Abstract
Keratoconus (KC) is a progressive degenerative disease that usually occurs bilaterally and is characterized by corneal thinning and apical protrusion of the cornea. Oxidative stress is an indicator of the accumulation of reactive oxygen species (ROS), and KC keratocytes exhibit increased ROS production compared with that of normal keratocytes. Therefore, oxidative stress in KC keratocytes may play a major role in the development and progression of KC. Here, we investigated the protective effect of sulforaphane (SF) antioxidants using a hydrogel-simulated model of the cell mechanical microenvironment of KC. The stiffness of the KC matrix microenvironment in vitro was 16.70 kPa and the stiffness of the normal matrix microenvironment was 34.88 kPa. Human keratocytes (HKs) were cultured for 24 h before observation or drug treatment with H2O2 in the presence or absence of SF. The levels of oxidative stress, nuclear factor E2-related factor 2 (Nrf-2) and antioxidant response element (ARE) were detected. The high-stress state of HKs in the mechanical microenvironment of KC cells compensates for the activation of the Nrf-2/ARE signaling pathway. H2O2 leads to increased oxidative stress and decreased levels of antioxidant proteins in KC. In summary, SF can reduce endogenous and exogenous oxidative stress and increase the antioxidant capacity of cells.
Subject terms: Cell biology, Diseases, Medical research, Molecular medicine
Introduction
Keratoconus (KC) is a progressive degenerative disease that usually occurs bilaterally and is characterized by corneal thinning and apical protrusion of the cornea1. KC is a major clinical problem worldwide, with a reported prevalence of approximately 1 in 450 individuals2. The pathogenesis of KC remains unknown but may involve genetic and environmental factors3,4. However, accumulating evidence has revealed the role of oxidative stress in KC5–8. Oxidative stress is an indicator of the accumulation of reactive oxygen species (ROS), and KC keratocytes exhibit increased ROS production compared with that of normal keratocytes6,7. In vitro studies with pathway prediction software indicate that many altered pathways in KC keratocytes are related to oxidative stress9. Therefore, oxidative stress in KC keratocytes may play a major role in the development and progression of KC. However, the role of oxidative stress in KC remains unclear.
Nuclear factor E2-related factor 2 (Nrf-2) plays a key role in antioxidant response element (ARE)-regulated gene expression10 by binding to AREs and transactivating downstream target genes. The ARE-regulated expression of phase II detoxifying antioxidants and enzymes, including heme oxygenase-1 (HO-1), helps counteract increased oxidative stress and maintain redox status in many tissues11,12. As shown in our previous study, type II collagenase is useful for establishing an animal model of KC expansion both in vitro and in vivo13,14. The present study provides evidence that activation of the Nrf-2/ARE pathway partially promotes the protective effect of the antioxidant sulforaphane (SF) in the KC cornea15. However, to our knowledge, the effect of Nrf-2/ARE at the cellular level has not been studied in the cornea of patients with KC.
The microenvironment of the extracellular matrix is complex and diverse and plays an important role in regulating cell behavior. The cornea, a viscoelastic material, possesses unique biomechanical properties; thus, the mechanical microenvironment plays a crucial role in determining the behavior of keratocytes16. Small-magnitude stretching may promote corneal matrix synthesis, whereas large-magnitude stretching promotes corneal matrix degradation17. Based on these findings, changes in the corneal mechanical microenvironment may affect keratocytes. The mechanical microenvironment plays an important role in regulating the biological behavior of cells, such as cardiomyocytes18 and skeletal muscle cells19, leading to myocardial fibrosis, abnormal myotube formation and other diseases. Thus, studies aiming to clarify the pathological mechanism and prevent KC by constructing the mechanical microenvironment of keratocytes are very important.
Herein, we constructed a mechanical microenvironment based on hydrogel materials to explore the effects of microenvironmental changes on the function of keratocytes20,21. In vitro models of normal corneal and KC microenvironments were first generated. Then, human keratocytes (HKs) were cultured to detect changes in oxidative stress-related factors and the Nrf-2/ARE pathway and to further explore the role of keratocytes in the pathogenesis of KC. Keratocytes in the KC mechanical microenvironment were treated with SF to investigate changes in their biological behavior. An in-depth study of the regulatory effects of SF on the Nrf-2/ARE pathway in keratocytes in the KC microenvironment was conducted, and SF was shown to exert a protective effect on oxidative stress, providing a strategy for the early prevention and treatment of KC and other corneal dilatation diseases.
Results
Modeling KC mechanical characterization in vitro with polyacrylamide (PA) hydrogels
To simulate KC in vitro, we prepared PA hydrogels. As shown in Fig. 1, the stiffness of the two groups of PA hydrogels was measured using atomic force microscopy (AFM) after the hydrogels were successfully prepared. After the 2.5%/0.75% and 2.5%/1.5% acrylamide (%)/MBA (%) solutions were polymerized, the Young’s moduli were determined to be 16.70 ± 0.95 kPa and 34.88 ± 1.13 kPa, respectively. The final prepared PA hydrogel exhibited the expected stiffness.
Figure 1.
Stiffness measurement of the PA hydrogel. (a) A picture of the production of the PA hydrogel. (b) An AFM cantilever attached to a silica sphere. (c) Raw data of the representative force–distance curve (approach part). (d) A representative force–indentation curve converted from (c) by subtracting the measured deflection from the known response of the cantilever. (e) The stiffness of the PA hydrogels. The error bars indicate the SDs; n = 3 per group.
