Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2024 Mar 22;10(3):e1407. doi: 10.1002/vms3.1407

Rapid detection of major enterotoxin genes and antibiotic resistance of Staphylococcus aureus isolated from raw milk in the Yazd province, Iran

Mohamad Javad Forouzani‐Moghaddam 1, Sina Habibi 1,2, Ahmad Hosseini‐Safa 1, Khadijeh Khanaliha 3, Roya Mokarinejad 1, Fatemeh Akhoundzadeh 1, Mojgan Oshaghi 1,✉
PMCID: PMC10959825  PMID: 38519836

Abstract

Introduction

Raw milk is a nutrient‐rich food, but it may harbour harmful bacteria, such as enterotoxigenic Staphylococcus aureus (S. aureus), which can cause staphylococcal food poisoning. Antibiotic resistance of S. aureus in raw milk can increase the risk of such infections, particularly among susceptible individuals.

Objective

This study aimed to investigate the prevalence of enterotoxin genes a, d, g, i and j and the antibiotic resistance of S. aureus isolated from raw milk samples.

Methods

During a 6‐month sampling period, 60 raw milk specimens were obtained from diverse locations in Yazd province, Iran. Antibiogram profiling was conducted via the disc diffusion method. In addition, staphylococcal enterotoxin (SE) genes a, d, g, i, and j were detected through real‐time PCR analysis.

Results

Bacteriological assays confirmed the presence of S. aureus in 11 samples (18.3%). All isolates demonstrated 100% resistance to penicillin G but exhibited sensitivity to vancomycin, while resistance to other antibiotics ranged from 36.4% to 45.5%. The prevalence of enterotoxin genes in these strains showed variable distribution, with sea being the predominant SE (45.5%), followed by sed (36.4%), seg (18.2), sej and sei (9.1% each).

Conclusions

This study discovered the presence of multiple enterotoxins in S. aureus strains obtained from raw milk samples. These strains also demonstrated resistance to a variety of antibiotics. Since enterotoxigenic S. aureus is known to cause human food poisoning, monitoring food hygiene practices, especially during raw milk production, is critical.

Keywords: classical enterotoxins, enterotoxin, milk, nonclassical enterotoxins, Staphylococcus aureus

In this study culture, biochemical tests, real‐time PCR, and the Kirby‐Bauer disk diffusion method were used to identify and characterise the isolates. Enterotoxin genes and antibiotic resistance were detected in 11 (18.3%) S. aureus strains from raw milk samples. The strains had the sea, sed, seg, sei and sej genes, with the sea being the most frequent. All strains resisted penicillin G but were susceptible to vancomycin. Resistance to other antibiotics ranged from 36.4% to 45.5%.

graphic file with name VMS3-10-e1407-g004.jpg

1. INTRODUCTION

The consumption of milk and its derivatives contributes significantly to human nutrition (Smith et al., 2022). Dairy products contain abundant nutrients, creating an ideal habitat for the growth of various microorganisms (Moosavy et al., 2019; Quigley et al., 2013). Raw milk can considerably threaten public health, as it may transmit foodborne diseases (FBDs) (Hassani et al., 2022). FBDs pose a significant public health issue worldwide, as recognised by the scientific community (Organization, 2015). It is estimated that one‐third of the population in developed countries experiences FBD each year (Ameme et al., 2016).

Staphylococcus aureus (S. aureus) is a prominent contributor to FBD. It ranks third among the most critical causative agents of FBD worldwide (Adwan et al., 2005; Baeza et al., 2007; Raineri et al., 2022). Mastitis is an ailment that affects dairy cattle, causing mammary gland inflammation. It is one of the most prevalent diseases among these animals, resulting in decreased milk production and quality, compromised livestock health and substantial economic losses (Tong et al., 2015; Wang et al., 2014). Bovine mastitis constitutes a primary concern for dairy producers, with S. aureus accounting for approximately 40% of mastitis cases in certain countries (Adwan et al., 2005; Hassanzadazar et al., 2018).

Staphylococcal food poisoning (SFP) results from consuming food contaminated with staphylococcal enterotoxins (SE). These toxins are extracellular, water‐soluble proteins with similar composition and biological activity but differ in their antigenic properties (Chajęcka‐Wierzchowska et al., 2020; Dehkordi et al., 2019; Nia et al., 2016; Ono et al., 2015). These enterotoxins are classified into two categories, classical and nonclassical, encompassing 23 types (Hu & Nakane, 2014; Omwenga et al., 2019). Classical‐type enterotoxins, which include serotypes (A to E) accounting for approximately 95% of S. aureus‐induced food poisoning cases, are responsible for nausea‐induced poisonings (Ertas et al., 2010; Kortepeter, 2001; Papadopoulos et al., 2019). Nonclassical enterotoxins, known as enterotoxin‐like (G‐R and U), exhibit lower stability and do not cause nausea (Bania et al., 2006; Benkerroum, 2018; Hait et al., 2014). Heating food is insufficient to mitigate the effects of enterotoxins, as the toxins remain stable despite the death of bacteria at high temperatures (Bhatia & Zahoor, 2007; Ethelberg et al., 2010). Enterotoxin A retains its biological activity for 28 min at 121°C, and enterotoxins exhibit resistance to various environmental factors (such as low pH, freezing and dryness) and proteolytic enzymes (Hennekinne et al., 2012; Nazari et al., 2014; Omwenga et al., 2019; Zitzmann et al., 2020).

The minimum quantity of enterotoxins required to induce disease ranges between 20 and 100 nanograms, with staphylococcal poisoning symptoms manifesting within 2 to 6 h of consumption of contaminated food (Asao et al., 2003; Cenci‐Goga et al., 2003). The severity of the symptoms associated with ingesting contaminated food depends on various factors. These include the quantity of contaminated food consumed, the concentration of toxins in the food, and the individual's overall health (Cenci‐Goga et al., 2003; Grispoldi et al., 2019).

Improper antibiotic usage in both veterinary and human medicine is a common concern that can contribute to the development of multidrug‐resistant microorganisms, posing a significant public health challenge (Aslam et al., 2021; Hassani et al., 2022).

Previous studies have reported varying rates of SE genes in milk and dairy products globally. A meta‐analysis of 21 studies found a pooled SE genes prevalence of 39.31% (95% CI: 25.99–53.44%), with the highest rates for sec (16.27%), followed by sea (9.11%) and see (4.31%) (Zhang et al., 2022). The estimated average prevalence of enterotoxigenic S. aureus in Iranian foods was 53.7% (95% CI: 41.4–65.6%), with sea and seg as the most common classical and nonclassical SE types (Dehkordi et al., 2019). Among classical SE genes in Iranian dairy, sea and sed predominated at 10% and 7.5% prevalence, while seb, sec and see were absent (Khoramrooz et al., 2016). In the Havaei et al. (2015) study, the sea gene was more prevalent than seb in raw milk samples from Iran (19 isolates versus two isolates). In Iranian raw milk, sea, seb and sed were the most prominent classical SEs (Nazari et al., 2014). Among nonclassical SE, seg showed the highest frequency (41.9%), followed by sei and seh in the Oliveira et al. (2022) study. The prevalence of classical and nonclassical SE in S. aureus from milk varies geographically. Prior studies have not examined SE contamination in Yazd province's dairy. Therefore, this study aimed to determine the presence of selected classic SE genes (sea and sed) and nonclassic genes (seg, sei, and sej) and antibiotic resistance patterns in S. aureus isolated from raw milk in this region.

2. MATERIALS AND METHODS

2.1. Sample collection

Sixty raw milk samples were aseptically collected from distinct regions of Yazd province (including the cities of Yazd, Nodoushan, Ashkezar, Mehriz and Taft) from May to October 2022. All the samples intended for bacterial analysis were transported under cold chain conditions (4°C) in sterile bags to the university's laboratory.

2.2. Isolation and identification of S. aureus

One millilitre of raw milk sample was homogenised with 9 mL of Tryptic Soy Broth (TSB) containing 7.5% sodium chloride (Merck, Germany) in triplicate. The samples were then incubated at 37°C for 24 to 48 h. One loopful of enrichment broth was cultured on Baird‐Parker agar (Merck, Germany) and incubated at 37°C for 24 to 48 h. Suspected colonies were subcultured onto a blood agar plate (Conda, Spain) and incubated at 37°C for 24 h. The identification of S. aureus was conducted using several tests, including Gram stain, colony morphology, catalase, coagulase and Voges‐Proskaver (VP) tests on the suspected colonies. This study used Staphylococcus epidermidis (S. epidermidis) ATCC 12228 and S. aureus ATCC 29213 as negative and positive controls, respectively.

2.3. Antimicrobial susceptibility test

The antimicrobial susceptibility testing of the S. aureus isolates was carried out using the Kirby‐Bauer disk diffusion method on Mueller‐Hinton agar (Merck, Germany), following the Clinical Laboratory Standard Institute (Hudzicki, 2009; Humphries et al., 2021). A commercially available panel of five different antimicrobial agent disks (Padtanteb, Iran) was utilised, including penicillin (10 IU), gentamicin (10 μg), trimethoprim‐sulphamethoxazole (25 μg), tetracycline (30 μg) and vancomycin (30 μg), which were representative of the major classes of antibiotics typically used in veterinary and human medicine in Iran.

