Genetic analysis of PALB2 gene WD40 domain in canine mammary tumour patients

Abstract

Background

DNA repair mechanisms are essential for tumorigenesis and disruption of HR mechanism is an important predisposing factor of human breast cancers (BC). PALB2 is an important part of the HR. There are similarities between canine mammary tumours (CMT) and BCs. As its human counterpart, PALB2 mutations could be a predisposing factor of CMT.

Objectives

In this study, we aimed to investigate the impacts of PALB2 variants on tumorigenesis and canine mammary tumor (CMT) malignancy.

Methods

We performed Sanger sequencing to detect germline mutations in the WD40 domain of the canine PALB2 gene in CMT patients. We conducted in silico analysis to investigate the variants, and compared the germline PALB2 mutations in humans that cause breast cancer (BC) with the variants detected in dogs with CMT.

Results

We identified an intronic (c.3096+8C>G) variant, two exonic (p.A1050V and p.R1354R) variants, and a 3′ UTR variant (c.4071T>C). Of these, p.R1354R and c.4071T>C novel variants were identified for the first time in this study. We found that the p.A1050V mutation had a significant effect. However, we could not determine sufficient similarity due to the differences in nucleotide/amino acid sequences between two species. Nonetheless, possible variants of human sequences in the exact location as their dog counterparts are associated with several cancer types, implying that the variants could be crucial for tumorigenesis in dogs. Our results did not show any effect of the variants on tumor malignancy.

Conclusions

The current project is the first study investigating the relationship between the PALB2 gene WD40 domain and CMTs. Our findings will contribute to a better understanding of the pathogenic mechanism of the PALB2 gene in CMTs. In humans, variant positions in canines have been linked to cancer‐related phenotypes such as familial BC, endometrial tumor, and hereditary cancer predisposition syndrome. The results of bioinformatics analyses should be investigated through functional tests or case‐control studies.

We investigated and found four substitutions in the canine PALB2 gene WD40 domain by Sanger sequencing and predicted their impacts on tumourigenesis by in silico analyses. Strikingly, we found that variant positions are associated with four different cancer types in humans when we compared the variant sites between two species. Functional experiments of the canine variants will show their effects in the future.

Abbreviations

3′UTR

3′ untranslated region

AIRE

autoimmun regulator

BC

breast cancer

CMT

canine mammary tumour

HR

homologous recombination

miRNA

microRNA

PALB2

partner and localizer of BRCA2

PAS

polyadenylation signal

PCR

polymerase chain reaction

SNP

single nucleotide polymorphism

TBE

tris boric acid EDTA

TF

transcription factor

1. INTRODUCTION

Breast cancers (BC) are the most common tumours in women and dogs (Ferlay et al., 2015; Sleeckx et al., 2011), both of which share anatomical and physiological similarities in terms of their mammary glands. Their shared malignancies and spontaneous occurrence in both BC and canine mammary tumours (CMT) make dogs a valuable model for comparative oncology (Kwon et al., 2023). Researchers have reported orthologous germline mutations between two species in several genes (Goebel & Merner, 2017).

Disruption of DNA repair mechanisms is critical for tumourigenesis (Bhattacharjee & Nandi, 2016). Homologous recombination (HR) provides an error‐free repair of damaged DNA chains in DNA double‐strand breaks (Sun et al., 2020). Failure of the proteins involved in the HR mechanism to fulfill their function can trigger cancer development by causing the accumulation of a series of mutations such as deletions, insertions and translocations in DNA and changes in the function and expression of damaged genes (Abass et al., 2016; Hodgson & Turashvili, 2020; O'kane et al., 2017; Trenner & Sartori, 2019,). Partner and Localizer of BRCA2 (PALB2) is a tumour suppressor in HR, interstrand cross‐link repair and replication fork collapse (Nepomuceno et al., 2017; Park, Zhang et al., 2014). RAD51 recombinase mediates strand invasion, strand exchange and D‐loop formation to repair the disrupted DNA chain in the HR mechanism. RAD51 must interact with BRCA2 for D‐loop formation to occur. PALB2 protein provides this interaction between BRCA2 and RAD51 proteins (Sun et al., 2020). The germline truncating mutations of the PALB2 gene identified in Finnish, Australian, Chinese, German, Italian, Dutch, North American, Polish, Russian, South African and Spanish populations and associated with inherited BC predispositions (Erkko et al., 2007; Southey et al., 2013). PALB2 has two significant domains that interact with BRCA2 or/and RAD51 proteins for its tumour suppressor function. The coiled‐coil region maintains the association of PALB2 with BRCA1 and RAD51 proteins, while the WD40 domain regulates the interaction between the PALB2 and BRCA2 and RAD51 proteins (Sun et al., 2020). Mutations in the WD40 domain are associated with BC, pancreatic cancer and ovarian cancer susceptibilities in humans (Nepomuceno et al., 2021). There are several damaging variants reported in the human PALB2 gene WD40 domain ( Boonen et al., 2019; Nepomuceno et al., 2021; Park, Singh et al., 2014). Moreover, variants of uncertain significance of the region impact the PALB2 stability (Boonen et al., 2020). The WD40 domain of the canine PALB2 protein is between the 1018th and 1355th residues (Ensembl 2021, The Uniprot Consortium 2021a).