HKs were cultured on three different substrates (106 kPa, 34.88 kPa and 16.70 kPa) and showed a single layer of adherent growth. The cell bodies were star-shaped or spindle-shaped, with an oval-shaped nucleus in the center of each cell. Vimentin+ staining (Fig. 2) confirmed that the cells cultured in vitro were HKs. The morphology of the HKs in the 16.70 kPa group, which represents the KC mechanical microenvironment, did not change.
Figure 2.

Human keratocytes (HKs) identification. (a) Detection of vimentin in HKs (immunofluorescence, × 200). Bar = 100 μm. DAPI, 4'-6-diamidino-2-phenylindole. (b) Percentage of vimentin-positive cells (%) under different culture conditions. Tukey's post hoc test was used to identify significant differences between samples. The data are presented as the means ± SDs; n = 3 per group. n.s., not significant.
Changes in the mechanical microenvironment induce oxidative stress in keratocytes in PA hydrogels.
To demonstrate whether changes in the mechanical microenvironment could induce oxidative stress in HKs in PA hydrogels, we measured the levels of malondialdehyde (MDA), superoxide dismutase (SOD), nitric oxide (NO), and hydroxyl radical (·OH). Based on immunofluorescence staining, the levels of detectable ROS were reduced only in the stromal cells in the 106 kPa and 34.88 kPa groups (Fig. 3a), and the ROS level in the HKs in the KC microenvironment group was significantly greater than that in the 106 kPa and 34.88 kPa groups (P < 0.001, P < 0.01; Fig. 3b). We measured the levels of MDA, SOD, NO, and ·OH to evaluate oxidative stress in the HKs of the three groups (Fig. 4). Significantly greater levels of MDA and NO and significantly lower SOD levels were detected in HKs within the 16.70 kPa group than the 34.88 kPa group.
Figure 3.

Generation of ROS in HKs. (a) The production of ROS in HKs was detected by DHE staining. Bar = 100 μm. (b) ROS levels in HKs. Tukey's post hoc test was used to identify significant differences between samples. The data are presented as the means ± SDs; n = 3 per group. **P < 0.01, ***P < 0.001, n.s., not significant.
Figure 4.
Detection of oxidative stress-related indicators under different culture conditions. (a) MDA content. (b) SOD. (c) NO. (d) ·OH. Tukey's post hoc test was used to identify significant differences between samples. The data are presented as the means ± SDs; n = 3 per group. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the 34.88 kPa group. #P < 0.05, ##P < 0.01 compared to the 16.70 kPa group. +P < 0.05, ++P < 0.01 compared to the 16.70 kPa-SF group. &&P < 0.01, &&&P < 0.001 compared to the 16.70 kPa group. ^P < 0.05, ^^^P < 0.001 compared to the 34.88 kPa-H2O2 group. $P < 0.05, $$P < 0.01 compared to the 16.70 kPa-H2O2 group. @P < 0.05, @@P < 0.01, and @@@P < 0.001 compared to the 16.70 kPa-H2O2-SF group.
The cells cultured on the three substrates were subjected to H2O2 treatment. As shown in Fig. 5, immunofluorescence staining revealed that the level of ROS in HKs in the 16.70 kPa-H2O2 group was significantly greater than that in the 106 kPa and 34.88 kPa groups (both P < 0.001). HKs produced significantly greater levels of MDA, NO, and ·OH, and a significantly lower level of SOD was produced by HKs in the 16.70 kPa-H2O2 group than in the 34.88 kPa-H2O2 group (Fig. 4). Significantly greater levels of MDA, NO and ·OH were detected in the 16.70 kPa-H2O2 group than in the 16.70 kPa group (Fig. 4).
Figure 5.

Generation of ROS in HKs after H2O2 treatment. (a) DHE staining was performed to detect the production of ROS. (b) ROS levels in corneal stromal cells. Tukey's post hoc test was used to identify significant differences between samples. The data are presented as the means ± SDs; n = 3 per group. ***P < 0.001, n.s., not significant.
SF inhibits the oxidative stress response of HKs in the KC mechanical microenvironment.
To determine whether SF inhibited the oxidative stress response of HKs in the mechanical microenvironment of KC, we treated HKs in the 16.70 kPa/-H2O2 group with SF or SF + Znpp and compared the levels of MDA, SOD, NO, and ·OH levels. The MDA and NO levels were significantly lower and the SOD level was significantly greater in the 16.70 kPa-SF group than in the 16.70 kPa group (Fig. 4). Significantly greater MDA and NO levels and significantly lower SOD activity were detected in the 16.70 kPa-SF + Znpp group than in the 16.70 kPa-SF group (Fig. 4).
Cells in the 16.70 kPa-H2O2 group were treated with SF or SF + Znpp, and the levels of MDA, SOD, NO and ·OH were compared. The MDA, NO and ·OH levels were significantly lower and the SOD level was significantly greater in the 16.70 kPa-H2O2-SF group than in the 16.70 kPa-H2O2 group (Fig. 4). Znpp IX significantly increased NO and ·OH levels and decreased SOD levels (Fig. 4).
SF decreases the levels of Nox-2 and Nox-4 and increases the levels of Nrf-2 and HO-1 in HKs in the KC mechanical microenvironment.