2.4. DNA extraction

Total genomic DNA was extracted from milk using the BioFact™ Genomic DNA Prep Kit (BIOFACT Co., Ltd., Republic Korea), according to the supplier's instructions. The concentration of the extracted DNA was assessed using a NanoDrop spectrophotometer (Thermo Scientific, Rockford, IL, USA). Finally, for further analysis, the samples were kept at −20°C.

2.5. Molecular detection for enterotoxin genes of S. aureus

The amplification of sea, sed, seg, sei and sej genes for the specific detection of S. aureus toxins was performed using real‐time PCR and specific primers described in Table 1. We utilised the femA primer specific to S. aureus as an internal positive control. Real‐time PCR was carried out in a final reaction volume of 20 μL containing 10 μL of master mix (ExcelTaqTM 2X Q‐PCR Master Mix, SYBR, no ROX, SMOBIO Technologies, Hsinchu City, Taiwan), 0.2 μL of each primer, 4.8 μL of distilled water and 5 μL of template DNA. DNA amplification was performed in a LightCycler® 96 machine (Roche, Switzerland) with the following conditions: initial denaturation for 5 min at 95°C, followed by 40 cycles of denaturation (95°C for 25 s), annealing (58–62°C for 25 s) and extension (72°C for 25 s). Different annealing temperatures were tested, as shown in Table 1. A final extension step (72°C for 5 min) was performed after the completion of the cycles. Finally, the real‐time amplification results were obtained using the LightCycler® 96 application and instrument software.

TABLE 1.

Primer pairs used in this study.

Gene Sequence (5′−3′) Tm PCR product (bp) References
sea F CCTTTGGAAACGGTTAAAACG 58 127 Omoe et al. (2005)
R TCTGAACCTTCCCATCAAAAAC
sed F CTAGTTTGGTAATATCTCCTTTAAACG 62 319 Omoe et al. (2005)
R TTAATGCTATATCTTATAGGGTAAACATC
seg F AAGTAGACATTTTTGGCGTTCC 58 287 Omoe et al. (2002)
R AGAACCATCAAACTCGTATAGC
sei F GGTGATATTGGTGTAGGTAAC 60 454 Omoe et al. (2002)
R ATCCATATTCTTTGCCTTTACCAG
sej F ATAGCATCAGAACTGTTGTTCCG 60 152 Omoe et al. (2005)
R CTTTCTGAATTTTACCACCAAAGG
femA F AAAAAAGCACATAACAAGCG 55 134 Mehrotra et al. (2000)
R GATAAAGAAGAAACCAGCAG
Open in a new tab

Tm: melting temperature.

2.6. Statistical analysis

The distribution of categorical variables was assessed using frequency and percentage tables. IBM SPSS software for Windows (version 22, SPSS Inc., Chicago, IL, USA) was utilised for data analysis.

3. RESULTS

The prevalence rate of S. aureus in raw milk was investigated in 60 raw milk samples, from which 11 isolates of S. aureus (18.3%) were positively identified based on the cultivation characteristics and laboratory tests indicative of the pathogen's presence. Of the studied S. aureus isolates, eight strains (13.3%) were determined to be positive for enterotoxins (both classic and nonclassic). Among these, seven strains (11.7%) were classified as classic enterotoxin carriers, while only three (5.0%) exhibited nonclassic enterotoxin production (Table 2).

TABLE 2.

The isolation rate of S. aureus, level of antibiotic resistance and distribution of the enterotoxin gene present in samples.

Variables N (%)
Total samples 60 (100)
S. aureus positive (n = 60) 11 (18.3)
Toxin positive (classical/nonclassical) (n = 6 0) 8 (13.3)
Classical toxin (n = 60) 7 (11.7)
Nonclassical toxin (n = 60) 3 (5.0)
Antibiotic resistance (n = 11)
P 11 (100)
GM 4 (36.4)
SXT 5 (45.5)
TE 4 (36.4)
VA 0 (0)
No. of enterotoxin genes (n = 11)
0 gene 3 (27.3)
1 gene 4 (36.4)
≥2 genes 4 (36.4)
≥1 gene(s) 8 (72.7)
Enterotoxin genes (n = 11)
sea 5 (45.5)
sed 4 (36.4)
seg 2 (18.2)
sei 1 (9.1)
sej 1 (9.1)
Open in a new tab

P: penicillin, GM: gentamycin, SXT: trimethoprim‐sulphamethoxazole, TE: tetracycline, VA: vancomycin.

Out of the 11 S. aureus isolated from raw milk, eight strains (72.7%) harbour one or more enterotoxin genes. In contrast, four strains (36.4%) carried a single enterotoxin gene, and three strains (27.3%) lacked any enterotoxin gene. The distribution of enterotoxin genes among the isolates revealed that sea was identified in five strains (45.5%), sed in four strains (36.4%), seg in two strains (18.2%), and sei and sej in one strain each (9.1%). Additionally, the cooccurrence of multiple enterotoxin genes, such as sea+sed, seg+sei, sed+sej and sea+sed+seg, was observed in a single strain for each combination (Table 2). The amplification curves of several genes, including FemA, sea, sed, seg, sei and sej, are depicted in Figure 1A–F. Figure 2A–F displays the melting peaks of these same genes. Positive controls and nontemplate controls are included in both figures for comparative purposes.

FIGURE 1.

FIGURE 1

Open in a new tab

Amplification curve of studied genes. A: FemA, B: sea, C: sed, D: seg, E: sei, F: sej (PC: positive control and NTC: nontemplate control).

FIGURE 2.

FIGURE 2

Open in a new tab

Melting peak of studied genes. A: FemA, B: sea, C: sed, D: seg, E: sei, F: sej (PC: positive control and NTC: nontemplate control).

This investigation observed varying antibiotic resistance patterns among S. aureus isolates. Vancomycin was effective against all isolates, with a 100% sensitivity rate. In contrast, there was a 100% resistance rate to penicillin. Resistance to other antibiotics was also noted: 45.5% for trimethoprim‐sulphamethoxazole (SXT) and 36.4% for gentamicin and tetracycline (Table 2).

Among the S. aureus isolates, resistance to antibiotics varied. Three isolates (27.3%) showed resistance to a single antibiotic. Four isolates (36.4%) were resistant to two antibiotics. Three isolates (27.3%) demonstrated resistance to three antibiotics. Only one isolate (9.1%) resisted four antibiotics (Figure 3).

FIGURE 3.

FIGURE 3

Open in a new tab

The amount of resistance to antibiotics in S. aureus isolates.

Three isolates resisted a single antimicrobial agent among the S. aureus recovered from raw milk. Among these, one strain harboured only the sed gene, while the other two lacked the enterotoxin gene. Four isolates demonstrated resistance to two antimicrobial agents, of which two strains were positive for the sea gene, one strain concomitantly carried the sed+sej genes, and one strain lacked the enterotoxin gene. Moreover, three isolates resisted three antimicrobial agents, with the sea, sea+sed and seg+sei genes in one strain each. One isolate with resistance to four antimicrobial agents simultaneously carried the sea+sed+seg genes (Table 3).

TABLE 3.

Distribution of the simultaneous presence of enterotoxin gene(s) and antibiotic resistance.

Isolate number 1 8 12 19 23 26 29 30 31 32 33
Resistant antibiotics P, GM P, GM P, GM, SXT, TE P P, SXT, TE P, GM P, SXT, TE P, SXT, TE P, SXT P P
Number of resistance (%) 2 (40) 2 (40) 4 (80) 1 (20) 3 (60) 2 (40) 3 (60) 3 (60) 2 (40) 1 (20) 1 (20)
Number of toxins 1 (20) 2 (40) 3 (60) 1 (20) 1 (20) 1 (20) 2 (40) 2 (40) 0 (0) 0 (0) 0 (0)
Toxins sea sed, sej sea, sed, seg sed sea sea sea, sed seg, sei ‐ ‐ ‐
Open in a new tab

4. DISCUSSION

Milk and its derivatives are among the most widely consumed food products worldwide. As such, any form of contamination, particularly by S. aureus, can result in human foodborne illnesses. Moreover, it can cause substantial economic losses, both in terms of milk production and medical expenses. In this study, we analysed 60 raw milk samples to isolate S. aureus, resulting in 11 samples (18.3%) being positive for S. aureus. Comparative investigations have previously reported S. aureus isolation rates ranging from 6.83% to 52% (Cenci‐Goga et al., 2003; Johler et al., 2018; Kou et al., 2021; Liu et al., 2017; Modaresi et al., 2022; Zhao et al., 2021). In a study conducted by Johler et al. (2018), they systematically collected 276 samples at various stages of raw milk production and processing in Italy, including raw milk, cheese whey, curd, brine, curd drying and finished cheese. They found a notable prevalence of S. aureus, with 36.25% of the samples testing positive for this pathogenic microorganism. Additionally, their investigation revealed that 19% of the raw milk samples showed clear evidence of S. aureus colonisation. A separate study by Modaresi et al. (2022) observed a significant contamination rate of 8.12% of S. aureus in the sampled raw milk substrates, consistent with the earlier findings. These variations are mainly attributable to differences in animal husbandry practices, milking techniques, and surrounding sanitary conditions (Umaru et al., 2016), all of which can lead to end‐product contamination. Therefore, it is essential to maintain standard hygienic conditions throughout milk collection, production, transportation, and distribution while implementing effective control and monitoring programs.