In this study, we hypothesize the potential impact of germline mutations in the PALB2 gene WD40 domain on CMT development and malignancy as well as their similarities to its human homolog on BC development. Therefore, we investigated the nucleotide polymorphisms of the PALB2 gene WD40 domain in CMT patients, and their association with CMT development, comparing them with BCs.

2. MATERIAL AND METHODS

We used DNA extracts from blood samples of benign (n = 7) and malignant (n = 13) CMT patients and a healthy dog. The blood samples were collected for a previous project and authorized for reuse of the blood and DNA samples for the current project (Ankara University Animal Experiments Local Ethics Committee‐Date: 17 July 2018; Decision number: 2018‐15‐94). We extracted DNAs from the blood samples using a commercial kit (Qiagen, Blood and Tissue DNA extraction kit, Germany), as per the manufacturer's instructions. We measured DNA concentrations and purity with Nanodrop 2000 (ThermoFisher, Germany) spectrophotometry and visualized DNA integrities by SYBR^TM Safe Gel Stain (Thermo Fisher) stained 1% agarose gel electrophoresis in TBE (tris boric acid EDTA) solution. We loaded 1μL 2× loading dye and 2 μL DNA for all samples in the agarose gel and used a 1 kb ladder. Duration and voltage conditions were 25–30 min and 80 V, respectively.

We designed specific primer sets (Table 1) and used standard Taq DNA polymerase (recombinant (5U/μL) 500 units, Thermo Fisher) for polymerase chain reactions (PCR). The PCRs were performed using a Mastercycler Epgradient (Eppendorf) thermal cycler. The PCR mastermix and thermal cycler conditions are presented in Tables S1 and S2 in the Supporting Information, respectively. The PCR products were visualized by SYBR^TM Safe Gel Stain (Thermo Fisher) stained with 2% agarose gel electrophoresis in the TBE solution. We loaded 2 μL 2× loading dye and 2 μL PCR products for all samples in the agarose gel and used a 100 bp ladder. Duration and voltage conditions were 20 min and 120 V, respectively. Before cycle sequencing reactions, we performed isopropanol precipitation (Table S3 in the Supporting Information).

TABLE 1.

Specific primer sets for PCR and cycle sequencing reactions.

Primer	Sequence (5′−3′)	Region; length
WD40D1_F	GATGATGAATGAGCAATGCAGGA	Exon 6 (partial), intron 6 (partial); 257 bp
WD40D1_R	AGAATGAGGGGAACGCCTG
WD40D2_F	GAAACAGATCCCAAGTATGGCTTT	Intron 6 (partial), exon 7, intron 7 (partial); 280 bp
WD40D2_R	TGCCCAGCGACATTACCAT
WD40D3_F	AGAGGATGCTGAACTTTCTCA	Intron 7 (partial), exon 8, intron 8 (partial); 319 bp
WD40D3_R	AAACCTACTTTACAACTTGCACT
WD40D4_F	TGAAAAGGCTTACTCCTGAT	Intron 8 (partial), exon 9, intron 9 (partial); 302 bp
WD40D4_R	CCTAAAGCCCAGAAAAACAA
WD40D5_F	AAGGCAAGGGCTGCTTAGAA	Intron 9 (partial), exon 10, intron 10 (partial); 289 bp
WD40D5_R	CCCCCAAACAGTCATATTTACAGTC
WD40D6_F	TTCTCCCTTGGTCACTTCCT	Intron 10 (partial), exon 11, intron 11 (partial); 259 bp
WD40D6_R	CAGTGGGACCATTAGCAACA
WD40D7_F	ACCCTTTGTTTTCCCCACCG	Intron 11 (partial), exon 12, intron 12 (partial); 269 bp
WD40D7_R	TTTGCACACGTGCCTTCCA
WD40D8_F	CAGGGACTGGACACATGATTGC	Intron 12 (partial), exon 13 (partial); 550 bp
WD40D8_R	TGGTGCCACTACCATCAGAA
WD8_SeqF	GATCATTTTGCAGCCGCAGT	Exon 13 (partial), only for cycle sequencing reactions
WD8_SeqR	GCTGTGTTTTCATATCAGTAGCGG

Abbreviation: bp, base pairs.

The PCR products were sequenced using a BigDye Terminator v3.1 cycle sequencing kit. Amplification primers and additional primers for sequencing (Table 1) were used. BigDye Terminator v3.1 cycle sequencing kit was used as per the manufacturer's protocol. ZR DNA sequencing clean‐up kit (Zymo Research, USA) was used for the clean‐up procedure. ABI Prism 310 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) was used for capillary electrophoresis. Electropherograms were controlled and aligned to PALB2 reference sequences (ENSCAFG00000030772 and ENSCAFT00000049192.1) using BioEdit Sequence Alignment Editor version 7.2.5 (BioEdit, Carlsbad, USA).

