity. Rev Cardiovasc Med. 2008;9(2):75-83. [PMC free article] [PubMed] [Google Scholar]
  • 10.Bayles CE, Hale DE, Konieczny Aet al. Upcycling the anthracyclines: new mechanisms of action, toxicology, and pharmacology. Toxicol Appl Pharmacol. 2023;459:116362. doi: 10.1016/j.taap.2022.116362 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Plosker GL, Faulds D. Epirubicin. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic use in cancer chemotherapy. Drugs. 1993;45(5):788-856. doi: 10.2165/00003495-199345050-00011 [DOI] [PubMed] [Google Scholar]
  • 12.Kim TH, Shin YJ, Won AJet al. et al. Resveratrol enhances chemosensitivity of doxorubicin in multidrug-resistant human breast cancer cells via increased cellular influx of doxorubicin. Biochim Biophys Acta. 2014;1840(1):615-625. doi: 10.1016/j.bbagen.2013.10.023 [DOI] [PubMed] [Google Scholar]
  • 13.Jazirehi AR, Bonavida B. Resveratrol modifies the expression of apoptotic regulatory proteins and sensitizes non-Hodgkin's lymphoma and multiple myeloma cell lines to paclitaxel-induced apoptosis. Mol Cancer Ther. 2004;3(1):71-84. 10.1158/1535-7163.71.3.1 [DOI] [PubMed] [Google Scholar]
  • 14.Fallah S, Karimi A, Panahi G, Gerayesh NS, Fadaei R, Seifi M. Human colon cancer HT-29 cell death responses to doxorubicin and Morus Alba leaves flavonoid extract. Cell Mol Biol. 2016;62(3):72-77. doi: 10.14715/cmb/2016.62.3.12 [DOI] [PubMed] [Google Scholar]
  • 15.Bast A, Kaiserová H, den Hartog GJ, Haenen GR, van der Vijgh WJ. Protectors against doxorubicin-induced cardiotoxicity: flavonoids. Cell Biol Toxicol. 2007;23(1):39-47. doi: 10.1007/s10565-006-0139-4 [DOI] [PubMed] [Google Scholar]
  • 16.Zarkovic N, Zarkovic K, Kralj Met al. et al. Anticancer and antioxidative effects of micronized zeolite clinoptilolite. Anticancer Res. 2003;23(2B):1589-1595. [PubMed] [Google Scholar]
  • 17.Soucek P, Kondrova E, Hermanek Jet al. et al. New model system for testing effects of flavonoids on doxorubicin-related formation of hydroxyl radicals. Anticancer Drugs. 2011;22(2):176-184. doi: 10.1097/cad.0b013e328341a17b [DOI] [PubMed] [Google Scholar]
  • 18.Aein M, Fallah S, Ahmadpour F, Dabili S, Shojaii A, Fadaei R. The effects of doxorubicin, ethanol extract and flavonoid-rich fraction of euphorbia splendida mobayen on the PARP level, and APC gene expression in HT-29 human colon cancer cell line. Jundishapur J Nat Pharm Prod. 2020;15(3):e79679. doi: 10.5812/jjnpp.79679 [DOI] [Google Scholar]
  • 19.Zhang HW, Hu JJ, Fu RQet al. Flavonoids inhibit cell proliferation and induce apoptosis and autophagy through downregulation of PI3Kγ mediated PI3 K/ AKT/ mTOR/ p70S6 K/ ULK signaling pathway in human breast cancer cells. Sci Rep. 2018;8(1):11255. doi: 10.1038/s41598-018-29308-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Yang Y, Cai X, Yang Jet al. et al. Chemoprevention of dietary digitoflavone on colitis-associated colon tumorigenesis through inducing Nrf2 signaling pathway and inhibition of inflammation. Mol Cancer. 2014;13:48. doi: 10.1186/1476-4598-13-48 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Deng YT, Lin JK. EGCG inhibits the invasion of highly invasive CL1-5 lung cancer cells through suppressing MMP-2 expression via JNK signaling and induces G2/M arrest. J Agric Food Chem. 2011;59(24):13318-13327. doi: 10.1021/jf204149c [DOI] [PubMed] [Google Scholar]
  • 22.Hsieh PL, Liao YW, Hsieh CW, Chen PN, Yu CC. Soy isoflavone genistein impedes cancer stemness and mesenchymal transition in head and neck cancer through activating miR-34a/RTCB axis. Nutrients. 2020;12(7):1924. doi: 10.3390/nu12071924 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Liu X, Liu W, Ding Cet al. et al. Taxifolin, extracted from waste Larix olgensis roots, attenuates CCl4-induced liver fibrosis by regulating the PI3 K/AKT/mTOR and TGF-β1/SMADS signaling pathways. Drug Des Dev Ther. 2021;15:871-887. 10.2147/DDDT.S281369 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Thuan NH, Shrestha A, Trung NTet al. Advances in biochemistry and the biotechnological production of taxifolin and its derivatives. Biotechnol Appl Biochem. 2022;69(2):848-861. doi: 10.1002/bab.2156 [DOI] [PubMed] [Google Scholar]
