Identification and biochemical characterization of a carboxylesterase gene associated with β-cypermethrin resistance in Dermanyssus gallinae

Abstract

Dermanyssus gallinae is a major hematophagous ectoparasite in layer hens. Although the acaricide β-cypermethrin has been used to control mites worldwide, D. gallinae has developed resistance to this compound. Carboxylesterases (CarEs) are important detoxification enzymes that confer resistance to β-cypermethrin in arthropods. However, CarEs associated with β-cypermethrin resistance in D. gallinae have not yet been functionally characterized. Here, we isolated a CarE gene (Deg-CarE) from D. gallinae and assayed its activity. The results revealed significantly higher expression of Deg-CarE in the β-cypermethrin-resistant strain (RS) than in the susceptible strain (SS) toward α-naphthyl acetate (α-NA) and β-naphthyl acetate (β-NA). These findings suggest that enhanced esterase activities might have contributed to β-cypermethrin resistance in D. gallinae. Quantitative real-time PCR analysis revealed that Deg-CarE expression levels were significantly higher in adults than in other life stages. Although Deg-CarE was upregulated in the RS, significant differences in gene copy numbers were not observed. Additionally, Deg-CarE expression was significantly induced by β-cypermethrin in both the SS and RS. Moreover, silencing Deg-CarE via RNA interference decreased the enzyme activity and increased the susceptibility of the RS to β-cypermethrin, confirming that Deg-CarE is crucial for β-cypermethrin detoxification. Finally, recombinant Deg-CarE (rDeg-CarE) expressed in Escherichia coli displayed high enzymatic activity toward α/β-NA. However, metabolic analysis indicated that rDeg-CarE did not directly metabolize β-cypermethrin. The collective findings indicate that D. gallinae resistance to β-cypermethrin is associated with elevated CarEs protein activity and increased Deg-CarE expression levels. These findings provide insights into the metabolic resistance of D. gallinae and offer scientific guidance for the management and control of D. gallinae.

INTRODUCTION

Dermanyssus gallinae, commonly known as poultry red mite, is an obligate hematophagous ectoparasite that primarily infests bird species, particularly poultry, and has a major impact on animal welfare worldwide (Sparagano et al., 2014). These mites have caused major economic losses in many countries (Sparagano et al., 2020), with annual losses estimated at €231 million in the European egg industry alone (Sigognault Flochlay et al., 2017). In Europe, more than 80% of layer farms are infected with D. gallinae, especially in Turkey, where the infection rate is as high as 98.9%. Additionally, D. gallinae infections have been reported in China, Brazil, Australia, and Japan (Mul, 2013; Pugliese et al., 2019; Ko and Nalbantolu, 2021). D. gallinae infection causes anemia, reduced egg quality and production, and even death in chickens. Moreover, numerous studies have indicated that D. gallinae could potentially act as a vector for various pathogens (Sommer et al., 2016; Tomley and Sparagano, 2018; Pugliese et al., 2019; Schiavone et al., 2022). Further, human infestations by D. gallinae may lead to the development of gammasoidosis (Sioutas et al., 2021).

Currently, D. gallinae is mainly controlled via the application of synthetic or semisynthetic acaricides (Marangi et al., 2012), such as carbamates, organophosphates (OPs), and synthetic pyrethroids (SPs) (Zeman, 1987). However, SPs resistance in D. gallinae has increased, with the species showing high levels of resistance to λ-cyhalothrin, β-cypermethrin, tetramethrin, permethrin, cypermethrin, α-cypermethrin, and cyfluthrin (Fletcher and Axtell, 1991; Zdybel et al., 2011; Pugliese et al., 2019; Katsavou et al., 2020; Wang et al., 2021; Koç et al., 2022). Many SPs acaricides have become less effective as a result of this resistance, which could have crucial negative effects on poultry health. Therefore, studying the genetic resistance mechanisms of D. gallinae populations to acaricides is necessary to control SPs resistance in this pest and develop novel resistance management strategies.

Acaricide resistance mechanisms typically fall into 2 main categories: insensitivity at the target site and increased enzymatic detoxification (Leeuwen et al., 2010). Acaricides are metabolized prior to contact with the target sites by major kinds of detoxifying enzymes, including carboxylesterases (CarEs), glutathione-S-transferases (GSTs), and cytochrome P450 (P450s) (Li et al., 2007). Resistance of D. gallinae to SPs is linked to mutations in the genes encoding voltage-gated sodium channels, which are the SPs target sites (Katsavou et al., 2020; Koç et al., 2022; Schiavone et al., 2023). Additionally, enhanced enzymatic detoxification of P450s and GSTs has been confirmed to contribute to SPs resistance in D. gallinae (Bartley et al., 2015; Wang et al., 2020; Wang et al., 2021).

CarEs belong to the α/β hydrolase superfamily and are ubiquitous in insects (Oakeshott et al., 2010a) and plants (Cao et al., 2019). In recent years, CarEs have been closely linked to the development of insecticide resistance (Oakeshott et al., 2013). Numerous investigations have demonstrated that alterations or increases in esterase activity are major factors in the development of SPs resistance in arthropods (Aponte et al., 2013). This shift or elevation in esterase activity could result from gene mutation, amplification, or transcriptional upregulation. Gene mutations may alter the structure of CarEs, resulting in enhanced metabolic action associated with mite mortality. A single amino acid substitution (tryptophan to leucine) of an α-esterase gene (MdαE7) determines the resistance of Musca domestica to malathion (Zhang et al., 2018). In addition, insects and mites produce large amounts of esterases via gene amplification and upregulation, which results in enhanced degradation and sequestration of insecticides (Li et al., 2007; Zhang et al., 2010). For instance, overexpression of CarE resulting from the increased relative expression of the mRNA and DNA of CarE and E4 esterase might have roles in Aphis glycines Matsumura resistance to λ-cyhalothrin (Xi et al., 2015). Feng et al. (2018) found that eleven genes were significantly overexpressed in the resistant housefly strain, among which 8 CarE genes were further upregulated by permethrin treatment. In D. gallinae, Schiavone et al. (2023) recently found that overexpression of detoxification enzymes, including CarEs, may be involved in the phoxim and cypermethrin resistance of D. gallinae in Italy. However, our current understanding of detailed information about the ability of individual CarEs to metabolize acaricides remains limited. Thus, investigating the biochemical characteristics of CarEs at the DNA, mRNA, and protein levels could further elucidate the mechanisms underlying CarE-mediated SPs resistance in D. gallinae.