We visualized the general effects of variants using the Ensembl variant effect predictor (VEP) (Mclaren et al., 2016). We examined conservation scores of coding region variants using the ConSurf server (Ashkenazy et al., 2016). The effects of the missense variant were examined by sorting intolerant from tolerant (SIFT) (Kumar et al., 2009), PolyPhen‐2 (Adzhubei et al., 2010), PROVEAN (Choi & Chan, 2015), MutPred2 (Pejaver et al., 2020) and SNPEffect4.0 (De Baets et al., 2012). The protein structure was modelled by SWISS‐MODEL (Waterhouse et al., 2018). Changes in ligand binding were controlled by FTSite binding site prediction (Kozakov et al., 2015) and FunFOLD2 (Roche et al., 2013). Transcription factors (TF) were detected by AnimalTFDB 3.0 (Hu, Miao et al., 2019). Micro RNAs (miRNA) were checked using miRWalk (Sticht et al., 2018), splice mechanisms by EX‐SKIP (Raponi et al., 2011) and human splicing finder (HSF) (Desmet et al., 2009), and alternative polyadenylation by Animal‐APAdb (Jin et al., 2021). The synonymous mutation was examined using the dbDSM v2.0 (Wen et al., 2016). DnaSP ver. 6.12.13 (Rozas et al., 2019) software was used to detect haplotype groups. We compared the canine variants with their human counterparts using the Ensembl comparative genomics‐genomic alignments tool and Ensembl VEP (Mclaren et al., 2016). For further information about in silico analyses, see Tables S4 and S5 in the Supporting Information.

3. RESULTS

DNA extractions, PCR and sequencing reactions were performed. We identified an intronic variant (c.3096+8C>G) in intron 6, and a missense variant (c.3149C>T/p.A1050V) in exon 7. Additionally, we identified a synonymous variant (c.4062C>T/p.R1354R) and a 3′ UTR variant (c.4071T>C) in exon 13 for the first time in this study. Information regarding the samples and variant distribution can be found in the Supporting Information. Figure 1 depicts electropherograms of wild‐type, mutant and heterozygous samples.

FIGURE 1.

Electropherograms of wild‐type, mutant and heterozygous samples. (a) g.22220063C>G splice region variant in intron 6; (b) c.3149C>T missense variant in exon 7; (c) c.4062C>T synonymous variant in exon 13; (d) c.4071T>C 3′ UTR variant in exon 13. Forward, electropherograms of forward sequences; reverse complement, electropherograms of reverse sequences (their reverse complements). Reverse readings of the electropherograms of exon 13 regions could not be performed due to thymine nucleotide repeats.

The identified variants were subjected to in silico analysis. The c.3096+8C>G is a splice region variant with low effect, previously recorded (rs24292038 SNP ID) in the Ensembl VEP. The position of the c.3096+8C>G intronic variant is c.2586+8G in the human PALB2 nucleotide sequence, as determined by the Ensembl Comparative Genomics alignments tool. The HSF revealed that all possible variants cause cryptic acceptor site activation and changes in splice mechanisms (Supporting Information).

The c.3149C>T (p.A1050V) is a missense variant with a medium effect. It has been previously recorded (rs853188656 SNP ID) in the Ensembl VEP database. 1050th residue (alanine) of the PALB2 protein sequence is highly conserved, buried and structural between species, as demonstrated by Figure S1 in the Supporting Information. The effects of the p.A1050V variant are summarized in Table 2. The protein structures of the wild‐type and the mutant sequences are depicted in Figure 2. Results of the FTSite Binding Site Prediction tool and the FunFOLD2 server can be found in Figure 3 and Figure 4, respectively. The miRWalk database revealed that cfa‐miR‐222, cfa‐miR‐8842, cfa‐miR‐8821 and cfa‐miR‐8846 miRNAs can bind to the variant region (Supporting Information). ELF1, EZH2, RELA, RUNX1, SP1 and TRIM28 can bind to the wild‐type nucleotide sequence of the variant. Autoimmun regulator (AIRE), EGR3 and SETDB1 can bind to the mutant‐type nucleotide sequence of the variant position. SPI1 and TCF4 can bind to both nucleotide sequences (Supporting Information). The mutant allele has a higher chance of exon skipping than the wild‐type allele as determined by EX‐SKIP (Figure S2 in the Supporting Information). The c.2639C>T variant (human position of the canine c.3149C>T) has a significant difference in ratios of exonic splicing enhancer (ESE) and exonic splicing silencer (ESS) motifs (−2), and there is a cryptic donor site activation and a potential change in splice mechanisms as revealed by HSF (Supporting Information).

TABLE 2.

The structural and functional effects of the canine p.A1050V/human p.A880V missense variant.

Tool	Method	Threshold	Canine results	Human results
SIFT	SIFT Sequence	0.05	0 (Deleterious)	0 (Deleterious)
PROVEAN	‐	−2.5	−2.450 (Neutral)	−2.612 (Deleterious)
PolyPhen‐2	Hum‐Div	0.5	0.991 (Probably damaging)	0.997 (Probably damaging)
	Hum‐Var	0.5	0.986 (Probably damaging)	0.881 (Possibly damaging)
MutPred2	‐	0.05	0.348	0.179
SNPEffect 4.0	TANGO		3.89 (No impact)	N/A
	WALTZ		23.83 (No impact)	N/A
	LIMBO		0.00 (No impact)	N/A

Note: TANGO predicts the aggregation‐prone regions in a protein sequence. WALTZ is an algorithm that accurately and specifically predicts amyloid‐forming regions in protein sequences. LIMBO is a chaperone binding site predictor for the Hsp70 chaperones, trained from peptide binding data and structural modelling.