  • 25.Haque MW, Pattanayak SP. Taxifolin inhibits 7,12-dimethylbenz(a)anthracene-induced breast carcinogenesis by regulating AhR/CYP1A1 signaling pathway. Pharmacogn Mag. 2018;13(Suppl 4):S749-S755. doi: 10.4103/pm.pm_315_17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li J, Hu L, Zhou Tet al. et al. Taxifolin inhibits breast cancer cells proliferation, migration and invasion by promoting mesenchymal to epithelial transition via β-catenin signaling. Life Sci. 2019;232:116617. doi: 10.1016/j.lfs.2019.116617 [DOI] [PubMed] [Google Scholar]
  • 27.Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods. 1983;65(1-2):55-63. doi: 10.1016/0022-1759(83)90303-4 [DOI] [PubMed] [Google Scholar]
  • 28.Park HJ, Shin DH, Chung WJet al. et al. Epigallocatechin gallate reduces hypoxia-induced apoptosis in human hepatoma cells. Life Sci. 2006;78(24):2826-2832. doi: 10.1016/j.lfs.2005 [DOI] [PubMed] [Google Scholar]
  • 29.Oh GS, Pae HO, Lee BSet al. Hydrogen sulfide inhibits nitric oxide production and nuclear factor-kappaB via heme oxygenase-1 expression in RAW264.7 macrophages stimulated with lipopolysaccharide. Free Radic Biol Med. 2006;41(1):106-119. doi: 10.1016/j.freeradbiomed.2006.03.021 [DOI] [PubMed] [Google Scholar]
  • 30.Pulaski BA, Ostrand-Rosenberg S. Mouse 4T1 breast tumor model. Curr Protoc Immunol. 2001;Chapter 20(Unit 20.2). doi: 10.1002/0471142735.im2002s39 [DOI] [PubMed] [Google Scholar]
  • 31.Liang YC, Berton S, Reeks C, Sun J. An in vivo biosafety-level-2-compatible model of Mycobacterium tuberculosis infection for drug susceptibility testing. STAR Protoc. 2022;3(3):101575. doi: 10.1016/j.xpro.2022.101575 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yang H, Wu C, Liu Fet al. et al. Blood collection through subclavian vein puncture in mice. J Vis Exp. 2019;147:1-6. doi: 10.3791/59556 [DOI] [PubMed] [Google Scholar]
  • 33.Fossey SL, Liao AT, McCleese JKet al. et al. Characterization of STAT3 activation and expression in canine and human osteosarcoma. BMC Cancer. 2009;9:81. doi: 10.1186/1471-2407-9-81 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002;30(9):e36. doi: 10.1093/nar/30.9.e36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402-408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 36.Yar Saglam AS, Kayhan H, Alp E, Onen HI. Resveratrol enhances the sensitivity of FL118 in triple-negative breast cancer cell lines via suppressing epithelial to mesenchymal transition. Mol Biol Rep. 2021;48(1):475-489. doi: 10.1007/s11033-020-06078-y [DOI] [PubMed] [Google Scholar]
  • 37.Yar Saglam AS, Alp E, Elmazoglu Z, Menevse S. Treatment with cucurbitacin B alone and in combination with gefitinib induces cell cycle inhibition and apoptosis via EGFR and JAK/STAT pathway in human colorectal cancer cell lines. Hum Exp Toxicol. 2016;35(5):526-543. doi: 10.1177/0960327115595686 [DOI] [PubMed] [Google Scholar]
  • 38.Volpe DA, Hamed SS, Zhang LK. Use of different parameters and equations for calculation of IC 50 values in efflux assays: potential sources of variability in IC 50 determination. AAPS J. 2014;16(1):172-180. doi: 10.1208/s12248-013-9554-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Chou TC, Talalay P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul. 1984;22:27-55. doi: 10.1016/0065-2571(84)90007-4 [DOI] [PubMed] [Google Scholar]