Of the isolated S. aureus, eight strains (72.7%) were identified as enterotoxigenic. Previous studies from different parts of the world have reported enterotoxigenic S. aureus isolation rates ranging from 29% to 54% (Cardoso et al., 1999; Cenci‐Goga et al., 2003; Kenny et al., 1993; Matsunaga et al., 1993; Riva et al., 2015; Stephan et al., 1999), while Aarestrup et al. (1995) and Wang et al. (2009) did not detect any enterotoxigenic S. aureus isolates among 160 isolates from bovine mastitis milk. Different enterotoxin genes can be attributed to isolation variations and sources (Hamidi et al., 2015; Valizadeh & Amini, 2016).

The current study discovered the presence of classical enterotoxins A (45.5%) and D (36.4%). In this investigation, the most common enterotoxin found in S. aureus‐positive samples was enterotoxin A. Several reports have indicated the presence of enterotoxins A and D genes, consistent with our findings, including those by Wang et al. (2009) and Khoramrooz et al. (2016). In previous investigations, the A and D genes have been documented to be present in 10–40% (Fooladi et al., 2010; Khoramrooz et al., 2016; Nazari et al., 2014; Xing et al., 2016) and 2.5–35% of cases (Havaei et al., 2015; Nazari et al., 2014; Rahimi & Alian, 2013; Song et al., 2015; Tarekgne et al., 2016), respectively, indicating the incidence of the A and D enterotoxin genes in our study was underestimated.

Our findings are at odds with those of Cenci‐Goga et al. (2003) and Karahan et al. (2009), who detected no isolates for sea and sed, respectively, and other studies (Ahari et al., 2009; Fooladi et al., 2010; Saadat et al., 2014). In contrast, 36.4% of our strains were positive for the sed gene, higher than the values reported in other studies (Karahan et al., 2009; Khoramrooz et al., 2016; Peles et al., 2007; Rall et al., 2008). Several researchers have noted that S. aureus isolates derived from bovine or ovine dairy products exhibit elevated levels of sec and sed (Arfatahery et al., 2016; Atanassova et al., 2001; Fooladi et al., 2010; Merz et al., 2016). For example, in the study by Papadopoulos et al. (2019), the prevalent gene identified in milk samples was the enterotoxin‐encoding gene, sec.

The seg gene was detected in 18.2% of the S. aureus strains during this investigation. In comparison, the sei and sej genes were found in 9.1% of the strains, indicating the prevalence of nonclassical enterotoxins. Similar to our results, previous studies by Hoseiyni et al. (2015) and Normanno et al. (2007) reported seg as the most commonly found nonclassical enterotoxin in milk. In contrast, Rall et al. (2008) identified the sei and sej genes at 17.54% and 7.7%, respectively, and Zschöck et al. (2005) reported a higher detection rate of 61% and 37.7%, respectively. However, the study by Ahmady and Kazemi (2013) did not identify any isolates with the sej, which differs from our findings. It has been noted through observation that the enterotoxins seg and sei tend to cooccur (Alibayov et al., 2014). In our current investigation, one sample presented both enterotoxins above. The findings of this study are consistent with those of Macori et al. (2017), who reported the cooccurrence of the seg and sei genes in 8.9% of their samples. Additionally, in the research by Johler et al. (2018), the seg and sei genes were consistently found together and were never identified independently from other genes, whereas in another study (Mashouf et al., 2015), they were detected separately.

In concurrence with previous works by Mashouf et al. (2015) and Wu et al. (2010), our present study also demonstrated a higher prevalence of classical enterotoxins (63.6%) compared to nonclassical variants (27.3%) in S. aureus strains. The classical enterotoxin sea has been identified as the primary causative agent of foodborne illness, and our study revealed its highest prevalence among the classical enterotoxins (45.5%). Meanwhile, the nonclassical enterotoxin seg displayed the highest prevalence among its counterparts (18.2%). Notably, Fursova et al. (2018) reported the isolation of sea and seg in more significant proportions from mastitis. In contrast, some authors have suggested that sec and sed are the most commonly produced enterotoxins by S. aureus in cow or sheep dairy products (Cenci‐Goga et al., 2003; Vitale et al., 2015). These variations could likely be attributed to geographical differences (Zhao et al., 2021). One strain from our study contained classical enterotoxins (sea and sed) and nonclassical enterotoxin (seg).

The main threat to the safety of milk and dairy products is the presence of pathogenic microorganisms in the manufacturing process. In a study by Kukhtyn et al. to determine the prevalence of S. aureus in milk and dairy products produced in the western regions of Ukraine, the researchers identified saprophytic staphylococci in a range of 83–97% of the milk and dairy samples. S. aureus was less frequently identified and was present in approximately 62.8% of sour cream samples, 35.5% of milk samples, and 23.0% of cottage cheese samples. Furthermore, in 40.0% of cases, S. aureus produced enterotoxin type A, a causative agent of foodborne toxaemia (Kukhtyn et al., 2017).

The rise of drug‐resistant S. aureus poses a significant public health challenge. Antibiotics have been the traditional treatment for mastitis. However, their effectiveness is diminishing due to the increasing prevalence of drug‐resistant S. aureus (Gomes & Henriques, 2016). Our investigation revealed that all S. aureus isolates (100%) were resistant to at least one antibiotic, consistent with other studies (Kalayu et al., 2020; Liu et al., 2017; Ren et al., 2020). However, when compared to countries such as Italy (39.4 %) and Poland (28.3 %), the rate of resistance to a single antibiotic is higher (Giacinti et al., 2017; Rola et al., 2016). Among our isolates, three (27.3%) exhibited resistance to a single antibiotic, four (36.4%) were resistant to two antibiotics, and four (36.4%) were considered multidrug‐resistant (MDR) isolates (≥3 antibiotic‐resistant). In a study by Jamali et al. in the Mazandaran province of Iran, 248 S. aureus isolates were identified from milk. Among these, 107 (43.95%), 95 (38.75%) and 32 (11.75%) samples displayed resistance to one, two and more than two antibiotics, respectively. Furthermore, 4.3% of the isolates were sensitive to all tested antimicrobial agents (Jamali et al., 2015). Numerous studies have demonstrated that multidrug resistance in S. aureus is rising (Albuquerque et al., 2007; Waters et al., 2011).

Our investigation revealed that all S. aureus isolates exhibited resistance to penicillin (100%), a finding that corroborates previous reports (Feng et al., 2016; Jamali et al., 2014; Kalayu et al., 2020; Qu et al., 2019). The high incidence of penicillin resistance is ascribed to the prevalent use of antibiotics, notably beta‐lactams, in managing bovine mastitis (Aslantaş & Demir, 2016; Riva et al., 2015). Penicillin is also the preferred therapy for S. aureus treatment (Thongratsakul et al., 2020), and recent reports indicate an increase in penicillin resistance in various countries (Aslantaş & Demir, 2016; Jahan et al., 2015), with resistance rates ranging between 7.7% and 94.3% (Li et al., 2015; Mcmillan et al., 2016; Riva et al., 2015; Wang et al., 2018; Zhao et al., 2021). Therefore, penicillin must be administered judiciously for S. aureus‐induced mastitis (Kou et al., 2021). However, in contrast to our findings, other studies (Oncel et al., 2004; Paludi et al., 2011; Serieys & Gicquel‐Bruneau, 2005) have reported a low rate of penicillin resistance. No vancomycin‐resistant isolates were detected in the present study, which is consistent with numerous investigations (Ateba et al., 2010; Farzana et al., 2004; Gundogan et al., 2005; Gündoğan et al., 2006; Kirkan et al., 2005; Lee, 2003; Pesavento et al., 2007) and could be due to the infrequent use of vancomycin in veterinary medicine (Pace & Yang, 2006).

In the present study, gentamicin and tetracycline resistance prevalence was 36.4% each, while trimethoprim‐sulphamethoxazole resistance was 45.5%. These findings indicate a higher resistance to gentamicin and lower resistance to tetracycline compared to the results reported by Jamali et al. (2015); moreover, there was complete discordance in trimethoprim‐sulphamethoxazole resistance. In their study, all S. aureus isolates were sensitive to this antibiotic (Jamali et al., 2015). Similarly, Kalayu et al. (2020) reported tetracycline and trimethoprim‐sulphamethoxazole resistance rates of 35.4% and 10.4%, respectively, consistent with and lower than the results of the present study.