Therefore, this study aimed to identify the CarE gene (Deg-CarE) in D. gallinae and evaluate the relationship between Deg-CarE and β-cypermethrin resistance. The findings provide evidence supporting the involvement of CarEs in conferring β-cypermethrin resistance in D. gallinae.

MATERIALS AND METHODS

Mites and Chemicals

The susceptible strain (SS) of D. gallinae was donated by Professor Pan Baoliang from the College of Veterinary Medicine, China Agricultural University, Beijing, China. This strain was relatively susceptible to β-cypermethrin based on the results of laboratory bioassays that revealed a median lethal concentration (LC₅₀) of 5.44 μg/cm² for mites (Wang et al., 2021). The strain was used as the reference SS in the current study. A field strain of D. gallinae (CHS-1) was collected in 2021 from a poultry farm located in the Shijiazhuang region of Hebei Province, China. This strain was assessed for its response to β-cypermethrin. The bioassay results demonstrated that it presented a 106-fold increase in resistance to β-cypermethrin compared with the SS strain. Therefore, CHS-1 was used as the relatively β-cypermethrin-resistant strain (RS). Mites of both strains were reared on chickens and kept under acaricide-free conditions at 30℃, 75% relative humidity, and 12-h light/dark photoperiods. The animal experiments were approved by the Institutional Animal Care and Use Committee of Hebei Agricultural University (approval no. 2021048).

Carbaryl (purity 98%) and β-cypermethrin (purity 95%) were obtained from Hubei YuanCheng Saichuang Technology Co., Ltd. (Hubei, China). The reference standards for β-cypermethrin (99.0%), carbaryl (98%), α-NA, β-NA, and Fast Blue RR salt were supplied by Aladdin Industrial Corporation (Shanghai, China). A prestained colored protein ladder was purchased from Beyotime Biological Co., Ltd. (Shanghai, China). High performance liquid chromatogram (HPLC) -grade methanol and acetonitrile were obtained from Thermo Fisher Scientific (Waltham, MA). The pMD-19T Simple Cloning Vector sourced from TaKaRa Bio (Beijing, China) and pET-28a (+) provided by Sangon Biotech Co., Ltd. (Shanghai, China) were used as the cloning vector and expression vector, respectively.

Bioassays

Bioassays were performed to determine the susceptibility of the RS to β-cypermethrin using filter paper for contact toxicity applications as previously described (Marangi et al., 2009; Wang et al., 2021). A stock of β-cypermethrin was prepared and serially diluted with acetone to generate working solutions for the RS. Twenty adult female mites were exposed to filter paper moistened with various concentrations of β-cypermethrin, whereas control papers were moistened with acetone. Mortality was assessed after 24 h. The LC₅₀ value for the RS was determined using probit analysis with SPSS v26.0 (SPSS Inc., Chicago, IL). The resistance ratio (RR) was calculated using the results for the SS strain as the factor divisor (Wang et al., 2018). Acaricide resistance levels were classified as previously described (Xia et al., 2014; Wang et al., 2021): sensitive (RR < 3.0), decreased sensitivity (3.0 ≤ RR < 5.0), low resistance (5.0 ≤ RR < 10.0), medium resistance (10.0 ≤ RR < 40.0), high resistance (40.0 ≤ RR < 160.0), and extremely resistance (RR ≥ 160.0).

Total RNA Extraction and cDNA Synthesis

Total RNA was extracted from 50 adult female mites from the SS strain using TRIzol Reagent (Tiangen Biotech Co., Ltd., China) according to the manufacturer's instructions. First-strand cDNA was synthesized from 2 µg RNA using EasyScript One-step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). The synthesized cDNA was used as the template for the PCR amplification of the full-length Deg-CarE gene.

Molecular Cloning of Deg-CarE

The full encoding sequence of Deg-CarE was obtained from the transcriptome database of D. gallinae (Huang et al., 2020). The open reading frame (ORF) of Deg-CarE was amplified via PCR using specific primers (Table 1) that were designed and synthesized by Sangon Biotech Co., Ltd. (China). Following purifcation by gel electrophoresis, the PCR products were subcloned into the pMD-19T Simple Cloning Vector and used to transform Escherichia coli DH5α competent cells. Positive clones were selected and sequenced at Sangon Biotech Co., Ltd. (Beijing, China), for confirmation.

Table 1.

Primers of the Deg-CarE gene used for PCR, qPCR and RNAi in this study.

Primer name	Sequence (5′→3′)	Application	Length (bp)
Deg-CarE-F	GCGGATCCATGTTCCGGGTTGTGAATCT	PCR	1755
Deg-CarE-R	CCAAGCTTTTAACATTTTTTTTCAGCAAACGC	PCR
qDeg-CarE-F	GATTATCGGCGACGGTCTGT	q-PCR	166
qDeg-CarE-R	CGTGTAGAACATGAGGCCGT	q-PCR
Actin-F	CCCA TGCTA TCCTGCGTCTC	q-PCR	169
Actin-R	GCCA TTTCCTGCTCAAAGTCC	q-PCR
dsDeg-CarE-1-F	GGATCCTAATACGACTCACTATAGGATGTTCCGGGTTGTGAATC	RNAi	765
dsDeg-CarE-1-R	AGCATGAAACAGACCCTTAG	RNAi
dsDeg-CarE-2-F	ATGTTCCGGGTTGTGAATC	RNAi
dsDeg-CarE-2-R	GGATCCTAATACGACTCACTATAGGAGCATGAAACAGACCCTTAG	RNAi
dsDeg-EGFP-1-F	GGATCCTAATACGACTCACTATAGGATGGTGAGCAAGGGCGAGGA	RNAi	670
dsDeg-EGFP-1-R	ACTCCAGCAGGACCATGTGATCG	RNAi
dsDeg-EGFP-2-F	ATGGTGAGCAAGGGCGAGGA	RNAi
dsDeg-EGFP-2-R	GGATCCTAATACGACTCACTATAGGACTCCAGCAGGACCATGTGATCG	RNAi

F and R are shown as forward and reverse primer, respectively. Underlined letters indicate the T7 RNA polymerase promoter.

Sequence Analyses

The predicted amino acid sequences of the full-length Deg-CarE sequence were deduced using DNAMAN 6.0.3.99. The molecular weight and theoretical isoelectric point were predicted with the ExPASy web tool (https://web.expasy.org/compute_pi/). To detect signal peptides, the SignalP5.0 server (http://www.cbs.dtu.dk/services/SignalP/) was used. Protein glycosylation was predicted using the NetNGlyc1.0 server (http://www.cbs.dtu.dk/services/NetNGlyc/). Multiple sequence alignment of the Deg-CarE amino acid sequences was compared with other known CarEs of different insects in GenBank using DNAMAN 6.0.3.99 software. A maximum likelihood phylogenetic tree was bootstrapped 1,000 times using ClustalW and viewed in MEGA 6.0. The sequences used to construct the tree were obtained from the literature (Li et al., 2023).

Enzyme Activities of CarEs in D. gallinae

A widely used method was implemented to determine CarEs activity. This method involved measuring the specific activities of crude SS and RS CarEs proteins using α-NA and β-NA as model substrates in 96-well microplates, as previously described (Pan et al., 2009). First, α-NA or β-NA were diluted from their respective 3 mM stock solutions in acetone to a working concentration of 0.3 mM. Fifty female specimens from each strain were homogenized completely in a 1.5-mL Eppendorf tube using 250 μL phosphate buffer (0.04 M, pH 7.0). The supernatant was employed as a crude enzyme source after the specimens were centrifuged for 10 min at 4°C and 12,000 × g. The reaction was performed in a final volume of 200 μL, which contained 50 μL of substrate solution (0.3 mM), 20 μL crude enzyme, and 80 μL phosphate buffer. The blank was devoid of crude enzyme. After incubation at 30°C for 10 min, the reaction was halted by adding 50 μL of a stop solution containing 2 parts 1% Fast Blue B and 5 parts 5% SDS. The color was allowed to develop for 10 min at 25 ± 1℃, and the absorbance of α- and β-NA was measured at 450 and 550 nm, respectively, using a Multiskan FC microplate photometer (Thermo Fisher Scientific). Standard curves for α-NA or β-NA were constructed, and the CarEs activity was determined based on the protein content and corresponding standard curves. Each sample was analyzed in triplicate. The protein content in the enzyme homogenate buffer was determined by the BCA assay (Solarbio Life Science, Beijing, China) using BSA as the standard.

Quantitative Real-Time PCR

To examine the DNA copy number of the Deg-CarE gene in the RS and SS strains, 50 adults from each strain were collected and genomic DNA was extracted using a TIANamp Genomic DNA Kit (Tiangen Biotech Co., Ltd.). These DNA were used as templates for quantitative real-time PCR (qRT-PCR). The standard plasmid was constructed by cloning the complete ORF of Deg-CarE from D. gallinae into the pMD-19T Simple Cloning Vector. The formula for converting plasmid mass to copy concentration is as follows:

$$copies/\mu L=C\times {10}^{-6}\times 6.02\times {10}^{23}/\left(660\times L\right)$$

where C is the plasmid concentration (μg/μL) and L is the plasmid length (bp). The standard curves were generated by a threshold cycle of serial 10-fold dilutions of plasmid templates (9.1 × 10⁸ – 9.1 copies/μL). The standard curve for Deg-CarE obtained by plotting the cycle threshold against the logarithm of copy numbers of the standard plasmid was Y =−0.4185X + 13.296 (R² = 0.9916, coefficient of correlation).

To examine the mRNA transcriptional levels of the Deg-CarE gene in the SS and RS, fifty adults from each strain were collected for total RNA extraction. To detect the effect of β-cypermethrin exposure on the expression of Deg-CarE, female SS and RS adults were treated with the LC₅₀ of β-cypermethrin for 6, 12, 24, and 36 h, respectively. Adults treated with insecticide-free acetone solution served as the control group. Then, 10 surviving females at each time point were collected and used for RNA extraction. To analyze the developmental expression patterns of Deg-CarE in D. gallinae, approximately 200 eggs, 200 larvae, 100 nymphs, and 50 adults from the SS strain were collected for total RNA extraction. Total RNA isolation and cDNA synthesis were performed as previously described.

The extracted DNA and all synthesized cDNA were used as templates for qRT-PCR using a CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA). Gene-specific primers are listed in Table 1. D. gallinae actin was used as an internal reference gene. The 20 μL reaction mixtures contained 10 μL PerfectStart Green qPCR SuperMix (TransGen Biotech), 7.2 μL distilled deionized water, 0.4 μL forward primer, 0.4 μL reverse primer, and 2 μL templates. The amplification conditions were 95°C for 3 min, followed by 40 cycles of 95°C for 5 s and 55°C for 30 s. Melting curve analysis from 60 to 95°C was used to verify the specificity of PCR product. The experiment was carried out at least in triplicate. Data were analyzed using Bio-Rad CFX Manager 3.1 (Bio-Rad, Hercules, CA). The 2^−ΔΔCt method was used to analyze the relative expression levels of the Deg-CarE gene (Livak and Schmittgen, 2001).

RNA Interference

RNA Interference (RNAi) was used to assess the effect of Deg-CarE overexpression in RS on survival following β-cypermethrin exposure because it is an effective approach for revealing the roles of CarEs genes in insects and mites. Briefly, enhanced green fluorescent protein (EGFP) and diethyl pyrocarbonate (DEPC)-treated water were used as controls. The cDNA synthesized from RS adult females and lab-preserved plasmid EGFP were used as PCR templates, respectively. The cDNA fragments of Deg-CarE and EGFP were amplified by PCR with primers containing the T7 RNA polymerase promoter (Table 1). PCR products were gel purified and then used to synthesize dsDeg-CarE and dsEGFP using the T7 RiboMAX Express RNAi System (Promega Corp., Madison, WI) following the manufacturer's instructions. After dissolving double strand (ds) RNA in DEPC-treated water to a final concentration of 3 μg/μL, the purified dsRNA was confirmed by 1% agarose gel electrophoresis, and its quantity was measured with a NanoDrop 2,000 Ultramicro Spectrophotometer (Thermo Fisher Scientific).

The dsRNA immersion method was used to silence the expression of the candidate genes, and 3 treatment groups were established: dsDeg-CarE, dsEGFP and DEPC-treated water groups. Twenty live RS females were placed in a sterile 1.5 mL microcentrifuge tube and 20 μL of dsDeg-CarE, dsEGFP, or DEPC-treated water were added. Three replicates were performed for each group. After the tubes were placed at 4°C for 24 h, live mites from 3 groups were collected and used for subsequent experiments. The Deg-CarE expression levels of living mites from the dsDeg-CarE, dsEGFP and DEPC-treated water groups after RNAi were determined using qRT-PCR to verify the gene silencing efficiency. Living mites were transferred to test cells. The LC₅₀ of the RS was used for the bioassays in this study. At 24 h postexposure, mortality was calculated to analyze the susceptibility of the treated mites from 3 groups to β-cypermethrin. If the mites did not react to stimulation with a soft brush, they were considered dead. Finally, the activity of CarEs in the treated mites from the RS was evaluated to determine whether enzyme activity changed after silencing. Three independent replicates were performed for the analysis.

Expression and Purification of Recombinant Deg-CarE

The Deg-CarE ORF with restriction sites was amplified by PCR using specific primer sequences containing restriction endonuclease recognition sites (Table 1). The purified amplicons were ligated into pET-28a (+) and transformed into E. coli BL21 (DE3) pLysS (TransGen Biotech). A final concentration of 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added to the medium to induce protein expression when the optical density at 600 nm (OD₆₀₀) of the bacterial solution was approximately 0.5–0.6. Subsequently, the bacterial suspension was collected at 24 h and lysed by ultrasonication. The protein was purified from insoluble bodies using ProteinIso Ni-NTA Resin (TransGen Biotech). The purified recombinant protein was analyzed by 10% SDS-PAGE. The resolved proteins were transferred to a polyvinylidene fluoride membrane, and immunoblotting with monoclonal antibody to His (ComWin Biotech Co., Ltd., Beijing, China) was performed to confirm the presence of the His-tagged proteins. The concentration of recombinant protein was determined by BCA assay (Solarbio Life Science, Beijing, China).

Enzymatic Activity of Recombinant Deg-CarE

Esterase activity was measured with α-NA as the substrate as previously described (Grant et al., 1989). Reactions were performed as described in Section 2.6. The substrate solution was added at a range of concentrations spanning the Km (based on preliminary assays). Finally, a microplate reader calibrated with naphthol standard curves was used to record the change in absorbance at 450 nm for 10 min to track the synthesis of naphthol. Using Hyper32 hyperbolic regression software, the initial velocity data was fitted to the Michaelis–Menten equation to determine the kinetic parameters of Vmax and Km (Tatheer et al., 2014). The effect of pH on recombinant Deg-CarE (rDeg-CarE) activity was analyzed in a series of buffers from pH 5.0 to 8.0. Furthermore, the optimal temperature for the activity of rDeg-CarE was investigated at 10, 20, 30, 40, 50, and 60℃ for 30 min.

HPLC Assay of Acaricide Hydrolysis

To elucidate the potential role of CarEs in acaricide resistance, the abilities of rDeg-CarE to metabolize β-cypermethrin and carbaryl were analyzed as previously described (Teese et al., 2013), with minor modifications. Briefly, the metabolic assay was performed in a 200 μL working solution containing 0.04 M phosphate buffer (pH 7.0), 100 μg/mL β-cypermethrin or carbaryl, and 20 μg of rDeg-CarE protein. Heat-inactivated rDeg-CarE was the negative control. An HPLC system equipped with a UV detector (Waters Co., Ltd., Milford, MA) was used to detect the quantity of acaricides. The acaricides in the samples (each 20 μL) were separated by a reverse-phase C18 column (4.6 × 250 mm, 5 μm; Waters) at 30°C using methanol/water (90:10, v/v) at a rate of 1.0 mL/min. The remaining quantities of β-cypermethrin and carbaryl were detected at 278 nm and 280 nm, respectively.

Statistical Analysis

All data were analyzed using SPSS v26.0 (SPSS Inc., Chicago, IL). The CarEs activity and transcription levels, SS and RS strain DNA copy numbers, and Deg-CarE gene expression levels after β-cypermethrin induction were analyzed by an independent sample t-test at a significance level of P < 0.05. Differences in Deg-CarE gene relative expression at different developmental stages, Deg-CarE transcription levels after RNAi, CarEs specific activity, and mortality rates were determined by one-way ANOVA, followed by Tukey's honestly significant difference (HSD) test, with significance indicated at P < 0.05.

RESULTS

Analysis of Resistance Level

Toxicity of β-cypermethrin to the CHS-1 strain of D. gallinae was determined by bioassay. As shown in Table 2, the LC₅₀ of the CHS-1 strain was 576.92 μg/cm². Compared with the SS, the CHS-1 strain exhibited 106-fold increase in resistance to β-cypermethrin. Based on the classification criteria for acaricide resistance levels described in the methods, the CHS-1 strain displayed high level of resistance to β-cypermethrin. Therefore, considering the LC₅₀ value and RR of the CHS-1 strain, this strain served as the relatively resistant β-cypermethrin strain in the investigation of the mediating role of CarEs in β-cypermethrin resistance in D. gallinae.

Table 2.

Toxicity of beta-cypermethrin to the SS and RS strains of Dermanyssus gallinae.

Strains	LC50 (95% CI) (μg/cm2)	Slope ± S.E.	Pa	χ2	RRb
SS strain (CBP-5)	5.44 (4.27-11.29)	0.36±0.13	0.82	0.40	1.00
RS strain (CHS-1)	576.92 (394.74-752.26)	0.0010±0.00010	0.99	0.27	106.05

^aChi-square testing linearity, P < 0.05.

^bRR, Resistance ratio = LC₅₀ of the RS / LC₅₀ of the SS.

Cloning and Sequence Analysis

To determine whether CarEs play a role in SP resistance in poultry red mites, Deg-CarE was identified from the transcriptome database of D. gallinae in the current study. The sequence was submitted to GenBank (accession number: OR616243). The ORF of Deg-CarE contains 1755 nucleotides encoding 584 amino acids. The predicted molecular weight and theoretical isoelectric point of this deduced protein is 64.6 kDa and 5.35, respectively. Furthermore, Deg-CarE protein was predicted to contain a signal peptide region located at positions 15 to 22 and 2 N-glycosylation sites for Asn50-Ile51-Ser52 and Asn284-Tyr285-Thr286. Sequence alignment revealed that the Deg-CarE protein sequence had highly conserved catalytic triads (Ser165-His423-Glu306), pentapeptide motifs (Gly163-X-Ser165-X-Gly167), and other enzymatically active sites (Figure 1), indicating that this protein was biologically active. Moreover, the phylogenetic analysis indicated that Deg-CarE belonged to the integument esterase clade (Figure 2).

Figure 1.

Amino acid sequence alignment of the Deg-CarE gene from Dermanyssus gallinae. The signal peptide sequences of Deg-CarE are indicated in bold and underlined. The catalytic triad residues are vertically boxed in red. The highly conserved pentapeptide residues are marked by blue square boxes. The oxyanion hole is denoted with dark arrows. The anionic site is labeled with triangles in blue. The potential N-glycosylation sites are indicated with 2 black horizontal boxes.

Figure 2.

Phylogenetic analysis of Dermanyssus gallinae carboxylesterases. The phylogenetic tree was generated using MEGA 6.0 with default settings using amino acid sequences from Drosophila melanogaster (Dm), Musca domestica (Md), and Anopheles gambiae (Ag). Bootstrap values were computed according to 1000 replicates with a cutoff of < 50%.

Enzyme Activities of Deg-CarE in D. gallinae

To further explore the potential function of CarEs in β-cypermethrin resistance of D. gallinae, the CarEs activities in the crude enzyme solution extracted from the SS and RS were determined using α-NA and β-NA as substrates. As shown in Figure 3, the RS exhibited significantly higher CarEs activity (1.21-fold for α-NA and 1.27-fold for β-NA) compared to the SS (P = 0.009) against the α-NA and β-NA substrates. Moreover, the specific activities of CarEs in both the RS and SS were significantly higher when α-NA was used as the substrate. The increased activity of CarEs observed in the RS suggests that CarEs plays an important role in acaricide resistance.

Figure 3.

Enzyme activities of carboxylesterases in the RS and SS towards α/β-naphthyl acetates. The activities of CarEs from the RS and SS strains towards α/β-naphthyl acetates were determined and are expressed as μmol/min/mg protein. * P ≤ 0.05 and ** P ≤ 0.01.

Expression Profiles of Deg-CarE

To clarify the relationship between CarEs and resistance in D. gallinae, qRT-PCR was performed to detect the expression patterns of Deg-CarE in the RS and SS. As shown in Figure 4A, the relative mRNA expression of Deg-CarE in the RS significantly increased by 2.84-fold compared to that in the SS of D. gallinae. Although the DNA copy number of Deg-CarE in the RS was slightly higher than that in the SS (1.17-fold), significant differences were not observed in the gene copy number of Deg-CarE between the RS and SS (P > 0.05). These results indicate that Deg-CarE overexpression may play an important role in β-cypermethrin resistance in D. gallinae.

Figure 4.

Expression profiles of Deg-CarE in different strains, after β-cypermethrin treatment, and during different developmental stages. (A) Relative mRNA and DNA expression quantities of the Deg-CarE gene in the SS and RS. (B and C) Induction of expression profiles of Deg-CarE gene in the SS and RS after β-cypermethrin treatment. (D) Developmental stage-dependent expression patterns of the Deg-CarE gene. Error bars represent the standard error of the calculated mean based on 3 biological replicates. Asterisks above the bars represent significant differences in gene expression levels. * P ≤ 0.05 and ** P ≤ 0.01.

Subsequently, our focus shifted to evaluating the performance of Deg-CarE when D. gallinae was exposed to β-cypermethrin. As shown in Figures 4B and 4C, the Deg-CarE gene can be induced with variable levels at different time points after exposure to β-cypermethrin at LC₅₀ doses in both the SS and RS. An obvious time-dependent induction pattern for Deg-CarE (varying from 1.35- to 9.99-fold) was detected in the RS (Figure 4B). In the SS, a similar induction pattern was observed, showing a slight increase (1.35-fold) after 6 h of treatment, followed by an significant increase (10.03-fold) after 12 h, a decrease (7.46-fold) after 24 h, and reaching its peak value (12.26-fold) after 36 h (Figure 4C).

Moreover, we examined the mRNA expression of the Deg-CarE gene at different developmental stages and observed that the Deg-CarE gene was expressed at all developmental stages of D. gallinae, albeit with significant variations among them (Figure 4D). More specifically, Deg-CarE was highly expressed in adult mites, and the value was significantly higher than that at the other 3 stages (P < 0.01). Overall, the mRNA expression levels of Deg-CarE in the larva, nymph, and adult mites were 0.15-, 4.50-, and 36.54-fold higher than those in the eggs, respectively.

Functional Analysis of Deg-CarE Using RNAi

The function of Deg-CarE in the RS of D. gallinae was investigated further using RNAi gene silencing. The results of qRT-PCR analysis showed a significantly reduced transcript level of Deg-CarE in the dsDeg-CarE-treated group compared to that in other groups. As shown in Figure 5A, the silencing efficiency was 68% at 24 h compared to that of the dsEGFP-immersed control, indicating an effective knockdown of Deg-CarE by RNAi. Moreover, significant differences were not observed in the expression levels between the DEPC-treated water and dsEGFP-treated groups. We also determined the specific activity of crude CarEs proteins in D. gallinae after RNAi (Figure 5B). Compared to that of the dsEGFP-treated group, the CarEs activity of females immersed in dsDeg-CarE showed a significant decrease (37.62% at 24 h). In contrast, significant changes in enzyme activity were not observed between the DEPC-treated water and dsEGFP-treated groups.

Figure 5.

RNA interference of Deg-CarE in the RS of D. gallinae. (A) Relative expression of Deg-CarE in the RS strain after RNAi. (B) Mortality determined upon β-cypermethrin treatment after RNAi. (C) Carboxylesterase activity determined after RNAi. DEPC-treated water and the dsEGFP group were controls. Error bars represent the SE of the calculated mean based on 3 biological replicates. Asterisks above the bars represent significant differences in gene expression levels. *P < 0.05.

Furthermore, our results demonstrated that the dsDeg-CarE-treated mites exhibited significantly higher susceptibility to β-cypermethrin than the dsEGFP-treated mites (P = 0.011), with 71.46% and 50.56% mortalities observed in the dsDeg-CarE- and dsEGFP-treated mites at 24 h after exposure to β-cypermethrin, respectively (Figure 5C). Furthermore, the mortality of D. gallinae did not differ significantly between the DEPC-treated water and dsEGFP-treated groups (P = 0.595). Collectively, these results imply that knockdown of Deg-CarE in D. gallinae led to a decrease in CarEs activity and an increase in sensitivity to β-cypermethrin.

Expression and Identification of Recombinant Deg-CarE

To obtain the recombinant Deg-CarE protein, the 1755 bp amplified Deg-CarE PCR product was verified as compatible with the predicted sequences of the Deg-CarE gene fragment by DNA sequencing. Deg-CarE was expressed in E. coli BL21 (DE3) pLysS using pET-28a as the vector. Upon induction with IPTG, SDS-PAGE revealed the expression of an unknown protein with an approximate molecular weight of 64.6 kDa (Figure 6A). After purification, a single protein band with an apparent molecular weight of 64.6 kDa was resolved by SDS-PAGE (Figure 6B). Western blot analysis was performed with anti-His tag antibody. Only 1 band with a molecular weight of 64.6 kDa was observed (Figure 6C), and it corresponded to the band resolved by SDS-PAGE, indicating the existence of the recombinant Deg-CarE protein.

Figure 6.

SDS-PAGE and western blotting analysis of recombinant Deg-CarE. (A) SDS-PAGE of rDeg-CarE. M, protein molecular weight marker; lane 1: bacterial lysate before induction; lane 2: bacterial lysate after induction; lane 3: supernatant from bacterial lysate after induction; lane 4: precipitation of bacterial lysate after induction. (B) SDS-PAGE of purified rDeg-CarE. (C) Western blot analysis of purified rDeg-CarE. lane 1: bacterial lysate of rDeg-CarE before induction; lane 2: rDeg-CarE after purification.

Enzymatic Activity of Recombinant Deg-CarE

To better explore the biochemical properties of the rDeg-CarE, the CarEs activity of rDeg-CarE was measured and kinetic assays were performed. The kinetic parameters for α/β-NA are presented in Table 3. The purified rDeg-CarE had specific activity to α-NA of 17.15 ± 1.40 μmol/min/mg protein and that of rDeg-CarE was 14.21 ± 1.41 μmol/min/mg protein when the substrate was β-NA. These results indicate that rDeg-CarE exhibits high esterase activity toward the 2 substrates. However, rDeg-CarE showed lower activity toward substrate β-NA compared with α-NA. Notably, rDeg-CarE had high affinity toward α-NA (Km of 0.51 ± 0.13 mM) compared with that of β-NA (Km of 0.70 ± 0.22 mM). These findings indicate that the purified rDeg-CarE protein showed high esterase activity.

Table 3.

Kinetic parameters for the recombinant Deg-CarE toward α/β-naphthyl acetates.

Substrate	Specific activity (μmol/min/mg)	Vmax (μmol/min/mg)	Km (mM)
α-NA	17.15±1.40	57.97±9.97	0.51±0.13
β-NA	14.21±1.41	69.22±13.83	0.70±0.22

Every experiment was conducted in triplicate, and every test was run at least 3 times. The data was displayed as mean ± SD.

We also found that rDeg-CarE exhibits higher activity when the temperature varies between 10 and 40°C, with maximum activity observed after incubation at 40°C for 30 min (Figure 7A). Enzyme activity was monitored across pH values ranging from 5.0 to 8.0, with pH 7.5 identified as the optimal pH for rDeg-CarE (Figure 7B). These results demonstrate that activity of rDeg-CarE varies based on temperature and pH.

Figure 7.

Effect of temperature and pH on the enzymatic activity of rDeg-CarE. (A) Six temperatures (10, 20, 30, 40, 50, and 60°C) were selected for the temperature test. (B) For the pH test, the optimal pH of the enzyme activity was determined using 100 mM PBS adjusted to a pH of 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, and 8.0. The error bars show the SE of the computed mean based on 3 biological replicates.

Metabolic Activity of CarE Toward Acaricides

To assess whether recombinant Deg-CarE is capable of acaricide metabolism, the metabolic activities of rDeg-CarE against β-cypermethrin and carbaryl were tested by HPLC. Figure 8 reveals that the concentrations of β-cypermethrin in the treatment and control groups did not significantly differ, indicating that rDeg-CarE proteins did not react to β-cypermethrin. Similarly, rDeg-CarE was also unable to metabolize carbaryl. Furthermore, incubation with recombinant Deg-CarE did not result in obvious substrate depletion or novel metabolite production. The insecticide metabolism assay results suggest that recombinant Deg-CarE may not be directly involved in the detoxification of β-cypermethrin and carbaryl in D. gallinae.

Figure 8.

Metabolic activities of rDeg-CarE to β-cypermethrin and carbaryl. (A) β-cypermethrin. (B) Carbaryl. The rDeg-CarE protein inactivated by boiling was the control.

DISCUSSION

Dermanyssus gallinae is globally recognized as one of the most crucial hematophagous ectoparasites in laying hens, and its metabolic resistance to SPs presents a substantial challenge to control efforts. However, the molecular mechanisms underlying resistance management remain poorly characterized. Due to the important role of insect CarEs in the detoxification of exogenous compounds, such as SPs, the potential mechanism by which these enzymes confer SPs resistance in D. gallinae has received increased attention. In this study, we cloned the full-length cDNA of Deg-CarE from D. gallinae in China. Sequence comparisons predicted that the deduced protein contained a pentapeptide (Gly-X-Ser-X-Gly), catalytic triad (Ser-His-Glu), and other conserved motifs typically associated with detoxification (Oakeshott et al., 2010a). Deg-CarE belongs to the integument esterase clade, which is closely related to detoxification of xenobiotics penetrating the integument and the inactivation and degradation of pheromones (Oakeshott et al., 2010b). This clade is reportedly involved in the metabolism of insecticides (Li et al., 2007). Our findings suggest that Deg-CarE in D. gallinae may be one of the key genes involved in detoxification of xenobiotics, such as acaricides, hormones, and plant secondary compounds.

The formation of SP-resistant populations in many insects and mites is accompanied by an increase in the activity of CarEs (Li et al., 2007), such as in Rhipicephalus bursa (Enayati et al., 2010) and Tetranychus cinnabarinus (Ya-Ning et al., 2011). Therefore, understanding changes in the activity of detoxification enzymes is important for elucidating the mechanism of insecticide resistance. The α/β-NA substrates are commonly used as a model substrate in CarEs activity assays. For both substrates, we found that the specific activity of CarEs was significantly higher in the RS than the SS. This suggests that increased CarEs activity might contribute to the formation of β-cypermethrin resistance in D. gallinae. Moreover, CarEs showed stronger activities against α-NA than β-NA, indicating that α-NA may be the most favorable substrate. Choosing a substrate to monitor CarEs activity remains a major challenge for accurately characterizing CarEs activities, particularly for multiple isozymes (Wheelock et al., 2005). Therefore, the increased activity of CarEs in RS strain indicated that CarEs plays an important role in acaricide resistance.

In certain instances, CarE-related resistance mechanisms predominantly involve increased esterase activity due to gene amplification and upregulation, as reported in SP-resistant insects, such as M. domestica (Zhang et al., 2010), Helicoverpa armigera (Wu et al., 2011), and A glycines (Xi et al., 2015). Moreover, both constitutive over-expression and inducible expression can contribute to the upregulation of CarE genes. In our study, Deg-CarE was significantly upregulated in the RS. Schiavone et al. (2023) also reported that resistant D. gallinae constructively overexpress CarEs. These results indicate that the Deg-CarE gene played a role in acaricide resistance. Similarly, the involvement of numerous BdCarEs in Bactrocera dorsalis in insecticide resistance was demonstrated by gene upregulation (Li et al., 2023). In addition to constitutive overexpression, acaricide exposure also results in the inductive expression of CarEs genes, which is considered an important cause of insect resistance. The inductive and constitutive overexpression of CarEs in M. domestica both contribute to the enhanced detoxification of insecticides (Feng et al., 2018). In our study, exposure to β-cypermethrin induced Deg-CarE expression both in the SS and RS, and the expression level of Deg-CarE fluctuated at different times but was still high after induction. Interestingly, Deg-CarE gene induction in D. gallinae did not follow a resistance-specific pattern. Similarly, Feng et al. (2018) reported that permethrin could also induce the expression of MdaE17, MdaE16, and MdaE9 in the resistant ALHF strain, susceptible aabys strain, and wild-type CS strain in M. domestica at specific intervals of time. Apart from gene upregulation, the overproduction of CarEs has also been demonstrated by gene amplification, such as CarEs E4 or its paralog FE4 protein in Myzus persicae. Nevertheless, the DNA copy numbers of Deg-CarE in the RS and SS had no significant differences. Taken together, the elevated CarEs activity observed in the RS strain likely resulted from the increased amount of CarEs enzymes, possibly related to the constitutive overexpression of Deg-CarE, rather than gene amplification and inductive overexpression. Overexpression of Deg-CarE would enhance the detoxification system of insects and mites. Thus, the Deg-CarE gene might play an essential role in CarE-mediated resistance against β-cypermethrin in D. gallinae.

The investigation of Deg-CarE expression patterns at different developmental stages enabled us to explore their potential functions. Several studies have shown that the expression of CarEs in different insect species is highly dependent on the developmental stage (Wang et al., 2017). We observed that the Deg-CarE gene was expressed in all life stages. However, the expression level of Deg-CarE was the highest in the adult stage. In B. dorsalis, similar results were observed for the transcriptional levels of BdCarE4, BdCarE6, and BdB1 (Wang et al., 2017). The high expression level of Deg-CarE in adult stage, coupled with the species' long lifetime and extensive feeding period, suggest their important role in dietary detoxification.

RNAi technology has recently been widely employed to investigate the roles of genes encoding detoxifying enzymes in insecticide resistance in insects and mites (Shi et al., 2016). For example, knockdown of a CarE gene (PxαE8) by injection of dsRNA in Plutella xylostella (GD-2019) increased the strain's susceptibility to phoxim and β-cypermethrin (Li et al., 2021). To further understand the role of Deg-CarE in β-cypermethrin resistance, we conducted RNAi targeting the Deg-CarE gene. In our study, after Deg-CarE gene knockdown by RNAi, the mortality increased significantly (71.46%) at 24 h post-treatment with β-cypermethrin compared to that with the dsEGFP-treated group (50.56%). This suggests a significant role of Deg-CarE in insecticide resistance. Furthermore, the specific activity of crude CarEs proteins in D. gallinae after RNAi was significantly decreased (37.62% at 24 h). Zhang et al. (2013) also reported that the knockdown of CarEs in A. gossypii decreased esterase activity. Collectively, these findings support the hypothesis that β-cypermethrin resistance in D. gallinae is caused by Deg-CarE overexpression.

Heterologous expression is a widely used technique to obtain target gene products and enable in vitro functional studies of target genes, especially in enzymatic research. Several CarE genes from Bombyx mori, Nilaparvata lugens, and A. gossypii have been successfully expressed in the E. coli system in previous studies (Cui et al., 2011; Shi et al., 2016). In this study, rDeg-CarE was expressed in E. coli, and the kinetic assay results indicated that rDeg-CarE exhibited high esterase activity toward α/β-NA. Similarly, CarE 001G from H. armigera showed hydrolase activity toward α/β-NA (Bai et al., 2019). Notably, rDeg-CarE exhibited comparatively high hydrolytic activity toward α-NA, consistent with the crude enzyme activity assay results, indicating that α-NA was the most suitable substrate. Moreover, the optimal reaction temperature was approximately 40℃, and the optimal pH of the reaction system was approximately 7.5, consistent with observations for BaCEs04 from Bacillus velezensis (Huang et al., 2020a). These results indicate that low or high temperatures are detrimental to enzyme activity and that acidic or alkaline conditions adversely affect enzyme activity.

CarEs are involved in resistance development through direct hydrolysis or by sequestration, in which the pesticide is bound without being efficiently metabolized (De Rouck et al., 2023). Acaricides may serve as the substrates for CarEs and could be metabolized to the less toxic compounds. Here, we determined the hydrolase activity of recombinant Deg-CarE against β-cypermethrin using HPLC. The current study showed that rDeg-CarE failed to metabolize β-cypermethrin, possibly due to CarEs acting as an “insecticide sink,” delaying or preventing interactions between insecticides and target sites instead of directly metabolizing them (Li et al., 2007). Additionally, the metabolism of β-cypermethrin may involve the participation of other metabolic enzymes. In this scenario, after the action of other metabolic enzymes, CarEs may act on β-cypermethrin metabolites produced by other enzymes, such as cytochrome P450s. Feng and Liu (2020) reported that the metabolic efficiencies of multiple CYP450s to permethrin (approximately 40 to 45%) in mosquitoes are more efficient than that of the CarEs to permethrin in M. domestica (approximately 16 to 30%). The difference in the hydrolase activity of distinct CarEs from the same insect species, which may have distinct functions in the detoxification of different insecticides, is another potential explanation (Yan et al., 2009). In Locusta migratoria, Zhang et al. (2015) reported that LmCesA4 metabolizes deltamethrin while LmCesA5 does not. Both CarE001A and CarE001H in H. armigera are involved in β-cypermethrin hydrolysis; however, they are unable to metabolize fenvalerate (Li et al., 2020). Thus, various CarEs differ in their ability to detoxify different types of insecticides, which may be a general phenomenon across a range of insects.

CONCLUSIONS

Deg-CarE was isolated from D. gallinae, and its molecular characteristics were investigated for the first time. Elevated CarE activity and Deg-CarE gene expression were observed in a β-cypermethrin-resistant D. gallinae. Furthermore, silencing of Deg-CarE by RNAi resulted in decreased enzyme activity and increased susceptibility to β-cypermethrin in RS. The purified rDeg-CarE displayed high enzymatic activity toward α/β-NA, and clear evidence has not been obtained to support the direct metabolism of β-cypermethrin by rDeg-CarE. In conclusion, our findings provide compelling evidence that Deg-CarE contributed significantly to β-cypermethrin resistance in D. gallinae. Future studies should focus on understanding the regulatory mechanisms underlying Deg-CarE expression at both transcriptional and post-transcriptional levels.