  • 40.Percie du Sert N, Hurst V, Ahluwalia A, et al. The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. Br J Pharmacol. 2020;177(16):3617-3624. doi: 10.1111/bph.15193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kebieche M, Lakroun Z, Lahouel M, Bouayed J, Meraihi Z, Soulimani R. Evaluation of epirubicin-induced acute oxidative stress toxicity in rat liver cells and mitochondria, and the prevention of toxicity through quercetin administration. Exp Toxicol Pathol. 2009;61(2):161-167. doi: 10.1016/j.etp.2008.06.002 [DOI] [PubMed] [Google Scholar]
  • 42.Ichioka D, Miyazaki J, Inoue Tet al. Impact of renal function of patients with advanced urothelial cancer on eligibility for first-line chemotherapy and treatment outcomes. Jpn J Clin Oncol. 2015;45(9):867-873. doi: 10.1093/jjco/hyv082 [DOI] [PubMed] [Google Scholar]
  • 43.Liu FS. Mechanisms of chemotherapeutic drug resistance in cancer therapy—a quick review. Taiwan J Obstet Gynecol. 2009;48(3):239-244. doi: 10.1016/S1028-4559(09)60296-5 [DOI] [PubMed] [Google Scholar]
  • 44.Butt SS, Khan K, Badshah Y, Rafiq M, Shabbir M. Evaluation of pro-apoptotic potential of taxifolin against liver cancer. PeerJ. 2021;9:e11276. doi: 10.7717/peerj.11276 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Dostal Z, Sebera M, Srovnal J, Staffova K, Modriansky M. Dual effect of taxifolin on ZEB2 cancer signaling in HepG2 cells. Molecules. 2021;26(5):1476. doi: 10.3390/molecules26051476 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Xie J, Pang Y, Wu X. Taxifolin suppresses the malignant progression of gastric cancer by regulating the AhR/CYP1A1 signaling pathway. Int J Mol Med. 2021;48(5):1097. doi: 10.3892/ijmm.2021.5030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kolhir VK, Bykov VA, Baginskaja AIet al. Antioxidant activity of a Dihydroquercetin isolated from Larix gmelinii (rupr.). Rupr. Wood. Phytother Res. 1996;10(6):478-482. 10.1002/(SICI)1099-1573(199609)10:6<478::AID-PTR883>3.0.CO;2-S [DOI] [Google Scholar]
  • 48.Speisky H, Shahidi F, Costa de Camargo A, Fuentes J. Revisiting the oxidation of flavonoids: loss, conservation or enhancement of their antioxidant properties. Antioxidants (Basel). 2022;11(1):133. doi: 10.3390/antiox11010133 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Pietta PG. Flavonoids as antioxidants. J Nat Prod. 2000;63(7):1035-1042. doi: 10.1021/np9904509 [DOI] [PubMed] [Google Scholar]
  • 50.Najeb SM, Jaccob AA, Al-Moziel MSG, Abdulhameed HM. Cardioprotective and antioxidant effects of taxifolin and vitamin C against diazinone-induced myocardial injury in rats. Environ Anal Health Toxicol. 2022;37(1):e2022002-0. doi: 10.5620/eaht.2022002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Lin JN, Wang JS, Lin CCet al. et al. Ameliorative effect of taxifolin on gentamicin-induced ototoxicity via down-regulation of apoptotic pathways in mouse cochlear UB/OC-2 cells. J Chin Med Assoc. 2022;85(5):617-626. doi: 10.1097/JCMA.0000000000000708 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Akagunduz B, Ozer M, Ozcıcek Fet al. Protective effects of taxifolin on pazopanib-induced liver toxicity. An experimental rat model. Exp Anim. 2021;70(2):169-176. doi: 10.1538/expanim.20-0103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Luo H, Jiang BH, King SM, Chen YC. Inhibition of cell growth and VEGF expression in ovarian cancer cells by flavonoids. Nutr Cancer. 2008;60(6):800-809. doi: 10.1080/01635580802100851. PMID: 19005980. [DOI] [PubMed] [Google Scholar]
  • 54.Zai W, Chen W, Luan Jet al. et al. Dihydroquercetin ameliorated Acetaminophen-induced hepatic cytotoxicity via activating JAK2/STAT3 pathway and autophagy. Appl Microbiol Biotechnol. 2018;102(3):1443-1453. doi: 10.1007/s00253-017-8686-6 [DOI] [PubMed] [Google Scholar]