To determine whether SF downregulates NADPH oxidase (Nox)-2 and Nox-4 levels and upregulates Nrf-2 and HO-1 levels in the KC mechanical microenvironment, we analyzed changes in the levels of proteins associated with oxidative stress in all groups by Western blot (WB) and RT‒qPCR analyses. The WB results showed that the levels of Nox-2 and Nox-4 proteins were significantly greater in the HKs in the 16.70 kPa group than the 34.88 kPa group (Fig. 6a, b). SF significantly reduced the levels of the Nox-2 and Nox-4 proteins, but these levels were significantly increased by Znpp IX. As shown in Fig. 6c and d, significantly greater levels of the Nrf-2 and HO-1 proteins were detected in HKs in the 16.70 kPa group than the 34.88 kPa group. SF significantly increased the levels of the Nrf-2 and HO-1 proteins, but Znpp IX significantly reduced their levels. RT‒qPCR quantitative analysis revealed a trend similar to that of the WB results (Fig. 7a).
Figure 6.
Expression levels of Nox-2, Nox-4, Nrf-2 and HO-1 in HKs under different experimental conditions. (a-d) The upper panels are protein grayscale images of Nox-2, Nox-4, Nrf-2 and HO-1 in Western blot analysis. The lower panels are the corresponding relative expression levels. The original blots are presented in S Figs. 5-9. Tukey's post hoc test was used to identify significant differences between samples. The data are presented as the means ± SDs; n = 3 per group. ***P < 0.001 compared to the 34.88 kPa group. ###P < 0.001 compared to the 16.70 kPa group; +++P < 0.001 compared to the 16.70 kPa-SF group.
Figure 7.
Determination of Nox-2, Nox-4, Nrf-2 and HO-1 mRNA levels under different experimental conditions. (a) SF downregulated Nox-2 and Nox-4 and upregulated Nrf-2 and HO-1 in HKs in the KC mechanical microenvironment. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the 34.88 kPa group. ##P < 0.01, ###P < 0.001 compared to the 16.70 kPa group. +P < 0.05, ++P < 0.01, +++P < 0.001 compared to the 16.70 kPa-SF group. (b) SF downregulated Nox-2 and Nox-4 and upregulated Nrf-2 and HO-1 in HKs in the KC mechanical microenvironment after H2O2 treatment. **P < 0.01, ***P < 0.001 compared with the 34.88 kPa-H2O2 group. #P < 0.05, ###P < 0.001 compared to the 16.70 kPa-H2O2 group. ++P < 0.01, +++P < 0.001 compared to the 16.70 kPa-H2O2-SF group. The housekeeping gene used for normalization was β-actin. The fold change in gene expression relative to that of β-actin was calculated as 2−ΔΔct (mean ± SD, n = 3). Tukey's post hoc test was used to identify significant differences between samples. The 34.88 kPa group, normal corneal mechanics microenvironment group. The 16.70 kPa group, KC mechanical microenvironment group.
SF upregulates Fn and COLI in HKs in the KC mechanical microenvironment.
To determine whether SF increases collagen deposition in the KC mechanical microenvironment, we conducted an experiment with Fn and COLI immunofluorescence. SF treatment increased the expression levels of Fn (S Fig. 1) and COLI (S Fig. 2) in keratocytes in the KC microenvironment, suggesting that SF is a therapeutic for KC.
SF downregulates Nox-2 and Nox-4 and upregulates Nrf-2 and HO-1 in HKs in the KC mechanical microenvironment after H2O2 treatment.
Next, we examined the expression of Nox-2, Nox-4, Nrf-2 and HO-1 in HKs in the 106 kPa, 34.88 kPa and 16.70 kPa groups treated with H2O2 by immunofluorescence staining to evaluate the levels of proteins associated with oxidative stress in HKs in the KC mechanical microenvironment after H2O2 treatment (Fig. 8). Nox-2 and Nox-4 immunoreactivity was lower in HKs within the 16.70 kPa-H2O2 group than in HKs within the other two groups (Fig. 8a, b, e). The immunoreactivity of Nrf-2 and HO-1 in the 16.70 kPa-H2O2 group was greater than that in the other two groups (Fig. 8c, d, e). The levels of Nox-2, Nox-4, Nrf-2 and HO-1 in the 34.88 kPa-H2O2, 16.70 kPa-H2O2, 16.70 kPa-H2O2-SF, and 16.70 kPa-H2O2-SF + Znpp groups were analyzed. The WB results revealed that the levels of the Nox-2 and Nox-4 proteins were significantly greater in the 16.70 kPa-H2O2 group than in the 34.88 kPa-H2O2 group (Fig. 9a, b). SF significantly reduced the levels of the Nox-2 and Nox-4 proteins, but Znpp IX significantly increased their levels. As shown in Fig. 9c and d, significantly lower levels of the Nrf-2 and HO-1 proteins were detected in the 16.70 kPa-H2O2 group than in the 34.88 kPa-H2O2 group (all P < 0.001). SF significantly increased the levels of Nrf-2 and HO-1, but Znpp IX significantly reduced their levels. RT‒qPCR analysis revealed a trend similar to that of WB analysis (Fig. 7b).
Figure 8.