Abbreviations: N/A, not available; PROVEAN, Protein variation effect analyzer; PolyPhen‐2, Polymorphism Phenotyping v2; SIFT, sorting intolerant from tolerant.

FIGURE 2.

WD40 domain models of wild‐type and mutant sequences. Made by SWISS‐model (Waterhouse et al., 2018). Blue arrows, variant sites.

FIGURE 3.

FTSite Binding site prediction (Kozakov et al., 2015) results of wild‐type and mutant sequences. White arrows, variant sites (between red dots). No difference has been found between wild‐type and mutant proteins for ligand‐binding regions.

FIGURE 4.

The FunFOLD2 server (Roche et al., 2013) results of wild‐type and mutant sequences. White arrows, ligand‐binding sites; red arrows, variant sites; red lines, ligand‐binding site amino acids; green lines, the 1050th amino acid position. Residues 1216 and 1268 are ligand‐binding regions of the wild‐type of protein sequence; however, residues 1009, 1216, 1268; 1047, 1048, 1049, 1050, 1051, 1052, 1053, 1054; 1014, 1015, 1016, 1017 and 1236 are ligand‐binding regions for the mutant protein sequence. On the mutant sequence, the 1050th amino acid is inside the ligand‐binding region.

The c.4062C>T (p.R1354R) is a synonymous variant with low effect in the Ensembl VEP database. The current study is the first to determine the presence of this synonymous variant. The p.R1354R position is not conserved (Figure S1 in the Supporting Information), and the arginine residue of the canine PALB2 protein is histidine in humans (The UniProt Consortium 2021b). The dbDSM v2.0 database has no records for the 1184th residue of the human PALB2 protein (human location of the canine p.R1354R). EP300, ESR1, KDM1A and TCF12 can bind to only the wild‐type sequences of c.4062C>T and c.4071T>C regions together (Supporting Information). EX‐SKIP shows that the chance of exon skipping in mutant alleles in exon 13 is higher than in wild‐type alleles (Figure S3 in the Supporting Information). HSF shows that the c.3552C>T and the c.3552C>A substitutions (human position of the canine c.4062C>T) change the ESE/ESS ratios significantly (−4 and −2, respectively). The c.3552C>G variant results in significant changes in ESE/ESS ratios (−4), cryptic acceptor site activation and changes in the splicing mechanism (Supporting Information). Animal‐APAdb shows that the variant position is a polyadenylation signal sequence (Supporting Information).

The c.4071T>C is a novel variant with a modifying effect in the Ensembl VEP database. FOXO3, FOXP2 and TCF7L2 can bind to only the wild‐type allele of the variant position. However, FOXP1 can bind to both the wild‐type and the mutant allele. EP300, ESR1, KDM1A and TCF12 can bind to only wild‐type sequences of the c.4062C>T and the c.4071T>C regions together (Supporting Information). According to HSF, c.*13T>A substitution (human position of the canine c.4071T>C) causes cryptic acceptor site activation and changes in the splicing mechanism. The c.*13T>G and the c.*13T>C substitutions cause significant changes in the ratios of ESE/ESS motifs (−5 and −3, respectively) (Supporting Information).

Haplotypes and sample distribution obtained by DnaSP results are presented in Tables S6 and S7, respectively, in the Supporting Information. Variants were compared between the canine and human species. The wild‐type nucleotide sequences differ between the two species for the c.3096+8C>G variant. According to the Ensembl VEP database, all potential substitutions of the c.3096+8C>G in humans are splice region variants with low impact.

The wild‐type nucleotides of the c.3149C>T variant in the human and canine PALB2 genes are the same. According to the Ensembl VEP database, all potential substitutions for the human PALB2 gene are missense variants with low impact in primer and alternate transcripts, and they are associated with at least a phenotype or disease. The SIFT scores of variants are 0 in the primer transcript, although the SIFT score of the c.2639C>G variant (human cDNA position of canine c.3149C>T) is 0.01. The PolyPhen scores are 0.956 for the c.2639C>A, 0.935 for the c.2639C>G, and 0.881 for the c.2639C>T, respectively. There are no phenotype or disease records for the c.2639C>T (p.A880V) variant in the Ensembl VEP database. However, SIFT, PolyPhen‐2, PROVEAN and MutPred2 results of the human p.A880V variant are shown in Table 2.

The wild‐type nucleotides of the c.4062C>T in the human and canine PALB2 genes are the same. The c.3552C>A and the c.3552C>G variants (human cDNA position of canine c.4062C>T) are missense mutations in all transcripts with medium impact in the Ensembl VEP database. The c.3552C>T variant is a synonymous mutation with low effect.

The wild‐type nucleotides of the c.4071T>C are the same in both species. According to the Ensembl VEP database, all potential substitutions have a modifier effect upon protein in this region in humans. All the human phenotype or disease records for the variant positions are listed in Table 3.

TABLE 3.

Human phenotype/disease records of the homolog nucleotide positions of the canine variants in the Ensembl database.