  • 55.Chen HJ, Chung YL, Li CYet al. et al. Taxifolin resensitizes multidrug resistance cancer cells via uncompetitive inhibition of P-glycoprotein function. Molecules. 2018;23(12):3055. doi: 10.3390/molecules23123055 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Wu J, Xue X, Zhang Bet al. et al. Enhanced antitumor activity and attenuated cardiotoxicity of Epirubicin combined with Paeonol against breast cancer. Tumour Biol. 2016;37(9):12301-12313. doi: 10.1007/s13277-016-5088-9 [DOI] [PubMed] [Google Scholar]
  • 57.Chen X, Gu N, Xue C, Li BR. Plant flavonoid taxifolin inhibits the growth, migration and invasion of human osteosarcoma cells. Mol Med Rep. 2018;17(2):3239-3245. doi: 10.3892/mmr.2017.8271 [DOI] [PubMed] [Google Scholar]
  • 58.Brusselmans K, Vrolix R, Verhoeven G, Swinnen JV. Induction of cancer cell apoptosis by flavonoids is associated with their ability to inhibit fatty acid synthase activity. J Biol Chem. 2005;280(7):5636-5645. doi: 10.1074/jbc.M408177200 [DOI] [PubMed] [Google Scholar]
  • 59.Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol. 2007;35(4):495-516. doi: 10.1080/01926230701320337 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Lowe SW, Lin AW. Apoptosis in cancer. Carcinogenesis. 2000;21(3):485-495. doi: 10.1093/carcin/21.3.485 [DOI] [PubMed] [Google Scholar]
  • 61.Green DR, Evan GI. A matter of life and death. Cancer Cell. 2002;1(1):19-30. doi: 10.1016/s1535-6108(02)00024-7 [DOI] [PubMed] [Google Scholar]
  • 62.Hengartner MO. The biochemistry of apoptosis. Nature. 2000;407(6805):770-776. doi: 10.1038/35037710 [DOI] [PubMed] [Google Scholar]
  • 63.Huang TC, Chiu PR, Chang WTet al. et al. Epirubicin induces apoptosis in osteoblasts through death-receptor and mitochondrial pathways. Apoptosis. 2018;23(3-4):226-236. doi: 10.1007/s10495-018-1450-2 [DOI] [PubMed] [Google Scholar]
  • 64.Mohammed HA, Almahmoud SA, El-Ghaly EMet al. Comparative anticancer potentials of taxifolin and quercetin methylated derivatives against HCT-116 cell lines: effects of O-methylation on taxifolin and quercetin as preliminary natural leads. ACS Omega. 2022;7(50):46629-46639. 10.1021/acsomega.2c05565 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Kabel A, Arab H, Abd Elmaaboud M. Attenuation of diethyl nitrosamine-induced hepatocellular carcinoma by taxifolin and/or alogliptin: the interplay between toll-like receptor 4, transforming growth factor beta-1, and apoptosis. Hum Exp Toxicol. 2021;40(10):1710-1720. doi: 10.1177/09603271211008496 [DOI] [PubMed] [Google Scholar]
  • 66.Razak S, Afsar T, Ullah Aet al. et al. Taxifolin, a natural flavonoid interacts with cell cycle regulators causes cell cycle arrest and causes tumor regression by activating wnt/ β-catenin signaling pathway. BMC Cancer. 2018;18(1):1043. doi: 10.1186/s12885-018-4959-4 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 67.Wang R, Zhu X, Wang Qet al. et al. The anti-tumor effect of taxifolin on lung cancer via suppressing stemness and epithelial-mesenchymal transition in vitro and oncogenesis in nude mice. Ann Transl Med. 2020;8(9):590. doi: 10.21037/atm-20-3329 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Chaffer CL, San Juan BP, Lim E, Weinberg RA. EMT, cell plasticity and metastasis. Cancer Metastasis Rev. 2016;35(4):645-654. doi: 10.1007/s10555-016-9648-7 [DOI] [PubMed] [Google Scholar]
  • 69.Singh M, Yelle N, Venugopal C, Singh SK. EMT: mechanisms and therapeutic implications. Pharmacol Ther. 2018;182:80-94. doi: 10.1016/j.pharmthera.2017.08.009 [DOI] [PubMed] [Google Scholar]
  • 70.Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial–mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15(3):178-196. doi: 10.1038/nrm3758 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.De Wever O, Mareel M. Role of tissue stroma in cancer cell invasion. J Pathol. 2003;200(4):429-447. doi: 10.1002/path.1398 [DOI] [PubMed] [Google Scholar]