Evaluation of Nox-2, Nox-4, Nrf-2 and HO-1 expression in HKs by immunofluorescence after H2O2 treatment. (a-d) Representative micrographs of HKs obtained from each group stained with an anti-Nox-2 antibody (red, a), an anti-Nox-4 antibody (green, b), an anti-Nrf-2 antibody (red, c), and an anti-HO-1 antibody (green, d) are shown in the upper panels. The middle panels show the corresponding images of DAPI-stained sections (blue). The lower panels show merged images. Scale bar = 100 μm. DAPI, 4'-6-diamidino-2-phenylindole. (e) The mean fluorescence intensity of Nox-2, Nox-4, Nrf-2 and HO-1 in the experimental groups. The data are presented as the means ± SDs; n = 3 per group. **P < 0.01, ***P < 0.001. The 106 kPa group, included conventional cell culture stiffness groups (the matrix stiffness of the rigid plastic dishes). The 34.88 kPa group, normal corneal mechanics microenvironment group. The 16.70 kPa group, KC mechanical microenvironment group.
Figure 9.
Expression levels of Nox-2, Nox-4, Nrf-2 and HO-1 in HKs under different experimental conditions after H2O2 treatment. (a-d) Representative immunoblotting showing the protein levels of Nox-2, Nox-4, Nrf-2 and HO-1 in HKs (upper panel) and densitometric analysis of the expression of Nox-2, Nox-4, Nrf-2 and HO-1 relative to the loading control (lower panel). The original blots are presented in S Figs. 10-14. Tukey's post hoc test was used to identify significant differences between samples. The data are presented as the means ± SDs, n = 3 per group. *P < 0.05, **P < 0.01, ***P < 0.001, vs. the 34.88 kPa-H2O2 group. #P < 0.05, and ###P < 0.001, vs. the 16.70 kPa-H2O2 group. +P < 0.05, +++P < 0.001, vs. the 16.70 kPa-H2O2-SF group.
Discussion
In this study, PA hydrogels with stiffnesses mimicking the normal corneal (34.88 kPa) and KC (16.70 kPa) mechanical microenvironments were prepared22–26. The elastic modulus in KC is approximately half that of the normal cornea24,25,27. Additionally, we utilized coverslips with stiffness akin to conventional cell culture substrates (106 kPa) as experimental controls28.
Oxidative stress has long been implicated in the pathogenesis of KC29–34. Our findings corroborate this, revealing elevated levels of ROS, MDA and NO in the KC microenvironment, alongside reduced SOD levels29,35. Abnormalities in matrix stiffness might significantly alter cell behavior, leading to disease36–38. As shown in the present study, H2O2 treatment exacerbated the oxidative stress response in HKs in the KC microenvironment, accompanied by an increase in ROS, MDA, NO and ·OH levels and a decrease in SOD levels. Notably, HKs cultured within the KC microenvironment exhibited heightened sensitivity to oxidative stress, indicating their potential role in the development and progression of KC.
In contrast to normal corneas, KC corneas do not activate the Nrf-2/ARE pathway39–41. Preliminary experiments revealed higher Nox-2 and Nox-4 expression but lower Nrf-2 and HO-1 levels in KC tissues compared to normal corneal tissue (S Fig. 3), suggesting limited activation of the antioxidant pathway in KC. A decrease in Nrf-2 may underlie the poor antioxidant functions in KC14,42,43. SF, an Nrf-2 activator, mitigates ROS accumulation in corneal stromal cells and enhances Nrf-2 nuclear translocation39,44. SF significantly reduced NO levels, increased SOD levels, and inhibited oxidative stress in HKs within the KC microenvironment. Additionally, SF inhibited the oxidative stress induced by H2O2, partially reversed by Znpp IX, an inhibitor of HO-1. Future gradient experiments with ZnPP IX concentration could elucidate HO-1 dependency. Overall, SF protects against oxidative stress in KC by targeting HKs, with HO-1 playing a crucial role.
Corneal stromal cells generate ROS through Nox-mediated NADPH oxidation, mainly via Nox-2 and Nox-4 activation7,45. Under oxidative stress, Nrf-2 translocates to the nucleus, prompting the expression of AREs such as HO-146. In the present study, Nox-2 and Nox-4 levels were significantly increased in HKs within the KC microenvironment, indicating their involvement in ROS production. Increased Nrf-2 and HO-1 levels in KC imply an endogenous mechanism against oxidative stress. However, interpreting these findings in KC is challenging without pathological cells, and mechanical tension inadequately models KC, limiting our study. Additionally, ROS levels were notably higher in KC-derived cells compared to normal corneal stromal cells (S Fig. 4), indicating their heightened susceptibility to oxidative damage in response to external stimuli. This underscores the physiological role of ROS in activating Nrf-2, thereby mediating SF's protective effect against oxidative stress in the KC microenvironment, through the Nrf-2/ARE pathway.
Studies indicate a decrease in total antioxidant capacity in KC, potentially associated with heightened oxidative stress and tissue damage47,48. H2O2 notably increased Nox-2, Nox-4, and ROS levels while decreasing Nrf-2 and HO-1 levels in the KC microenvironment. Interestingly, HKs in the KC microenvironment didn't adaptively regulate H2O2-induced oxidative stress or activate the Nrf-2/ARE pathway, contrasting in vivo findings. SF significantly downregulated Nox-2 and Nox-4 and upregulated Nrf-2 and HO-1 in the KC microenvironment after H2O2 treatment. This suggests that SF induces HO-1 expression, facilitates Nrf-2 nuclear translocation, activates the Nrf-2/ARE pathway, and exerts antioxidant effects on HKs in the KC microenvironment following H2O2 treatment.