Antibiotic‐resistant S. aureus strains in dairy products, mainly raw milk, pose a significant public health threat (Titouche et al., 2019). The indiscriminate use of antibiotics in livestock farming is considered a substantial contributor to this concern. Weak hygiene practices within the livestock industry, including the use of contaminated equipment and tools and nonadherence to sanitary principles by workers, can exacerbate the proliferation of drug‐resistant strains and the spread of foodborne illnesses (Ghimpețeanu et al., 2022; Hailu et al., 2021). This poses a substantial risk to vulnerable members of the community. To mitigate such health risks, the rigorous and continuous implementation of screening programs to identify individuals and equipment carrying these microbes in producing and processing milk and food distribution can play a pivotal role in reducing these health hazards.

In our study, a strain carrying classical and nonclassical enterotoxin genes exhibited the highest antibiotic resistance (80%) to four antibiotics. Additionally, strains harbouring the enterotoxin gene resisted one to three antibiotics. The present study revealed that among the strains that exhibited resistance to only one antibiotic, there was either a lack of the enterotoxin gene or the gene carried only the sed variant. Furthermore, our findings indicate that the prevalence of enterotoxin genes is higher in S. aureus strains that exhibit resistance to multiple antibiotics. Notably, the simultaneous presence of various enterotoxins was more frequently observed in strains resistant to three or four antibiotics. Our results suggest that their pathogenicity is amplified when S. aureus strains exhibit antibiotic resistance and enterotoxin production. This poses treatment challenges in mastitis and heightens the risk of enterotoxigenic S. aureus poisoning.

Contamination of raw milk with antibiotic‐resistant and enterotoxigenic S. aureus poses a significant health risk. Future improvements in detection technologies for well‐characterised SE genes could incorporate more sensitive and specific molecular methods, like PCR‐based assays, to identify and quantify these genes precisely across various sample types. Applying microbial enrichment techniques and targeted DNA extraction methods can reduce host DNA and better recover reads from specific populations, improving the detection of SE genes. Milk filters can serve as valuable tools for characterising the microbiome and resistome in bulk tank milk and detecting foodborne pathogens (Rubiola et al., 2022). Next‐generation sequencing technologies like whole metagenome shotgun (WMS) can comprehensively analyse SE genes and resistomes in various niches, including food and food‐associated environments, surmounting the limitations of traditional culture‐dependent methods. This allows the detection of both known and novel SE gene variants. Both reads‐based and assembly‐based approaches enable WMS to resolve resistomes comprehensively, identifying antimicrobial resistance genes from low‐abundance bacteria and elucidating genomic contexts more effectively (Liu et al., 2020; Rubiola et al., 2022; Warder et al., 2021). Full‐length 16S rRNA gene metabarcoding by third‐generation sequencing cost‐effectively profiles the most abundant taxa with practicality. Full‐length 16S rRNA gene metabarcoding appropriately identifies predominant microorganisms, while WMS sequencing demonstrates superior capacity for taxonomically detecting low‐abundance microorganisms and functionally examining microbial communities (Liu et al., 2020; Rubiola et al., 2022; Warder et al., 2021). Advancing bioinformatic tools and analytical algorithms is crucial for accurately identifying and characterising SE genes within the complex metagenomic datasets produced by high‐throughput sequencing (Liu et al., 2020). Integrating these advanced technologies into routine microbiology testing could enhance the detection and tracing of potential foodborne pathogens and antimicrobial resistance determinants, including SE genes, across the food production chain.

Given the traditional production of dairy products from raw milk in Yazd province, it is imperative to implement continuous monitoring programs, stringent control measures and intensified disinfection procedures spanning from dairy farms to distribution. Furthermore, disseminating education emphasising the importance of adhering to sanitary protocols among personnel involved in the food supply chain is pivotal. This proactive measure can effectively curtail the proliferation of S. aureus in milk and dairy products, mitigating the potential risk associated with strains harbouring enterotoxin genes and displaying microbial resistance for consumers.

5. CONCLUSIONS

Based on empirical evidence, the significant prevalence of enterotoxin and antibiotic resistance among the isolates studied necessitates regular monitoring throughout all stages of milk production, from cattle farms to distribution centres, with the explicit aim of preventing the spread of S. aureus in commonly consumed food products such as milk. Also, ongoing research should focus on improving the speed, sensitivity, quantification and portability of detection methods for SE. Several emerging technologies, including WMS and full‐length 16S rRNA gene metabarcoding, promise to enhance SE genes detection. Together, these novel techniques could facilitate improved control of SE across the food production chain.

AUTHOR CONTRIBUTIONS

Mohamad Javad Forouzani‐Moghaddam: Formal analysis; investigation; methodology; writing – original draft. Sina Habibi: Conceptualisation; formal analysis; investigation; methodology; software; validation; visualisation; writing – original draft; writing – review & editing. Ahmad Hosseini‐Safa: Conceptualisation; formal analysis; investigation; methodology; software; validation; visualisation; writing – original draft; writing – review & editing. Khadijeh Khanaliha: Conceptualisation; methodology; project administration; writing – original draft. Roya Mokarinejad: Formal analysis; investigation; methodology. Fatemeh Akhoundzadeh: Formal analysis; investigation; methodology. Mojgan Oshaghi: Conceptualisation; formal analysis; investigation; methodology; project administration; software; supervision; validation; visualisation; writing – original draft.

CONFLICT OF INTEREST STATEMENT

There is no conflict of interest.

ETHICS STATEMENT

This study is experimental research approved with an Ethical code number of ‘IR.IUMS.REC.1400.539’ in Iran University of Medical Sciences, Tehran, Iran.

ACKNOWLEDGEMENTS

This research study has been supported financially by the Research Council of Iran University of Medical Sciences, Tehran, Iran, in 2022.

Forouzani‐Moghaddam, M. J. , Habibi, S. , Hosseini‐Safa, A. , Khanaliha, K. , Mokarinejad, R. , Akhoundzadeh, F. , & Oshaghi, M. (2024). Rapid detection of major enterotoxin genes and antibiotic resistance of Staphylococcus aureus isolated from raw milk in the Yazd province, Iran. Veterinary Medicine and Science, 10, e1407. 10.1002/vms3.1407