Canine region	Human variant	Amino acid change	Record	Phenotype/Disease	Details
Intron 6	c.2586+8G>A		rs1060504708	Familial cancer of the breast Hereditary cancer‐predisposing syndrome	Low significance/ likely benign
Exon 7	c.2639C>A	p.A880D	rs1597085237	Familial cancer of the breast	Low significance
	c.2639C>N		COSV55166669	Endometrium tumour	‐
	c.2640C>A/T	p.A880A	rs752928633	Familial cancer of the breast Hereditary cancer‐predisposing syndrome	Low significance/ likely benign
Exon 13	c.3550C>T	p.H1184Y	rs770692850	Hereditary cancer‐predisposing syndrome	Low significance
	c.3550C>N		COSV55168966	Lung tumour	‐
	c.3551del	p.H1184fs	rs1597061743	Familial cancer of the breast Hereditary cancer‐predisposing syndrome	Low significance
3′ UTR	c.*6_*13delinsAATTTGTATACCACTATTCA		rs1567204889	Hereditary cancer‐predisposing syndrome	Low significance/ likely benign

4. DISCUSSION

Researchers have reported that disruptions in the tumour suppressor effect of the BRCA2, RAD51 and PALB2 complex cause cancers, particularly BCs (Deveryshetty et al., 2019; Hodgson & Turashvili, 2020; Nepomuceno et al., 2017; Park, Zhang et al., 2014; Prakash et al., 2015). HR is essential for DNA double‐strand break repair and cancer prevention (Hodgson & Turashvili, 2020; O'kane et al., 2017; Trenner & Sartori, 2019). Studies have shown a relationship between mutations in the BRCA2 (Borge et al., 2011; Enginler et al., 2014; Kaszak et al., 2018; Lüder Ripoli et al., 2016; Ozmen et al., 2017a) and RAD51 genes and CMT (Canadas et al., 2018; Ozmen et al., 2017b; Uemura et al., 2019). The significance of PALB2 mutations in BCs is well known and is routinely monitored (Cock‐Rada et al., 2018; Schroeder et al., 2015; Slavin et al., 2015; Yao et al., 2020). Additionally, the PALB2 gene WD40 domain interacts with the BRCA2 and RAD51 proteins (Ducy et al., 2019; Oliver et al., 2009; Siaud et al., 2011; F. Zhang et al., 2009). This study is the first investigation of the relationship between the canine PALB2 gene WD40 domain and CMTs. Within the project's scope, we detected an intronic variant, two exonic variants and a 3′ UTR variant in CMT cases.

We used the most common CMT histopathology for our investigation (Atalay Vural & Aydin, 2001; Erer & Kıran, 1993; Gülçubuk & Gürel, 2003). There was no significant association between malignancy and variations in the current project. Because of the low genetic heterogeneity of dogs, breed predispositions are crucial in tumourigenesis (Sargan, 2012). A larger sample size is necessary to investigate breed predispositions further.

The functions of proteins can be affected by several steps and impacts in their journey from genetic information to degradation. Genetic and epigenetic variations could affect a protein's abundance, activity, specificity and affinity. Substitutions, deletions, insertions and indels change the primary structure. Moreover, transcription, mRNA processing and translation could be affected by nucleotide variants (Vihinen, 2021). The results of in silico analysis are significant. The intronic variant is a splice region variant. Splice region variants could change the splicing mechanism and cause alternative transcripts (Desmet et al., 2010). The HSF tool results of its human homolog support that it can cause a cryptic acceptor site activation and change the splicing mechanism. Although the reference genome has only one PALB2 transcript, the Great Dane genome (ENSCAFG00040003287) has three transcripts in the Ensembl VEP database (ENSCAFT00040006272.1, ENSCAFT00040006296.1, ENSCAFT00040006272.1). The intronic variant can create an alternate transcript by changing the splicing mechanism and so further investigation is needed. The rs1060504708 SNP of the human PALB2 gene is associated with hereditary cancer predisposition syndrome, so it is possible that similar impacts exist between the two species.

Changes in the primary structures of proteins determine the secondary and tertiary structures and the three‐dimensional folding (Selzer et al., 2019). In transient protein–protein interactions, even the state of the folding structure of the protein in different physiological conditions and environments affects the protein's function through binding dynamics (Nooren, 2003). Therefore, alterations in the primary structure can significantly affect protein function. The p.A1050V substitution is the only variant that changes amino acid sequence occurs in a highly conserved, buried and structural residue. Residues that are conserved among species may have a critical function, and a possible mutation can harm the organism. Despite the neutral PROVEAN score for the canine variant, the PROVEAN tool is designed for the human variations (Choi & Chan, 2015) and the result of the human homolog is deleterious. SIFT, PolyPhen‐2 and MutPred2 results are similar for both species and noteworthy. The FTSite Binding Site Prediction and the FunFOLD2 have inconsistencies in their ligand‐binding analysis. According to the FunFOLD2 server, the substitution alters the ligand‐binding sites. The Ensembl VEP database does not contain any phenotype or disease information about the human p.A880V (the human homolog of the canine p.A1050V). However, data on p.A880D and the variant position related to familial BC, endometrial tumour and hereditary cancer predisposition syndrome are interesting. Additionally, the lack of information about the relationship between the p.A880V variant and tumour phenotype in humans does not preclude its appearance in humans. To clearly understand the impacts on the CMTs, case–control studies or functional tests are advised. The p.A1050V variant is also noteworthy because it can bind microRNAs to its position.