Our study has several limitations. First, further investigation is needed to simulate the stiffness of the KC matrix microenvironment and explore its effects. on HKs. Second, correlating the stiffness of KC stromal cells with the microenvironment could aid in the early diagnosis of KC. In addition, studying cells in a 3D microenvironment could better simulate in vivo conditions and enhance our understanding of the biological behavior of HKs.
In conclusion, the high-stress state of HKs in the KC mechanical microenvironment compensates for Nrf-2/ARE pathway activation. H2O2-induced oxidative stress decreases antioxidant protein expression in KC. SF mitigates both endogenous and exogenous oxidative stress and enhances cellular antioxidant capacity, closely linked to Nrf-2/ARE activation. Our findings lay the groundwork for SF's potential as a therapeutic agent for KC.
Materials and methods
Fabrication of PA hydrogels
Glass coverslips and slides were cleaned to remove organics, dried in an oven and functionalized with 2% 3-(trimethoxysilyl) propyl methacrylate. Moreover, the surface of the glass slide was treated with dichloromethylsilane (DCMS). The PA hydrogels were fabricated according to protocols described elsewhere26,49. Briefly, a polymer solution containing acrylamide, MBA (N,N-methylene-bis-acrylamide, Sigma Aldrich, St. Louis, USA), 10% aluminum persulfate and a 1/1000 volume of tetramethylethylenediamine was prepared. This solution was sandwiched between a DCMS-treated slide and a functionalized coverslip. Following polymerization, the PA hydrogel was incubated with 1 mg/mL sulf-SANPAH, washed with 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid buffer at pH 8.5 and then incubated with 0.12 mg/mL rat tail collagen type I overnight at room temperature. The dishes were placed on the sample stage of a custom bio-AFM system equipped with an inverted microscope (Nikon, TE2000U). All AFM data were analyzed using SPIP 6.3.3 software to determine the Young’s modulus, which represents the stiffness of the PA hydrogel.
Cell culture and treatment
HKs were acquired from ScienCell Research Laboratories (catalog #6520) and cultured in fibroblast medium. All cells on the hydrogel substrate and on common culture dishes were cultured for 24 h before detection or drug treatment. HKs were treated with SF (50 μM, 4 h) (Sigma) in the presence or absence of 10 μM Znpp IX (a specific inhibitor of HO-1, 1 h) (Sigma). For oxidative stress analysis, HKs were treated with 200 μM H2O2 for 1 h with or without 50 μM SF for 4 h and 10 μM Znpp IX for 1 h. The treatment concentrations used in our study were evaluated and optimized in our primary experiments. Cells from the third to fifth passages were utilized in this study.
Analysis of ROS generation
The generation of corneal ROS was assessed using dihydroethidium (DHE; Invitrogen Molecular Probes, Eugene, OR) as previously described50. Briefly, HKs were carefully washed with sterile PBS after the cell culture medium was removed. The cells were incubated with 5 μM DHE at 37 °C for 30 min and rinsed 2–3 times with sterile PBS. The cells were kept away from light during the procedure and were sealed with a sealing sheet. Green light was emitted under a fluorescence microscope, and the red emission of corneal stromal cells was observed and imaged.
Immunocytochemistry
HKs were seeded onto coverslips, and PA hydrogels were added to the wells of a six-well plate (5 × 105 cells/well). Next, the cells were fixed with 4% paraformaldehyde, permeabilized with 0.3% Triton X-100 for 20 min, and then blocked with 2% normal goat serum. The cells were then incubated overnight at 4 °C with primary antibodies against HO-1 (ADI-SPA-895-F, 1:100), Nox-2 (ab80508, 1:1000), Nox-4 (NB110-58,849, 1:500), Nrf-2 (bs-1074R, 1:500), vimentin (ab192890, 1:400), Fn (NBP1-51,723, 1:400) and COLI (NB600-408, 1:400). The cells were incubated with secondary antibody for 1 h at 25 °C, and their nuclei were stained with DAPI. Finally, the stained cells on the coverslips were observed under an Olympus optical microscope.
Western blotting
Total protein was extracted from the cells by sonication in RIPA buffer (C1053, Applygen, Beijing, China). A bicinchoninic acid protein assay reagent kit (P1511, Applygen) was used to measure the protein concentration (n = 5 per group). Equal amounts of protein (20 µg/lane) were separated by 10 or 12% SDS‒PAGE. Next, the proteins were transferred to an Immun-Blot PVDF membrane that was subsequently blocked and probed with one of the following primary antibodies: HO-1, Nox-2, Nox-4, Nrf-2 or mouse monoclonal anti-β-actin (A1978, 1:2000). Protein bands were visualized using Amersham Biosciences ECL Western blot detection reagent (GE Healthcare Life Sciences, Uppsala, Sweden). For quantification, blots from at least three independent experiments were used and quantified using ImageJ software.
Measurement of the MDA, SOD, NO, and ·OH levels
The levels of MDA, SOD, NO, and ·OH in the samples at the end of the treatments were quantified by utilizing a commercial kit according to the manufacturer’s instructions (Abcam, MA, USA).