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Aarestrup, F. M. , Andersen, J. K. , & Jensen, N. E. (1995). Lack of staphylococcal enterotoxin production among strains of Staphylococcus aureus from bovine mastitis in Denmark. Acta Veterinaria Scandinavica, 36, 273–275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Adwan, G. M. , Abu‐Shanab, B. , & Adwan, K. (2005). Enterotoxigenic Staphylococcus aureus in raw milk in the North of Palestine. Turkish Journal of Biology, 29(4), 229–232. [Google Scholar]
  3. Ahari, H. , Shahbazzad, D. , & Misaghi, A. (2009). Selective amplification of SEA, SEB and SEC genes by multiplex PCR for rapid detection of Staphylococcus aureus. Pakistan Journal of Nutrition, 8(8), 1224–1228. [Google Scholar]
  4. Ahmady, M. , & Kazemi, S. (2013). Detection of the enterotoxigenic genes (sei, sej) in Staphylococcus aureus isolates from bovine mastitis milk in the West Azerbaijan of Iran. Comparative Clinical Pathology, 22(4), 649–654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Albuquerque, W. F. , Macrae, A. , Sousa, O. V. , Vieira, G. H. F. , & Vieira, R. (2007). Multiple drug resistant Staphylococcus aureus strains isolated from a fish market and from fish handlers. Brazilian Journal of Microbiology, 38, 131–134. [Google Scholar]
  6. Alibayov, B. , Zdeňková, K. , Purkrtová, S. , Demnerová, K. , & Karpíšková, R. (2014). Detection of some phenotypic and genotypic characteristics of Staphylococcus aureus isolated from food items in the Czech Republic. Annals of Microbiology, 64, 1587–1596. [Google Scholar]
  7. Ameme, D. K. , Abdulai, M. , Adjei, E. Y. , Afari, E. A. , Nyarko, K. M. , Asante, D. , Kye‐Duodu, G. , Abbas, M. , Sackey, S. , & & Wurapa, F. (2016). Foodborne disease outbreak in a resource‐limited setting: a tale of missed opportunities and implications for response. Pan African Medical Journal, 23(1), 69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Arfatahery, N. , Davoodabadi, A. , & Abedimohtasab, T. (2016). Characterization of toxin genes and antimicrobial susceptibility of Staphylococcus aureus isolates in fishery products in Iran. Scientific Reports, 6(1), 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Asao, T. , Kumeda, Y. , Kawai, T. , Shibata, T. , Oda, H. , Haruki, K. , Nakazawa, H. , & Kozaki, S. (2003). An extensive outbreak of staphylococcal food poisoning due to low‐fat milk in Japan: estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiology and Infection, 130(1), 33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Aslam, B. , Khurshid, M. , Arshad, M. I. , Muzammil, S. , Rasool, M. , Yasmeen, N. , Shah, T. , Chaudhry, T. H. , Rasool, M. H. , Shahid, A. , Xueshan, X. , & Baloch, Z. (2021). Antibiotic resistance: one health one world outlook. Frontiers in Cellular and Infection Microbiology, 11, 771510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Aslantaş, Ö. , & Demir, C. (2016). Investigation of the antibiotic resistance and biofilm‐forming ability of Staphylococcus aureus from subclinical bovine mastitis cases. Journal of Dairy Science, 99(11), 8607–8613. [DOI] [PubMed] [Google Scholar]
  12. Atanassova, V. , Meindl, A. , & Ring, C. (2001). Prevalence of Staphylococcus aureus and staphylococcal enterotoxins in raw pork and uncooked smoked ham – A comparison of classical culturing detection and RFLP‐PCR. International Journal of Food Microbiology, 68(1‐2), 105–113. [DOI] [PubMed] [Google Scholar]
  13. Ateba, C. N. , Mbewe, M. , Moneoang, M. S. , & Bezuidenhout, C. C. (2010). Antibiotic‐resistant Staphylococcus aureus isolated from milk in the Mafikeng Area, North West province, South Africa. South African Journal of Science, 106(11), 1–6. [Google Scholar]
  14. Baeza, R. , Rössler, C. E. , Mielnicki, D. M. , Zamora, M. C. , & Chirife, J. (2007). Simplified prediction of Staphylococcus aureus growth in a cooked meat product exposed to changing environmental temperatures in warm climates. Revista Argentina De Microbiología, 39(4), 237–242. [PubMed] [Google Scholar]
  15. Bania, J. , Dabrowska, A. , Bystron, J. , Korzekwa, K. , Chrzanowska, J. , & Molenda, J. (2006). Distribution of newly described enterotoxin‐like genes in Staphylococcus aureus from food. International Journal of Food Microbiology, 108(1), 36–41. [DOI] [PubMed] [Google Scholar]
  16. Benkerroum, N. (2018). Staphylococcal enterotoxins and enterotoxin‐like toxins with special reference to dairy products: An overview. Critical Reviews in Food Science and Nutrition, 58(12), 1943–1970. [DOI] [PubMed] [Google Scholar]
  17. Bhatia, A. , & Zahoor, S. (2007). Staphylococcus aureus enterotoxins: a review. Journal of Clinical and Diagnostic Research, 1(3), 188–197. [Google Scholar]
  18. Cardoso, H. F. T. , Silva, N. , Sena, M. J. , & Carmo, L. S. (1999). Production of enterotoxins and toxic shock syndrome toxin by Staphylococcus aureus isolated from bovine mastitis in Brazil. Letters in Applied Microbiology, 29(5), 347–349. [DOI] [PubMed] [Google Scholar]
  19. Cenci‐Goga, B. T. , Karama, M. , Rossitto, P. V. , Morgante, R. A. , & Cullor, J. S. (2003). Enterotoxin production by Staphylococcus aureus isolated from mastitic cows. Journal of Food Protection, 66(9), 1693–1696. [DOI] [PubMed] [Google Scholar]
  20. Chajęcka‐Wierzchowska, W. , Gajewska, J. , Wiśniewski, P. , & Zadernowska, A. (2020). Enterotoxigenic potential of coagulase‐negative staphylococci from ready‐to‐eat food. Pathogens, 9(9), 734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Dehkordi, M. K. , Shamsabadi, M. G. , & Banimehdi, P. (2019). The occurrence of Staphylococcus aureus, enterotoxigenic and methicillin‐resistant strains in Iranian food resources: A systematic review and meta‐analysis. Annali di Igiene, Medicina Preventiva e di Comunita, 31(4), 263–278. [DOI] [PubMed] [Google Scholar]
  22. Dehkordi, M. K. , Shamsabadi, M. G. , & Banimehdi, P. (2019). The occurrence of Staphylococcus aureus, enterotoxigenic and methicillin‐resistant strains in Iranian food resources: A systematic review and meta‐analysis. Annali di Igiene, 31(3), 263–278. [DOI] [PubMed] [Google Scholar]
  23. Ertas, N. , Gonulalan, Z. , Yildirim, Y. , & Kum, E. (2010). Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique. International Journal of Food Microbiology, 142(1‐2), 74–77. [DOI] [PubMed] [Google Scholar]
  24. Ethelberg, S. , Lisby, M. , Böttiger, B. , Schultz, A. C. , Villif, A. , Jensen, T. , Olsen, K. E. , Scheutz, F. , Kjelsø, C. , & Muller, L. (2010). Outbreaks of gastroenteritis linked to lettuce, Denmark, January 2010. Eurosurveillance, 15(6), 19484. [PubMed] [Google Scholar]
  25. Farzana, K. , Shah, S. N. H. , & Jabeen, F. (2004). Antibiotic resistance pattern against various isolates of Staphylococcus aureus from raw milk samples. Journal of Research (Science), 15(2), 145–151. [Google Scholar]
  26. Feng, Y. , Wang, Q. , Wang, X.‐R. , Wang, L. , Li, X.‐P. , Luo, J.‐Y. , Zhang, S.‐D. , & Li, H.‐S. (2016). Genetic characterization of antimicrobial resistance in Staphylococcus aureus isolated from bovine mastitis cases in Northwest China. Journal of Integrative Agriculture, 15(12), 2842–2847. [Google Scholar]
  27. Fooladi, A. I. , Tavakoli, H. , & Naderi, A. (2010). Detection of enterotoxigenic Staphylococcus aureus isolates in domestic dairy products. Iranian Journal of Microbiology, 2(3), 137. [PMC free article] [PubMed] [Google Scholar]
  28. Fursova, K. K. , Shchannikova, M. P. , Loskutova, I. V. , Shepelyakovskaya, A. O. , Laman, A. G. , Boutanaev, A. M. , Sokolov, S. L. , Artem'eva, O. A. , Nikanova, D. A. , Zinovieva, N. A. , & Brovko, F. A. (2018). Exotoxin diversity of Staphylococcus aureus isolated from milk of cows with subclinical mastitis in Central Russia. Journal of dairy science, 101(5), 4325–4331. [DOI] [PubMed] [Google Scholar]
  29. Ghimpețeanu, O. M. , Pogurschi, E. N. , Popa, D. C. , Dragomir, N. , Drăgotoiu, T. , Mihai, O. D. , & Petcu, C. D. (2022). Antibiotic use in livestock and residues in food – A public health threat: A review. Foods, 11(10), 1430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Giacinti, G. , Carfora, V. , Caprioli, A. , Sagrafoli, D. , Marri, N. , Giangolini, G. , Amoruso, R. , Iurescia, M. , Stravino, F. , Dottarelli, S. , Feltrin, F. , Franco, A. , Amatiste, S. , & Battisti, A. (2017). Prevalence and characterization of methicillin‐resistant Staphylococcus aureus carrying mecA or mecC and methicillin‐susceptible Staphylococcus aureus in dairy sheep farms in central Italy. Journal of Dairy Science, 100(10), 7857–7863. [DOI] [PubMed] [Google Scholar]