MicroRNAs (miRNA) are non‐coding RNA molecules that play a crucial role in post‐transcriptional gene regulation. miRNAs exhibit oncogenic or tumour‐suppressive effects on tumour progression, invasion and metastasis in humans. Therefore, they are significant in terms of early diagnosis, prognosis and identification of risks, and as targets that have the potential to be used clinically in personalized cancer treatments and preventive medicine (Asiaf et al., 2018; Sethi, 2014). In CMT cases, miRNAs also exhibit similar effects (Boggs et al., 2008; Cullen & Breen, 2016; Fish et al., 2018; Kaszak et al., 2018). In miRNA–mRNA interactions, single nucleotide polymorphisms (SNPs) occurring in nucleotide sequences may cause stronger or weaker binding due to changes in transcript and miRNA affinity at binding sites (Ying, 2008). The nucleotide sequence of cfa‐miR‐222 is conserved with hsa‐miR‐222‐3p (MIMAT0000279) in humans (Kozomara et al., 2019). Although hsa‐miR‐222‐3p can bind to human PALB2 transcripts, it binds to different regions of the transcripts compared to cfa‐miR‐222 (Sticht et al., 2018). It is an oncomiR associated with drug resistance (Rinnerthaler et al., 2016; S. Zhang et al., 2020), poor prognosis and metastasis in lymph nodes. Treatment with miR‐222‐3p antagonists can be strengthened as support in chemotherapy (Mavrogiannis et al., 2018). miR‐222‐3p has the potential as a biomarker in the diagnosis and prognosis of BC, and it can be targeted to control malignancy (Amini et al., 2018; Y. Wang et al., 2018). Therefore, it is speculated that cfa‐miR‐222 might have similar effects on human BC cases. However, cfa‐miR‐8842, cfa‐miR‐8821 and cfa‐miR‐8846 do not have homologs in humans, and no studies on these miRNAs in dogs exist.

Splice region variants are not the only variants that can affect the splicing mechanism (Desmet et al., 2010). The EX‐SKIP tool reported a higher probability of exon skipping in mutant sequences. In the HSF tool, only the c.2639C>T change was found to cause alterations in the splice enhancer and silencer motif ratios and it may also activate a cryptic donor site at that position. Remarkably, the c.2639C>T variant in humans is substituted by a thymine nucleotide in the dog transcript in exon 7, creating a new donor site and altering auxiliary signals. The p.A1050V variant may also affect the alternative splicing mechanism.

Changes in the activity of several genes and proteins play a role in transforming normal cells in the breast tissue into malignant ones, and various hormones acting as TFs have essential effects in this process (Mester & Redeuilh, 2012). SNPs occurring in TF‐binding sites can change the affinity of regulatory proteins to these sites, cause new TF‐binding sites or adversely affect TF binding, leading to complex diseases and pathological conditions (Degtyareva et al., 2021).

In exon 7, ELF1, EZH2, RELA, RUNX1, SP1 and TRIM28 can only bind to the wild‐type nucleotide sequence. ELF1 is substantial for BC treatment and prognosis (Dittmer, 2011; Scott et al., 1994) and is associated with BRCA2 (Davis et al., 1999). Changes in EZH2 can have both tumour‐suppressive and tumourigenic effects depending on the situation (Anwar et al., 2021) owing to its roles in chromatin remodelling and DNA methylation (Chase & Cross, 2011; Simon & Lange, 2008; Zeidler & Kleer, 2006). It also targets the RAD51 gene and BRCA1, which have an aggressive character and poor prognosis, increasing its expression in triple‐negative BCs (Bae & Hennighausen, 2014). RELA (p65) regulates the expression of many genes involved in the control of cellular proliferation, neoplastic transformation and apoptosis, causing an increase in the expression of oncogenes and stimulating gene expressions that will trigger metastasis (Biswas et al., 2019; Bouchal et al., 2015; Kim et al., 2018; Lee et al., 2011; Lerebours et al., 2008; Liu et al., 2012; Ricca et al., 2001). RUNX1 can act as an oncogene or a tumour‐suppressor (Chimge & Frenkel, 2013; Groner et al., 2017; Janes, 2011) and its regulation may be impaired in tumour formations (Chimge & Frenkel, 2013; Janes, 2011). SP1 regulates several oncogenes in BC (Duan et al., 1998; Khan et al., 2003; Maor et al., 2006; Petz & Nardulli, 2000; Petz et al., 2004; Qin et al., 1999; Schultz et al., 2003; Sisci et al., 2010; Stoner et al., 2004; Xie, 1999) and is also involved in BRCA1 transactivation (Maor et al., 2007). TRIM28 expression inhibits cell proliferation in breast and lung tumour cell cultures by suppressing TFs in the E2F family (L. Chen et al., 2012).