Real-time PCR
To evaluate mRNA expression, RT‒PCR was performed on all samples as previously described51. Briefly, total RNA extraction was carried out using an Ambion RNA Mini Extraction Kit. cDNA synthesis was performed using a PrimeScript RT reagent kit (RR047A, TaKaRa Bio Inc., Japan). The quality and concentration of the synthesized cDNA were measured with an ND-1000 Nanodrop spectrophotometer. RT‒PCR was performed with SYBR Premix Ex Taq II (RR820A, TaKaRa). The reaction contained 10 ng of cDNA in a 20-μl volume using a PikoReal 96 real-time PCR system (Thermo, Waltham, MA, USA). The conditions used were two minutes at 50 °C, 30 s at 94 °C, and 40 cycles of 5 s at 94 °C and 34 s at 60 °C. The expression of each gene was quantified in duplicate. The housekeeping gene used for normalization was β-actin. The relative mRNA expression was normalized against the expression of β-actin and calculated using the 2−ΔΔct method. The primers used are shown in Table 1 (AuGCT DNA-SYN Biotechnology). GraphPad Prism 6 and MS Excel were used for data analysis. All samples and analyses were repeated at least three times.
Table 1.
Gene markers and corresponding primers.
| Gene | Forward sequence (5’-3’) | Reverse sequence (5’-3’) |
|---|---|---|
| HO-1 | CTTCTTCACCTTCCCCAACA | GCTCTGGTCCTTGGTGTCAT |
| Nox-2 | TGCACCTCAGGTATCAATTC | AAGGGCCAATATTCTCAGAC |
| Nox-4 | GGAGCAATAAGCCAGTCACC | GAACCCCAAATGTTGCTTTG |
| Nrf-2 | ACCATGGTTCCAAGTCCAGA | CTGTCAACTGGTTGGGGTCT |
| β-actin | TGACGTGGACATCCGCAAAG | TCTTCATTGTGCTGGGTGCC |
Statistical analysis
All results are expressed as the mean ± standard deviation (SD). The results of multiple groups were compared using one-way analysis of variance followed by Tukey's post hoc test using SPSS Statistics, version 17.0 (SPSS, Inc., Armonk, NY) unless otherwise noted. Differences were considered significant at P < 0.05. In addition, n = 3 unless otherwise noted. No statistical methods were used to predetermine the sample size.
Supplementary Information
Acknowledgements
Supported by the National Natural Science Foundation of China (82101090, 11372011 and 11772336), the Beijing Natural Science Foundation (7192210), Medical Science and Technology Project of Henan Province (SBGJ202103012) and Basic Science Key Project of Henan Eye Institute/Henan Eye Hospital (22JCQN001).
Author contributions
R.L. and X.Y. conceived and designed the experiments. R.L. performed the experiments and analyzed the data. R.M. participated in the arrangement and modification of the images. R.L. wrote the manuscript. X.Y. modified the manuscript. R.L. and X.Y. read and approved the final manuscript.
Data availability
The data that support the findings of this study are available from the corresponding author [yanxiaoming7908@163.com] upon reasonable request.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-024-57596-9.
References
- 1.Mas Tur V, MacGregor C, Jayaswal R, O’Brart D, Maycock N. A review of keratoconus: Diagnosis, pathophysiology, and genetics. Surv. Ophthalmol. 2017;62:770–783. doi: 10.1016/j.survophthal.2017.06.009. [DOI] [PubMed] [Google Scholar]
- 2.Ambekar R, Toussaint KC, Wagoner Johnson A. The effect of keratoconus on the structural, mechanical, and optical properties of the cornea. J. Mech. Behav. Biomed. Mater. 2011;4:223–236. doi: 10.1016/j.jmbbm.2010.09.014. [DOI] [PubMed] [Google Scholar]
- 3.Abu-Amero KK, Al-Muammar AM, Kondkar AA. Genetics of keratoconus: Where do we stand? J. Ophthalmol. 2014;2014:1–11. doi: 10.1155/2014/641708. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Nielsen K, Hjortdal J, Pihlmann M, Corydon TJ. Update on the keratoconus genetics. Acta Ophthalmol. 2013;91:106–113. doi: 10.1111/j.1755-3768.2012.02400.x. [DOI] [PubMed] [Google Scholar]
- 5.Kenney MC, et al. Increased levels of catalase and cathepsin V/l2 but decreased TIMP-1 in keratoconus corneas: Evidence that oxidative stress plays a role in this disorder. Invest. Ophthalmol. Vis. Sci. 2005;46:823–832. doi: 10.1167/iovs.04-0549. [DOI] [PubMed] [Google Scholar]
- 6.Chwa M, et al. Hypersensitive response to oxidative stress in keratoconus corneal fibroblasts. Invest. Ophthalmol. Vis. Sci. 2008;49:4361–4369. doi: 10.1167/iovs.08-1969. [DOI] [PubMed] [Google Scholar]
- 7.Chwa M, et al. Increased stress-induced generation of reactive oxygen species and apoptosis in human keratoconus fibroblasts. Invest. Ophthalmol. Vis. Sci. 2006;47:1902–1910. doi: 10.1167/iovs.05-0828. [DOI] [PubMed] [Google Scholar]
- 8.Soiberman US, et al. Small molecule modulation of the integrated stress response governs the keratoconic phenotype in vitro. Invest. Ophthalmol. Vis. Sci. 2019;60:3422–3431. doi: 10.1167/iovs.19-27151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Karamichos D, et al. In vitro model suggests oxidative stress involved in keratoconus disease. Sci. Rep. 2014;4:4608. doi: 10.1038/srep04608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Jeong W-S, Jun M, Kong A-NT. Nrf2: a potential molecular target for cancer chemoprevention by natural compounds. Antioxid. Redox Signal. 2006;8:99–106. doi: 10.1089/ars.2006.8.99. [DOI] [PubMed] [Google Scholar]
- 11.Siow RCM, Ishii T, Mann GE. Modulation of antioxidant gene expression by 4-hydroxynonenal: atheroprotective role of the Nrf2/ARE transcription pathway. Redox Rep. 2007;12:11–15. doi: 10.1179/135100007X162167. [DOI] [PubMed] [Google Scholar]
- 12.Itoh K, et al. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem. Biophys. Res. Commun. 1997;236:313–322. doi: 10.1006/bbrc.1997.6943. [DOI] [PubMed] [Google Scholar]
- 13.Qiao J, et al. A rabbit model of corneal Ectasia generated by treatment with collagenase type II. BMC Ophthalmol. 2018;18:94. doi: 10.1186/s12886-018-0760-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Liu R, Yan X. Oxidative stress in corneal stromal cells contributes to the development of keratoconus in a rabbit model. Eur. J. Ophthalmol. 2021;31:3518–3524. doi: 10.1177/11206721211028745. [DOI] [PubMed] [Google Scholar]
- 15.Liu R, Yan X. Sulforaphane protects rabbit corneas against oxidative stress injury in keratoconus through activation of the Nrf-2/HO-1 antioxidant pathway. Int. J. Mol. Med. 2018;42:2315–2328. doi: 10.3892/ijmm.2018.3820. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hazeltine LB, Selekman JA, Palecek SP. Engineering the human pluripotent stem cell microenvironment to direct cell fate. Biotechnol. Adv. 2013;31:1002–1019. doi: 10.1016/j.biotechadv.2013.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Liu C, Feng P, Li X, Song J, Chen W. Expression of MMP-2, MT1-MMP, and TIMP-2 by cultured rabbit corneal fibroblasts under mechanical stretch. Exp. Biol. Med. (Maywood) 2014;239:907–912. doi: 10.1177/1535370214536650. [DOI] [PubMed] [Google Scholar]
- 18.Zhao H, et al. Microengineered in vitro model of cardiac fibrosis through modulating myofibroblast mechanotransduction. Biofabrication. 2014;6:045009. doi: 10.1088/1758-5082/6/4/045009. [DOI] [PubMed] [Google Scholar]
- 19.Engler AJ, et al. Myotubes differentiate optimally on substrates with tissue-like stiffness: pathological implications for soft or stiff microenvironments. J. Cell Biol. 2004;166:877–887. doi: 10.1083/jcb.200405004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Garagorri N, et al. Keratocyte behavior in three-dimensional photopolymerizable poly(ethylene glycol) hydrogels. Acta Biomater. 2008;4:1139–1147. doi: 10.1016/j.actbio.2008.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ahearne M, Lynch AP. Early observation of extracellular matrix-derived hydrogels for corneal stroma regeneration. Tissue Eng. Part C. Methods. 2015;21:1059–1069. doi: 10.1089/ten.tec.2015.0008. [DOI] [PubMed] [Google Scholar]
- 22.Last JA, Thomasy SM, Croasdale CR, Russell P, Murphy CJ. Compliance profile of the human cornea as measured by atomic force microscopy. Micron. 2012;43:1293–1298. doi: 10.1016/j.micron.2012.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Last J, Liliensiek S, Nealey P, Murphy C. Determining the mechanical properties of human corneal basement membranes with atomic force microscopy. J. Struct. Biol. 2009;167:19–24. doi: 10.1016/j.jsb.2009.03.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Andreassen TT, Simonsen AH, Oxlund H. Biomechanical properties of keratoconus and normal corneas. Exp. Eye Res. 1980;31:435–441. doi: 10.1016/S0014-4835(80)80027-3. [DOI] [PubMed] [Google Scholar]
- 25.Nash IS, Greene PR, Foster CS. Comparison of mechanical properties of keratoconus and normal corneas. Exp. Eye Res. 1982;35:413–424. doi: 10.1016/0014-4835(82)90040-9. [DOI] [PubMed] [Google Scholar]
- 26.Tse JR, Engler AJ. Preparation of hydrogel substrates with tunable mechanical properties. Curr. Protoc. cell Biol. Chapter. 2010;10:16. doi: 10.1002/0471143030.cb1016s47. [DOI] [PubMed] [Google Scholar]
- 27.Gefen A, Shalom R, Elad D, Mandel Y. Biomechanical analysis of the keratoconic cornea. J. Mech. Behav. Biomed. Mater. 2009;2:224–236. doi: 10.1016/j.jmbbm.2008.07.002. [DOI] [PubMed] [Google Scholar]
- 28.Gilbert PM, et al. Substrate elasticity regulates skeletal muscle stem cell self-renewal in culture. Science. 2010;329:1078–1081. doi: 10.1126/science.1191035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Behndig A, Karlsson K, Johansson BO, Brannstrom T, Marklund SL. Superoxide dismutase isoenzymes in the normal and diseased human cornea. Invest. Ophthalmol. Vis. Sci. 2001;42:2293. [PubMed] [Google Scholar]
- 30.Buddi R, et al. Evidence of oxidative stress in human corneal diseases. J. Histochem. Cytochem. 2002;50:341–351. doi: 10.1177/002215540205000306. [DOI] [PubMed] [Google Scholar]
- 31.Gondhowiardjo TD, van Haeringen NJ. Corneal aldehyde dehydrogenase, glutathione reductase, and glutathione S-transferase in pathologic corneas. Cornea. 1993;12:310–314. doi: 10.1097/00003226-199307000-00006. [DOI] [PubMed] [Google Scholar]
- 32.Gondhowiardjo TD, et al. Analysis of corneal aldehyde dehydrogenase patterns in pathologic corneas. Cornea. 1993;12:146–154. doi: 10.1097/00003226-199303000-00010. [DOI] [PubMed] [Google Scholar]
- 33.Arnal E, Peris-Martínez C, Menezo JL, Johnsen-Soriano S, Romero FJ. Oxidative stress in keratoconus? Invest. Ophthalmol. Vis. Sci. 2011;52:8592–8597. doi: 10.1167/iovs.11-7732. [DOI] [PubMed] [Google Scholar]
- 34.Kenney MC, Brown DJ. The cascade hypothesis of keratoconus. Contact Lens Anterior Eye. 2003;26:139–146. doi: 10.1016/S1367-0484(03)00022-5. [DOI] [PubMed] [Google Scholar]
- 35.Behndig A, Svensson B, Marklund SL, Karlsson K. Superoxide dismutase isoenzymes in the human eye. Investig. Ophthalmol. Vis. Sci. 1998;39:471–475. [PubMed] [Google Scholar]
- 36.Yong KW, et al. Paracrine effects of adipose-derived stem cells on matrix stiffness-induced cardiac myofibroblast differentiation via angiotensin II type 1 receptor and smad7. Sci. Rep. 2016;6:1–13. doi: 10.1038/srep33067. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Xu J, Sigworth FJ, LaVan DA. Synthetic protocells to mimic and test cell function. Adv. Mater. 2010;22:120–127. doi: 10.1002/adma.200901945. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Cheung IMY, Mcghee CNJ, Sherwin T. Beneficial effect of the antioxidant riboflavin on gene expression of extracellular matrix elements, antioxidants and oxidases in keratoconic stromal cells. Clin. Exp. Optom. 2014;97:349–355. doi: 10.1111/cxo.12138. [DOI] [PubMed] [Google Scholar]
- 39.Yang L, et al. Trichostatin A Inihibits TGF-β-induced reactive oxygen species accumulation and myofibroblast differentiation via enhanced Nrf2-ARE signaling. Mol. Pharmacol. 2013;83:671–680. doi: 10.1124/mol.112.081059. [DOI] [PubMed] [Google Scholar]
- 40.Lupasco T, et al. Corneal epithelium in keratoconus underexpresses active NRF2 and a subset of oxidative stress-related genes. PLoS One. 2022;17:e0273807. doi: 10.1371/journal.pone.0273807. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Shinde V, et al. RNA sequencing of corneas from two keratoconus patient groups identifies potential biomarkers and decreased NRF2-antioxidant responses. Sci. Rep. 2020;10:9907. doi: 10.1038/s41598-020-66735-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Monteiro de Barros MR, Chakravarti S. Pathogenesis of keratoconus: NRF2-antioxidant, extracellular matrix and cellular dysfunctions. Exp. Eye Res. 2022;219:109062. doi: 10.1016/j.exer.2022.109062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Hadvina R, et al. Exosomes and their miRNA/protein profile in keratoconus-derived corneal stromal cells. Exp. Eye Res. 2023;236:109642. doi: 10.1016/j.exer.2023.109642. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Cai J, Estes A, Liu Y. Omics analyses in keratoconus: from transcriptomics to proteomics. Curr. Ophthalmol. Rep. 2020;8:216–225. doi: 10.1007/s40135-020-00253-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.O’Brien WJ, Heimann T, Rizvi F. NADPH oxidase expression and production of superoxide by human corneal stromal cells. Mol. Vis. 2009;15:2535–2543. [PMC free article] [PubMed] [Google Scholar]
- 46.Kang KW, Lee SJ, Kim SG. Molecular mechanism of nrf2 activation by oxidative stress. Antioxid. Redox Signal. 2005;7:1664–1673. doi: 10.1089/ars.2005.7.1664. [DOI] [PubMed] [Google Scholar]
- 47.Wojcik KA, Blasiak J, Szaflik J, Szaflik JP. Role of biochemical factors in the pathogenesis of keratoconus. Acta Biochim. Pol. 2014;61:55–62. doi: 10.18388/abp.2014_1923. [DOI] [PubMed] [Google Scholar]
- 48.Wojcik KA, Kaminska A, Blasiak J, Szaflik J, Szaflik JP. Oxidative stress in the pathogenesis of keratoconus and Fuchs endothelial corneal dystrophy. Int. J. Mol. Sci. 2013;14:19294–19308. doi: 10.3390/ijms140919294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Dembo M, Wang YL. Stresses at the cell-to-substrate interface during locomotion of fibroblasts. Biophys. J. 1999;76:2307–2316. doi: 10.1016/S0006-3495(99)77386-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.He M, Pan H, Xiao C, Pu M. Roles for redox signaling by NADPH oxidase in hyperglycemia-induced heme oxygenase-1 expression in the diabetic retina. Investig. Opthalmology Vis. Sci. 2013;54:4092. doi: 10.1167/iovs.13-12004. [DOI] [PubMed] [Google Scholar]
- 51.Fleige S, et al. Comparison of relative mRNA quantification models and the impact of RNA integrity in quantitative real-time RT-PCR. Biotechnol. Lett. 2006;28:1601–1613. doi: 10.1007/s10529-006-9127-2. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available from the corresponding author [yanxiaoming7908@163.com] upon reasonable request.