  31. Gomes, F. , & Henriques, M. (2016). Control of bovine mastitis: old and recent therapeutic approaches. Current Microbiology, 72, 377–382. [DOI] [PubMed] [Google Scholar]
  32. Grispoldi, L. , Massetti, L. , Sechi, P. , Iulietto, M. F. , Ceccarelli, M. , Karama, M. , Popescu, P. A. , Pandolfi, F. , & Cenci‐Goga, B. T. (2019). Characterization of enterotoxin‐producing Staphylococcus aureus isolated from mastitic cows. Journal of Dairy Science, 102(2), 1059–1065. [DOI] [PubMed] [Google Scholar]
  33. Gündoğan, N. , Citak, S. , & Turan, E. (2006). Slime production, DNase activity and antibiotic resistance of Staphylococcus aureus isolated from raw milk, pasteurised milk and ice cream samples. Food Control, 17(5), 389–392. [Google Scholar]
  34. Gundogan, N. , Citak, S. , Yucel, N. , & Devren, A. (2005). A note on the incidence and antibiotic resistance of Staphylococcus aureus isolated from meat and chicken samples. Meat Science, 69(4), 807–810. [DOI] [PubMed] [Google Scholar]
  35. Hailu, W. , Helmy, Y. A. , Carney‐Knisely, G. , Kauffman, M. , Fraga, D. , & Rajashekara, G. (2021). Prevalence and antimicrobial resistance profiles of foodborne pathogens isolated from dairy cattle and poultry manure amended farms in northeastern Ohio, the United States. Antibiotics, 10(12), 1450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Hait, J. M. , Tallent, S. M. , & Bennett, R. W. (2014). Screening, detection, and serotyping methods for toxin genes and enterotoxins in Staphylococcus strains. Journal of AOAC International, 97(4), 1078–1083. [DOI] [PubMed] [Google Scholar]
  37. Hamidi, R. M. , Hosseinzadeh, S. , Shekarforoush, S. S. , Poormontaseri, M. , & Derakhshandeh, A. (2015). Association between the enterotoxin production and presence of Coa, Nuc genes among Staphylococcus aureus isolated from various sources, in Shiraz. Iranian Journal of Veterinary Research, 16(4), 381. [PMC free article] [PubMed] [Google Scholar]
  38. Hassani, S. , Moosavy, M.‐H. , Gharajalar, S. N. , Khatibi, S. A. , Hajibemani, A. , & Barabadi, Z. (2022). High prevalence of antibiotic resistance in pathogenic foodborne bacteria isolated from bovine milk. Scientific Reports, 12(1), 3878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Hassanzadazar, H. , Taami, B. , Abbasi, Z. , & Aminzare, M. (2018). Microbial contamination of cream filled pastries supplied in confectioneries of Zanjan, Iran. Journal of Nutrition, Fasting and Health, 6(1), 30–34. (Special issue on Food Safety). [Google Scholar]
  40. Havaei, S. A. , Assadbeigi, B. , Esfahani, B. N. , Hoseini, N. S. , Rezaei, N. , & Havaei, S. R. (2015). Detection of mecA and enterotoxin genes in Staphylococcus aureus isolates associated with bovine mastitis and characterization of Staphylococcal cassette chromosome mec (SCCmec) in MRSA strains. Iranian Journal of Microbiology, 7(3), 161. [PMC free article] [PubMed] [Google Scholar]
  41. Hennekinne, J.‐A. , De Buyser, M.‐L. , & Dragacci, S. (2012). Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiology Reviews, 36(4), 815–836. [DOI] [PubMed] [Google Scholar]
  42. Hoseiyni, S. M. , Arabestani, M. , Mahmoodi, H. , & Farhangara, E. (2015). Prevalence of G, H, I, J Enterotoxin genes and antibacterial susceptibility pattern in staphylococcus aureus strains isolated from different foods. Journal of Mazandaran University of Medical Sciences, 25(123), 1–10. [Google Scholar]
  43. Hu, D.‐L. , & Nakane, A. (2014). Mechanisms of staphylococcal enterotoxin‐induced emesis. European Journal of Pharmacology, 722, 95–107. [DOI] [PubMed] [Google Scholar]
  44. Hudzicki, J. (2009). Kirby‐Bauer disk diffusion susceptibility test protocol. American Society for Microbiology, 15, 55–63. [Google Scholar]
  45. Humphries, R. , Bobenchik, A. M. , Hindler, J. A. , & Schuetz, A. N. (2021). Overview of changes to the clinical and laboratory standards institute performance standards for antimicrobial susceptibility testing, M100. Journal of Clinical Microbiology, 59(12), e00213–00221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Jahan, M. , Rahman, M., Parvej, S., Chowdhury, S.Z.H, Haque, E., Talukder, A.K., & Ahmed, S. (2015). Isolation and characterization of Staphylococcus aureus from raw cow milk in Bangladesh. Journal of Advanced Veterinary and Animal Research, 2, 49‐55.
  47. Jamali, H. , Paydar, M. , Radmehr, B. , Ismail, S. , & Dadrasnia, A. (2015). Prevalence and antimicrobial resistance of Staphylococcus aureus isolated from raw milk and dairy products. Food Control, 54, 383–388. [Google Scholar]
  48. Jamali, H. , Radmehr, B. , & Ismail, S. (2014). Prevalence and antibiotic resistance of Staphylococcus aureus isolated from bovine clinical mastitis. Journal of Dairy Science, 97(4), 2226–2230. [DOI] [PubMed] [Google Scholar]
  49. Johler, S. , Macori, G. , Bellio, A. , Acutis, P. L. , Gallina, S. , & Decastelli, L. (2018). Characterization of Staphylococcus aureus isolated along the raw milk cheese production process in artisan dairies in Italy. Journal of Dairy Science, 101(4), 2915–2920. [DOI] [PubMed] [Google Scholar]
  50. Kalayu, A. A. , Woldetsadik, D. A. , Woldeamanuel, Y. , Wang, S.‐H. , Gebreyes, W. A. , & Teferi, T. (2020). Burden and antimicrobial resistance of S. aureus in dairy farms in Mekelle, Northern Ethiopia. BMC Veterinary Research, 16, 1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Karahan, M. , Açık, M. N. , & Çetinkaya, B. (2009). Investigation of toxin genes by polymerase chain reaction in Staphylococcus aureus strains isolated from bovine mastitis in Turkey. Foodborne Pathogens and Disease, 6(8), 1029–1035. [DOI] [PubMed] [Google Scholar]
  52. Kenny, K. , Reiser, R. F. , Bastida‐Corcuera, F. D. , & Norcross, N. L. (1993). Production of enterotoxins and toxic shock syndrome toxin by bovine mammary isolates of Staphylococcus aureus . Journal of Clinical Microbiology, 31(3), 706–707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Khoramrooz, S. S. , Mansouri, F. , Marashifard, M. , Malek Hosseini, S. A. A. , Akbarian Chenarestane‐Olia, F. , Ganavehei, B. , Gharibpour, F. , Shahbazi, A. , Mirzaii, M. , & Darban‐Sarokhalil, D. (2016). Detection of biofilm related genes, classical enterotoxin genes and agr typing among Staphylococcus aureus isolated from bovine with subclinical mastitis in southwest of Iran. Microbial Pathogenesis, 97, 45–51. [DOI] [PubMed] [Google Scholar]
  54. Kirkan, Ş. , Göksoy, E. Ö. , & Kaya, O. (2005). Identification and antimicrobial susceptibility of Staphylococcus aureus and coagulase negative staphylococci from bovine mastitis in the Aydın region of Turkey. Turkish Journal of Veterinary & Animal Sciences, 29(3), 791–796. [Google Scholar]
  55. Kortepeter, M. , (2001). USAMRIID's medical management of biological casualties handbook. International Medical Pub. [Google Scholar]
  56. Kou, X. , Cai, H. , Huang, S. , Ni, Y. , Luo, B. , Qian, H. , Ji, H. , & Wang, X. (2021). Prevalence and characteristics of Staphylococcus aureus isolated from retail raw milk in Northern Xinjiang, China. Frontiers in Microbiology, 12, 705947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Kukhtyn, M. D. , Horyuk, Y. V. , Horyuk, V. V. , Yaroshenko, T. Y. , Vichko, O. I. , & Pokotylo, O. S. (2017). Biotype characterization of Staphylococcus aureus isolated from milk and dairy products of private production in the western regions of Ukraine. Regulatory Mechanisms in Biosystems, 8(3), 384–388. [Google Scholar]
  58. Lee, J. H. (2003). Methicillin (oxacillin)‐resistant Staphylococcus aureus strains isolated from major food animals and their potential transmission to humans. Applied and Environmental Microbiology, 69(11), 6489–6494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Li, L. , Zhou, L. , Wang, L. , Xue, H. , & Zhao, X. (2015). Characterization of methicillin‐resistant and‐susceptible staphylococcal isolates from bovine milk in northwestern China. PloS One, 10(3), e0116699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Liu, H. , Li, S. , Meng, L. , Dong, L. , Zhao, S. , Lan, X. , Wang, J. , & Zheng, N. (2017). Prevalence, antimicrobial susceptibility, and molecular characterization of Staphylococcus aureus isolated from dairy herds in northern China. Journal of Dairy Science, 100(11), 8796–8803. [DOI] [PubMed] [Google Scholar]