On the other hand, AIRE, EGR3 and SETDB1 can bind to the mutant sequence. There is a significant correlation between AIRE expression and good prognosis in estrogen receptor positive (ER +) BC cases, and AIRE expression in luminal BC cell lines is associated with a decrease in tumour aggression (Bianchi et al., 2016). EGR3 is associated with BC progression, metastasis, recurrence and invasion (Hayashi & Yamaguchi, 2008; Inoue et al., 2004, Suzuki et al., 2007). SETDB1 is associated with the induction of epithelial‐mesenchymal transition (EMT), cancer stem cell formation, cancer cell motility, invasion, metastasis and sensitivity to some cancer drugs (H. Du et al., 2018; Zhang et al., 2014). On the other hand, SETDB1 deficiency suppresses cell migration and invasion, and its downregulation reduces lung metastasis in vivo. Moreover, increased overexpression of SETDB1 stimulates EMT through SNAIL in the MCF7 cell line (Yang et al., 2019). The missense variant is essential for protein structure and function changes. The possibility of exon skipping and changes in miRNA‐binding affinity and TF‐binding potential could have cumulative impacts on the protein expression and function. The impact of missense or truncating mutations in genes that are active in the HR mechanism was studied by functional tests in dogs. The protein–protein interactions between RAD51 and BRCA2 were investigated using a mammalian two‐hybrid assay (Ochiai et al., 2015, 2011) and a competitive ELISA test (Yoshikawa et al., 2012) for BRCA2 mutations. Another study focused on the determination of the functional impact of the highly conserved residue of BRCA2 on the relationship between RAD51 and BRCA2 proteins by co‐immunoprecipitation and mammalian two‐hybrid assays (Zhu et al., 2023). As the same, RAD51 mutations' effects on RAD51 and PALB2 interactions were investigated using mammalian two‐hybrid assay and pull‐down (PD) assays (Uemura et al., 2019). Our aim was the detection of PALB2 polymorphisms in the study, and we did not conduct any functional experiments for further analysis. However, we advise similar strategies for the p.A1050V variant to determine its functional impacts.

The synonymous variant and the 3′ UTR variant were together; they could be a haplotype, but we did not use plasmids for sequencing and have yet to get any information about it. Synonymous mutations do not change the amino acid sequence. However, they can change the secondary structure and stability of mRNA, the interaction of mRNA with specific ligands and the alteration of codons read by tRNAs with different cellular availability, which can affect translation kinetics and protein folding (Fernández‐Calero et al., 2016). Moreover, splice accuracy and efficiency are associated with changes in translation speed depending on codon matching (Cartegni et al., 2002; Fernández‐Calero et al., 2016; Li et al., 2021; Pagani et al., 2005). Synonymous mutations can cause several pathological conditions in humans (Kimchi‐Sarfaty et al., 2007; Li et al., 2021; Pagani et al., 2005; Rauscher & Ignatova, 2018). The p.R1354R variant is not a highly conserved residue. The human species has a histidine instead of an arginine residue at this position (The Uniprot Consortium 2021c). The Animal‐APAdb indicates the nucleotide position of the variant is in a polyadenylation site cluster.

The variant can affect mRNA processing via the alternative polyadenylation (APA) mechanism. APA is the last process in the formation of mature mRNA and has several effects on the translation efficiency, stability and localization of mRNA, causing differences in protein activities (W. Chen et al., 2017). Studies show that differences exist between cancerous and healthy tissues with respect to APAs, making the APA mechanism significant (Yuan et al., 2021).

The EX‐SKIP tool result shows a higher probability of exon skipping in the mutant sequences for both the exon 13 and the 3′ UTR variants. According to HSF, ratios of auxiliary motifs differed for all possible variants. Additionally, cryptic acceptor region activation was reported for the c.3552C>G. In the exon 13 region, proportional changes have only been reported in the helper motifs of the c.3552C>T human variant (canine homolog). TFs that can bind to the region covering the positions of both variants in exon 13 and the 3′ UTR region were detected. EP300, ESR1, KDM1A and TCF12 can only bind to the wild‐type sequence. EP300 is a tumour suppressor in cell proliferation and differentiation and is also involved in the cell cycle (Wirtenberger et al., 2006). It is responsible for regulating BRCA1 expression (Q. Wang et al., 2013), and it increases the expression of genes that affect metastasis by participating in cell migration (He et al., 2015). ESR1, also known as Erα, is affected by steroid hormones that can influence the growth, proliferation and metastasis of BC cells (Bettuzzi et al., 1992; Hansen & Fuqua, 1999). Estrogens exert their proliferative effects through the ER (Hansen & Fuqua, 1999). In BCs, loss of ER is associated with aggressive characteristics (Degraffenried et al., 2002), endocrine resistance (Freitag et al., 2021), recurrence and poor prognosis (Stossi et al., 2012). In the absence of a functional BRCA1, the expression of ESR1 mRNA decreased, and Oct‐1 and BRCA1 should interact with the promoter region of ESR1 for ESR1 expression (Hosey et al., 2007). KDM1A (LSD1) has histone demethylase activity (Perillo et al., 2020) and acts as a tumour suppressor by suppressing invasion, cell migration and metastasis in luminal BCs (Bennesch et al., 2016; Hu et al., 2019; Tu et al., 2020; Zheng et al., 2018). TCF12 expression in the stroma of invasive BC tissues is higher than in normal breast tissues, and in ER‐BC tissues, it is higher than in ER+ cases, which is associated with a poor prognosis (Tang et al., 2016). Although it is not a conserved region, potential human variants which occur at the nucleotide position of the synonymous variant are associated with familial BC, hereditary cancer predisposition syndrome and lung tumours in the Ensembl VEP (Mclaren et al., 2016).

The 3′ UTR variant present in the transcript but not involved in protein structure was analysed to investigate the splicing mechanism and TF binding. With the result of EX‐SKIP, HSF detected changes in splice enhancer and silencer motif ratios in the c.*13T>G and c.*13T>C possible variants (human) and reported cryptic acceptor region activation in the c.*13T>A variant. The c.4071T>C variant may also affect the splicing mechanism. According to the analysis results for TF‐binding sites, FOXO3, FOXP2 and TCF7L2 bind to the wild‐type sequence of the c.4071T>C position but not to the mutant sequence. FOXO3 has a tumour suppressor function and interacts with Erα and Erb, inhibiting cell growth (Zou et al., 2008). Its high expression is associated with a good prognosis, survival time and a period without distant metastasis (Habashy et al., 2011). Researchers have defined FOXO3 as a prognostic marker (Jiang et al., 2013). Although there is a suppression of invasion and metastasis in ER+ cases, these characteristics increase in ER cases (Sisci et al., 2013). On the other hand, FOXO3 expression stimulates the expression of miR‐29b‐2 and miR‐338 and suppresses EMT, cell migration, invasion and metastasis through these miRNAs (Song et al., 2021). FOXP2 may be a tumour suppressor (Cuiffo et al., 2014). A decrease in FOXP2 expression stimulates invasion and cell migration in BC (M. T. Chen et al., 2018). Moreover, FOXP2 interacts with FOXA2 in BC cells and inhibits EMT (Liu et al., 2021). TCF7L2 has oncogenic effects of abnormal gene expression. Its expression decreases in BC cases compared to normal breast tissue (El‐Tanani et al., 2008). Several studies and meta‐analyses reported that the polymorphisms of TCF7L2 are associated with BC predisposition (Burwinkel et al., 2006; J. Chen et al., 2013; Connor et al., 2012; Goode et al., 2009; Lu et al., 2015; Min et al., 2016; Naidu et al., 2012; F. Wang et al., 2015; Y. Wang et al., 2021; M. Zhang et al., 2018). TCF7L2 can cause effects such as proliferation and invasion in cancer cells by stimulating the transcription of miRNAs through the miR‐21 (Kang, 2011). According to the Ensembl VEP, an indel mutation occurs at the nucleotide position of the 3′ UTR region variant in humans associated with hereditary cancer predisposition syndrome (Mclaren et al., 2016). This indicates that the variant may be significant for CMT.

The current project is the first study investigating the relationship between the PALB2 gene WD40 domain and CMTs. We identified four variants and assessed their impacts on CMTs through in silico analyses. The synonymous and the 3′ UTR variants are novel variants in the exon 13 region. The most significant variant detected through in silico analysis was the p.A1050V in exon 7. We observed that these variants did not affect the tumour malignancy. In humans, variant positions in canines have been linked to cancer‐related phenotypes such as familial BC, endometrial tumour and hereditary cancer predisposition syndrome. However, there are limitations in the similarity between the two species concerning the PALB2 sequence, and further research is necessary. The results of bioinformatics analyses should be investigated through functional tests or case–control studies.

AUTHOR CONTRIBUTIONS

ÖŞÇ: DNA extractions; PCR; Sanger sequencing; bioinformatics and in silico analysis. ÖÖ: Hypothesis; experimental design; bioinformatics and in silico analysis. SK: Hypothesis and experimental design. AR: Hypothesis; experimental design and sample collection. GÖ: Hypothesis; experimental design and sample collection. AS: Hypothesis; experimental design and sample collection. OK: Hypothesis; experimental design and histopathologic analyses.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflict of interest.

ETHICS STATEMENT

The blood and DNA samples are authorized for reuse for the current project (Ankara University Animal Experiments Local Ethics Committee‐Date: 17.07.2018; Decision number: 2018‐15‐94).

‐ Approval of the research protocol by an Institutional Reviewer Board: Ankara University Animal Experiments Local Ethics Committee approved the research protocol.

‐ Informed Consent: N/A

‐ Registry and the Registration No. of the study/trial: Ankara University, The Scientific Research Projects Coordinator, Project number: 19L0239005. Ankara University Animal Experiments Local Ethics Committee, Approval date: 17.07.2018, Decision number: 2018‐15‐94.

‐ Animal Studies: N/A

Supporting information

Genbank accesion numbers: OQ721107, OQ721108, OQ721109, OQ721110, OQ721111, OQ721112 (identical sequences of different objects) for novel mutations in the current research.

Supplementary material

Supplementary material

Çıldır, Ö. Ş. , Özmen, Ö. , Kul, S. , Rişvanlı, A. , Özalp, G. , Sabuncu, A. , & Kul, O. (2024). Genetic analysis of PALB2 gene WD40 domain in canine mammary tumour patients. Veterinary Medicine and Science, 10, e1366. 10.1002/vms3.1366