Skip to main content
PLOS One logoLink to PLOS One
. 2024 Mar 22;19(3):e0297796. doi: 10.1371/journal.pone.0297796

Development and validation of multiplex one-step qPCR/RT-qPCR assays for simultaneous detection of SARS-CoV-2 and pathogens associated with feline respiratory disease complex

Côme J Thieulent 1,2, Mariano Carossino 1,2, Laura Peak 1, Wendy Wolfson 3, Udeni B R Balasuriya 1,2,*
Editor: Julian Ruiz-Saenz4
PMCID: PMC10959388  PMID: 38517847

Abstract

Feline respiratory disease complex (FRDC) is caused by a wide range of viral and bacterial pathogens. Both Influenza A virus (IAV) and Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) also induce respiratory diseases in cats. Two one-step multiplex qPCR/RT-qPCR assays were developed and validated: FRA_1 (Feline respiratory assay 1) for the detection of four viral targets and FRA_2 for the detection of three bacteria associated with FRDC. Both multiplex assays demonstrated high specificity, efficiency (93.51%–107.8%), linearity (> 0.998), analytical sensitivity (≤ 15 genome copies/μl), repeatability (coefficient of variation [CV] < 5%), and reproducibility (CV < 6%). Among the 63 clinical specimens collected from FRDC-suspected cats, 92.1% were positive for at least one pathogen and co-infection was detected in 57.1% of samples. Mycoplasma felis (61.9%) was the most found pathogen, followed by feline herpesvirus-1 (30.2%), Chlamydia felis (28.7%) and feline calicivirus (27.0%). SARS-CoV-2 was detected in two specimens. In summary, this new panel of qPCR/RT-qPCR assays constitutes a useful and reliable tool for the rapid detection of SARS-CoV-2 and viral and bacterial pathogens associated with FRDC in cats.

Introduction

Feline respiratory disease complex (FRDC) is a contagious respiratory or ocular disease caused by one or multiple viral and bacterial pathogens. FRDC is a major cause of morbidity and mortality in cats, particularly in high density facilities, such as shelters [1]. While FRDC may occur in adult cats, kittens are prone to develop more severe clinical signs [2]. Common clinical manifestations include mucopurulent nasal discharge, sneezing, conjunctivitis and ocular discharge, coughing, fever, lethargy and inappetence of varying severity [3]. FRDC is the result of a complex multifactorial interaction between respiratory pathogens, stress, and individual animal susceptibility [24]. A wide array of viruses and bacteria are reported to induce FRDC in cats. The two most prevalent viruses responsible for FRDC are feline herpesvirus-1 (FHV-1; Varicellovirus felidalpha1, the causative agent of feline viral rhinotracheitis [FVR]) and feline calicivirus (FCV). The bacteria Bordetella bronchiseptica, Chlamydia felis and Mycoplasma felis are also frequently detected in cats with FRDC [311]. Co-infections are also common [3, 12, 13].

In the last two decades, Influenza A viruses (IAV: Alphainfluenzavirus influenzae) and Severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) have been identified as emerging infections in cats [14]. Recent outbreaks of IAV infection have been reported [15, 16], and five subtypes of IAV were identified as the cause of acute respiratory illness including H5N1 [1722], H1N1 [2327], H5N6 [2830], H7N2 [31, 32] and H3N2 [33, 34]. Depending on the IAV subtype, clinical signs in cats may be subclinical, or develop mild to severe and occasionally lethal respiratory disease [16, 20]. IAV seems to be transmitted to cats by birds, humans, and dogs [16, 3336]. Furthermore, during COVID-19 pandemic dogs, cats and many other animal species were infected with SARS-CoV-2 [3739]. Cats are susceptible to SARS-CoV-2 following both experimental and natural infection, although natural cases have been only sporadically reported [3949]. Large wild felids including lions, tigers and pumas are also susceptible to natural infection [5053]. SARS-CoV-2-infected cats may remain asymptomatic or display signs of respiratory disease clinically indistinguishable from other respiratory pathogens. [14, 40, 43, 44, 54, 55]. Based on the public health importance of SARS-CoV-2 and IAV (i.e., zoonotic potential), rapid laboratory diagnosis to differentiate these two infections from other common viral and bacterial agents is critical in controlling outbreaks and implementing appropriate public health measures.

Multiplex qPCR and RT-qPCR assays are commonly used in veterinary diagnostic settings [5662]. Multiplexing has several advantages including reduction of cost, reduction in the amount of clinical sample needed, reduction of set-up and analysis time, and finally improved precision by minimizing pipetting errors. In this study, we developed and evaluated the analytical performance of a panel of two multiplex one-step qPCR/RT-qPCR assays for simultaneous detection and differentiation of viruses (Feline Respiratory Assay_1: FRA_1) and bacteria (FRA_2) associated with FRDC in cats. This new panel was then used to test clinical specimens collected from FRDC-suspected felines in Louisiana, USA, between 2020 to 2022. Overall, this newly developed highly sensitive panel of multiplex qPCR/RT-qPCR assays can simultaneously detect all FRDC associated pathogens, as well as IAV and SARS-CoV-2 in feline clinical specimens with high analytical sensitivity and specificity.

Materials and methods

Viruses and bacteria

The panel of reference pathogens (viruses and bacteria) used for evaluating specificity (inclusivity/exclusivity) of each qPCR and RT-qPCR assay in singleplex and in multiplex format is presented in Table 1. RNA derived from Canine Influenza A (CIV) H3N2 VSL-1355 and CIV H3N8 A/Ca/FL/15592/04 were kindly provided by Dr. Diego Diel and Dr. Edward Dubovi (Department of Population Medicine and Diagnostic Sciences, Cornell University College of Veterinary Medicine, Ithaca, NY), respectively. All other prototype strains were obtained from the American Type Culture Collection (ATCC®; Manassas, VA), or BEI Resources (Manassas, VA).

Table 1. Panel of viruses and bacteria associated with feline respiratory disorders, related pathogens and SARS-CoV-2 variants used to assess the specificity of each qPCR/RT-qPCR assay.

Pathogens Reference strain Source
Feline Calicivirus (FCV) VR-782 ATCC®
SARS-CoV-2 USA-WA1/2020 NR-52281 BEI Resources
SARS-CoV-2 Alpha (B.1.1.7) NR-54020 BEI Resources
SARS-CoV-2 Beta (B.1.351) NR-55282 BEI Resources
SARS-CoV-2 Delta (B.1.617.2) NR-55671 BEI Resources
SARS-CoV-2 Omicron (B.1.1.529) NR-56461 BEI Resources
Feline Herpesvirus 1 (FHV-1) VR-814 ATCC®
Canine Influenza A (CIV) H3N2 VLS-1355 Cornell Universitya
CIV H3N8 A/Ca/FL/15592/04 Cornell Universityb
Bordetella bronchiseptica E014 NR-44164 BEI Resources
Chlamydia felisEverett et al. VR-120 ATCC®
Mycoplasma felisCole et al. 23391 ATCC®
Mycoplasma cynos Rosendal 27544 ATCC®
Mycoplasma canis NR-3865 BEI Resources
Feline Coronavirus (FCoV) L1911562 LADDLc
Feline Infectious Peritonitis Virus (FIPV) NR-43287 BEI Resources
Feline Panleukopenia Virus (FPlV) VR-648 ATCC®

aKindly provided by Dr. Diego Diel

bKindly provided by Dr. Edward Dubovi

cLADDL: Louisiana Animal Disease Diagnostic Laboratory, School of Veterinary Medicine, Louisiana State University, Louisiana, Inited States of America

Clinical specimens

A total of 63 clinical specimens from 39 FRDC-suspected felines that were submitted for routine diagnostic testing to the Louisiana Animal Disease Diagnostic Laboratory (LADDL) between 2020 and 2022 were included in this study (S1 Table). The specimens were submitted by practicing veterinarians or the attending veterinarian from the LSU School of Veterinary Medicine Shelter Medicine Program. The cats submitted through the Shelter Medicine Program came from four shelters (Shelter 1 to 4) located in and around Baton Rouge, LA, in 2022. Nasal and pharyngeal specimens were collected using sterile oropharyngeal/nasal swabs (VMRD, Pullman, WA) and resuspended in either 2 ml of BHI Broth (Hardy Diagnostics, Santa Maria, CA) or 2 ml of PrimeStore® molecular transport medium (VMRD) and stored at 4°C until used.