  61. Liu, J. , Zhu, Y. , Jay‐Russell, M. , Lemay, D. G. , & Mills, D. A. (2020). Reservoirs of antimicrobial resistance genes in retail raw milk. Microbiome, 8(1), 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Macori, G. , Giacinti, G. , Bellio, A. , Gallina, S. , Bianchi, D. , Sagrafoli, D. , Marri, N. , Giangolini, G. , Amatiste, S. , & Decastelli, L. (2017). Molecular epidemiology of methicillin‐resistant and methicillin‐susceptible Staphylococcus aureus in the ovine dairy chain and in farm‐related humans. Toxins, 9(5), 161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Mashouf, R. Y. , Hosseini, S. M. , Mousavi, S. M. , & Arabestani, M. R. (2015). Prevalence of enterotoxin genes and antibacterial susceptibility pattern of Staphylococcus aureus strains isolated from animal originated foods in West of Iran. Oman Medical Journal, 30(4), 283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Matsunaga, T. , Kamata, S.‐I. , Kakiichi, N. , & Uchida, K. (1993). Characteristics of Staphylococcus aureus isolated from peracute, acute and chronic bovine mastitis. Journal of Veterinary Medical Science, 55(2), 297–300. [DOI] [PubMed] [Google Scholar]
  65. Mcmillan, K. , Moore, S. C. , Mcauley, C. M. , Fegan, N. , & Fox, E. M. (2016). Characterization of Staphylococcus aureus isolates from raw milk sources in Victoria, Australia. BMC Microbiology, 16(1), 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Mehrotra, M. , Wang, G. , & Johnson, W. M. (2000). Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. Journal of Clinical Microbiology, 38(3), 1032–1035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Merz, A. , Stephan, R. , & Johler, S. (2016). Staphylococcus aureus isolates from goat and sheep milk seem to be closely related and differ from isolates detected from bovine milk. Frontiers in Microbiology, 7, 319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Modaresi, R. , Tajik, H. , & Mardani, K. (2022). Prevalence of methicillin‐resistant staphylococcus aureus in raw cow's milk collected from storage tanks and milk supply centers in urmia city, Iran, and determination of their antibiotic resistance. Studies in Medical Sciences, 33(3), 183–>193. [Google Scholar]
  69. Moosavy, M. , Kordasht, H. K. , Khatibi, S. A. , & Sohrabi, H. (2019). Assessment of the chemical adulteration and hygienic quality of raw cow milk in the northwest of Iran. Quality Assurance and Safety of Crops & Foods, 11(5), 491–498. [Google Scholar]
  70. Nazari, R. , Godarzi, H. , Baghi, F. R. , & Moeinrad, M. (2014). Enterotoxin gene profiles among Staphylococcus aureus isolated from raw milk. Iranian Journal of Veterinary Research, 15(4), 409. [PMC free article] [PubMed] [Google Scholar]
  71. Nia, Y. , Mutel, I. , Assere, A. , Lombard, B. , Auvray, F. , & Hennekinne, J.‐A. (2016). Review over a 3‐year period of European Union proficiency tests for detection of staphylococcal enterotoxins in food matrices. Toxins, 8(4), 107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Normanno, G. , La Salandra, G. , Dambrosio, A. , Quaglia, N. C. , Corrente, M. , Parisi, A. , Santagada, G. , Firinu, A. , Crisetti, E. , & Celano, G. V. (2007). Occurrence, characterization and antimicrobial resistance of enterotoxigenic Staphylococcus aureus isolated from meat and dairy products. International Journal of Food Microbiology, 115(3), 290–296. [DOI] [PubMed] [Google Scholar]
  73. Oliveira, R. , Pinho, E. , Almeida, G. , Azevedo, N. F. , & Almeida, C. (2022). Prevalence and diversity of Staphylococcus aureus and staphylococcal enterotoxins in raw milk from Northern Portugal. Frontiers in Microbiology, 13, 703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Omoe, K. , Hu, D.‐L. , Takahashi‐Omoe, H. , Nakane, A. , & Shinagawa, K. (2005). Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiology Letters, 246(2), 191–198. [DOI] [PubMed] [Google Scholar]
  75. Omoe, K. , Ishikawa, M. , Shimoda, Y. , Hu, D.‐L. , Ueda, S. , & Shinagawa, K. (2002). Detection of seg, seh, and sei genes in Staphylococcus aureus isolates and determination of the enterotoxin productivities of S. aureus isolates harboring seg, seh, or sei genes. Journal of Clinical Microbiology, 40(3), 857–862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Omwenga, I. , Aboge, G. O. , Mitema, E. S. , Obiero, G. , Ngaywa, C. , Ngwili, N. , Wamwere, G. , Wainaina, M. , & Bett, B. (2019). Staphylococcus aureus enterotoxin genes detected in milk from various livestock species in northern pastoral region of Kenya. Food Control, 103, 126–132. [Google Scholar]
  77. Oncel, T. , Ica, T. , & Akan, M. (2004). Beta lactamase production rate and antimicrobial susceptibility of Staphylococcus aureus isolated from clinical and subclinical mastitis cases in Turkey. Revue De Medecine Veterinaire, 155(7), 385–388. [Google Scholar]
  78. Ono, H. K. , Sato'o, Y. , Narita, K. , Naito, I. , Hirose, S. , Hisatsune, J. , Asano, K. , Hu, D.‐L. , Omoe, K. , Sugai, M. , & Nakane, A. (2015). Identification and characterization of a novel staphylococcal emetic toxin. Applied and Environmental Microbiology, 81(20), 7034–7040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Organization, W. H. (2015). WHO estimates of the global burden of foodborne diseases: foodborne disease burden epidemiology reference group 2007‐2015. World Health Organization.
  80. Pace, J. L. , & Yang, G. (2006). Glycopeptides: Update on an old successful antibiotic class. Biochemical Pharmacology, 71(7), 968–980. [DOI] [PubMed] [Google Scholar]
  81. Paludi, D. , Vergara, A. , Festino, A. R. , Di Ciccio, P. , Costanzo, C. , Conter, M. , Zanardi, E. , Ghidini, S. , & Ianieri, A. (2011). Antimicrobial resistance pattern of methicillin‐resistant Staphylococcus aureus in the food industry. Journal of Biological Regulators and Homeostatic Agents, 25(4), 671. [PubMed] [Google Scholar]
  82. Papadopoulos, P. , Angelidis, A. S. , Papadopoulos, T. , Kotzamanidis, C. , Zdragas, A. , Papa, A. , Filioussis, G. , & Sergelidis, D. (2019). Staphylococcus aureus and methicillin‐resistant S. aureus (MRSA) in bulk tank milk, livestock and dairy‐farm personnel in north‐central and north‐eastern Greece: Prevalence, characterization and genetic relatedness. Food Microbiology, 84, 103249. [DOI] [PubMed] [Google Scholar]
  83. Peles, F. , Wagner, M. , Varga, L. , Hein, I. , Rieck, P. , Gutser, K. , Keresztúri, P. , Kardos, G. , Turcsányi, I. , Béri, B. , & Szabó, A. (2007). Characterization of Staphylococcus aureus strains isolated from bovine milk in Hungary. International Journal of Food Microbiology, 118(2), 186–193. [DOI] [PubMed] [Google Scholar]
  84. Pesavento, G. , Ducci, B. , Comodo, N. , & Nostro, A. L. (2007). Antimicrobial resistance profile of Staphylococcus aureus isolated from raw meat: A research for methicillin resistant Staphylococcus aureus (MRSA). Food Control, 18(3), 196–200. [Google Scholar]
  85. Qu, Y. , Zhao, H. , Nobrega, D. B. , Cobo, E. R. , Han, B. , Zhao, Z. , Li, S. , Li, M. , Barkema, H. W. , & Gao, J. (2019). Molecular epidemiology and distribution of antimicrobial resistance genes of Staphylococcus species isolated from Chinese dairy cows with clinical mastitis. Journal of Dairy Science, 102(2), 1571–1583. [DOI] [PubMed] [Google Scholar]
  86. Quigley, L. , O'sullivan, O. , Stanton, C. , Beresford, T. P. , Ross, R. P. , Fitzgerald, G. F. , & Cotter, P. D. (2013). The complex microbiota of raw milk. FEMS Microbiology Reviews, 37(5), 664–698. [DOI] [PubMed] [Google Scholar]
  87. Rahimi, E. , & Alian, F. (2013). Presence of enterotoxigenic Staphylococcus aureus in cow, camel, sheep, goat, and buffalo bulk tank milk. Veterinarski Arhiv, 83(1), 23–30. [Google Scholar]
  88. Raineri, E. J. M. , Altulea, D. , & Van Dijl, J. M. (2022). Staphylococcal trafficking and infection – From ‘nose to gut'and back. FEMS Microbiology Reviews, 46(1), fuab041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Rall, V. L. M. , Vieira, F. P. , Rall, R. , Vieitis, R. L. , Fernandes, A. , Candeias, J. M. G. , Cardoso, K. F. G. , & Araújo, J. P. (2008). PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk. Veterinary Microbiology, 132(3‐4), 408–413. [DOI] [PubMed] [Google Scholar]
  90. Ren, Q. , Liao, G. , Wu, Z. , Lv, J. , & Chen, W. (2020). Prevalence and characterization of Staphylococcus aureus isolates from subclinical bovine mastitis in southern Xinjiang, China. Journal of Dairy Science, 103(4), 3368–3380. [DOI] [PubMed] [Google Scholar]