  • 72.Hong J, Zhou J, Fu Jet al. et al. Phosphorylation of serine 68 of Twist1 by MAPKs stabilizes Twist1 protein and promotes breast cancer cell invasiveness. Cancer Res. 2015;76(12):3626-3640. doi: 10.1158/0008-5472.CAN-10-2914 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Qiao Y, Chen J, Lim YBet al. et al. YAP regulates actin dynamics through ARHGAP29 and promotes metastasis. Cell Rep. 2014;19(8):1495-1502. doi: 10.1016/j.celrep.2017.04.075 [DOI] [PubMed] [Google Scholar]
  • 74.Satelli A, Li S. Vimentin in cancer and its potential as a molecular target for cancer therapy. Cell Mol Life Sci. 2011;68(18):3033-3046. doi: 10.1007/s00018-011-0735-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Vuoriluoto K, Haugen H, Kiviluoto Set al. et al. Vimentin regulates EMT induction by Slug and oncogenic H-Ras and migration by governing Axl expression in breast cancer. Oncogene. 2011;30(12):1436-1448. doi: 10.1038/onc.2010.509 [DOI] [PubMed] [Google Scholar]
  • 76.Valenta T, Hausmann G, Basler K. The many faces and functions of β-catenin. EMBO J. 2012;31(12):2714-2736. doi: 10.1038/emboj.2012.150 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Jolly MK, Ware KE, Gilja S, Somarelli JA, Levine H. EMT and MET: necessary or permissive for metastasis? Mol Oncol. 2017;11(7):755-769. doi: 10.1002/1878-0261.12083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Nieto MA. The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol. 2002;3(3):155-166. doi: 10.1038/nrm757 [DOI] [PubMed] [Google Scholar]
  • 79.Barrallo-Gimeno A, Nieto MA. The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development. 2005;132(14):3151-3161. doi: 10.1242/dev.01907 [DOI] [PubMed] [Google Scholar]
  • 80.Zhang K, Rodriguez-Aznar E, Yabuta Net al. et al. Lats2 kinase potentiates Snail1 activity by promoting nuclear retention upon phosphorylation. EMBO J. 2016;35(4):333-355. doi: 10.1038/emboj.2011.357 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Zhan T, Rindtorff N, Boutros M. Wnt signaling in cancer. Oncogene. 2017;36(11):1461-1473. doi: 10.1038/onc.2016.304 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Tang JM, Min J, Li BSet al. et al. Therapeutic effects of punicalagin against ovarian carcinoma cells in association with β-catenin signaling inhibition. Int J Gynecol Cancer. 2016;26(9):1557-1563. doi: 10.1097/IGC.0000000000000805 [DOI] [PubMed] [Google Scholar]
  • 83.Franco-Chuaire ML, Magda Carolina SC, Chuaire-Noack L. Epithelial-mesenchymal transition (EMT): principles and clinical impact in cancer therapy. Invest Clin. 2013;54(2):186-205. [PubMed] [Google Scholar]
  • 84.Liu X, Huang H, Remmers N, Hollingsworth MA. Loss of E-cadherin and epithelial to mesenchymal transition is not required for cell motility in tissues or for metastasis. Tissue Barriers. 2014;2(4):e969112. doi: 10.4161/21688362.2014.969112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Yang J, Weinberg RA. Epithelial-mesenchymal transition: at the crossroads of development and tumor metastasis. Dev Cell. 2008;14(6):818-829. doi: 10.1016/j.devcel.2008.05.009 [DOI] [PubMed] [Google Scholar]
  • 86.Srinivasan A, Thangavel C, Liu Yet al. et al. Quercetin regulates β-catenin signaling and reduces the migration of triple negative breast cancer. Mol Carcinog. 2016;55(5):743-756. doi: 10.1002/mc.22318 [DOI] [PubMed] [Google Scholar]
  • 87.Romagnolo DF, Selmin OI. Flavonoids and cancer prevention: a review of the evidence. J Nutr Gerontol Geriatr. 2012;31(3):206-238. doi: 10.1080/21551197.2012.702534 [DOI] [PubMed] [Google Scholar]
  • 88.Jegal J, Park NJ, Kim TYet al. et al. Effect of topically applied Wikstroemia dolichantha diels on the development of atopic dermatitis-like skin symptoms in mice. Nutrients. 2019;11(4):914. doi: 10.3390/nu11040914 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Technology in Cancer Research & Treatment are provided here courtesy of SAGE Publications

RESOURCES