Nucleic acid extraction

Nasal swab samples were vortexed, spun down and total nucleic acid were extracted using the taco mini nucleic acid automatic extraction system (GeneReach, Taichung, Taiwan) following manufacturer’s recommendations. One-hundred microliters of nasal swab suspensions were extracted and eluted in the same volume of elution buffer. The extracted nucleic acid samples were stored at -80°C until used.

Primers probes design

Specific forward and reverse primers and probes targeting the glycoprotein B (gB) of FHV-1 and open reading frame (ORF) 1 of FCV were designed using IDT’s PrimerQuest tool (https://www.idtdna.com/Primerquest/home/Index) from sequences available on the GenBank nucleotide database (https://www.ncbi.nlm.nih.gov/nuccore/) (Table 2). The primers and probe sequence specificity were further validated in silico using the NCBI Basic Local Aligment Search Tool (BLAST; https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). Self-annealing sites, hairpin loop formation and 3’ complementarity were verified using IDT’s OligoAnalyzer tool (https://www.idtdna.com/calc/analyzer). Influenza A virus [63] primers and probe targeting the matrix (M) gene were used as previously published [63, 64] with addition of degeneracies in the primers sequences in order to match that of IAV sequences from cats available on the Influenza Research Database (https://www.fludb.org) (Table 2). Sequences of primers and probes for SARS-CoV-2 (US CDC SARS-CoV-2 N1 assay; Lu et al., 2020), Bordetella bronchiseptica [66], Mycoplasma felis [67] and Chlamydia felis [68] were used as previously published (Table 2).

Table 2. Primers and probe sequences used for the detection of FRDC-associated pathogens and SARS-CoV-2.

Target (gene) Oligonucleotide ID Primers and probe sequences (5’-3’) Nucleotide position Product size (bp) GenBank accession # Reference
SARS-CoV-2 (Nucleocapsid [ORF9a]) SARS-CoV-2_N1-F GACCCCAAAATCAGCGAAAT 28,287–28,306 72 MN985325.1 [63]
SARS-CoV-2_N1-R TCTGGTTACTGCCAGTTGAATCTG 28,358–28,335
SARS-CoV-2_N1-P FAM-ACCCCGCATTACGTTTGGTGGACC-QSY 28,309–28,332
Influenza A virus (Matrix protein) IAV_M-F AGATGAGYCTTCTAACCGAGGTCG 24–47 101 MF978391.1 [61, 62] with modifications
IAV_M-R1a TGCAAAGACATCTTCAAGTYTCTG 124–101
IAV_M-R2a TGCAAAGACACTTTCCAGTCTCTG 124–101
IAV_M-P VIC-TCAGGCCCCCTCAAAGCCGA-QSY 74–93
Feline calicivirus (ORF-1) FCV_ORF1-F CCGCCAATCAACATGTGGTA 2,427–2,446 114 L40021.1 This article
FCV_ORF1-R GCACATCATATGCGGCTCTG 2,540–2,521
FCV_ORF1-P ABY-TGATTTGGCCTGGGCTCTTCG-QSY 2,464–2,484
Feline herpesvirus 1 (Glycoprotein B [UL27]) FHV-1_gB-F GTTAATCCCGACGATCCGTTAC 77,404–77,425 101 MH070348.1 This article
FHV-1_gB-R CAGGGACACAGTGGCTATTT 77,504–77,485
FHV-1_gB-P Cy5-CTACTCGGT/TAO/ATTGCAGCGACTGGC-3IAbRQSp 77,459–44,436
Bordetella bronchiseptica (Intergenomic region between flaA and fliA B) Fla2-F AGGCTCCCAAGAGAGAAAGGCTT 1,140,858–1,140,880 118 CP019934.1 [64]
Fla12-R AAACCTGCCGTAATCCAGGC 1,140,975–1,140,956
Fla-P FAM-ACCGGGCAGCTAGGCCGC-QSY 1,140,887–1,140,904
Mycoplasma felis (tuf) Mfelis_tuf-F TAAATTAGCTCTTGATGGTGTTCCT 469–493 100 FJ896389.1 [65]
Mfelis_tuf-R TTCAAAGTCTTTTTCTGGAGTTTCA 568–544
Mfelis_tuf-P VIC-TGAGAAGAAAAAGTTATGGAATTAATGGATGCA-QSY 497–529
Chamydia felis (ompA) Cfelis_ompA-F TCGGATTGATTGGTCTTGCA 449–468 78 AY184290.1 [66]
Cfelis_ompA-R GCTCTACAATGCCTTGAGAAATTTC 526–502
Cfelis_ompA-P ABY-ACTGATTTCGCCAATCAGCGTCCAA-QSY 472–496

aIAV_M-R1 and IAV_M-R2 were used at equimolar amount (200 nM).

3IAbRQSp: 3’ Iowa Black® RQ; ABY, ABY dye; Cy5: Cyanine-5 dye; F: forward primer; FAM, 6-carboxyfluorescein dye; P: probe; QSY, QSY quencher; R: reverse primer; TAO: TAO quencher; VIC, VIC dye.

Multiplex TaqMan® quantitative PCR (qPCR) and reverse transcription PCR (RT-qPCR) assays for feline respiratory pathogens

A 4-plex RT-qPCR assay and a 3-plex qPCR assay were developed and designated as FRA_1 (targeting SARS-CoV-2, IAV, FCV and FHV-1) and FRA_2 (targeting B. bronchiseptica, M. felis and C. felis). Both assays were performed in a total volume of 25 μl containing 12.5 μl of 2X QuantiTect Multiplex RT-PCR Master Mix, 0.25 μl of QuantiTect RT Mix (QIAGEN, Hilden, Germany), 1.25 μl of primers (200 nM) and fluorogenic probes (200 nM) mix, 6 μl of RNase free water and 5 μl of template DNA/RNA. All reactions were run on a 7500 Fast Real-Time PCR System (Applied Biosystems, Waltham, MA) with the following thermal profile: a reverse transcription step (20 min at 50°C) following by an initial activation step (15 min at 95°C) and 40 cycles of denaturation & annealing/extension (45 sec at 94°C & 75 sec at 60°C). The complete step-by-step protocol has been deposited on the protocols.io platform (https://dx.doi.org/10.17504/protocols.io.ewov1q4z2gr2/v1).

Synthesis of in vitro transcribed RNA and DNA

Specific plasmid DNA and in vitro transcribed (IVT) RNA were synthesized in order to determine the analytical sensitivity of each multiplex qPCR/RT-qPCR assay as previously described [56], with minor modifications. Two inserts, containing the target regions of each assay flanked by PstI and HindIII restriction sites, were chemically synthesized and cloned into the pGEM®-3Z vector (Promega, Madison, WI) downstream the T7 promoter (pGEM−3Z_FCV_FHV1_IAV_SCoV2 and pGEM−3Z_Bbron_ Mcynos_Mfelis_Cfelis) by GeneArt Gene Synthesis (Thermo Fisher Scientific, Waltham, MA). Transformed Escherichia coli DH10β cells were incubated overnight at 37°C with agitation (270 rpm). Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (QIAGEN). Both plasmids were linearized using HindIII restriction enzyme and plasmid DNA concentration was measured using Qubit dsDNA BR Assay Kit (Thermo Fisher Scientific). pGEM−3Z_FCV_FHV1_IAV_SCoV2 plasmid was subjected to in vitro transcription using the Megascript® T7 Transcription Kit (Thermo Fisher Scientific) following manufacturer’s recommendations. Subsequently, DNase treatment was performed with TURBO DNase (Thermo Fisher Scientific) for 15 min at 37°C. The IVT RNA products were purified using MEGAclear Transcription Clean-Up Kit (Thermo Fisher Scientific) and quantified using Qubit RNA BR Assay Kit (Thermo Fisher Scientific). The number of plasmid DNA and IVT RNA copies/μl were calculated according to the following formula [56, 6062, 6972]:

NumberofplasmidDNAandIVTRNAmolecules/μl=Avogadro'snumber6.022×1023×PlasmidDNA/IVTRNAconcentration(gμl)PlasmidDNA/IVTRNAmolecularweight(gmol)

Plasmid DNA and IVT RNA molecular weight were calculated using Molbiotools website (https://molbiotools.com/dnacalculator.php) and concentrations were adjusted to 107 copies/μl in nuclease-free water containing 40 ng/μl of yeast tRNA (Thermo Fisher Scientific) and stored at -80°C until use.. Ten-fold serial dilutions of plasmid DNA/IVT RNA was directly used for determining the analytical sensitivity of the qPCR assay targeting the DNA viruses and bacteria.

Analytical parameter determination and statistical analysis

Analytical parameters were determined as previously described [56] with minor modifications. Standard curves were generated using a ten-fold dilution series of plasmid DNA or IVT RNA (107 to 102 copies/μl) in triplicate. Coefficients of determination (R2) were used to assess curve fitness. Amplification efficiency [E (%)] was calculated after regression analysis using the following formula: E = [10−1/slope -1] × 100. Limit of detection with 95% confidence (LOD95%) of each assay was determined by statistical probit analysis (non-linear regression model) using SPSS 14.0 software (SPSS Inc., Chicago, IL) from twelve replicates per dilution ranging from 103 to 100 copies/μl. Cycle threshold (Ct) cut-off values were determined using the following formula: Ct cut-off = Average replicate values of the endpoint dilution + (3 × standard deviation (SD) [73]. Intra-run and inter-run imprecision were determined by performing 12 replicates on the same run or three replicates on two independent runs of plasmid DNA/IVT RNA containing 105 to and 103 copies/μl, respectively. The coefficient of variation (%CV) was calculated using the following formula: %CV = 100 × (standard deviation of replicates [log10 copies/μl] ÷ average of replicates [log10 copies/μl]). All graphs were created using GraphPad Prism v9.3.1 statistical analysis software (GraphPad, San Diego, CA).

Results

Analytical specificity of singleplex and multiplex qPCR/RT-qPCR assays for the detection of feline respiratory pathogens

The analytical specificity (inclusivity/exclusivity) of all singleplex and multiplex qPCR/RT-qPCR assays were first evaluated using a panel of reference viruses and bacteria associated with respiratory, systemic, and enteric diseases in cats, as well as different SARS-CoV-2 variants of concern (VOC). All assays used and developed in this study showed exclusive specificity for their respective targets and did not cross-react between each other under multiplex conditions (S1 Fig). The specificity of the M. felis (tuf) assay was confirmed by absence of amplification of M. canis and M. cynos DNA extracts. Additionally, none of the assays amplified nucleic acids extracted from other feline viruses, including feline coronavirus (FCoV), feline infectious peritonitis virus (FIPV), and feline panleukopenia virus (FPLV).

Analytical sensitivity of singleplex and multiplex qPCR/RT-qPCR assays for the detection of feline respiratory pathogens

The analytical sensitivity of all assays in singleplex and in multiplex format were determined using ten-fold serial dilutions (107 copies/μl to 102 copies/μl) of plasmid DNA/IVT RNA containing the target sequences. Linear standard curves were generated for each assay in singleplex and multiplex with a coefficient of linear regression (R2) ≥ 0.998 (Fig 1A, Table 3, S2 and S3 Figs). Amplification efficiency for each singleplex assay was between 97.31% and 108.49%. When tested in multiplex, a similar amplification efficiency was observed with values comprised between 93.51% and 107.81% (Table 3). The lower limit of detection (LOD95%) varied between 6 to 15 RNA/DNA copies/μl for each singleplex and multiplex assays (Fig 1B). A similar detection rate limit (100%) was calculated for each assay when used in both singleplex and multiplex conditions (10 to 100 copies/μl). Altogether, these results demonstrate the high analytical sensitivity of our panel of qPCR/RT-qPCR assays for the detection of feline respiratory pathogens, without loss of sensitivity when used in multiplex conditions.

Fig 1. Analytical parameters of singleplex and multiplex qPCR/RT-qPCR assays for the detection of FRDC-associated pathogens and SARS-CoV-2.

Fig 1

A) Comparison of analytical sensitivity of each singleplex and multiplex qPCR/RT-qPCR assays for the detection of pathogens associated with FRDC. B) Analytical sensitivity determination of singleplex and multiplex qPCR/RT-qPCR assays. Each assay was performed using 12 replicates ranging from 103 to 100 copies/μl of IVT DNA/RNA. Each circle and square indicate the Ct value of one replicate obtained by singleplex and multiplex amplification, respectively. Short solid lines indicate the median Ct value and dashed lines indicate the detection limit. Ct: Cycle threshold; IVT RNA: in vitro transcribed RNA; R2: linearity; E: Efficiency; ND: not detected; NTC: no template control.

Table 3. Analytical sensitivity of singleplex and multiplex qPCR/RT-qPCR assays for the detection of FRDC-associated pathogens and SARS-CoV-2.

Assay Target Parameter Slope Linearity (R2) Efficiency (%) LOD95% (copies/μl) Detection rate limit (copies/μl) Ct cut-off
FRA_1 SARS-CoV-2 (N1 (ORF9a]) Singleplex -3.335 0.9999 99.46 8 10 35
Multiplex -3.329 1.0000 99.71 15 100 35
IAV (M) Singleplex -3.388 0.9998 97.31 15 100 34
Multiplex -3.488 0.9984 93.51 15 100 34
FCV (ORF-1) Singleplex -3.343 0.9998 99.13 8 10 35
Multiplex -3.311 0.9999 100.46 8 10 37
FHV-1 (gB [UL27]) Singleplex -3.317 0.9996 100.21 6 10 37
Multiplex -3.390 0.9996 97.24 8 10 33
FRA_2 B. bronchiseptica (flaA—fliA-B) Singleplex -3.171 0.9997 106.71 9 100 39
Multiplex -3.159 0.9998 107.28 11 100 38
M. felis (ompA) Singleplex -3.140 0.9995 108.20 15 100 40
Multiplex -3.151 0.9994 107.66 9 100 37
C. felis (tuf) Singleplex -3.134 0.9992 108.49 15 100 40
Multiplex -3.148 0.9990 107.81 7 100 37

FRA: Feline respiratory assay; R2: Linearity; LOD95%: Limit of detection 95%; Ct: Cycle threshold.

Repeatability and reproducibility of multiplex qPCR/RT-qPCR assays for detection of feline respiratory pathogens

The repeatability and reproducibility of both multiplex assays was measured by determining the intra-run and inter-run imprecision, respectively. A range of three concentrations; 105 copies/μl (high target concentration), 104 copies/μl (medium target concentration) and 103 copies/μl (low target concentration), of plasmid DNA/IVT RNA was used to determine the coefficient of variability (CV) of each assay. For all assays the intra-run imprecision was < 1.5% at high target concentration, < 4% at medium target concentration and < 5% at low target concentration (Table 4). Similarly, the inter-run imprecision was < 3% at high target concentration, < 2.5% at medium target concentration and < 6% at low target concentration. While the CV increases with lower target concentrations, these data indicate that all multiplex assays have a high repeatability and reproducibility at high to low concentrations.

Table 4. Precision assessment of the feline respiratory assays 1 (FRA_1) and FRA_2.

Assay Target Intra-run variability CV (%)# Inter-run variability CV (%)#
105 copies/μl 104 copies/μl 103 copies/μl 105 copies/μl 104 copies/μl 103 copies/μl
FRA_1 SARS-CoV-2 (N) 0.66 0.70 1.28 0.88 1.45 2.55
IAV (M) 0.71 0.91 2.78 1.42 1.15 2.58
FCV (ORF-1) 0.60 0.98 1.17 0.78 0.98 2.27
FHV-1 (gB) 0.55 0.50 1.33 1.07 2.12 3.08
FRA_2 B. bronchispetica (flaA—fliA-B) 0.85 2.48 4.09 0.59 1.25 3.27
M. felis (tuf) 1.27 3.53 4.88 2.86 2.09 5.41
C. felis (ompA) 1.00 2.782 4.483 0.67 2.05 2.24

#CV (%): Coefficient of variation = (standard deviation of replicates [log10 copies/μl] ÷ Average of replicates [log10 copies/μl]) × 100

Screening of clinical specimens collected from FRDC-suspected cats

The panel of multiplex assays was used to test 63 clinical samples collected from domestic cats and exotic felids that displayed respiratory disease between 2020 and 2022 in Louisiana, USA. Among the 63 samples, 58 (92.1%) were positive for at least one of the seven pathogens screened. M. felis (61.9%) was the most commonly identified agent, followed by FHV-1 (30.2%), C. felis (28.7%) and FCV (27.0%) (Fig 2 and Table 5). B. bronchiseptica and SARS-CoV-2 were detected in four (6.3%) and two (3.2%) samples, respectively. None of the samples were positive for IAV. Both SARS-CoV-2 positive samples were collected from two 6-year-old female African lions with cough in 2021 within the same zoo. Partial sequencing of the Spike protein gene (ORF 2) performed by the National Veterinary Services Laboratories, Ames, IA, indicated that both SARS-CoV-2 isolates were consistent with the Delta variant (clade B.1.617.2). The complete sequences were previously deposited in GISAID database under accession numbers EPI_ISL_9046672 and EPI_ISL_9046673.

Fig 2. UpSet plot summarizing the number of feline respiratory pathogens and SARS-CoV-2 detected in felids using the newly developed multiplex qPCR/RT-qPCR panel.

Fig 2

The number of samples with single agents detected or with multiple agents detected (co-infection) are shown as vertical bars. The bottom left horizontal bar graph labeled Set Size shows the total number of samples positives for each specific feline respiratory pathogen and SARS-CoV-2.

Table 5. Detection rate of FRDC-associated pathogens in the clinical specimens used to evaluate the FRA_ and FRA_2 assays.

Pathogens No. of positives (n = 58/63)* % positive (92.1%)*
SARS-CoV-2 2 3.2
IAV 0 0
FCV 17 27.0
FHV-1 19 30.2
B. bronchiseptica 4 6.3
M. felis 39 61.9
C. felis 18 28.7

*Positive samples for at least one pathogen

Single infections and co-infections were observed in 22 (34.9%) and 36 (57.1%) samples, respectively (Fig 2 and Table 6), demonstrating that infections with more than one FRDC- associated pathogen can occur more often. Except for the co-infection of FHV-1 with FCV in one sample, all other co-infected samples consisted of a combination of M. felis with FHV, FCV or C. felis (Fig 2 and Table 6). Co-infection of M. felis with C. felis was also commonly observed in the clinical specimens tested (16/36; 44.5%).

Table 6. Detection rate of single agent infections and co-infections associated with FRDC in the clinical specimens evaluated with FRA_1 and FRA_2 assays.

Pathogens No. of Positive samples % of Positive samples
Respiratory infections associated with one pathogen 22/63 * 34.9
SARS-CoV-2 2 3.2
FCV 4 6.3
B. bronchiseptica 4 6.3
M. felis 4 6.3
FHV-1 8 12.7
Respiratory infections associated with two pathogens 31/63 * 49.2
FHV-1 + FCV 1 1.6
FHV-1 + M. felis 7 11.1
FCV + M. felis 7 11.1
C. felis + M. felis 16 25.4
Respiratory infections associated with three pathogens 5/63 * 7.9
FCV + C. felis + M. felis 2 3.2
FHV-1 + FCV + M. felis 3 4.8

*5/63 (7.9%) specimens were negative for the pathogens tested.

Discussion

The most common pathogens reported to induce feline respiratory disease include FCV, FHV-1, B. bronchiseptica, M. felis and C. felis [3, 8]. The emergence of new pathogens (e.g. IAV and SARS-CoV-2) and the continuous circulation of common etiological agents in the feline population has made feline FRDC more complex and challenging its clinical diagnosis [14]. Additionally, co-infections by two or more viral and/or bacterial pathogens is commonly observed in cats suffering from FRDC, making the treatment challenging [74, 75]. The traditional methods for infectious agent identification, such as bacterial culture, viral isolation and conventional PCR are time consuming, have low sensitivity and are not suitable for easy identification of co-infections. Multiplex qPCR/RT-qPCR is a rapid and sensitive technique now commonly used in veterinary diagnostic laboratories [5659]. However, there were no multiplex qPCR/RT-qPCR assays available for detection of infectious agents associated with FRDC. To overcome this, we developed a panel of two multiplex qPCR/RT-qPCR for the detection of the most prevalent feline respiratory pathogens as well as the detection of two emerging viruses of cats, IAV and SARS-CoV-2.

In this study two multiplex qPCR/RT-qPCR assays were developed, namely FRA_1 and FRA_2, for the detection of viruses (i.e., FCV, FHV-1, IAV and SARS-CoV-2) and bacteria (i.e., B. bronchiseptica, M. felis and C. felis), respectively. These multiplex assays were designed using a combination of well-established qPCR/RT-qPCR assays [6368] and adding two new primers/probe combinations for the detection of FCV and FHV-1. These new primer/probe sets were developed targeting the highly conserved ORF1 and gB of FCV and FHV-1, respectively [76]. Both assays, as well as previously published assays showed high specificity for their targets alone and in combination, confirming the absence of non-specific amplification. Analytical sensitivity of each multiplex qPCR/RT-qPCR assays were evaluated in this study and compared to singleplex assays. The nearly perfect linearity (R2 > 0.998) and high amplification efficiency (> 93%) denotes the overall excellent analytical performance of each assay. In addition, no difference in analytical performance was observed between singleplex and multiplex formats of the assays. Detection of low genomic copy numbers is critical to assay’s sensitivity. Here, with a LOD95% ≤ 15 copies/μl, a high analytical sensitivity was observed for all our primers and probe sets when multiplexed. The LOD95% determined here showed a three to four log10 improvement compared to the recently published multiplex conventional PCR assays for the detection of FHV-1, FCV, IAV and C. felis (LOD were 1 × 104 to 1 × 105 copies/μL) [77]. Measuring both intra-run and inter-run assay variability is important to assess the assay’s quality and reproducibility. Here, a low intra-run and inter-run assay variabilities were observed for all assays when run in multiplex. This indicated that the qPCR/RT-qPCR assays are robust and consistent, providing confidence in the results obtained in this study. Overall, excellent analytical parameters were determined for both FRA_1 and FRA_2 multiplex assays.

It is worth noting that a single nucleotide degeneracy was introduced to the forward and reverse primers of the IAV assay, respectively, in order to empirically guarantee annealing to IAV strains derived from cats (n = 37) and retrieved from the Influenza Research Database. While it has been demonstrated that >4 degenerate nucleotides can lead to amplification bias and a reduction of the sensitivity (10-fold) [7880], the introduction of one degenerate nucleotide per primer in this case did not seemingly affected the sensitivity of this or other targets combined (LOD95% for IAV = 15 copies/μl in singleplex and multiplex conditions). The absence of IAV in any of the samples collected during the period of this study could be associated with the limited number of available samples during the study period as well as to the epidemiological occurrence of IAV in cats, which typically occur within distinct temporal and geographic locations. Hence, IAV infection in cats is relatively rare [16]. but their impact in cat populations and potential public health impact [15, 16], makes its diagnosis highly relevant.

To our knowledge, this study is the first reporting on the development of a complete panel of multiplex qPCR/RT-qPCR for the detection of feline respiratory pathogens along with SARS-CoV-2. Our panel was then used to evaluate clinical specimens collected from FRDC-suspected cats in different shelters, veterinary practices, and a zoo in Baton Rouge and the surrounding area between 2020 and 2022. As only a small number of samples were tested in this study, no conclusions can be made concerning the prevalence of the feline respiratory pathogens in this area. Nevertheless, a high rate of co-infections (57.1%) was detected in the samples collected here, supporting the need for simultaneous detection of multiple pathogens involved in FRDC. The most common infectious agent detected in this study was M. felis (61.9%), as consistently reported [12, 74, 81, 82]. A meta-analysis demonstrated that M. felis and FRDC were significantly associated [83], suggesting that M. felis may act as the initial pathogen that may predispose the cats to other viral and bacterial pathogens. However, the hypothesis that this bacterium may overgrow following damage as a consequence of FRDC needs to be considered, especially, because it was detected in almost all co-infected samples (35/36; 97.2%). However, further studies are still needed to determine the role of M. felis in feline FRDC. FCV, FHV-1 and C. felis were detected in approximately 30% of the tested samples, which is consistent with previous reports [8, 12, 74, 75, 81]. The detection of SARS-CoV-2 Delta VOC (B.1.617.2) in nasal swabs of two lions from the same premise by the CDC-developed RT-qPCR test [65] confirm that it can be multiplexed with other qPCR/RT-qPCR assays, as previously demonstrated [61, 62]. The use of SARS-CoV-2-positive nasal swabs from lions in this study was for the sole purpose of evaluating the performance of the panels developed. While domestic cats are susceptible to natural and experimental SARS-CoV-2 infections [3949], SARS-CoV-2 has not, at least yet, established as a relevant pathogen in cats responsible for FRDC. However, screening for SARS-CoV-2 in cats with FRDC is relevant from a public health standpoint.

While the assays developed here demonstrated optimal analytical performance, one of the main limitations of this study is the limited number of available samples to perform thorough clinical performance evaluation. Thus, continued evaluation of clinical specimens to assess the assay’s performance in the field is warranted. In conclusion, this study highlights the strength of our new qPCR/RT-qPCR panel for the detection of SARS-CoV-2, IAV and the most important FRDC-associated pathogens. Therefore, this panel is suitable for routine diagnostics and rapid identification of pathogens associated with feline respiratory disease outbreaks in catteries, shelters, and pet shops where they house a large number of cats.

Supporting information

S1 Fig. Assessment of the specificity of each qPCR/RT-qPCR assay using reference viral and bacterial DNA and RNA.

Each column corresponds to one specific qPCR/RT-qPCR assay and each row corresponds to one specific reference strain of virus or bacteria. Specificity was assessed for each assay in singleplex and in multiplex formats. White cases correspond to the absence of detection while black cases correspond to DNA/RNA amplification in both singleplex and multiplex assays.

(TIF)

S2 Fig. Amplification curves generated under singleplex and multiplex conditions for a ten-fold serial dilution series of each target included in the FRA_1 assay.

Each dilution was performed using three replicates ranging from 107 to 101 IVT RNA copies/μl. The X-axis represents the cycle number and the Y-axis represents the delta Rn value.

(TIF)

pone.0297796.s002.tif (11.3MB, tif)
S3 Fig. Amplification curves generated under singleplex and multiplex conditions for a ten-fold serial dilution series of each target included in the FRA_2 assay.

Each dilution was performed using three replicates ranging from 107 to 101 plasmid DNA copies/μl. The X-axis represents the cycle number, and the Y-axis represents the delta Rn value.

(TIF)

pone.0297796.s003.tif (10.4MB, tif)
S1 Table. Origin and type of samples collected from URTD-suspected cats during this study.

Thirty-nine nasal swabs and 24 pharyngeal swabs were collected from 39 felines from 2020 and 2022.

(DOCX)

pone.0297796.s004.docx (19.2KB, docx)
S1 File. Original data used to determine the analytical specificity, sensitivity, repeatability, and reproducibility of FRA_1 and FRA_2 assays.

(PDF)

pone.0297796.s005.pdf (214KB, pdf)

Acknowledgments

The following reagents were obtained through BEI Resources, NIAID, NIH: SARS-Related Coronavirus 2, Isolate hCoV-19/USAWA1/2020, NR-52281, Centers for Disease Control and Prevention; SARS-Related Coronavirus 2, Isolate hCoV-19/USA/CA_UCSD_5574/2020, NR-54020, contributed by Dr. Aaron Carlin; SARS-Related Coronavirus 2, Isolate hCoV-19/USA/MDHP01542/2021 (Lineage B.1.351), in Homo sapiens Lung Adenocarcinoma (Calu-3) Cells, NR-55282 (contributed by Andrew S. Pekosz); SARS-Related Coronavirus 2, Isolate hCoV-19/USA/MDHP05285/2021 (Lineage B.1.617.2; Delta Variant), NR-55671, contributed by Andrew S. Pekosz; SARS-Related Coronavirus 2, Isolate hCoV-19/USA/MDHP20874/2021 (Lineage B.1.1.529; Omicron Variant), NR-56461, contributed by Andrew S. Pekosz; Bordetella bronchiseptica, Strain E014, NR-44164; Mycoplasma canis, Strain PG 14, NR-3865; Alphacoronavirus 1, 79–1146 [formerly Feline Infectious Peritonitis Virus (FIPV)], NR-43287.

The authors would like to kindly acknowledge Dr. Dr. Diego Diel, Department of Population Medicine and Diagnostic Sciences, Cornell University College of Veterinary Medicine, Ithaca, NY and Dr. Edward Dubovi for providing RNA derived from canine influenza A viruses.

Data Availability

All relevant data are within the manuscript and its Supporting information file.

Funding Statement

This study entitled “Development of multiplex real-time PCR assays for differentiating SARS-CoV-2 from other respiratory and enteric pathogens and enteric pathogens and an IgM/IgG ELISA for the serologic diagnosis of COVID-19 in dogs and cats” was funded to UBRB by the Vet-LIRN COVID-19 Capacity Grant number 1U18FD007514 and supported by the Food and Drug Administration (FDA) of the U.S. Department of Health and Human Services (HHS) as part of a financial assistance award totaling $100,000 with 100 percent funding by FDA/HHS. The contents are those of the author(s) and do not necessarily represent the official views of, nor an endorsement, by FDA/HHS, or the U.S. Government. Reference to any commercial materials, equipment, or process does not in any way constitute approval, endorsement, or recommendation by the Food and Drug Administration. CJT is partially supported through an NIH-USDA NIFA R01 Research Grant Program Dual Purpose with Dual Benefit: Research in Biomedicine and Agriculture Using Agriculturally Important Domestic Animal Species grant number 2019-67016-29102 (award number AWD-47990-1) from the USDA National Institute of Food and Agriculture to UBRB. Additionally, self-generated funds from UBRB and MC (PG008671) partially supported this study. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Dinnage JD, Scarlett JM, Richards JR. Descriptive epidemiology of feline upper respiratory tract disease in an animal shelter. J Feline Med Surg. 2009;11: 816–825. doi: 10.1016/j.jfms.2009.03.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Sykes JE. Pediatric feline upper respiratory disease. Vet Clin North Am Small Anim Pract. 2014;44: 331–342. doi: 10.1016/j.cvsm.2013.10.005 [DOI] [PubMed] [Google Scholar]
  • 3.Cohn LA. Feline Respiratory Disease Complex. Veterinary Clinics of North America: Small Animal Practice. 2011;41: 1273–1289. doi: 10.1016/j.cvsm.2011.07.006 [DOI] [PubMed] [Google Scholar]
  • 4.Helps CR, Lait P, Gruffydd-Jones T. tract disease caused by feline herpesvirus,. The Veterinary Record. 2005; 5. [DOI] [PubMed] [Google Scholar]
  • 5.Hofmann-Lehmann R, Hosie MJ, Hartmann K, Egberink H, Truyen U, Tasker S, et al. Calicivirus Infection in Cats. Viruses. 2022;14: 937. doi: 10.3390/v14050937 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Walter J, Foley P, Yason C, Vanderstichel R, Muckle A. Prevalence of feline herpesvirus-1, feline calicivirus, Chlamydia felis, and Bordetella bronchiseptica in a population of shelter cats on Prince Edward Island. Can J Vet Res. 2020;84: 181–188. [PMC free article] [PubMed] [Google Scholar]
  • 7.Sykes JE, Anderson GA, Studdert VP, Browning GF. Prevalence of feline Chlamydia psittaci and feline herpesvirus 1 in cats with upper respiratory tract disease. J Vet Intern Med. 1999;13: 153–162. doi: 10.1892/0891-6640(1999)013&lt;0153:pofpaf&gt;2.3.co;2 [DOI] [PubMed] [Google Scholar]
  • 8.Bannasch MJ, Foley JE. Epidemiologic evaluation of multiple respiratory pathogens in cats in animal shelters. Journal of Feline Medicine and Surgery. 2005;7: 109–119. doi: 10.1016/j.jfms.2004.07.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Johnson LR, Foley JE, De Cock HEV, Clarke HE, Maggs DJ. Assessment of infectious organisms associated with chronic rhinosinusitis in cats. J Am Vet Med Assoc. 2005;227: 579–585. doi: 10.2460/javma.2005.227.579 [DOI] [PubMed] [Google Scholar]
  • 10.Hoskins JD, Williams J, Roy AF, Peters JC, McDonough P. Isolation and characterization of Bordetella bronchiseptica from cats in southern Louisiana. Veterinary Immunology and Immunopathology. 1998;65: 173–176. doi: 10.1016/s0165-2427(98)00152-4 [DOI] [PubMed] [Google Scholar]
  • 11.Di Martino B, Di Francesco CE, Meridiani I, Marsilio F. Etiological investigation of multiple respiratory infections in cats. New Microbiol. 2007;30: 455–461. [PubMed] [Google Scholar]
  • 12.Litster A, Wu CC, Leutenegger CM. Detection of feline upper respiratory tract disease pathogens using a commercially available real-time PCR test. Vet J. 2015;206: 149–153. doi: 10.1016/j.tvjl.2015.08.001 [DOI] [PubMed] [Google Scholar]
  • 13.Nguyen D, Barrs VR, Kelman M, Ward MP. Feline upper respiratory tract infection and disease in Australia. J Feline Med Surg. 2019;21: 973–978. doi: 10.1177/1098612X18813248 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Palombieri A, Di Profio F, Fruci P, Sarchese V, Martella V, Marsilio F, et al. Emerging Respiratory Viruses of Cats. Viruses. 2022;14: 663. doi: 10.3390/v14040663 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wasik BR, Voorhees IEH, Parrish CR. Canine and Feline Influenza. Cold Spring Harb Perspect Med. 2021;11: a038562. doi: 10.1101/cshperspect.a038562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Frymus T, Belák S, Egberink H, Hofmann-Lehmann R, Marsilio F, Addie DD, et al. Influenza Virus Infections in Cats. Viruses. 2021;13: 1435. doi: 10.3390/v13081435 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Leschnik M, Weikel J, Möstl K, Revilla-Fernández S, Wodak E, Bagó Z, et al. Subclinical Infection with Avian Influenza A H5N1 Virus in Cats. Emerg Infect Dis. 2007;13: 243–247. doi: 10.3201/eid1302.060608 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Rimmelzwaan GF, van Riel D, Baars M, Bestebroer TM, van Amerongen G, Fouchier RAM, et al. Influenza A Virus (H5N1) Infection in Cats Causes Systemic Disease with Potential Novel Routes of Virus Spread within and between Hosts. Am J Pathol. 2006;168: 176–183. doi: 10.2353/ajpath.2006.050466 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Thiry E, Zicola A, Addie D, Egberink H, Hartmann K, Lutz H, et al. Highly pathogenic avian influenza H5N1 virus in cats and other carnivores. Vet Microbiol. 2007;122: 25–31. doi: 10.1016/j.vetmic.2006.12.021 [DOI] [PubMed] [Google Scholar]
  • 20.Kuiken T, Rimmelzwaan G, van Riel D, van Amerongen G, Baars M, Fouchier R, et al. Avian H5N1 influenza in cats. Science. 2004;306: 241. doi: 10.1126/science.1102287 [DOI] [PubMed] [Google Scholar]
  • 21.Keawcharoen J, Oraveerakul K, Kuiken T, Fouchier RAM, Amonsin A, Payungporn S, et al. Avian Influenza H5N1 in Tigers and Leopards. Emerg Infect Dis. 2004;10: 2189–2191. doi: 10.3201/eid1012.040759 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Marschall J, Hartmann K. Avian influenza A H5N1 infections in cats. J Feline Med Surg. 2008;10: 359–365. doi: 10.1016/j.jfms.2008.03.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fiorentini L, Taddei R, Moreno A, Gelmetti D, Barbieri I, De Marco MA, et al. Influenza A pandemic (H1N1) 2009 virus outbreak in a cat colony in Italy. Zoonoses Public Health. 2011;58: 573–581. doi: 10.1111/j.1863-2378.2011.01406.x [DOI] [PubMed] [Google Scholar]
  • 24.Knight CG, Davies JL, Joseph T, Ondrich S, Rosa BV. Pandemic H1N1 influenza virus infection in a Canadian cat. Can Vet J. 2016;57: 497–500. [PMC free article] [PubMed] [Google Scholar]
  • 25.Sponseller BA, Strait E, Jergens A, Trujillo J, Harmon K, Koster L, et al. Influenza A pandemic (H1N1) 2009 virus infection in domestic cat. Emerg Infect Dis. 2010;16: 534–537. doi: 10.3201/eid1603.091737 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Campagnolo ER, Rankin JT, Daverio SA, Hunt EA, Lute JR, Tewari D, et al. Fatal pandemic (H1N1) 2009 influenza A virus infection in a Pennsylvania domestic cat. Zoonoses Public Health. 2011;58: 500–507. doi: 10.1111/j.1863-2378.2011.01390.x [DOI] [PubMed] [Google Scholar]
  • 27.Tangwangvivat R, Chanvatik S, Charoenkul K, Chaiyawong S, Janethanakit T, Tuanudom R, et al. Evidence of pandemic H1N1 influenza exposure in dogs and cats, Thailand: A serological survey. Zoonoses Public Health. 2019;66: 349–353. doi: 10.1111/zph.12551 [DOI] [PubMed] [Google Scholar]
  • 28.Yu Z, Gao X, Wang T, Li Y, Li Y, Xu Y, et al. Fatal H5N6 Avian Influenza Virus Infection in a Domestic Cat and Wild Birds in China. Sci Rep. 2015;5: 10704. doi: 10.1038/srep10704 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Cao X, Yang F, Wu H, Xu L. Genetic characterization of novel reassortant H5N6-subtype influenza viruses isolated from cats in eastern China. Arch Virol. 2017;162: 3501–3505. doi: 10.1007/s00705-017-3490-2 [DOI] [PubMed] [Google Scholar]
  • 30.Lee K, Lee E-K, Lee H, Heo G-B, Lee Y-N, Jung J-Y, et al. Highly Pathogenic Avian Influenza A(H5N6) in Domestic Cats, South Korea. Emerg Infect Dis. 2018;24: 2343–2347. doi: 10.3201/eid2412.180290 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Blachere FM, Lindsley WG, Weber AM, Beezhold DH, Thewlis RE, Mead KR, et al. Detection of an avian lineage influenza A(H7N2) virus in air and surface samples at a New York City feline quarantine facility. Influenza Other Respir Viruses. 2018;12: 613–622. doi: 10.1111/irv.12572 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Newbury SP, Cigel F, Killian ML, Leutenegger CM, Seguin MA, Crossley B, et al. First Detection of Avian Lineage H7N2 in Felis catus. Genome Announc. 2017;5: e00457–17. doi: 10.1128/genomeA.00457-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Song DS, An DJ, Moon HJ, Yeom MJ, Jeong HY, Jeong WS, et al. Interspecies transmission of the canine influenza H3N2 virus to domestic cats in South Korea, 2010. J Gen Virol. 2011;92: 2350–2355. doi: 10.1099/vir.0.033522-0 [DOI] [PubMed] [Google Scholar]
  • 34.Jeoung H-Y, Lim S-I, Shin B-H, Lim J-A, Song J-Y, Song D-S, et al. A novel canine influenza H3N2 virus isolated from cats in an animal shelter. Vet Microbiol. 2013;165: 281–286. doi: 10.1016/j.vetmic.2013.03.021 [DOI] [PubMed] [Google Scholar]
  • 35.Ali A, Daniels JB, Zhang Y, Rodriguez-Palacios A, Hayes-Ozello K, Mathes L, et al. Pandemic and seasonal human influenza virus infections in domestic cats: prevalence, association with respiratory disease, and seasonality patterns. J Clin Microbiol. 2011;49: 4101–4105. doi: 10.1128/JCM.05415-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Pigott AM, Haak CE, Breshears MA, Linklater AKJ. Acute bronchointerstitial pneumonia in two indoor cats exposed to the H1N1 influenza virus. J Vet Emerg Crit Care (San Antonio). 2014;24: 715–723. doi: 10.1111/vec.12179 [DOI] [PubMed] [Google Scholar]
  • 37.Cui S, Liu Y, Zhao J, Peng X, Lu G, Shi W, et al. An Updated Review on SARS-CoV-2 Infection in Animals. Viruses. 2022;14: 1527. doi: 10.3390/v14071527 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Mahdy MAA, Younis W, Ewaida Z. An Overview of SARS-CoV-2 and Animal Infection. Front Vet Sci. 2020;7: 596391. doi: 10.3389/fvets.2020.596391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Shi J, Wen Z, Zhong G, Yang H, Wang C, Huang B, et al. Susceptibility of ferrets, cats, dogs, and other domesticated animals to SARS-coronavirus 2. Science. 2020;368: 1016–1020. doi: 10.1126/science.abb7015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Barrs VR, Peiris M, Tam KWS, Law PYT, Brackman CJ, To EMW, et al. SARS-CoV-2 in Quarantined Domestic Cats from COVID-19 Households or Close Contacts, Hong Kong, China. Emerg Infect Dis. 2020;26: 3071–3074. doi: 10.3201/eid2612.202786 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Gaudreault NN, Trujillo JD, Carossino M, Meekins DA, Morozov I, Madden DW, et al. SARS-CoV-2 infection, disease and transmission in domestic cats. Emerg Microbes Infect. 2020;9: 2322–2332. doi: 10.1080/22221751.2020.1833687 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Musso N, Costantino A, La Spina S, Finocchiaro A, Andronico F, Stracquadanio S, et al. New SARS-CoV-2 Infection Detected in an Italian Pet Cat by RT-qPCR from Deep Pharyngeal Swab. Pathogens. 2020;9: 746. doi: 10.3390/pathogens9090746 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Hosie MJ, Epifano I, Herder V, Orton RJ, Stevenson A, Johnson N, et al. Detection of SARS-CoV-2 in respiratory samples from cats in the UK associated with human-to-cat transmission. Vet Rec. 2021;188: e247. doi: 10.1002/vetr.247 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Keller M, Hagag IT, Balzer J, Beyer K, Kersebohm JC, Sadeghi B, et al. Detection of SARS-CoV-2 variant B.1.1.7 in a cat in Germany. Res Vet Sci. 2021;140: 229–232. doi: 10.1016/j.rvsc.2021.09.008 [DOI] [PubMed] [Google Scholar]
  • 45.Klaus J, Zini E, Hartmann K, Egberink H, Kipar A, Bergmann M, et al. SARS-CoV-2 Infection in Dogs and Cats from Southern Germany and Northern Italy during the First Wave of the COVID-19 Pandemic. Viruses. 2021;13: 1453. doi: 10.3390/v13081453 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Neira V, Brito B, Agüero B, Berrios F, Valdés V, Gutierrez A, et al. A household case evidences shorter shedding of SARS-CoV-2 in naturally infected cats compared to their human owners. Emerg Microbes Infect. 2021;10: 376–383. doi: 10.1080/22221751.2020.1863132 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Schulz C, Wylezich C, Wernike K, Gründl M, Dangel A, Baechlein C, et al. Prolonged SARS-CoV-2 RNA Shedding from Therapy Cat after Cluster Outbreak in Retirement Home. Emerg Infect Dis. 2021;27: 1974–1976. doi: 10.3201/eid2707.204670 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Chaintoutis SC, Siarkou VI, Mylonakis ME, Kazakos GM, Skeva P-N, Bampali M, et al. Limited cross-species transmission and absence of mutations associated with SARS-CoV-2 adaptation in cats: A case study of infection in a small household setting. Transbound Emerg Dis. 2022;69: 1606–1616. doi: 10.1111/tbed.14132 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Fritz M, Nesi N, Denolly S, Boson B, Legros V, Rosolen SG, et al. Detection of SARS-CoV-2 in two cats during the second wave of the COVID-19 pandemic in France. Vet Med Sci. 2022;8: 14–20. doi: 10.1002/vms3.638 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.McAloose D, Laverack M, Wang L, Killian ML, Caserta LC, Yuan F, et al. From People to Panthera: Natural SARS-CoV-2 Infection in Tigers and Lions at the Bronx Zoo. mBio. 2020;11: e02220–20. doi: 10.1128/mBio.02220-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Grome HN, Meyer B, Read E, Buchanan M, Cushing A, Sawatzki K, et al. SARS-CoV-2 Outbreak among Malayan Tigers and Humans, Tennessee, USA, 2020. Emerg Infect Dis. 2022;28: 833–836. doi: 10.3201/eid2804.212219 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Mishra A, Kumar N, Bhatia S, Aasdev A, Kanniappan S, Sekhar AT, et al. SARS-CoV-2 Delta Variant among Asiatic Lions, India. Emerg Infect Dis. 2021;27: 2723–2725. doi: 10.3201/eid2710.211500 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Koeppel KN, Mendes A, Strydom A, Rotherham L, Mulumba M, Venter M. SARS-CoV-2 Reverse Zoonoses to Pumas and Lions, South Africa. Viruses. 2022;14: 120. doi: 10.3390/v14010120 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Zoccola R, Beltramo C, Magris G, Peletto S, Acutis P, Bozzetta E, et al. First detection of an Italian human-to-cat outbreak of SARS-CoV-2 Alpha variant—lineage B.1.1.7. One Health. 2021;13: 100295. doi: 10.1016/j.onehlt.2021.100295 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Miró G, Regidor-Cerrillo J, Checa R, Diezma-Díaz C, Montoya A, García-Cantalejo J, et al. SARS-CoV-2 Infection in One Cat and Three Dogs Living in COVID-19-Positive Households in Madrid, Spain. Front Vet Sci. 2021;8: 779341. doi: 10.3389/fvets.2021.779341 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Carossino M, Barrandeguy ME, Erol E, Li Y, Balasuriya UBR. Development and evaluation of a one-step multiplex real-time TaqMan® RT-qPCR assay for the detection and genotyping of equine G3 and G14 rotaviruses in fecal samples. Virol J. 2019;16: 49. doi: 10.1186/s12985-019-1149-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Pan Z, Lu J, Wang N, He W-T, Zhang L, Zhao W, et al. Development of a TaqMan-probe-based multiplex real-time PCR for the simultaneous detection of emerging and reemerging swine coronaviruses. Virulence. 2020;11: 707–718. doi: 10.1080/21505594.2020.1771980 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Pansri P, Katholm J, Krogh KM, Aagaard AK, Schmidt LMB, Kudirkiene E, et al. Evaluation of novel multiplex qPCR assays for diagnosis of pathogens associated with the bovine respiratory disease complex. Vet J. 2020;256: 105425. doi: 10.1016/j.tvjl.2020.105425 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Wang R, Zhang W, Ye R, Pan Z, Li G, Su S. One-step multiplex TaqMan probe-based method for real-time PCR detection of four canine diarrhea viruses. Molecular and Cellular Probes. 2020;53: 101618. doi: 10.1016/j.mcp.2020.101618 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Carossino M, Balasuriya UBR, Thieulent CJ, Barrandeguy ME, Vissani MA, Parreño V. Quadruplex Real-Time TaqMan® RT-qPCR Assay for Differentiation of Equine Group A and B Rotaviruses and Identification of Group A G3 and G14 Genotypes. 2023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Thieulent CJ, Carossino M, Peak L, Wolfson W, Balasuriya UBR. Multiplex One-Step RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Enteric Viruses of Dogs and Cats. Viruses. 2023;15: 1890. doi: 10.3390/v15091890 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Thieulent CJ, Carossino M, Peak L, Strother K, Wolfson W, Balasuriya UBR. Development and Validation of a Panel of One-Step Four-Plex qPCR/RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Pathogens Associated with Canine Infectious Respiratory Disease Complex. Viruses. 2023;15: 1881. doi: 10.3390/v15091881 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Spackman E, Senne DA, Myers TJ, Bulaga LL, Garber LP, Perdue ML, et al. Development of a Real-Time Reverse Transcriptase PCR Assay for Type A Influenza Virus and the Avian H5 and H7 Hemagglutinin Subtypes. J Clin Microbiol. 2002;40: 3256–3260. doi: 10.1128/JCM.40.9.3256-3260.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Slomka MJ, Densham ALE, Coward VJ, Essen S, Brookes SM, Irvine RM, et al. Original Article: Real time reverse transcription (RRT)-polymerase chain reaction (PCR) methods for detection of pandemic (H1N1) 2009 influenza virus and European swine influenza A virus infections in pigs: SIV and pandemic (H1N1) 2009 detection by RRT PCRs. Influenza and Other Respiratory Viruses. 2010;4: 277–293. doi: 10.1111/j.1750-2659.2010.00149.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Lu X, Wang L, Sakthivel SK, Whitaker B, Murray J, Kamili S, et al. US CDC Real-Time Reverse Transcription PCR Panel for Detection of Severe Acute Respiratory Syndrome Coronavirus 2. Emerg Infect Dis. 2020;26: 1654–1665. doi: 10.3201/eid2608.201246 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Tizolova A, Brun D, Guiso N, Guillot S. Development of real-time PCR assay for differential detection of Bordetella bronchiseptica and Bordetella parapertussis. Diagnostic Microbiology and Infectious Disease. 2014;78: 347–351. doi: 10.1016/j.diagmicrobio.2013.12.020 [DOI] [PubMed] [Google Scholar]
  • 67.Söderlund R, Bölske G, Holst BS, Aspán A. Development and evaluation of a real-time polymerase chain reaction method for the detection of Mycoplasma felis. J VET Diagn Invest. 2011;23: 890–893. doi: 10.1177/1040638711407479 [DOI] [PubMed] [Google Scholar]
  • 68.Pantchev A, Sting R, Bauerfeind R, Tyczka J, Sachse K. Detection of all Chlamydophila and Chlamydia spp. of veterinary interest using species-specific real-time PCR assays. Comparative Immunology, Microbiology and Infectious Diseases. 2010;33: 473–484. doi: 10.1016/j.cimid.2009.08.002 [DOI] [PubMed] [Google Scholar]
  • 69.Carossino M, Li Y, Lee P-YA, Tsai C-F, Chou P-H, Williams D, et al. Evaluation of a field-deployable reverse transcription-insulated isothermal PCR for rapid and sensitive on-site detection of Zika virus. BMC Infect Dis. 2017;17: 778. doi: 10.1186/s12879-017-2852-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Carossino M, Lee P-YA, Nam B, Skillman A, Shuck KM, Timoney PJ, et al. Development and evaluation of a reverse transcription-insulated isothermal polymerase chain reaction (RT-iiPCR) assay for detection of equine arteritis virus in equine semen and tissue samples using the POCKIT system. J Virol Methods. 2016;234: 7–15. doi: 10.1016/j.jviromet.2016.02.015 [DOI] [PubMed] [Google Scholar]
  • 71.Lu Z, Chambers TM, Boliar S, Branscum AJ, Sturgill TL, Timoney PJ, et al. Development and Evaluation of One-Step TaqMan Real-Time Reverse Transcription-PCR Assays Targeting Nucleoprotein, Matrix, and Hemagglutinin Genes of Equine Influenza Virus. J Clin Microbiol. 2009;47: 3907–3913. doi: 10.1128/JCM.00598-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Lu Z, Branscum AJ, Shuck KM, Zhang J, Dubovi EJ, Timoney PJ, et al. Comparison of two real-time reverse transcription polymerase chain reaction assays for the detection of Equine arteritis virus nucleic acid in equine semen and tissue culture fluid. J VET Diagn Invest. 2008;20: 147–155. doi: 10.1177/104063870802000202 [DOI] [PubMed] [Google Scholar]
  • 73.Burd EM. Validation of laboratory-developed molecular assays for infectious diseases. Clin Microbiol Rev. 2010;23: 550–576. doi: 10.1128/CMR.00074-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.McManus CM, Levy JK, Andersen LA, McGorray SP, Leutenegger CM, Gray LK, et al. Prevalence of upper respiratory pathogens in four management models for unowned cats in the Southeast United States. The Veterinary Journal. 2014;201: 196–201. doi: 10.1016/j.tvjl.2014.05.015 [DOI] [PubMed] [Google Scholar]
  • 75.Schulz C, Hartmann K, Mueller RS, Helps C, Schulz BS. Sampling sites for detection of feline herpesvirus-1, feline calicivirus and Chlamydia felis in cats with feline upper respiratory tract disease. J Feline Med Surg. 2015;17: 1012–1019. doi: 10.1177/1098612X15569615 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Mao J, Ye S, Li Q, Bai Y, Wu J, Xu L, et al. Molecular Characterization and Phylogenetic Analysis of Feline Calicivirus Isolated in Guangdong Province, China from 2018 to 2022. Viruses. 2022;14: 2421. doi: 10.3390/v14112421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Xiao X, Hao X, Chen B, Zhou P, Li S. Two Multiplex PCR Methods for Detecting Several Pathogens Associated with Feline Respiratory and Intestinal Tracts. Veterinary Sciences. 2023;10: 14. doi: 10.3390/vetsci10010014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Gaby JC, Buckley DH. The Use of Degenerate Primers in qPCR Analysis of Functional Genes Can Cause Dramatic Quantification Bias as Revealed by Investigation of nifH Primer Performance. Microb Ecol. 2017;74: 701–708. doi: 10.1007/s00248-017-0968-0 [DOI] [PubMed] [Google Scholar]
  • 79.Nam YR, Lee U, Choi HS, Lee KJ, Kim N, Jang YJ, et al. Degenerate PCR primer design for the specific identification of rhinovirus C. Journal of Virological Methods. 2015;214: 15–24. doi: 10.1016/j.jviromet.2014.10.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Rijsewijk F, Pritz-Verschuren S, Kerkhoff S, Botter A, Willemsen M, Nieuwstadt TV, et al. Development of a polymerase chain reaction for the detection of Anguillid herpesvirus DNA in eels based on the herpesvirus DNA polymerase gene. Journal of Virological Methods. 2005;124: 87–94. doi: 10.1016/j.jviromet.2004.11.007 [DOI] [PubMed] [Google Scholar]
  • 81.Fernandez M, Manzanilla EG, Lloret A, León M, Thibault J-C. Prevalence of feline herpesvirus-1, feline calicivirus, Chlamydophila felis and Mycoplasma felis DNA and associated risk factors in cats in Spain with upper respiratory tract disease, conjunctivitis and/or gingivostomatitis. J Feline Med Surg. 2017;19: 461–469. doi: 10.1177/1098612X16634387 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Vekšins A. Feline upper respiratory tract disease—Computed tomography and laboratory diagnostic. Vet World. 2022;15: 1880–1886. doi: 10.14202/vetworld.2022.1880-1886 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Le Boedec K. A systematic review and meta-analysis of the association between Mycoplasma spp and upper and lower respiratory tract disease in cats. J Am Vet Med Assoc. 2017;250: 397–407. doi: 10.2460/javma.250.4.397 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Assessment of the specificity of each qPCR/RT-qPCR assay using reference viral and bacterial DNA and RNA.

Each column corresponds to one specific qPCR/RT-qPCR assay and each row corresponds to one specific reference strain of virus or bacteria. Specificity was assessed for each assay in singleplex and in multiplex formats. White cases correspond to the absence of detection while black cases correspond to DNA/RNA amplification in both singleplex and multiplex assays.

(TIF)

S2 Fig. Amplification curves generated under singleplex and multiplex conditions for a ten-fold serial dilution series of each target included in the FRA_1 assay.

Each dilution was performed using three replicates ranging from 107 to 101 IVT RNA copies/μl. The X-axis represents the cycle number and the Y-axis represents the delta Rn value.

(TIF)

pone.0297796.s002.tif (11.3MB, tif)
S3 Fig. Amplification curves generated under singleplex and multiplex conditions for a ten-fold serial dilution series of each target included in the FRA_2 assay.

Each dilution was performed using three replicates ranging from 107 to 101 plasmid DNA copies/μl. The X-axis represents the cycle number, and the Y-axis represents the delta Rn value.

(TIF)

pone.0297796.s003.tif (10.4MB, tif)
S1 Table. Origin and type of samples collected from URTD-suspected cats during this study.

Thirty-nine nasal swabs and 24 pharyngeal swabs were collected from 39 felines from 2020 and 2022.

(DOCX)

pone.0297796.s004.docx (19.2KB, docx)
S1 File. Original data used to determine the analytical specificity, sensitivity, repeatability, and reproducibility of FRA_1 and FRA_2 assays.

(PDF)

pone.0297796.s005.pdf (214KB, pdf)

Data Availability Statement

All relevant data are within the manuscript and its Supporting information file.


Articles from PLOS ONE are provided here courtesy of PLOS

RESOURCES