  91. Riva, A. , Borghi, E. , Cirasola, D. , Colmegna, S. , Borgo, F. , Amato, E. , Pontello, M. M. , & Morace, G. (2015). Methicillin‐resistant Staphylococcus aureus in raw milk: Prevalence, SCC mec typing, enterotoxin characterization, and antimicrobial resistance patterns. Journal of Food Protection, 78(6), 1142–1146. [DOI] [PubMed] [Google Scholar]
  92. Rola, J. , Czubkowska, A. , Korpysa‐Dzirba, W. , & Osek, J. (2016). Occurrence of Staphylococcus aureus on farms with small scale production of raw milk cheeses in Poland. Toxins, 8(3), 62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  93. Rubiola, S. , Macori, G. , Chiesa, F. , Panebianco, F. , Moretti, R. , Fanning, S. , & Civera, T. (2022). Shotgun metagenomic sequencing of bulk tank milk filters reveals the role of Moraxellaceae and Enterobacteriaceae as carriers of antimicrobial resistance genes. Food Research International, 158, 111579. [DOI] [PubMed] [Google Scholar]
  94. Rubiola, S. , Macori, G. , Civera, T. , Fanning, S. , Mitchell, M. , & Chiesa, F. (2022). Comparison between full‐length 16s RRNA metabarcoding and whole metagenome sequencing suggests the use of either is suitable for large‐scale microbiome studies. Foodborne Pathogens and Disease, 19(7), 495–504. [DOI] [PubMed] [Google Scholar]
  95. Saadat, Y. R. , Fooladi, A. A. I. , Shapouri, R. , Hosseini, M. M. , & Khiabani, Z. D. (2014). Prevalence of enterotoxigenic Staphylococcus aureus in organic milk and cheese in Tabriz, Iran. Iranian Journal of Microbiology, 6(5), 345. [PMC free article] [PubMed] [Google Scholar]
  96. Serieys, F. , & Gicquel‐Bruneau, M. (2005). Homogénéité intra‐troupeau des souches de Staphylococcus aureus de mammites sub‐cliniques pour la production de ß‐lactamase et la résistance à la pénicilline. Renc Rech Ruminant, 12, 267–270. [Google Scholar]
  97. Smith, N. W. , Fletcher, A. J. , Hill, J. P. , & Mcnabb, W. C. (2022). Modeling the contribution of milk to global nutrition. Frontiers in Nutrition, 8, 1287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  98. Song, M. , Bai, Y. , Xu, J. , Carter, M. Q. , Shi, C. , & Shi, X. (2015). Genetic diversity and virulence potential of Staphylococcus aureus isolates from raw and processed food commodities in Shanghai. International Journal of Food Microbiology, 195, 1–8. [DOI] [PubMed] [Google Scholar]
  99. Stephan, R. , Dura, U. , & Untermann, F. (1999). Resistance situation and enterotoxin production capacity of Staphylococcus aureus strains from bovine mastitis milk samples. Schweizer Archiv fur Tierheilkunde, 141(6), 287–290. [PubMed] [Google Scholar]
  100. Tarekgne, E. K. , Skjerdal, T. , Skeie, S. , Rudi, K. , Porcellato, D. , Félix, B. , & Narvhus, J. A. (2016). Enterotoxin gene profile and molecular characterization of Staphylococcus aureus isolates from bovine bulk milk and milk products of Tigray region, northern Ethiopia. Journal of Food Protection, 79(8), 1387–1395. [DOI] [PubMed] [Google Scholar]
  101. Thongratsakul, S. , Usui, M. , Higuchi, H. , Takahashi, T. , Sato, T. , Poolkhet, C. , & Tamura, Y. (2020). Prevalence and characterization of Staphylococcus aureus isolated in raw milk from cows in Hokkaido, Japan. Tropical Animal Health and Production, 52, 1631–1637. [DOI] [PubMed] [Google Scholar]
  102. Titouche, Y. , Hakem, A. , Houali, K. , Meheut, T. , Vingadassalon, N. , Ruiz‐Ripa, L. , Salmi, D. , Chergui, A. , Chenouf, N. , Hennekinne, J. A. , Torres, C. , & Auvray, F. (2019). Emergence of methicillin‐resistant Staphylococcus aureus (MRSA) ST8 inraw milk and traditional dairy products in the Tizi Ouzou area of Algeria. Journal of Dairy Science, 102(8), 6876–6884. [DOI] [PubMed] [Google Scholar]
  103. Tong, S. Y. C. , Davis, J. S. , Eichenberger, E. , Holland, T. L. , & Fowler, V. G. (2015). Staphylococcus aureus infections: Epidemiology, pathophysiology, clinical manifestations, and management. Clinical Microbiology Reviews, 28(3), 603–661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  104. Umaru, G. , Kwaga, J. K. P. , Bello, M. , Raji, M. A. , & Maitala, Y. S. (2016). Antibiotic resistance of Staphylococcus aureus isolated from fresh cow milk in settled Fulani herds in Kaduna State, Nigeria. Bulletin of Animal Health and Production in Africa, 64(1), 173–182. [Google Scholar]
  105. Valizadeh, E. , & Amini, K. (2016). Identification of Staphylococcus aureus enterotoxin genes using multiplex PCR. Journal of Babol University of Medical Sciences, 18(12), 26–32. [Google Scholar]
  106. Vitale, M. , Scatassa, M. L. , Cardamone, C. , Oliveri, G. , Piraino, C. , Alduina, R. , & Napoli, C. (2015). Staphylococcal food poisoning case and molecular analysis of toxin genes in Staphylococcus aureus strains isolated from food in Sicily, Italy. Foodborne Pathogens and Disease, 12(1), 21–23. [DOI] [PubMed] [Google Scholar]
  107. Wang, S.‐C. , Wu, C.‐M. , Xia, S.‐C. , Qi, Y.‐H. , Xia, L.‐N. , & Shen, J.‐Z. (2009). Distribution of superantigenic toxin genes in Staphylococcus aureus isolates from milk samples of bovine subclinical mastitis cases in two major diary production regions of China. Veterinary Microbiology, 137(3‐4), 276–281. [DOI] [PubMed] [Google Scholar]
  108. Wang, W. , Lin, X. , Jiang, T. , Peng, Z. , Xu, J. , Yi, L. , Li, F. , Fanning, S. , & Baloch, Z. (2018). Prevalence and characterization of Staphylococcus aureus cultured from raw milk taken from dairy cows with mastitis in Beijing, China. Frontiers in Microbiology, 9, 1123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  109. Wang, X. , Li, G. , Xia, X. , Yang, B. , Xi, M. , & Meng, J. (2014). Antimicrobial susceptibility and molecular typing of methicillin‐resistant Staphylococcus aureus in retail foods in Shaanxi, China. Foodborne Pathogens and Disease, 11(4), 281–286. [DOI] [PubMed] [Google Scholar]
  110. Warder, L. M. C. , Doster, E. , Parker, J. K. , Morley, P. S. , Mcclure, J. T. , Heider, L. C. , & Sánchez, J. (2021). Characterization of the microbiota and resistome of bulk tank milk samples from Prince Edward Island dairy farms. Journal of Dairy Science, 104(10), 11082–11090. [DOI] [PubMed] [Google Scholar]
  111. Waters, A. E. , Contente‐Cuomo, T. , Buchhagen, J. , Liu, C. M. , Watson, L. , Pearce, K. , Foster, J. T. , Bowers, J. , Driebe, E. M. , Engelthaler, D. M. , Keim, P. S. , & Price, L. B. (2011). Multidrug‐resistant Staphylococcus aureus in US meat and poultry. Clinical Infectious Diseases, 52(10), 1227–1230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  112. Wu, D. , Wang, Q. , Yang, Y. , Geng, W. , Wang, Q. , Yu, S. , Yao, K. , Yuan, L. , & Shen, X. (2010). Epidemiology and molecular characteristics of community‐associated methicillin‐resistant and methicillin‐susceptible Staphylococcus aureus from skin/soft tissue infections in a children's hospital in Beijing, China. Diagnostic Microbiology and Infectious Disease, 67(1), 1–8. [DOI] [PubMed] [Google Scholar]
  113. Xing, X. , Zhang, Y. , Wu, Q. , Wang, X. , Ge, W. , & Wu, C. (2016). Prevalence and characterization of Staphylococcus aureus isolated from goat milk powder processing plants. Food Control, 59, 644–650. [Google Scholar]
  114. Zhang, J. , Wang, J. , Jin, J. , Li, X. , Zhang, H. , Shi, X. , & Zhao, C. (2022). Prevalence, antibiotic resistance, and enterotoxin genes of Staphylococcus aureus isolated from milk and dairy products worldwide: A systematic review and meta‐analysis. Food Research International, 162, 111969. [DOI] [PubMed] [Google Scholar]
  115. Zhao, X. , Yuan, X. , Hu, M. , Zhang, Y. , Li, L. , Zhang, Q. , Yuan, X. , Wang, W. , & Liu, Y. (2021). Prevalence and characterization of Staphylococcus aureus and methicillin‐resistant Staphylococcus aureus isolated from bulk tank milk in Shandong dairy farms. Food Control, 125, 107836. [Google Scholar]
  116. Zitzmann, C. , Schmid, B. , Ruggieri, A. , Perelson, A. S. , Binder, M. , Bartenschlager, R. , & Kaderali, L. (2020). A coupled mathematical model of the intracellular replication of dengue virus and the host cell immune response to infection. Frontiers in Microbiology, 11, 725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  117. Zschöck, M. , Kloppert, B. , Wolter, W. , Hamann, H. P. , & Lämmler, C. (2005). Pattern of enterotoxin genes seg, seh, sei and sej positive Staphylococcus aureus isolated from bovine mastitis. Veterinary Microbiology, 108(3‐4), 243–249. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES