Phylogeny and species diversity of the genus Helvella with emphasis on eighteen new species from China

Abstract

Abstract: Helvella is a widespread, frequently encountered fungal group appearing in forests, but the species diversity and molecular phylogeny of Helvella in China remains incompletely understood. In this work, we performed comprehensive phylogenetic analyses using multilocus sequence data. Six datasets were employed, including a five-locus concatenated dataset (ITS, nrLSU, tef1-α, rpb2, hsp), a two-locus concatenated dataset (ITS, nrLSU), and four single-locus datasets (ITS) that were divided based on the four different phylogenetic clades of Helvella recognized in this study. A total of I 946 sequences were used, of which 713 were newly generated, including 170 sequences of ITS, 174 sequences of nrLSU, 131 sequences of tef1-α, 107 sequences of rpb2 and 131 sequences of hsp. The phylogeny based on the five-locus concatenated dataset revealed that Helvellas. str. is monophyletic and four phylogenetic clades are clearly recognized, i.e., Acetabulum clade, Crispa clade, Elastica clade, and Lacunosa clade. A total of 24 lineages or subclades were recognized, II of which were new, the remaining 13 corresponding with previous studies. Chinese Helvella species are distributed in 22 lineages across four clades. Phylogenetic analyses based on the two-locus concatenated dataset and four single-locus datasets confirmed the presence of at least 93 phylogenetic species in China. Among them, 58 are identified as known species, including a species with a newly designated lectotype and epitype, 18 are newly described in this paper, and the remaining 17 taxa are putatively new to science but remain unnamed due to the paucity or absence of ascomatal materials. In addition, the Helvella species previously recorded in China are discussed. A list of 76 confirmed species, including newly proposed species, is provided. The occurrence of H. crispa and H. elastica are not confirmed although both are commonly recorded in China.

Citation: Mao N, Xu YY, Zhang YX, Zhou H, Huang XB, Hou CL, Fan L (2023). Phylogeny and species diversity of the genus Helvella with emphasis on eighteen new species from China. Fungal Systematics and Evolution 12: 111–152. doi: 10.3114/fuse.2023.12.08

INTRODUCTION

Helvella (1753) is one of the most conspicuous members of Helvellaceae. Almost all Helvella species have saddle-shaped ascocarps with cupulate or lobed caps on a distinct stipe, and ellipsoid ascospores with a large central oil drop with the exception of the H. macropus complex which has subfusoid ascospores. Helvella species are extraordinarily common and widely distributed in terrestrial biomes of the Northern and Southern Hemispheres (Skrede et al. 2017, 2020). Some of them have great dietary and health value, such as, H. bachu, H. lacunosa and H. taiyuanensis (Liu et al. 1985, Shameem et al. 2016, Zhao et al. 2016a). Ecologically, some species in this genus form ectomycorrhizal associations with host plants (Pinaceae and Fagaceae) (Maia et al. 1996, Tedersoo et al. 2006, Hwang et al. 2015).

As a frequently encountered and important fungal group, the systematics and species diversity of Helvella have been widely studied by mycologists from different parts of the world, especially from Europe and North America (Dissing 1966a, b, Korf 1972, Weber 1972, 1975, Harmaja 1979, Häffner 1987, Abbott & Currah 1997, Landeros et al. 2012, 2015, Nguyen et al. 2013, Skrede et al. 2017, 2020, 2023, Hansen et al. 2019, Løken et al. 2019). The ascoma shape and colour, pubescence on the apothecium receptacle surface, ascospore size and shape are highlighted in the identification of Helvella species. However, it's difficult to discriminate the difference between Helvella species with only morphology. Molecular systematics and DNA barcode sequences as a robust tool to identify fungal species have been applied to taxonomic studies of Helvella, which are useful for establishing the species concepts of Helvella (Landvik et al. 1999, Hansen & Pfister 2006, Tedersoo et al. 2006, Laessoe & Hansen 2007, Nguyen et al. 2013, Landeros et al. 2015, Skrede et al. 2017, 2020, 2023, Hansen et al. 2019, Wang et al. 2019, 2023a, b, Lu et al. 2023, Yu et al. 2023). For example, Landeros et al. (2015) revealed Helvella is monophyletic by analysing partial nrLSU data. Skrede et al. (2017) assessed species boundaries within Helvella in Europe by using morphology and phylogenetic evidence from four loci – heat shock protein 90 (hsp), translation elongation factor alpha (tef1-α), RNA polymerase II second largest subunit (rpb2) and the nuclear large subunit ribosomal DNA (nrLSU), in which a total of 55 species in Europe were identified, 30 species were designated neo- and epitypes, and seven new species were described.

In China, based on morphology, or both morphology and molecular data, a lot of research has been focused on the taxonomy of Helvella (Teng 1963, Liu et al. 1985, Cao 1988, Liu & Cao 1988, Cao & Liu 1990, Cao et al. 1990, Zhuang 1995, 1996, 1997, 1998a, b, Zhuang & Wang 1998, Wang & Chen 2002, Xu 2002, Zhuang 2004, Zhuang & Yang 2008, Ariyawansa et al. 2015, Zhao et al. 2015, Hyde et al. 2016, Wang et al. 2016, 2019, 2023a, b, Zhao et al. 2016a, b, Tibpromma et al. 2017, Xu et al. 2022, Yu et al. 2023). Recently, 16 new species and two new Chinese records were determined based on morphology and molecular phylogenies infered from ITS, LSU, tef1-α, and hsp (Wang et al. 2023a). Presently, a total of 90 species are recorded from China, but molecular evidence lack for 37 species. Moreover, many newly introduced collections did not match to previously known species either in morphology or molecular analysis. It is therefore necessary to thoroughly revise records of Chinese Helvella spp. In the present study, five highly informative genetic markers (ITS, nrLSU, tef1-α, rpb2, hsp) were used in our molecular analyses. Morphological features and DNA-based molecular analyses were conducted based on the specimens gathered from many parts of China, combined with existing type specimens and sequences available in the GenBank database. Our aims were to: 1) readdress the infrageneric group limits and relationships within Helvella; 2) clarify the species diversity and phylogenetic relationships of Helvella in China, and 3) describe and illustrate new species found in China based on both molecular and morphological data.

MATERIALS AND METHODS

Sample collections

Samples collected in China were examined. Voucher specimens were accessioned in the Herbarium Biology Department at Capital Normal University (BJTC). Additional specimens on loan from other fungaria were also studied. The principal fungaria were the Herbarium Mycologicum Academiae Sinicaea at the Institute of Microbiology, Chinese Academy of Sciences (HMAS) and the Herbarium of Cryptogams at the Kunming Institute of Botany, Chinese Academy of Sciences (HKAS), Herbarium of Mycology of Jilin Agricultural University (HMJAU), and the Hebarium of Shanxi Institute for Functional Foods, Shanxi Agricultural University (HSA). Macroscopic characters were described from fresh and dried material. Microscopic characteristics were observed in sections obtained from dried specimens mounted in 5 % KOH, Congo Red, cotton blue, Melzer's reagent, or water.

DNA extraction, PCR amplification, sequencing and nucleotide alignment

Dried specimens were crushed by shaking for 3 min at 30 Hz (Mixer Mill MM 301, Retsch, Haan, Germany) in a 1.5 mL tube together with one 3-mm-diam tungsten carbide ball, and total genomic DNA was extracted using the E.Z.N.A. Fungal DNA kit (Omega Bio-Tek Inc. Norcross, Georgia, USA) following the manufacturer's protocol. Polymerase chain reactions (PCR) were performed to amplify partial sequences from the five partial genes (ITS, nrLSU, tef1-α, rpb2, hsp) with previously published primer sets. The details of primer combinations, optimized PCR annealing temperatures and references for published primers are provided (Table 1).

Table 1.

Sequences of primers, citations for previously published primers and annealing temperature used for PCR amplification of sequences generated for this study.

Gene region	Forward primer	Primer sequence (5’–3’)	Reverse primer	Primer sequence (5’–3’)	PCR annealing temp (°C)	References
ITS	ITS1-F	CTTGGT CATTTAGAGGAAGTAA	ITS4	TCCTCCG CTTATTGATATG C	53 or 55	White et al. (1990)
ITS2	ITS3	GCATCGATGAAGAACGCAGC	ITS4	(see above)	55	White et al. (1990)
nrLSU	LROR	ACCCGCTGAACTTAAGC	LR5	TCCTGAGGGAAACTTCG	55	Vilgalys & Hester (1990)
tef1-α	EF1-983F	GCYCCYGGHCAYCGTGAYTTYAT	EF1-2218R	ATGACACCRACRGCRACRGTYTG	touchdown	Rehner & Buckley (2005)
rpb2	fRPB2-7cF	ATGGGYAARCAAGCYATGGG	fRPB2-11aR	GCRTGGATCTTRTCRTCSACC	touchdown	Liu et al. (1999)
hsp	H_hspf	CRGGCATCCGGGTGACGTAAT	H_hspr	AGGGKGTTGTCGACTCCGAGG	58	Skrede et al. (2017)

Amplification reactions were performed in 25 μL reaction volumes containing 2 μL DNA template, 1 μL per primer (10 μM), 12.5 μL 2× Master Mix (TiangenBiotech Co., Beijing, China), and 8.5 μL ddH₂O.

Amplification reactions were performed as follows: for the ITS or ITS2 gene: initial denaturation at 94 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, 53 or 55 °C for 45 s, 72 °C for 55 s, and a final extension at 72 °C for 10 min; for the nrLSU gene: initial denaturation at 94 °C for 4 min, followed by 35 cycles at 94 °C for 30 s, 55 °C for 45 s, 72 °C for 1 min, and a final extension at 72 °C for 10 min; for the tef1-α gene: initial denaturation at 94 °C for 3 min, followed by 11 cycles including denaturation at 94 °C for 30 s, annealing temperature started at 64 °C (decreased by 1 °C per cycle, until to 54 °C) for 45 s and extension at 72 °C for 1 min, then followed by 30 cycles at 94 °C for 35 s, 56 °C for 45 s, 72 °C for 1 min, and a final extension at 72 °C for 10 min; for the rpb2 gene: initial denaturation at 94 °C for 3 min, followed by 11 cycles including denaturation at 94 °C for 30 s, annealing temperature started at 62 °C (decreased by 1 °C per cycle, until to 52 °C) for 45 s and extension at 72 °C for 1 min, then followed by 30 cycles at 94 °C for 35 s, 55 °C for 45 s, 72 °C for 1 min, and a final extension at 72 °C for 10 min; for the hsp gene: initial denaturation at 94 °C for 4 min, followed by 35 cycles at 94 °C for 30 s, 58 °C for 45 s, 72 °C for 1 min, and a final extension at 72 °C for 10 min. The PCR products were sent to Beijing Zhongkexilin Biotechnology Co. Ltd. (Beijing, China) for purification and sequencing. The newly generated sequences were assembled and edited using SeqMan (DNA STAR package; DNAStar Inc., Madison, WI, USA) with generic-level identities for sequences confirmed via BLAST queries of GenBank.

A total of 713 Helvella sequences from our 186 collections were used in the molecular phylogenetic analyses, of which 170 in ITS, 174 in nrLSU, 131 in tef1-α, 107 in rpb2, and 131 in hsp. Sequences of all DNA regions generated in this study were deposited in GenBank. Other sequences of Helvella and related species obtained from GenBank are based on published literature (Nguyen et al. 2013, Landeros et al. 2012, 2015, Zhao et al. 2015, Hyde et al. 2016, Wang et al. 2016, 2019, 2023a, Zhao et al. 2016a, b, Skrede et al. 2017, 2020, 2023, Hansen et al. 2019, Løken et al. 2019), or selected by using the BLASTn search function of the NCBI database to find similar matches with taxa in Helvella. For ITS sequence data, the genus search tool in GenBank database was used for retrieving Helvella-related ITS sequences. The accession numbers of new and downloaded sequences stored in the NCBI GenBank nucleotide database (http://www.ncbi.nlm.nih.gov/) are provided in Supplementary Tables S1–S6.

Six molecular datasets were assembled for this study. Dataset I was comprised of five gene fragments (ITS/nrLSU/tef1-α/rpb2/ hsp) and contained all the Helvella species with available DNA data worldwide. The phylogenetic trees derived from the singlegene dataset (including ITS, nrLSU, tef1-α, rpb2 and hsp) did not exhibit any incongruence because no well-supported (BS > 70 %) conflict was detected among the topologies of the five genes. The concatenated five-gene dataset was used to infer the phylogenetic placement of Helvella species and to assess subgeneric limits and relationships within Helvella. Dissingia oblongispora and Pindara terrestris were used as outgroup taxa. Datasets II–V were comprised of single gene fragment (ITS), which respectively corresponded to four subgeneric phylogenetic clades of Helvella that were recognized in this study based on the phylogenetic analyses for Dataset I, i.e., Acetabulum clade (Datasets II), Crispa clade (Datasets III), Elastica clade (Datasets IV), and Lacunosa clade (Datasets V). Each dataset contained all corresponded and qualified ITS sequences that were newly provided in this study and downloaded from GenBank. The four single-gene datasets were used to delimit and detect Helvella species and assess the species diversity. Dataset VI was comprised of two gene fragments (ITS/nrLSU) and contained all Chinese Helvella species recognized in this study except for the species lacking available molecular data. This concatenated twogene dataset was used to show the species diversity of Helvella in China excluding the species lacking DNA data, and to infer the phylogenetic relationships between Chinese Helvella species.

Sequences were aligned and edited in MAFFT (Katoh & Frith 2012) under default parameters, and manually adjusted for maximum sequence similarity in Se-Al v. 2.03a (Rambaut 2000). Ambiguously aligned regions and gaps in the alignment were excluded before the analyses. For the concatenated dataset (Datasets I, VI), alignments were constructed separately for each of the gene fragments using MAFFT (Katoh & Frith 2012), optimized using BioEdit v. 7.0.9 (Hall 1999), then concatenated using SequenceMatrix v. 1.7.8 (Vaidya et al. 2011). Unsampled gene regions were coded as missing data and the intron regions of protein-coding genes were retained in the final analyses. Poorly aligned sites were identified by Gblocks v. 0.91b (http://www.ncbi.nlm.nih.gov/; Castresana 2000; using default options except ALLOWED GAP POSITIONS 5 half) with default parameters. All identified ambiguous sites were excluded before the analyses. Alignments of all datasets used in this study were submitted to TreeBASE (No. 30611).

Phylogenetic analyses

Maximum likelihood (ML) analyses on all six datasets in this study were conducted with RAxML v. 8.0.14 (Stamatakis et al. 2014) and the GTRGAMMAI substitution model with parameters unlinked. The ML bootstrap replicates (1 000) were computed in RAxML with a rapid bootstrap analysis and search for the bestscoring ML tree.

Bayesian inference (BI) was performed with MrBayes v. 3.2.2 (Ronquist & Huelsenbeck 2003) as an additional method for determining branch support. The best substitution model that fit the data at each locus was evaluated using MrModeltest v. 2.3 (Nylander 2004). For the concatenated analyses (Datasets I and VI), each locus was considered a partition and assigned its own best-fiШng substitution model, that was GTR+I+G for ITS, nrLSU, rpb2 and hsp, and SYM+I+G for tef1-α. We used two independent runs with four Markov chains Monte Carlo (MCMC) for 5 155 000 (Dataset I) and 4 420 000 (Dataset VI) generations under the default settings. For the ITS analysis (Datasets II–V), the best substitution model for each dataset respectively was GTR+I+G (Datasets II, III), GTR+G (Datasets IV, V). The MCMC analysis were run for 825 000 (Dataset II), 1 430 000 (Dataset III), 2 330 000 (Dataset IV) and 3 010 000 (Dataset V) generations under the default settings. Average standard deviations of split frequency (ASDSF) values were far lower than 0.01 at the end of the generations. Trees were sampled every 100 generations after burn-in (25 % of trees were discarded as the burn-in phase of the analyses, set up well after convergence), and 50 % majority-rule consensus trees were constructed.

Clades with bootstrap support (BS) ≥ 70 % and Bayesian posterior probability (PP) ≥ 0.95 were considered as significantly supported (Hillis & Bull 1993, Alfaro et al. 2003). All phylogenetic trees were viewed with TreeView (Page 2001).

RESULTS

Phylogenetic analyses

Combined five-gene phylogeny of Helvella

Dataset I (ITS/nrLSU/tef1-α/rpb2/hsp) contained 1 348 sequences from 136 species, including 629 sequences newly generated from Chinese collections. The length of the aligned dataset was 2 726 bp after exclusion of poorly aligned sites (all in ITS), with 565 bp for ITS, 666 bp for nrLSU, 908 bp for tef1-α, 346 bp for rpb2, and 241 bp for hsp. Maximum likelihood and BI analyses yielded similar tree topologies and only the tree inferred from the ML analysis is illustrated with strong statistical bootstrap from ML and posterior probability from BI support values shown (Fig. 1). Our present analysis revealed that the genus Helvella is monophyletic, and four distinct clades in Helvella can be recognized (Fig. 1), i.e., Acetabulum clade, Crispa clade, Elastica clade, and Lacunosa clade.

Fig. 1.

Phylogeny of Chinese Helvella inferred from the Dataset I (ITS/nrLSU/tef1-α/rpb2/hsp) using the maximum likelihood (ML) analysis. Numbers representing likelihood bootstrap support values (MLBS ≥ 70 %, left) and significant Bayesian posterior probability (BPP ≥ 0.95, right) are indicated above the nodes. Chinese Helvella species are printed in bold. New species and new sequences are printed in golden font.

Within the Acetabulum clade, two lineages were furthermore recognized, i.e., the acetabulum lineage and solitaria lineage. Within the Crispa clade, H. crispa and its allies consisted of a well-supported lineage which was designated as crispa lineage hereafter, and the other two species, H. maculata and H. maculatoides, both outside crispa lineage, formed their own independent branches. Within the Elastica clade, eight individual evolving lineages were recognized, i.e., bicolor-elastica lineage, capucina-danica lineage, carnosa lineage, corbierei-stevensii lineage, fallax-pezizoides lineage, hypocrateriformis lineage, macropus lineage, and rivularis-sublicia lineage. The species H. atroides, H. fibrosa, H. japonica and H. orientitomentosa are outside the macropus lineages and formed their own independent branches. Within the Lacunosa clade, 13 lineages were recognized, i.e., alpestris-nannfeldtii lineage, alpicola lineage, alpina-corium lineage, atra-pallescens lineage, costifera lineage, dalgeri lineage, fusca-lactea lineage, hyperborea lineage, lacunosa-helvellula lineage, palustris-philonotis lineage, phlebophora lineage, sulcata-phlebophoroides lineage, and tianshanensis lineage. Both H. floriforma and H. queletiana are outside all lineages and formed their own independent branches. Furthermore, six of the 13 lineages (atra-pallescens lineage, fusca-lactea lineage, lacunosa-helvellula lineage, palustris-philonotis lineage, phlebophora lineage and sulcata-phlebophoroides lineage) and the species H. queletiana gathered into a distinct and strong supported group, which was recognized as the lacunosa subclade. The remaining seven lineages and H. floriforma in the Lacunosa clade were scattered outside the lacunosa subclade. For improving the discussion, they were designated as a group, i.e., costifera group (Fig. 1).

ITS-based phylogenetic analysis

The ITS dataset was employed to delimit and detect the Chinese Helvella species diversity in this study. ITS sequence is considered a universal barcode for fungi (Schoch et al. 2012) and helpful for analyses of Helvella groups from ectomycorrhizal root tips. A total of 715 ITS sequences, including 168 novel sequences from Chinese collections, were obtained for this study. Our multigene phylogenetic analysis (Fig. 1) revealed that Chinese Helvella collections were classified in four clades, therefore these ITS sequences were accordingly split into four parts (Datasets II–V) that represented four clades (Acetabulum clade, Crispa clade, Elastica clade and Lacunosa clade). This parsing of species facilitates the molecular phylogenetic analyses for delimiting many Chinese Helvella species and detecting the phylogenetic relationships between these Helvella species. The phylogenetic analyses for all four clades are documented below.

Acetabulum clade: Dataset II (ITS) was used to delimit and detect the Helvella species of the Acetabulum clade. This dataset comprised 30 sequences of the Acetabulum clade, in which eight sequences were isolated from our Helvella specimens. The length of the dataset was 321 bp after alignment and exclusion of poorly aligned sites. Maximum likelihood and BI analyses yielded identical tree topologies; only the tree inferred from the ML analysis is shown (Supplementary Fig. S1). This ITS-based phylogenetic analysis resolved seven clusters from this clade. Of these, five clusters were identified as known species because each cluster contains the authentic sequence(s) of these species, i.e., H. acetabulum, H. acetabuloides, H. solitaria, H. sichuanensis, and H. taiyuanensis. They all occur in China. The remaining two clusters represent two putatively unknown species, marked as Helvella sp. 1, 2, which are respectively from Iran or an unknown country (See Supplementary Fig. S1, Supplementary Table S3).

Crispa clade: Dataset III (ITS) was used to delimit and detect the Helvella species of the Crispa clade. This dataset comprised 126 sequences from the Crispa clade, in which 35 sequences were isolated from our Helvella specimens. The length of the dataset was 794 bp after alignment and exclusion of poorly aligned sites. Maximum likelihood and BI analyses yielded identical tree topologies; only the tree inferred from the ML analysis is shown (Supplementary Fig. S2). A total of 13 clusters with strong support were recognized in this clade. Of these, six clusters were identified as known species, i.e., H. crispoides, H. involuta, H. maculatoides, H. orienticrispa, H. pseudoreflexa, and H. zhongtiaoensis, and they all occur in China. Two clusters composed of Chinese collections were new to science, which are described as new species in this study (see Taxonomy). The remaining five clusters were suggested as putatively unknown species, marked as Helvella sp. 3–7. Notably, Helvella sp. 5 occurs in China and an unknown country. The other four species are respectively from France, Germany or the United States (See Supplementary Fig. S2, Supplementary Table S4).

Elastica clade: Dataset IV (ITS) was used to delimit and detect the Helvella species of the Elastica clade. This dataset comprised 318 sequences, including 102 sequences newly isolated from our Helvella specimens. The length of the dataset was 578 bp after alignment and exclusion of poorly aligned sites. Maximum likelihood and BI analyses yielded identical tree topologies; only the tree inferred from the ML analysis is shown (Supplementary Fig. S3). A total of 66 strong support clusters corresponding to 66 Helvella species were resolved in this clade. Of these, 26 clusters corresponded to known species because each cluster contains the authentic sequence(s) of these species. Sixteen species of them occur in China, i.e., H. atroides, H. bachu, H. capucinoides, H. carnosa, H. corbierei, H. danica, H. ephippioides, H. fistulosa, H. galeriformis, H. guttata, H. macropus, H. nordlandica, H. orentitomentosa, H. pubescens, H. scyphoides, and H. subspadicea. Fourteen clusters composed of Chinese collection(s) are treated in this study (see Taxonomy). The other 26 clusters were suggested as putatively new species as currently no sporocarps are available for these species, or we were not able to examine the specimens in this study. They are accordingly marked as Helvella sp. 8–33. Notably, 14 species m occur in China, i.e., Helvella sp. 14–15, Helvella sp. 18, Helvella sp. 20, Helvella sp. 23–32. The others are from France, Germany, Italy, Japan, United States, South Korea, Spain, Switzerland, etc. (See Supplementary Fig. S3, Supplementary Table S5).

Lacunosa clade: Dataset V (ITS) was used to delimit and detect the Helvella species of the Lacunosa clade. This dataset comprised 247 sequences, including 29 sequences newly isolated from our Helvella specimens. The length of the dataset was 517 bp after alignment and exclusion of poorly aligned sites. Maximum likelihood and BI analyses yielded identical tree topologies; only the tree inferred from the ML analysis is shown (Supplementary Fig. S4). A total of 66 strongly supported clusters corresponding to 66 Helvella species were resolved in this clade. Of these, 39 clusters corresponded to known species because each cluster contains the authentic sequence(s) of these species. Twenty-nine species occur in China, i.e., H. atra, H. austrooccidentalis, H. borealis, H. calycina, H. costifera, H. cystidiata, H. fulva, H. huangii, H. jizushanica, H. lacunosa, H. liui, H. lobata, H. magna, H. parva, H. philonotis, H. phlebophora, H. phlebophoropsis, H. plateata, H. ravida, H. rugosa, H. sublactea, H. subtinta, H. terricola, H. tianshanensis, H. tinta, H. varia, H. vitrea, H. vulgata and H. yunnanensis. Two clusters composed of Chinese collections are described as new species in this study (see Taxonomy). The other 25 clusters were suggested as putatively new species as currently no sporocarps are available for these species, or we were not able to examine the specimens in this study. They are accordingly marked as Helvella sp. 34–58. Notably, one of these species occur in China, i.e., Helvella sp. 42. The others are respectively from Denmark, Germany, Hungary, Mexico, Norway, Sweden, United States, etc. (See Supplementary Fig. S4, Supplementary Table S6).

Species diversity of Helvella in China

Dataset VI (ITS/nrLSU) comprised 581 sequences with 574 sequences from Chinese samples, in which all Chinese Helvella species determined based on the phylogenetic analyses for Datasets I–V outlined above were included except for H. palustris (only having hsp) (Fig. 1, Supplementary Figs S1–S4). Dissingia oblongispora was selected as the outgroup. The length of the aligned dataset was 1 238 bp after exclusion of poorly aligned sites, with 529 bp for ITS and 709 bp for nrLSU. Maximum likelihood and BI analyses yielded identical tree topologies; only the tree inferred from the ML analysis is shown (Fig. 2).

Fig. 2.

Phylogeny of Chinese Helvella species inferred from the Dataset VI (ITS/nrLSU) using the maximum likelihood (ML) analysis. Numbers representing likelihood bootstrap support values (MLBS ≥ 70 %, left) and significant Bayesian posterior probability (BPP ≥ 0.95, right) are indicated above the nodes. New species are printed in bold.

Our phylogenetic analyses revealed 92 phylogenetic species from the Chinese collections, which were further clustered in four Helvella clades (Fig. 2). Of these, 57 clusters correspond to 57 species known from China (Ariyawansa et al. 2015, Zhao et al. 2015, Hyde et al. 2016, Wang et al. 2016, 2019, 2022, 2023a, Zhao et al. 2016a, b, Tibpromma et al. 2017, Zhuang et al. 2018, Xu et al. 2022, Lu et al. 2023, Yu et al. 2023), including five species new to China, i.e., H. carnosa (Fig. 2, Supplementary Fig. S3), H. corbierei (Fig. 2, Supplementary Fig. S3), H. fistulosa (Fig. 2, Supplementary Fig. S3), H. nordlandica (Fig. 2, Supplementary Fig. S3) and H. scyphoides (Fig. 2, Supplementary Fig. S3). Of the remaining 35 species, 18 species are described as new species (see Taxonomy section in this paper), and 17 are suggested as potentially undescribed species (marked as Helvella sp. 5 in Fig. 2 & Supplementary Fig. S2; Helvella sp. 14–15, Helvella sp. 18, Helvella sp. 20, Helvella sp. 23–32 in Figs 2 & S3; Helvella sp. 42. in Figs 2 & S4; Helvella sp. 59 in Figs 1 & 2). Notably, H. floriforma (Figs 1, 2, Datasets I, VI), H. palustris (Fig. 1, Dataset I), and Helvella sp. 59 (Figs 1, 2, Datasets I, VI) are not represented in the ITS dataset because there were no available ITS sequence of the three species.

TAXONOMY

Based on our phylogenetic and morphological data, 18 new species are described and illustrated, an epitype is designated for one species, and five species are newly recorded from China.

Helvella albopatella L. Fan, N. Mao & Y.Y. Xu, sp. nov. MycoBank MB 849609. Fig. 3.

Fig. 3.

Helvella albopatella (BJTC FM2610-A, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Asci and paraphyses in Congo Red. E. Immature asci in Congo Red. Scale bars: A = 1 cm; B-E = 10 μm.

Etymology: albopatella, albo-, white, patella, disc, referring to the white and disc-like cap of this species.

Apothecia stipitate-cupulate; cap regularly or irregularly discoid, slightly cumulate, or occasionally recurved, 0.4–0.7 cm high, 0.9–2.0 cm broad; hymenium white, grey white to pale white, becoming dark brown when dry; receptacle surface pubescent, concolourous with the disc, becoming yellowish when dry; stipe terete, 1.0–3.0 cm high, 0.15–0.3 cm broad, solid, greyish white to white, becoming yellowish when dry. Ectal excipulum 75–100 µm broad, of textura angularis, cells hyaline to pale brown, extending into fascicled hyphoid hairs in outer ectal excipulum, hairs multiseptated, cells elongate club-shaped, 15–35 × 11–16 µm. Medullary excipulum 225–300 µm broad, of interwoven textura intricata, hyphae 2.0–6.0 µm broad. Asci pleurorhynchous, tapering towards the base, 8-spored, 225–265 × 13–17 µm. Ascospores ellipsoid, with one large oil drop when mature, 16–18 × 11–12.5 μm, [Lm × Wm = 16.7 × 11.7 μm, Q = 1.32–1.56, Q_av = 1.42 ± 0.07]. Paraphyses filiform, septate, pale brown, 6.0–10.0 µm wide at clavate to subcapitate tips and 2.0–4.0 µm below.

Habitat: Scattered on the ground in broadleaf forest and coniferous forest.

Distribution: Known from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Linfen City, Pu County, Wulushan mountains, on the ground in broadleaf forest dominated by Quercus sp., 36°56״23׳N, Ш°23״46׳E, alt. 1 644.6 m, 26 Aug. 2022, N. Mao (holotype BJTC FM2610-A, GenBank Acc. No.: ITS = OR355082, nrLSU = OR355252, tef1-α = OR359014, rpb2 = OR359137, hsp = OR366079); ibid., (BJTC FM2610-B).

Notes: Helvella albopatella is recognized by its disc-like cap and overall whitish ascomata with terete stipe. It is placed in the hypocrateriformis lineage, Elastica clade, sister to H. nordlandica, in our phylogenetic tree (Fig. 1). Morphologically, H. albopatella is distinguished from all other species in this lineage (including H. nordlandica) by its overall whitish ascomata with disc-like cap and a terete stipe. Molecularly, there are one hsp, three rpb2, five nrLSU, and 12 tef1-α substitutions between H. albopatella and H. nordlandica. Four ITS sequences downloaded from GenBank matched H. albopatella in our analysis (Fig. S3). These sequences are respectively extracted from ascomata or ectomycorrhizal root tips of Quercus liaotungensis and Quercus sp., from China. These results implied that H. albopatella is also occurs in another region of China and can form ectomycorrhizas with Quercus species. Helvella albopatella shares less than 94.87 % similarity in ITS region with other Helvella species.

Helvella alborava L. Fan, N. Mao & H. Zhou, sp. nov. MycoBank MB 849610. Fig. 4.

Fig. 4.

Helvella alborava (BJTC C316-A, holotype). A, B. Apothecia. C. Ascospores in water. D. Asci and paraphyses in Congo Red. E. Ectal excipulum in Congo Red. F. Immature asci in Congo Red. Scale bars: A = 1 cm; B-F = 10 μm.

Etymology: alborava, albo-, means white, rava, means grey, referring to grey whitish ascomata.

Apothecia stipitate-capitate; cap regularly or irregularly saddleshaped, sometimes regularly or irregularly cup-like, 0.6-2.0 cm high, 1.0-1.9 cm broad, at first margin adhered to stipe, then reflexed with age; hymenium greyish white to greyish, becoming brown to dark brown when dry; receptacle surface fine pubescent, concolourous with hymenium, becoming pale yellow to greyish brown when dry; stipe glabrous to fine pubescent, terete, 2.1-4.2 cm high, 0.2-0.5 cm broad, solid or hollow, greyish white, becoming pale brown to greyish brown when dry, towards base with inconspicuous grooves, base slightly enlarged. Ectal excipulum 80-120 µm broad, of textura angularis, cells hyaline to pale brown, extending into fascicled hyphoid hairs in outer ectal excipulum, hairs multiseptated, cells elongate club-shaped, 13-30 × 8-16 µm. Medullary excipulum 175-250 µm broad, of interwoven textura intricata, hyphae 2.04.0 µm broad. Asci pleurorhynchous, tapering, 8-spored, 215275 × 13-19 µm. Ascospores ellipsoid, with one large oil drop when mature, 17-19 × 10-12 μm, [Lm × Wm = 17.9 × 10.9 μm, Q = 1.45-1.81, Q_av = 1.64 ± 0.09]. Paraphyses filiform, septate, pale brown, 4.0–6.0 µm wide at clavate to subcapitate tips and 2.0-3.5 µm below.

Habitat: Scattered on the ground in broadleaf forest.

Distribution: Known from Hebei Province, Northern China.

Specimens examined: China, Hebei Province, Xinglong County, on the ground in mixed broadleaf forest, alt. 898 m, 25 Aug. 2020, G.Q. Chen (holotype BJTC C316-A, GenBank Acc. No.: ITS = OR355106, nrLSU = OR355276, tef1-α = OR359033, rpb2 = OR359155, hsp = OR366098), ibid., (BJTC C316-B).

Notes: Helvella alborava is phylogenetically nested in the rivularis-sublicia lineage, Elastica clade (Fig. 1). There are three other species in this lineage from China, i.e., H. multiformis, H. nigrorava and H. pubescens. Helvella multiformis is distinguished from H. alborava by its shape and colour of cap (cup to saddle, grey to black) and large spores (Lm × Wm = 19.1 × 11.9 μm); Helvella nigrorava by its dark grey to greyish black and saddle-shaped caps, and distinct pubescence on the surface of the receptacle and stipe (also see the comments on H. nigrorava in this paper); Helvella pubescens by its cup-like cap and stipe densely covered with pyramidal 'warts' (Skrede et al. 2017). In addition, seven hsp, three rpb2, five nrLSU, and 26 tef1-α substitutions separated H. alborava from H. multiformis; seven hsp, nine rpb2, 16 nrLSU substitutions and 41 tef1-α substitutions from H. pubescens. Two ITS ECM-sequences match H. alborava in our analysis (Fig. S3). They are extracted from the ectomycorrizal root tips of Quercus variabilis, and Q. liaotungensis from Shanxi Province and Beijing, Northern China. These indicate that H. alborava could form ectomycorrhizas with the two plant species. Helvella alborava shares less than 97.6 % similarity in ITS region with other Helvella species.

Helvella brunneogaleriformis L. Fan, N. Mao & YY Xu, sp. nov. MycoBank MB 849611. Fig. 5.

Fig. 5.

Helvella brunneogaleriformis (BJTC FM911, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Asci and paraphyses in Congo Red. E. Paraphyses in Congo Red. F. Immature asci in Congo Red. Scale bars: A = 2 cm; B, D, E = 20 μm; C = 50 μm; F = 10 μm.

Etymology: brunneogaleriformis, because this species is phylogenetically closely related to H. galeriformis but with a brown cap.

Apothecia stipitate-capitate; cap irregularly umbrella-type, hemispheric to irregularly saddle-shaped, 0.5-2.2 cm high, 1.02.7 cm broad, at first margin adhered to stipe, then irregularly folded and free from stipe with age; hymenium ochre to brown when fresh, becoming dark brown to black brown when dry; receptacle surface glabrous, white, becoming yellow when dry; stipe terete 2.5-7.5 cm high, 0.3-0.7 cm broad, solid or hollow, white, or gradually becoming pale yellow brown to brown towards the base, becoming yellow when dry, base slightly enlarged, occasionally with a few shallow grooves. Ectal excipulum 80-130 µm broad, of textura angularis, cells hyaline to pale brown, arranged in rows turning out perpendicular to receptacle surface, outermost cells clavate, 23-56 × 13-29 µm. Medullary excipulum 150-230 µm broad, of interwoven textura intricata, hyphae 2.5-6.5 µm broad. Asci pleurorhynchous, tapering, 8-spored, 260-330 × 15-20 µm. Ascospores ellipsoid, with one large oil drop when mature, 17-20.5 × 10.5-12.5 μm, [Lm × Wm = 19 × 11.5 μm, Q = 1.5-1.8, Q_av = 1.65 ± 0.07]. Paraphyses filiform, 2.5-4.5 µm below, pale yellow to pale brown, septate, clavate to subcapitate, 6-13(-15) µm wide at tips.

Habitat: Scattered on the ground in coniferous forest.

Distribution: Known only from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Xinzhou City, Wutai County, Wutaishan mountains, on the ground in coniferous forest dominated by Larix principis-rupprechtii and Picea asperata, alt. 1 222 m, 27 Aug. 2019, C. Yang (holotype BJTC FM911, GenBank Acc. No.: ITS = OR355065, nrLSU = OR355235, tef1-α = OR359000, rpb2 = OR359124, hsp = OR366062); ibid., Lvliang City, Jiaocheng County, Guandishan mountains, on the ground in coniferous forest dominated by L. principis-rupprechtii and P asperata, alt. 2 003 m, 7 Sep. 2017, Y.Y. Xu (BJTC FM269); ibid., (BJTC FM272).

Notes: Helvella brunneogaleriformis is sister to H. galeriformis in the capucina-danica lineage, Elastica clade, as revealed in present analysis (Fig. 1). Morphologically, both species are similar in cap shape. However, the two species can be separated by the hymenium colour, which is ochre to brown in H. brunneogaleriformis, whereas grey blackish in H. galeriformis. Helvella brunneogaleriformis is similar to H. elastica and H. carnosa in its brown hymenium, and yellowish stipe. However, H. elastica and H. carnosa typically have a saddle-like cap, and H. elastica has lager asci (330-360 × 15-17 µm) and relatively longer ascospores (19-22 × 10.6-12.2 μm) (Skrede et al. 2017). Helvella carnosa has narrower asci (270-300 × 13-15 μm) and relatively narrower paraphyses at the apex (5-8 μm) (Skrede et al. 2017). In addition, six hsp, 13 rpb2, 16 nrLSU, and 20 tef1-α substitutions separated it from H. elastica; five hsp, 11 rpb2, 17 nrLSU substitutions, and 32 tef1-α substitutions from H. carnosa. Helvella brunneogaleriformis shares less than 97.8 % similarity in ITS region with other Helvella species.

Helvella caespitosa L. Fan, N. Mao & YY. Xu, sp. nov. MycoBank MB 849612. Fig. 6.

Fig. 6.

Helvella caespitosa (HSA 379-A, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Asci and paraphyses in Congo Red. E. Asci in Congo Red. Scale bars: A = 1 cm; B, E = 10 μm; C, D = 20 μm.

Etymology: caespitosa, referring to its habit of growing in a cluster.

Apothecia stipitate-capitate; cap saddle-shaped, margin strongly deflexed, 0.4-1.0 cm high, 0.5-1.8 cm broad; hymenium dark grey to grey blackish, becoming greyish black when dry; receptacle surface pale grey, becoming greyish brown when dry; stipe pubescent, terete, 1.5-3.0 cm high, 0.2-0.3 cm broad, solid, pale grey, becoming greyish brown when dry, base often with white mycelia. Ectal excipulum 75-150 µm broad, of textura angularis, cells hyaline to pale brown, outermost cells club-shaped, 16-31 × 8-14 µm. Medullary excipulum 150–300 µm broad, of interwoven textura intricata, hyphae 2.0-5.5 µm broad. Asci pleurorhynchous, tapering, 8-spored, 210-300 × 14-21 µm. Ascospores ellipsoid, with one large oil drop when mature, 16.5-20 × 10-12 μm, [Lm × Wm = 18.5 × 11.1 μm, Q = I. 50-1.80, Q_av = 1.66 ± 0.07]. Paraphyses filiform, septate, pale brown, 5.0-9.0 µm wide at clavate to subcapitate tips and 1.5 3.5 µm below.

Habitat: Clustered or grouped on the ground in coniferous and broadleaf mixed forest dominated by Betula sp., Pinus tabuliformis, Populus sp., Quercus wutaishansea.

Distribution: Known from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Lvliang City, Xing County, Heichashan mountains, on the ground in coniferous and broadleaf mixed forest dominated by Betula sp., Pinus tabuliformis, Populus sp., Quercus wutaishansea, alt. 1 590 m, 6 Sep. 2018, J.Z. Cao (holotype HSA 379-A, GenBank Acc. No.: ITS = OR355091, nrLSU = OR355261, tef1-α = OR359022, hsp = OR366087); ibid., (HSA 379-B).

Notes: Helvella caespitosa is diagnosed by its grey blackish saddle-shaped cap with strongly deflexed margin, dark grey stipe with pubescent surface, and habit of growing in cluster. Our present analysis places H. caespitosa in the fallax-pezizoides lineage in the Elastica clade and sister to H. bresadolae and H. pezizoides (Fig. 1). Helvella bresadolae is easily confused with H. caespitosa in appearance of its cap. However, H. bresadolae is distinguished from H. caespitosa by its stipe base without white mycelia and relatively smaller asci (200–240 × 14–17 µm). The difference between H. pezizoides and H. caespitosa is in the cap margin of ascomata, which is inrolled in H. pezizoides but deflexed in H. caespitosa (Dissing 1966b). In addition, one hsp and 13 nrLSU substitutions separated it from H. bresadolae; 10 hsp, 13 nrLSU, and 19 tef1-α substitutions from H. pezizoides. Three ITS sequences downloaded from GenBank matched H. caespitosa in our analysis (Fig. S3). These sequences are respectively extracted from ectomycorrhizal root tips of Picea crassifolia, Pinus tabuliformis, and Quercus liaotungensis, from Ningxia Hui Autonomous Region, Northern China. These indicated that H. caespitosa also occurs in other regions of China, and has a wide host range. Helvella caespitosa shares less than 89.94 % similarity in ITS region with other Helvella species.

Helvella cremeoinvoluta L. Fan, N. Mao & YY. Xu, sp. nov. MycoBank MB 849613. Fig. 7.

Fig. 7.

Helvella cremeoinvoluta (BJTC FM941-A, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in water. D. Asci in Congo Red. E. Immature asci and paraphyses in Congo Red. Scale bars: A = 1 cm; B-E = 10 μm.

Etymology: cremeoinvoluta, referring to its high similarity to H. involuta in appearance of ascoma but pale grey-white to pale cream receptacle.

Apothecia stipitate-capitate; cap saddle-shaped to irregularly lobate, 0.5–1.3 cm high, 1.1–2.3 cm broad, margin strongly rolled upwards and completely wrapped the hymenium at first, then unrolled with age; hymenium glabrous, garish white to cream, becoming pale brown to yellowish brown when dry; receptacle surface subpubescent, pale grey white to pale cream, becoming yellowish when dry; stipe 2.6–4.8 cm high, 0.7–1.7 cm broad, white to yellowish white, becoming pale yellow to greyish yellow when dry, ribbed, blunt-edged, partly anastomosing and double-edged, with lacunae between ribs, chambered inside. Ectal excipulum 125–190 µm broad, of textura angularis, cells hyaline to pale brown, outermost cells catenuliform in long fascicled tufts, with cylindrical to subclavate cells of 18–37 × 11–18 µm. Medullary excipulum 240–330 µm broad, of interwoven textura intricata, hyphae 3–7 µm broad. Asci pleurorhynchous, tapering, 8-spored, 225–275 × 13–18 µm. Ascospores ellipsoid, with one large oil drop when mature, 17–18.5 ×9.5–11 μm, [Lm × Wm = 17.6 × 10.1 μm, Q = 1.60–1.85, Q_av = 1.74 ± 0.10]. Paraphyses filiform, septate, hyaline to pale brown, 4–6 µm wide at tips and 2–4 µm below.

Habitat: Scattered to gregarious on the ground in coniferous forest dominated by Larix principis-rupprechtii.

Distribution: Known only from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Xinzhou City, Wutai County, Wutaishan mountains, on the ground in coniferous forest dominated by Larix principis-rupprechtii, 38°55'39"N, 113°35'43"E, alt.

1 543 m, 28 Aug. 2019, Y. Shen (holotype BJTC FM941-A, GenBank Acc. No.: ITS = OR355153, nrLSU = OR355324, tef1-α = OR359066, rpb2 = OR359178, hsp = OR366131); ibid., 38°55'39''N, 113°35'40''E, alt. 1 543 m, 28 Aug. 2019, Y. Shen (BJTC FM941-B).

Notes: Helvella cremeoinvoluta and H. crispoides are closely related to each other in our phylogenetic analyses (Figs 1, 2). Morphologically, H. crispoides differs from H. cremeoinvoluta by its grey receptacle surface, white stipe, relatively shorter ascospores (15-17 × 9.5-11.5 μm), and broader paraphyses at the apex (6-7.5 μm) (Tibpromma et al. 2017). Helvella involuta is similar to H. cremeoinvoluta in cap shape and ascospores size, but the colour of its receptacle surface is clearly yellowish (Zhao et al. 2015), that is completely different from the present species (grey-white to pale cream). Helvella cremeoinvoluta shares less than 96.1 % ITS similarity with other Hevella species, supporting it is a distinct species.

Helvella deflexa L. Fan, N. Mao & YY. Xu, sp. nov. MycoBank MB 849614. Fig. 8.

Fig. 8.

Helvella deflexa (HSA 240-A1, holotype). A. Apothecia. B. Ascospores in water. C. Paraphyses in Congo Red. D. Ectal excipulum in Congo Red. E. Immature asci in Congo Red. Scale bars: A = 1 cm; B-D = 10 μm.

Etymology: deflexa, referring to the strongly deflexed margin of the cap.

Apothecia stipitate-capitate; cap saddle-shaped, 0.7–1.1 cm high, 2.0–3.0 cm broad, with a strongly deflexed margin; hymenium brown to dark brown; receptacle surface yellowish white; stipe terete, 1.5–3.0 cm high, 0.3–0.5 cm broad, solid or hollow, white to cream. Ectal excipulum 75–100 µm broad, of textura angularis, cells hyaline to pale brown, arranged in rows turning out perpendicular to receptacle surface, outermost cells elongate club-shaped, 21–50 × 10–20 µm. Medullary excipulum 100–125 µm broad, of interwoven textura intricata, hyphae 2.0–6.0 µm broad. Asci pleurorhynchous, tapering, 8-spored, 290–325 × 15–23 µm. Ascospores ellipsoid and with slightly narrow ends, with one large central oil drop and a few of small ones when mature, 19.5–23 × 12–14.5 μm, [Lm × Wm = 21.0 × 13.1 μm, Q = 1.46–1.81, Q_av = 1.60 ± 0.08]. Paraphyses filiform, septate, subhyaline to pale brown, 6.0–11.0 µm wide at clavate to subcapitate tips and 2.0–4.0 µm below.

Habitat: Scattered on the ground in coniferous and broadleaf mixed forest dominated by Betula sp. and Larix principis-rupprechtii.

Distribution: Known from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Lvliang City, Jiaocheng County, Pangquangou, on the ground in coniferous and broadleaf mixed forest dominated by Betula sp. and Larix principis-rupprechtii, alt. 2 160 m, 28 Aug. 2018, L.J. Guo (holotype HSA 240-A1, GenBank Acc. No.: ITS = OR355069, nrLSU = OR355239, tef1-α = OR359004, rpb2 = OR359127, hsp = OR366066); ibid., (HSA 240-A2).

Notes: Helvella deflexa is recognized by its saddle-shaped cap with strongly deflexed margin, a long and white terete stipe and ascospores with slightly narrow ends. It is phylogenetically nested in the capucina-danica lineage of Elastica clade, closely related to H. danica (Fig. 1). Hevlella danica differs from H. deflexa by its campanulate cap and clustered habit (Skrede et al. 2017). Molecularly, one hsp, three rpb2, two nrLSU and seven tef1-α substitutions separated H. deflexa from H. danica. Helvella deflexa shares less than 96.16 % similarity in ITS region with other Helvella species.

Helvella flavostipitata L. Fan, N. Mao & YY. Xu, sp. nov. MycoBank MB 849615. Fig. 9.

Fig. 9.

Helvella flavostipitata (HSA 387-A, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Asci and paraphyses in Congo Red. E. Immature asci in Congo Red. Scale bars: A = 1 cm; B, E = 10 μm; C, D = 20 μm.

Etymology: flavostipitata, flavo-, yellow, referring to the yellow stalk of this saddle fungus.

Apothecia stipitate-capitate; cap saddle-shaped, 2–2.4 cm high, 1.6–2.4 cm broad, margin adhered to stipe; hymenium yellowish brown to brown, becoming dark brown when dry; receptacle surface glabrous, pale grey to greyish yellow, becoming yellow when dry; stipe terete, 3.5–5.0 cm high, 0.3–0.4 cm broad, hollow, yellow, not change colour when dry, base often with white mycelia. Ectal excipulum 80–120 µm broad, of textura angularis, cells hyaline to pale brown, arranged in rows turning out perpendicular to receptacle surface, outermost cells clavate, 18–43 × 9–21 µm. Medullary excipulum 150–250 µm broad, of interwoven textura intricata, hyphae 2.0–7.0 µm broad. Asci pleurorhynchous, tapering, 8-spored, 250–310 × 14–20 µm. Ascospores ellipsoid, with one large oil drop when mature, 18–20.5 × 10.5–12.5 μm, [Lm × Wm = 19.3 × 11.5 μm, Q = 1.53–1.84, Q_av = 1.67 ± 0.08]. Paraphyses filiform, septate, pale yellow to pale brown, 5.5–9 µm wide at clavate to subcapitate tips and 2.0–4.0 µm below.

Habitat: Scattered on the ground in coniferous forest.

Distribution: Known from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Lvliang City, Jiaocheng County, Pangquangou, on the ground in coniferous forest dominated by Picea sp., alt. 1 860 m, 6 Sep. 2018, H. Liu (holotype HSA 387-A, GenBank Acc. No.: ITS = OR355035, nrLSU = OR355205, tef1-α = OR358976, rpb2 = OR359103); ibid., (HSA 387-B).

Notes: Helvella flavostipitata is phylogenetically sister to H. carnosa in the carnosa lineage, Elastica clade (Fig. 1). Morphologically, both species have regularly saddle-shaped and brown caps, but H. carnosa has a receptacle surface with delicate pubescence and relatively narrower asci (13–15 µm) (Skrede et al. 2017), whereas H. flavostipitata has a glabrous receptacle surface and wider asci (14–20 µm diam). Molecularly, H. flavostipitata deviates consistently in one hsp, five nrLSU, and nine tef1-α substitutions. Five ITS sequences from GenBank matched H. flavostipitata in our analysis (Fig. S3). These sequences are respectively extracted from ascomata or ectomycorrhizal root tips of Pinus wallichiana and P. tabuliformis, from China or Pakistan. These results implied that H. flavostipitata can form ectomycorrhizas with Pinus species. Helvella flavostipitata shares less than 91.5 % similarity in ITS region with other Helvella species.

Helvella multiformis L. Fan, N. Mao & YY Xu, sp. nov. MycoBank MB 849616. Fig. 10.

Fig. 10.

Helvella multiformis (A, C, E-H. BJTC FM1130, holotype. B. BJTC FM1131. D. BJTC FM2484). A-D. Apothecia. E. Ascospores in water. F. Asci and paraphyses in Congo Red. G. Ectal excipulum in Congo Red. H. Immature asci in Congo Red. Scale bars: A-D = 1 cm; E-H = 10 μm.

Etymology: multiformis, referring to the cap shape that includes cup and saddle.

Apothecia stipitate-cupulate; cap regular cupulate to saucershaped at first, then expanding to saddle-shaped, occasionally applanate, 0.7–2.2 cm high, 1.5–3.7 cm broad; hymenium, greyish black, dark brown, blackish to black, becoming dark brown to black when dry; receptacle surface pubescent, greyish to dark grey, becoming brown when dry; stipe terete, 2.0–5.0 cm high, 0.3–0.7 cm broad, solid or hollow, greyish white to greyish yellow, becoming greyish brown when dry, occasionally with grooves, base slightly enlarged. Ectal excipulum 120–200 µm broad, of textura angularis, cells hyaline to pale brown, sometimes extending into fascicled hyphoid hairs in outer ectal excipulum, hairs multiseptated, cells elongate club-shaped, 16–40 × 8–21 µm. Medullary excipulum 300–360 µm broad, of interwoven textura intricata, hyphae 3.0–6.0 µm broad. Asci pleurorhynchous, tapering, 8-spored, 250–300 × 17–20 µm. Ascospores ellipsoid, with one large oil drop when mature, 18–20.5 × 11–13 μm, [Lm × Wm = 19.1 × 11.9 μm, Q = 1.44–1.81, Q_av = 1.61 ± 0.09]. Paraphyses filiform, septate, subhyaline to pale brown, 4.5-7.0 µm wide at clavate to subcapitate tips and 2-4 µm below.

Habitat: Scattered on the ground in broadleaf forest and coniferous forest.

Distribution: Known from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Jincheng City, Qinshui County, Lishan mountains, on the ground in broadleaf forest dominated by Quercus sp., 35°29′4″N, 112°1″″25″E, alt. 1 675m, 27 Aug. 2020, N. Mao (holotype BJTC FM1130, GenBank Acc. No.: ITS = OR355100, nrLSU = OR355270, tef1-α = OR359027, rpb2 = OR359149, hsp = OR366092); ibid., (BJTC FM1131); ibid., Linfen City, Pu County, Wulushan mountains, on the ground in coniferous forest dominated by Pinus sp., 10 Sep. 2017, X.Y. Yan (BJTC FM305); ibid., Lvliang City, Jiaocheng County, Guandishan mountains, on the ground in coniferous forest dominated by Larix principis-rupprechtii and Picea asperata, alt. 2 003 m, 7 Sep. 2017, J.Z. Cao (BJTC FM264); ibid., Lvliang City, Xing County, Heicha mountains, on the ground in broadleaf forest dominated by Populus sp., alt. 1 590 m, 5 Sep. 2018, L.J. Guo (HSA 362); ibid., Taiyuan City, Loufan County, Yundingshan mountains, on the ground in coniferous forest dominated by Pinus sp., alt. 1 642 m, 23 Aug. 2022, N. Mao (BJTC FM2484).

Notes: Helvella multiformis is diagnosed by its variation of cap shape and colour (cup to saddle, grey to black). Phylogenetically it is nested in the rivularis-sublicia lineage, Elastica clade, and closely related to H. poculiformis and H. sublicia (Fig. 1). Helvella poculiformis is differentiated from H. multiformis by its cup-like and grey or grey-brown cap (never saddle-shaped and black), H. sublicia (syn. Helvella ephippium) by its whitish, greyish to dark grey cap (lacking black tints) (Skrede et al. 2020). Molecularly, five hsp and two rpb2 substitutions separate this new species from H. poculiformis; five hsp, six rpb2, five nrLSU substitutions, and 11 tef1-α substitutions from H. sublicia. Four ITS sequences from GenBank matched H. multiformis in our analysis (Fig. S3). These sequences are respectively extracted from ascomata or ectomycorrhizal root tips of Epipactis helleborine, and Pinus tabuliformis, from Shanxi Province, Ningxia Hui Autonomous Region. These indicate that H. multiformis also occurs in other regions of China, and could form ectomycorrhiza with E. helleborine and P. tabuliformis. Helvella multiformis shares less than 95.35 % ITS similarity with other Hevella species, supporting it as a distinct species.

Helvella neofistulosa L. Fan, N. Mao & C.L. Hou, sp. nov. MycoBank MB 849617. Fig. 11.

Fig. 11.

Helvella neofistulosa (BJTC ZH1213, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in water. D. Asci and paraphyses in Congo Red. E. Immature asci in Congo Red. Scale bars: A = 1 cm; B, E = 10 μm; C, D = 20 μm.

Etymology: neofistulosa, neo-, new, because this species is phylogenetically closely related to H. fistulosa.

Apothecia stipitate-capitate; cap saddle-shaped, bi-to trilobate, or irregularly lobate, 0.6-2.5 cm high, 1.3-2.5 cm broad, at first margin adhered to stipe, then reflexed with age; hymenium grey to greyish yellow, becoming ochre to dark brown when dry; receptacle surface subpubescent, greyish white, becoming yellow when dry; stipe 1.3-5.3 cm high, 0.3-0.7 cm broad, solid or hollow, greyish white to cream, becoming yellow when dry, base slightly enlarged. Ectal excipulum 70-120 µm broad, of textura angularis, cells hyaline to pale brown, arranged in rows turning out perpendicular to receptacle surface, outermost cells clavate, 22-50 × 10-23 µm. Medullary excipulum 160–250 µm broad, of interwoven textura intricata, hyphae 2.3-4.5 µm broad. Asci pleurorhynchous, tapering, 8-spored, 250-300 × 14-21 µm. Ascospores ellipsoid, with one large oil drop when mature, 18-22.5 × 10.5-12.5 μm, [Lm × Wm = 20 × 11.6 μm, Q = 1.58-1.89, Q_av = 1.72 ± 0.08]. Paraphyses filiform, 2.5-4.5 µm below, septate, clavate to subcapitate, 6-11 µm wide at tips.

Habitat: Scattered on the ground in mixed broadleaf forest.

Distribution: Known from Beijing and Hebei Province, Northern China.

Specimens examined: China, Beijing, Huairou District, Labagoumen, on the ground in mixed broadleaf forest, alt. 1 250 m, 25 Aug. 2020, H. Zhou (holotype BJTC ZH1213, GenBank Acc. No.: ITS = OR355059, nrLSU = OR355229, tef1-α = OR358994, rpb2 = OR359118, hsp = OR366056); Hebei Province, Chicheng county, Dahaituo, on the ground in mixed broadleaf forest, alt. 1 267 m, 25 Aug. 2020, H. Zhou (BJTC FM1251).

Notes: Helvella neofistulosa is placed in a position sister to H. fistulosa in the capucina-danica lineage, Elastica clade (Fig. 1). Morphologically, the two species can be separated by the cap colour, which is grey to greyish yellow in H. neofistulosa but brown in H. fistulosa. Molecularly, there are two hsp, one rpb2, three nrLSU, and 22 tef1-α substitutions between the two species (Skrede et al. 2017). Two ITS sequences downloaded from GenBank matched H. neofistulosa in our analysis (Fig. S3). The two sequences are respectively extracted from ascomata or ectomycorrhizal root tips of broadleaved trees, from China or Japan, implying that H. neofistulosa also occurs in Japan and can form ectomycorrhizas with broadleaved trees. Helvella neofistulosa shares less than 95.08 % ITS similarity with other Hevella species, supporting it is a distinct species.

Helvella nigrorava L. Fan, YY. Xu & C.L. Hou, sp. nov. MycoBank MB 849618. Fig. 12.

Fig. 12.

Helvella nigrorava (BJTC ZH67, holotype). A. Apothecium. B. Ascospores in water. C. Asci in Congo Red. D. Asci and paraphyses in Congo Red. E. Ectal excipulum in Congo Red. Scale bars: A = 1 cm; B-E = 10 μm.

Etymology: nigrorava, nigro-, means black, rava, means grey, referring to the blackish grey cap of this species.

Apothecium stipitate-capitate; cap saddle-shaped, 1.5 cm high, 1.2 cm broad; hymenium dark grey to greyish black, becoming black brown to black when dry; receptacle surface pubescent, concolourous with hymenium, becoming dark brown to black brown when dry; stipe pubescent, terete, 1.7 cm high, 0.2-0.35 cm broad, solid or hollow, greyish white to grey, becoming greyish brown to brown when dry, base slightly enlarged. Ectal excipulum 75-115 µm broad, of textura angularis, cells hyaline to pale brown, extending into fascicled hyphoid hairs in outer ectal excipulum, hairs multiseptated, cells elongate club-shaped, 11-37 × 9-16 µm. Medullary excipulum 135-200 µm broad, of interwoven textura intricata, hyphae 2.0-5.0 µm broad. Asci pleurorhynchous, tapering, 8-spored, 235-265 × 15-20 µm. Ascospores ellipsoid, with one large oil drop when mature, 16.5–18.5 × 11-12.5 μm, [Lm × Wm = 17.5 × 11.8 μm, Q = 1.40-1.63, Q_av = 1.49 ± 0.07]. Paraphyses filiform, septate, pale yellow to pale brown, 4.5-6.0 µm wide at clavate to subcapitate tips and 2.5-4.0 µm below.

Habitat: Scattered on the ground in broadleaf forest. Distribution: Known from Beijing, Northern China.

Specimen examined: China, Beijing, Changping District, Tiebiyinshan Mountains, on the ground in broadleaf forest, alt. 362 m, 14 Aug. 2019, H. Zhou (holotype BJTC ZH67, GenBank Acc. No.: ITS = OR355105, nrLSU = OR355275, tef1-α = OR359032, rpb2 = OR359154, hsp = OR366097).

Notes: Helvella nigrorava was phylogenetically sister to H. alborava, a new species described in this study, in the rivularis-sublicia lineage, Elastica clade (Fig. 1). The two species can be separated by the cap shape and colour, which is saddle-shaped or irregularly cup-like and grey to greyish white in H. alborava, but regularly saddle-shaped and dark grey to greyish black in H. nigrorava. Also, H. nigrorava is more distinct pubescent on both of receptacle and stipe than that in H. alborava. Molecularly, there were four hsp, three rpb2, two nrLSU, and 20 tef1-α substitutions between the two species. One ITS sequence (GenBank MF405780) extracted from ectomycorrizal root tip of Quercus variabilis in Shanxi Province, Northern China matched this species (Fig. S3), indicating that H. nigrorava can form ectomycorrhizas with this plant species. Helvella nigrorava shares less than 95.9 % similarity in ITS region with other Helvella species.

Helvella pseudoelastica L. Fan, Y.Y. Xu & H. Zhou, sp. nov. MycoBank MB 849619. Fig. 13.

Fig. 13.

Helvella pseudoelastica (BJTC C351-A, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Paraphyses in Congo Red. E. Immature asci in Congo Red. Scale bars: A = 1 cm; B-E = 10 μm.

Etymology: pseudoelastica, referring to the similarity to H. elastica in appearance of ascomata.

Apothecia stipitate-capitate; cap saddle-shaped to bilobate, 0.7–1.2 cm high, 1.2–1.9 cm broad; hymenium greyish white, becoming brown when dry; receptacle surface greyish white, becoming yellowish when dry; stipe terete, 2.8–4.3 cm high, 0.2–0.4 cm broad, solid or hollow, white to yellowish white with distinct tints of pinkish especially near the base, becoming yellowish brown when dry. Ectal excipulum 85–115 µm broad, of textura angularis, cells hyaline to pale brown, arranged in rows turning out perpendicular to receptacle surface, outermost cells elongate club-shaped, 15–40 × 8–20 µm. Medullary excipulum 125–150 µm broad, of interwoven textura intricata, hyphae 2.0–5.0 µm broad. Asci pleurorhynchous, tapering, 8-spored, 260–290 × 16–21 µm. Ascospores ellipsoid, with one large oil drop when mature, 20–23 × 11–13 μm, [Lm × Wm = 21.5 × 12.1 μm, Q = 1.57–1.91, Q_av = 1.77 ± 0.11]. Paraphyses filiform, septate, pale brown, 5.0–8.0 µm wide at clavate to subcapitate tips and 2.0–4.0 µm below.

Habitat: Scattered on the ground in broadleaf forest.

Distribution: Known from Hebei Province, Northern China.

Specimens examined: China, Hebei Province, Xinglong County, on the ground in broadleaf forest, alt. 946 m, 22 Aug. 2020, G.Q. Cheng (holotype BJTC C351-A, GenBank Acc. No.: ITS = OR355170, nrLSU = OR355341, tef1-α = OR359078, rpb2 = OR359189, hsp = OR366143); ibid., (BJTC C351-B).

Notes: Helvella pseudoelastica was nested in the capucina-danica lineage, Elastica clade (Fig. 1). Morphologically, it is difficult to separate H. pseudoelastica from the species of capucina-danica lineage, bicolor-elastica lineage and carnosa lineage in the Elastica clade by morphology alone. Most of these specimens had been misidentified as H. elastica during past decades. The stipe with distinct pinkish tint may be unique for this new species, but more specimens are needed to confirm this observation. Helvella pseudoelastica is closely related to H. panormitana, but there are two hsp, six rpb2, five nrLSU, and 12 tef1-α substitutions between them. Helvella pseudoelastica shares less than 93.08 % similarity in the ITS region with other Helvella species. An ITS specimen-sequence (GenBank KR673633) from South Korea matched H. pseudoelastica in our phylogenetic analysis (Fig. S3), which indicated that H. pseudoelastica also occurs in South Korea.

Helvellapseudofallax L. Fan, N. Mao & Y.Y. Xu, sp. nov. MycoBank MB 849620. Fig. 14.

Fig. 14.

Helvella pseudofallax (HSA 356, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Paraphyses in Congo Red. E. Immature asci in Congo Red. Scale bars: A = 1 cm; B, E = 10 μm; C, D = 20 μm.

Etymology: pseudofallax, referring to its morphological similarity to H. fallax.

Apothecia stipitate-capitate; cap saddle-shaped or irregularly lobed, 0.6–1.0 cm high, 0.7–1.8 cm broad, at first margin adhered to stipe, then occasionally irregularly folded and free from stipe with age; hymenium grey, dark grey to blackish, becoming greyish black when dry; receptacle surface subpubescent, pale grey, becoming greyish black to black brown when dry; stipe subpubescent, terete, 1.5–5.0 cm high, 0.2–0.6 cm broad, solid or hollow, grey, becoming greyish black when dry. Ectal excipulum 150–200 µm broad, of textura angularis, cells hyaline to pale brown, extending into fascicled hyphoid hairs in outer ectal excipulum, hairs multiseptated, cells elongate clubshaped, 20–45 × 9–20 µm. Medullary excipulum of interwoven textura intricata, 200–350 µm thick, hyphae, 2.0–6.5 µm broad. Asci pleurorhynchous, tapering, 8-spored, 230–300 × 13–19 µm. Ascospores ellipsoid, with one large oil drop when mature, 15.5–19.5 × 9.5–11 μm, [Lm × Wm = 17.5 × 10.3 μm, Q = 1.55–1.90, Q_av = 1.70 ± 0.08]. Paraphyses filiform, septate, pale brown, 6.0–10.0 µm wide at clavate to subcapitate tips and 2.0–4.5 µm below.

Habitat: Scattered on the ground in broadleaf forest dominated by Populus sp.

Distribution: Known from Hebei and Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Lvliang City, Xing County, Heichashan mountains, on the ground in broadleaf forest dominated by Populus sp., alt. 1 590 m, 5 Sep. 2018, J.Z. Cao (holotype HSA 356, GenBank Acc. No.: ITS = OR355083, nrLSU = OR355253, tef1-α = OR359015, rpb2 = OR359138, hsp = OR366080); ibid., Xinzhou City, Wutai County, Wutaishan mountains, on the ground in broadleaf forest dominated by Populus sp., alt. 1 910 m, 3 Sep. 2020, J.Z. Cao (BJTC FM1148); Hebei Province, Zhangjiakou City, Chicheng County, on the ground in broadleaf forest, alt. 1 314 m, 26 Aug. 2020, H. Zhou (BJTC ZH1283).

Notes: Helvella pseudofallax was phylogenetically placed in the fallax-pezizoides lineage of the Elastica clade (Fig. 1). Helvella fallax and H. pulla are highly similar to the present species in morphology, but the pubescent receptacle and slightly reflexed cap margin separate it from the two former species (Skrede et al. 2017, 2020). In addition, six hsp, nine rpb2, 19 LSU, and 20 tef1-α substitutions separated this new species from H. fallax; 12 hsp, nine rpb2, and 21 LSU substitutions from H. pulla. Helvella pseudofallax shares less than 93.74 % similarity in the ITS region with other Helvella species.

Helvella pseudopezizoides L. Fan, N. Mao & YY. Xu, sp. nov. MycoBank MB 849621. Fig. 15.

Fig. 15.

Helvella pseudopezizoides (BJTC FM1045-A, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Asci and paraphyses in Congo Red. E. Asci in Congo Red. Scale bars: A = 1 cm; B, E = 10 μm; C, D = 20 μm.

Etymology: pseudopezizoides, referring to the similarity to H. pezizoides.

Apothecia stipitate-capitate; cap saddle-shaped, or irregularly lobed, margin adnate to stipe, 0.9–2.0 cm high, 0.7–2.5 cm broad; hymenium grey, dark grey to grey blackish, becoming black when dry, slightly wrinkled with age; receptacle surface pubescent to villose, greyish black, becoming black when dry; stipe terete, 1.5–3.0 cm high, 0.2–0.7 cm broad, solid or hollow, concolourous with receptacle surface, becoming black when dry, occasionally with grooves. Ectal excipulum 100–200 µm broad, of textura angularis, cells hyaline to pale brown, extending into fascicled hyphoid hairs in outer ectal excipulum, hairs multiseptated, cells elongate club-shaped, 20–45 × 8–16 µm. Medullary excipulum 300–400 µm broad, of interwoven textura intricata, hyphae 2.0–6.0 µm broad. Asci pleurorhynchous, tapering, 8-spored, 230–300 × 13–18 µm. Ascospores ellipsoid, with one large oil drop when mature, 16–19.5 × 10.5–12 μm, [Lm × Wm = 18.1 × 11.2 μm, Q = 1.50–1.76, Q_av = 1.62 ± 0.06]. Paraphyses filiform, septate, pale brown, 6.0–11.0 µm wide at clavate to subcapitate tips and 2.0–4.5 µm below.

Habitat: Scattered on the ground in forest dominated by Quercus sp.

Distribution: Known from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Jingcheng City, Qinshui County, Shangwoquan Village, on the ground in broadleaf forest dominated by Quercus sp., alt. 1 170 m, 25 Aug. 2020, H. Liu (holotype BJTC FM1045-A, GenBank Acc. No.: ITS = OR355089, nrLSU = OR355259, tef1-α = OR359020, rpb2 = OR359143, hsp = OR366085); ibid., (BJTC FM1045-B).

Notes: Helvella pseudopezizoides is diagnosed by its overall dark grey to blackish ascomata with saddle-shaped or irregularly lobed cap and thin terete stipe. It was phylogenetically nested in the fallax-pezizoides lineage of the Elastica clade (Fig. 1). Helvella pezizoides is highly similar to the present species, but it differs by its somewhat inrolled cap margin, and smaller ascospores (14.5–16.5 × 8.5–9.6 μm) (Skrede et al. 2020). Other species in the fallax-pezizoides lineage are also somewhat similar in morphology, including H. fallax, H. caespitosa, H. pseudofallax, H. pulla, H. subglabra, H. subglabroides, but the cap colour in all of them is grey or dark grey, not blackish to black, then the stipe is pale at least near base (Skrede et al. 2017, 2020, the present study). In addition, three hsp, three rpb2, 20 nrLSU, and 16 tef1-α substitutions separated this new species from H. fallax; 14 hsp, and 26 nrLSU substitutions from H. caespitosa; 15 hsp, 11 rpb2, 28 nrLSU, and 26 tef1-α substitutions from H. pezizoides; 12 hsp, eight rpb2, 23 nrLSU, and 40 tef1-α substitutions from H. pseudofallax; seven hsp, three rpb2, and 23 nrLSU from H. pulla; four hsp, and five rpb2 from H. subglabra; five hsp, three rpb2, 24 nrLSU, and 21 tef1-α substitutions from H. subglabroides. An ITS sequence (GenBank KX444420) from an ECM root tip of Quercus liaotungensis in Beijing matched this species (Fig. S3), indicating that this species could form ectomycorrhiza with this host. Helvella pseudopezizoides shares less than 89.95 % similarity in the ITS region with other Helvella species.

Helvella sinocrispa L. Fan, N. Mao & Y.Y. Xu, sp. nov. MycoBank MB 849622. Fig. 16.

Fig. 16.

Helvella sinocrispa (BJTC FM96-A, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in water. D. Asci and paraphyses in Congo Red. Scale bars: A = 1 cm; B-D = 10 μm.

Etymology: sinocrispa, referring to its similarity to H. crispa in morphology.

Apothecia stipitate-capitate; cap saddle-shaped to irregularly lobate, 1.4–2.5 cm high, 2.5–4 cm broad, at first margin rolled to hymenium, then expanded or cracked with age; hymenium glabrous, cream white to whitish, becoming brown to dark brown when dry; receptacle surface subpubescent, pale yellow to greyish yellow, becoming pale brown to yellowish brown when dry; stipe robust, 2.5–5.5 cm high, 1.0–2.6 cm broad, glabrous, white to dirty whitish, becoming pale yellow when dried, ribbed, blunt-edged, partly anastomosing and double-edged, with lacunae between ribs, chambered inside. Ectal excipulum 80–180 µm broad, of textura angularis, cells hyaline to pale brown, outermost cells catenuliform in long fascicled tufts, with cylindrical to subclavate, end cells 15–37 × 8.5–15 µm. Medullary excipulum 190–270 µm broad, of interwoven textura intricata, hyphae 2.5–5 µm broad. Asci pleurorhynchous, tapering, 8-spored, 255–285 × 13–16.5 µm. Ascospores ellipsoid, with one large oil drop when mature, 18–20 ×10.5–12 μm, [Lm × Wm = 19.3 × 11.2 μm, Q = 1.60–1.90, Q_av = 1.73 ± 0.08]. Paraphyses filiform, septate, hyaline to pale brown, 4.5–7 µm wide at tips and 2–3.5 µm below.

Habitat: Solitary or scattered on the ground in coniferous forest dominated by Larixprincipis-rupprechtii and Picea asperata.

Distribution: Known only from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Xinzhou City, Ningwu County, Guancenshan mountains, on the ground in coniferous forest dominated by Larix principis-rupprechtii and Picea asperata, alt. 2 230 m, 24 Aug. 2017, M. Chen (holotype BJTC FM96-A, GenBank Acc. No.: ITS = OR355155, nrLSU = OR355326, tef1-α = OR359068, rpb2 = OR359180, hsp = OR366133); ibid., (BJTC FM96-B).

Notes: Helvella sinocrispa is recognized by its isolated phylogenetic position in the Crispa clade (Fig. 1). Morphologically it is highly similar to three other species of this clade, namely H. crispa, H. orienticrispa, and H. pseudoreflexa. In fact, it is difficult to distinguish these four species by morphology alone. DNA analysis is therefore needed to accurately identify them. Molecularly, three hsp, six rpb2, five nrLSU, and 11 tef1-α substitutions separated this new species from H. crispa; three hsp, four rpb2, one nrLSU, and 12 tef1-α substitutions from H. orienticrispa; three hsp, four rpb2, two nrLSU, and 11 tef1-α substitutions from H. pseudoreflexa. Four ITS sequences downloaded from GenBank matched H. sinocrispa in our analysis (Fig. S2). These sequences are extracted from ascomata and ectomycorrhizal root tips from China, Europe or the USA. These results implied that H. sinocrispa is widely distributed in Northern Hemisphere. DNA analysis revealed that H. sinocrispa shares less than 94.04 % similarity in ITS region with other Helvella species, supporting it as a distinct species.

Helvella sinohyperborea L. Fan, N. Mao & Y.Y. Xu, sp. nov. MycoBank MB 849623. Fig. 17.

Fig. 17.

Helvella sinohyperborea (A, D–G. BJTC FM105, holotype. B, C. BJTC FM165). A. Apothecium. B, C. Apothecium infected by Hypomyces sp. D. Ascospores in water. E. Asci and paraphyses in Congo Red. F. Ectal excipulum in water. G. Immature asci in Congo Red. Scale bars: A–C = 1 cm; D–G = 10 μm.

Etymology: sinohyperborea, referring to its close phylogenetic relationship to H. hyperborea.

Apothecia stipitate-cupulate; cap regular cupulate or irregularly undulate with wrinkled surface, 1.3–2.0 cm high, 2.1–6.0 cm broad; hymenium dark brown to blackish, becoming black when dry; receptacle surface upper part slightly lighter than the hymenium, below gradually white, becoming black when dry; stipe short, 1.0–2.5 cm high, 0.5–0.8 cm broad, hollow, white, becoming pale yellow to pale brown when dry, ribbed, blunt-edged, partly anastomosing and double-edged, occasionally with lacunae between ribs, ribs extending onto the receptacle. Ectal excipulum 100–150 µm broad, of textura angularis, cells hyaline to pale brown, extending into fascicled hyphoid hairs in outer ectal excipulum, hairs multiseptated, cells elongate club-shaped, 15–40 × 11–19 µm. Medullary excipulum 400–700 µm broad, of interwoven textura intricata, hyphae 2.0–6.0 µm broad. Asci pleurorhynchous, tapering, 8-spored, 240–300 × 13–19 µm. Ascospores ellipsoid, with one large oil drop when mature, 16–18.5 × 11–12.5 μm, [Lm × Wm = 17.5 × 11.8 μm, Q = 1.38–1.58, Q_av = 1.49 ± 0.05]. Paraphyses filiform, septate, pale brown, 4.5–6.0 µm wide at clavate to subcapitate tips and 1.5–3.5 µm below.

Habitat: Scattered on the ground in coniferous forest dominated by Larix principis-rupprechtii.

Distribution: Known from Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Xinzhou City, Ningwu County, Guancen mountains, on the ground in coniferous forest dominated by Larix principis-rupprechtii, alt. 2 220 m, 24 Aug. 2017, X.Y. Yan (holotype BJTC FM105, GenBank Acc. No.: ITS = OR355132, nrLSU = OR355303, tef1-α = OR359056, rpb2 = OR359170, hsp = OR366121); ibid., alt. 2 099 m, 25 Aug. 2017, X.Y. Yan (BJTC FM165).

Notes: Helvella sinohyperborea is characterized by the cuplike or undulate cap, the short robust ribbed stipe. Our present analysis places H. sinohyperborea in the hyperborean-tinta lineage in the Lacunosa clade, closely related to H. hyperborea and H. tinta. Helvella hyperborea is a Northern European species. It is differentiated from H. sinohyperborea by its regular cup-like cap, long stipe and pale brown hymenium (Skrede et al. 2017). Helvella tinta is a species known from southwestern China. It is distinguished from H. sinohyperborea by its cup-like cap of ascomata with a consistently mottled, greyish to dark brown hymenium and receptacle surface (Hyde et al. 2016). Molecularly, two hsp and one rpb2 substitutions separate this new species from H. hyperborea; four hsp, five nrLSU, and one tef1-α substitutions from H. tinta. Helvella sinohyperborea shared less than 97.83 % similarity in ITS region with other Helvella species. Two ITS sequences downloaded from GenBank matched H. sinohyperborea in our analysis (Fig. S4). These sequences are both extracted from ectomycorrhizal root tips of Picea crassifolia, from Inner Mongolia, Ningxia Hui Autonomous Region. This indicated that H. sinohyperborea also occurs in other regions of China, and could form ectomycorrhiza with P crassifolia.

Helvella subglabroides L. Fan, N. Mao & Y.Y. Xu, sp. nov. MycoBank MB 849624. Fig. 18.

Fig. 18.

Helvella subglabroides (BJTC C614). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Asci and paraphyses in Congo Red. E. Immature asci in Congo Red. Scale bars: A = 1 cm; B, E = 10 μm; C, D = 20 μm.

Etymology: subglabroides, referring to its high similarity to H. subglabra in appearance of its ascomata.

Apothecia stipitate-capitate; cap saddle-shaped, 0.7–2.5 cm high, 0.8–2.0 cm broad, at first margin adhered to stipe, then reflexed with age; hymenium grey to greyish yellow, becoming dark grey to greyish black when dry; receptacle surface glabrous to fine pubescent, concolourous with hymenium, becoming brown when dry; stipe terete, 2.0–5.0 cm high, 0.2–0.4 cm broad, solid, subpubescent, greyish white to grey, becoming dark grey when dry, base occasionally with inconspicuous grooves and white mycelia. Ectal excipulum 50–100 µm broad, of textura angularis, cells hyaline to pale brown, arranged in rows turning out perpendicular to receptacle surface, outermost cells clavate, 20–45 × 9–20 µm. Medullary excipulum 100–200 µm broad, of interwoven textura intricata, hyphae 2.5–6.5 µm broad. Asci pleurorhynchous, tapering, 8-spored, 200-260 × 12.5-18.5 µm. Ascospores ellipsoid, with one large oil drop when mature, 15–19.5 × 9–11 μm, [Lm × Wm = 17.2 × 10 μm, Q = 1.5–2, Q_av = 1.73 ± 0.10]. Paraphyses filiform, septate, yellowish brown, 5.5–11.5 µm wide at clavate to subcapitate tips and 2.5–4.0 µm below.

Habitat: Scattered on the ground in mixed coniferous and broadleaf forest.

Distribution: Known from Hebei, Shanxi, and Yunnan Province, China.

Specimens examined: China, Shanxi Province, Changzhi City, Qinyuan County, Lingkong mountains, on the ground in coniferous forest and broadleaf mixed forest, 15 Aug. 2022, N. Mao (holotype BJTC FM2686, GenBank Acc. No.: ITS = OR355088, nrLSU = OR355258, tef1-α = OR359019, rpb2 = OR359142, hsp = OR366084); ibid., Jincheng City, Qinshui County, Shangwoquan Village, on the ground in broadleaf forest dominated by Quercus sp., 35°36'57"N, 112°3'7"E, alt. 1 170 m, 25 Aug. 2020, H. Liu (BJTC FM1049); Hebei Province, Zhangjiakou City, Chicheng County, Dahaituo Township, on the ground in coniferous forest and broadleaf mixed forest, alt. 1 222 m, 26 Aug. 2020, G.Q. Cheng (BJTC C614); Yunnan Province, Lijiang City, Jinshan mountains, 12 Sep. 2012, Q. Zhao (HKAS 78939); ibid., (HKAS 78940).

Notes: Our present analysis places H. subglabroides in the fallax-pezizoides lineage, Elastica clade, and is closely related to the North American H. subglabra (Fig. 1). Morphologically, H. subglabroides is also similar to H. subglabra, both having a saddle-shaped cap. However, the two species can be separated by their hymenium colour, which is grey to greyish yellow in the former but dark grey in the latter (Weber 1972). Molecularly, three hsp, four rpb2, eight nrLSU substitutions distinguish H. subglabra from H. subglabroides. Helvella subglabroides shares less than 96.15 % similarity in ITS region with other Helvella species.

Helvella sulcatoides L. Fan, N. Mao & Y.Y. Xu, sp. nov. MycoBank MB 849625. Fig. 19.

Fig. 19.

Helvella sulcatoides (BJTC FM1416, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Asci and paraphyses in Congo Red. E. Immature asci in Congo Red. Scale bars: A = 1 cm; B-E = 10 μm.

Etymology: sulcatoides, referring to its similarity to H. sulcata.

Apothecia stipitate-capitate; cap saddle-shaped, mostly bilobate, I. 3-1.8 cm broad, 1.3-2.0 cm high, margin attached to stipe; hymenium grey, dark grey to black grey, becoming black when dried, slightly wrinkled; receptacle surface pale grey to greyish brown, becoming greyish brown when dried, smooth, without ribs on receptacle surface; stipe 0.5–0.9 cm broad, 1.2–2.4 cm high, greyish white to black grey, becoming dark brown to black brown when dry, ribbed, longitudinal ribs high and prominent, sharp, occasionally double-edged, sometimes with a few deep 'holes' between ribs. Ectal excipulum of textura angularis, 65–100 µm thick, cells hyaline to pale brown, arranged in rows turning out perpendicular to receptacle surface, outermost cells arranged in dense, club-shaped, 13-40 × 7-18 µm. Medullary excipulum of interwoven textura intricata, 130-200 µm thick, hyphae 2.5-6.5 µm broad. Asci pleurorhynchous, tapering, 8-spored, 225-275 × 14-18 µm. Ascospores ellipsoid, with one large oil drop when mature, 14.5-16.5 × 9-10.5 μm, [Lm × Wm = 15.9 × 9.9 μm, Q = 1.41-1.74, Q_av = 1.56 ± 0.08]. Paraphyses filiform, septate, hyaline to pale brown, 4-6 µm wide at tips and 2.5-4 µm below.

Habitat: Solitary or scattered on the ground in coniferous forest dominated by Larixprincipis-rupprechtii and Picea asperata.

Distribution: Known from Beijing and Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Xinzhou City, Wutai County, Wutaishan mountains, on the ground in coniferous forest dominated by Larix principis-rupprechtii and Picea asperata., 11 Aug. 2020, H. Liu (holotype BJTC FM1416, GenBank Acc. No.: ITS = OR355119, nrLSU = OR355290, tef1-α = OR359043, rpb2 = OR359160, hsp = OR366108); ibid., Lvliang City, Jiaocheng County, Guandishan mountains, 37°52′16″N, 111°30′25″E, alt. 2 003 m, 7 Sep. 2017, J.Z. Cao (BJTC FM263); Beijing, Huairou District, Labagoumen, alt. 1 345 m, 25 Aug. 2020, H. Zhou (BJTC ZH1231).

Notes: Phylogenetically, H. sulcatoides is placed in the sulcata-phlebophoroides lineage, Lacunosa clade (Fig. 1). It is closely related and similar to H. borealis and H. sulcata, but H. borealis is differentiated from H. sulcatoides by its grey white hymenium, slightly broader paraphyses at the apex (6.5-10.5 μm) and habit of growing on rotten wood (Wang et al. 2023a); H. sulcata by its black hymenium, large asci (290-320 × 13-16 μm), and broad spores (14.8-16.8 × 10.5-13.2 μm) (Skrede et al. 2017). Helvella phlebophoroides, a species recently described from Europe, is also closely related to H. sulcatoides, but can be separated by its irregularly radiating ribs on the receptacle surface, and large asci (280-320 × 12-15 µm) (Skrede et al. 2020). In addition, one hsp, five tef1-α substitutions separated H. sulcatoides from H. borealis; one hsp, four nrLSU, three tef1-α substitutions from H. sulcata; four hsp, six rpb2, and eight nrLSU substitutions from H. phlebophoroides.

Helvella xiaohuipan L. Fan, N. Mao & Y.Y. Xu, sp. nov. MycoBank MB 849626. Fig. 20.

Fig. 20.

Helvella xiaohuipan (BJTC FM2317, holotype). A. Apothecia. B. Ascospores in water. C. Ectal excipulum in Congo Red. D. Asci and paraphyses in Congo Red. E. Asci in Congo Red. Scale bars: A = 1 cm; B-E = 10 μm.

Etymology: xiaohuipan, Chinese, meaning this Helvella is a small-sized and grey species with cup-like cap.

Apothecia stipitate-cupulate; regular cupulate to saucer-shaped, 0.3-0.7 cm high, 0.7-2.0 cm broad; hymenium grey to dark grey, becoming brown to black-brown when dry; receptacle surface pubescent, concolourous with hymenium, becoming greyish brown when dry; stipe terete, slender, 1.2–1.8 cm high, 0.15–0.35 cm broad, solid, yellowish white, becoming yellow when dry. Ectal excipulum 150-175 µm broad, of textura angularis, cells hyaline to pale brown, extending into fascicled hyphoid hairs in outer ectal excipulum, hairs multiseptated, cells elongate club-shaped, 12-37 × 10-20 µm. Medullary excipulum 250–300 µm broad, of interwoven textura intricata, hyphae 2.0-5.0 µm broad. Asci pleurorhynchous, tapering, 8-spored, 235-275 × 14-20 µm. Ascospores ellipsoid, with one large oil drop when mature, 17-19.5 × 10.5-12 μm, [Lm × Wm = 18 × 11.4 μm, Q = 1.46-1.72, Q_av = 1.58 ± 0.06]. Paraphyses filiform, septate, pale brown, 4.5-6.0 µm wide at clavate to subcapitate tips and 3.54.5 µm below.

Habitat: Scattered on the ground in broadleaf forest and coniferous forest.

Distribution: Known from Hebei and Shanxi Province, Northern China.

Specimens examined: China, Shanxi Province, Yuncheng City, Xia County, Sijiao Town, on the ground in broadleaf forest dominated by Quercus sp., 35°07″″89″N, 111°40″″09″E, alt. 970 m, 12 Aug. 2022, N. Mao (holotype BJTC FM2317, GenBank Acc. No.: ITS = OR355079, nrLSU = OR355249, tef1-α = OR359011, rpb2 = OR359134, hsp = OR366076); Hebei Province, Tangshan City, Zhangzhuangzi Village, on the ground in broadleaf forest dominated by Castanea mollissima, 40°14″″21″N, 117°51″″15″E, alt. 107 m, 17 Sep. 2017, T. Ling (BJTC FM367).

Notes: Helvella xiaohuipan is characterized by its grey and cuplike cap, pubescent receptacle surface, yellowish white slender terete stipe and ellipsoid ascospores. Helvella xiaohuipan was phylogenetically nested in its own lineage (xiaohuipan lineage) in the Elastica clade, sister to the fallax-pezizoides lineage (Fig. 1). Currently, there are only two species recognized in this lineage, both from China. Helvella fibrosa (= H. villosa) in the fibrosa-macropus lineage is similar to H. xiaohuipan in colour and shape of ascomata (Dissing & Nannfeldt 1966). However, H. fibrosa differs from H. xiaohuipan by its grey stipe and ascospores longer than 20 μm. Helvella pubescens from the rivularis-sublicia lineage and H. scyphoides from the hypocrateriformis lineage also have a disk-like cap, but the colour of the cap is brown (Skrede et al. 2017) rather than grey as in H. xiaohuipan. Moreover, species in the fallax-pezizoides lineage have saddle-shaped ascocarps that make them easy to distinguish from the new species. An ITS specimen-sequence (GenBank JX462576, labelled as Helvella cf. corium) from China matched H. xiaohuipan in our phylogenetic analysis (Fig. S1), indicating that H. xiaohuipan also occurs in other regions of China. DNA analysis revealed that H. xiaohuipan shares less than 92.88 % similarity in ITS region with other Helvella species, supporting it as a distinct species.

Helvella galeriformis B. Liu & J.Z. Cao, Acta Mycol. Sin. 7: 199. 1988, L. Fan, N. Mao & Y.Y. Xu, emend. Fig. 21.

Fig. 21.

Helvella galeriformis (HSA 232, epitype). A, B. Apothecium. C. Ascospores in water. D. Ectal excipulum in Congo Red. E. Paraphyses in Congo Red. F. Asci in Congo Red. Scale bars: A, B = 1 cm; C, F = 10 μm; D, E = 20 μm.

Apothecia stipitate-capitate; cap irregularly hemisphere, irregularly umbrella type to irregularly saddle-shaped, 0.6-2 cm high, 1.5-3.5 cm broad, at first margin adhered to stipe, then more or less deflexed; hymenium greyish black, occasionally with olive green tinge; receptacle surface white, concolourous with stipe; stipe terete, 1.2-5.0 cm high, 0.3-0.7 cm broad, solid or hollow, cream to white, base slightly enlarged, with shallow grooves. Ectal excipulum 90–150 µm broad, of textura angularis, cells hyaline to pale brown, arranged in rows turning out perpendicular to receptacle surface, outermost cells clavate, 22–56 × 10–25 µm. Medullary excipulum 150–250 µm broad, of interwoven textura intricata, hyphae 2.5–6.5 µm broad. Asci pleurorhynchous, tapering, 8-spored, 300–360 × 15–20 µm. Ascospores ellipsoid, with one large oil drop when mature, 19–22.5 × 11.5–13.5 μm, [Lm × Wm = 20.8 × 12.5 μm, Q = 1.5–1.8, Q_av = 1.65 ± 0.07]. Paraphyses filiform, 2.5–4.5 µm below, pale yellow to pale brown, septate, clavate to subcapitate, 6–10 µm wide at tips.

Habitat: Scattered on the ground in mixed coniferous and broadleaf forest.

Distribution: Known only from Shanxi Province, Northern China.

Specimens examined: Lectotype here designated, Liu & Cao (1988), Acta Mycol. Sin. 7: 199. 1988, fig. 2, MycoBank MBT 10014903. China, Shanxi Province, Lvliang City, Jiaocheng County, Guandishan mountains, on the ground in coniferous forest dominated by Larix principis-rupprechtii and Betula sp., alt. 2 160 m, 28 Aug. 2018, H. Liu (epitype here designated HSA 232, MycoBank MBT 10014391, GenBank Acc.

No.: ITS = OR355066, nrLSU = OR355236, tef1-α = OR359001, rpb2 = OR359125, hsp = OR366063); ibid., L.J. Guo (HSA 240-B); ibid., on the ground in coniferous forest dominated by Picea sp., alt. 1 875 m, 25 Aug. 2022, N. Mao (BJTC FM2574).

Notes: The holotype of H. galeriformis collected from Guancenshan Mountains (cited as 'Gaunqin Mountain') in Shanxi Province (MHSU 452) has been lost. However, because Liu & Cao (1988) provided an illustration (Liu & Cao 1988; fig. 2), this is here designated as lectotype, allowing us to introduce an epitype based on recently collected material (HSA 232). Recently, we collected several specimens in the same region of the holotype of H. galeriformis (Liu & Cao 1988), but the swollen cells in the medullary excipulum were not observed. However, the diagnosed colour and peculiar shape of ascomata matched well with the original description of H. galeriformis. Considering the collecting site, habitat and morphology, we regard these specimens as conspecific to H. galeriformis. Therefore, we designate a lectotype and epitype for H. galeriformis here. Helvella galeriformis is sister to H. brunneogaleriformis in our phylogenetic analyses (Figs 1, 2). Morphologically, H. brunneogaleriformis differs from H. galeriformis by its brown hymenium without blackish tint, smaller ascospores (17-20.5 × 10.5–12.5 μm), and broader paraphyses at the apex (6–13 μm). Molecularly, H. brunneogaleriformis deviates consistently in one hsp, one tef1-α, and eight nrLSU substitutions from H. galeriformis. Helvella galeriformis shares less than 97.8 % similarity in the ITS region with H. brunneogaleriformis.

Helvella carnosa Skrede et al., Persoonia 39: 237. 2017. Fig. 22.

Fig. 22.

Photographs of apothecia in their natural habitat. A, B. Helvella carnosa (A. BJTC BP060. B. BJTC FM2619). C. H. corbierei (HSA 181). D. H. fistulosa (BJTC 1976). E. H. nordlandica (BJTC FM346-A). F. H. scyphoides (HSA 239). Scale bars = 1 cm.

Habitat: Scattered on the ground in coniferous forest or broadleaf forest.

Distribution: Known from Northern area in China.

Specimens examined: China, Beijing, Yanqing County, Songshan Mountains, alt. 812 m, 31 Aug. 2017, C.L. Hou (BJTC BP030); ibid., (BJTC BP043), ibid., alt. 816 m, C.L. Hou (BJTC BP060); ibid., alt. 919 m, 5 Sep. 2018, C.L. Hou (BJTC BP718); ibid., alt. 1 010 m, 5 Sep. 2018, C.L. Hou (BJTC BP724); ibid., Badaling, alt. 608 m, 6 Sep. 2018, X.Y. Shen. (BJTC SBP287); ibid., Shanxi Province, Xing County, Heichashan Mountains, on the ground in broadleaf forest, alt. 1 590 m, 5 Sep. 2018, J.Z. Cao (HSA 360); ibid., Pu County, Wulushan mountains, on the ground in coniferous forest, alt. 1 700 m, 9 Sep. 2018, L.J. Guo (HSA 434); ibid., Pu County, Wulushan mountains, 10 Sep. 2017, Y.Y. Xu (BJTC FM297); ibid., (BJTC FM298), ibid., J.Z. Cao (BJTC FM316); ibid., on the ground in coniferous forest, alt. 1 739 m, 26 Aug. 2022, N. Mao (BJTC FM2619); ibid., Lvliang City, Jiaocheng County, Guandishan Mountains, on the ground in coniferous forest, alt. 2 003 m, 7 Sep. 2017, T. Li (BJTC FM274); ibid., Ningwu County, Guancenshan Mountains, on the ground in coniferous forest, alt. 1 346 m, 15 Oct. 2017, X.Y. Yan (BJTC FM376), ibid., Wutai County, Wutaishan Mountains, alt. 1 376 m, 29 Aug. 2019, H. Liu (BJTC FM953); ibid., Qinshui County, Lishan mountains, on the ground in coniferous and broad-leaved mixed forest, alt. 1 650 m, 24 Aug. 2020, N. Mao (BJTC FM1032); ibid., Loufan County, Yunding Mountains, on the ground in coniferous forest, alt. 1 639 m, 23 Aug. 2022, N. Mao (BJTC FM2478); ibid., 1 642 m, 23 Aug. 2022, N. Mao (BJTC FM2479), ibid., on the ground in broad-leaved mixed forest, 1 861 m, 23 Aug. 2022, N. Mao (BJTC FM2499).

Notes: Helvella carnosa is a species recently described from Europe (Skrede et al. 2017). Our present analysis revealed that H. carnosa is common in Northern China (Fig. S3), and can form ectomycorrhiza with Abies grandis and Pinus tabuliformis, Helvella carnosa shares less than 91.86 % similarity in the ITS region with other Helvella species.

Helvella corbierei (Malençon) Van Vooren & Frund, Bull. Mycol. Bot. Dauphiné-Savoie 198: 9. 2010. Fig. 22.

Habitat: Scattered on the ground in coniferous and broad-leaved mixed forest.

Distribution: Known from Northern area in China.

Specimens examined: China, Shanxi Province, Ningwu County, Dashidong, on the ground in coniferous forest, alt. 2 207 m, 2 Aug. 2018, H. Liu (HSA 138); ibid., Qiuqiangou, on the ground in coniferous and broad-leaved mixed forest, alt. 1 600 m, 4 Aug. 2018, H. Liu (HSA 181).

Notes: Helvella corbierei is widely distributed in Europe and North America. It is confirmed from China based on morphological and DNA evidence in this study. Helvella corbierei shares less than 95.59 % similarity in the ITS region with other Helvella species.

Helvella fistulosa Alb. & Schwein., Consp. Fungorum Lusat.: 299. 1805. Fig. 22.

Habitat: Scattered on the ground in coniferous and broad-leaved mixed forest.

Distribution: Known from the Southwest area in China.

Specimen examined: China, Yunnan Province, Kunming City, Jinning District, Shuibo Villa, on the ground in coniferous and broad-leaved mixed forest, 28 Aug. 2021, T.H. Li (BJTC 1976).

Notes: Helvella fistulosa is widely distributed in Europe, North America and Japan (Skrede et al. 2017). In this study, a specimen from Yunnan Province matched this species, which confirmed the occurrence of H. fistulosa in China. Helvella fistulosa shares less than 94.51 % similar in the ITS region with other Helvella species.

Helvella nordlandica Skrede & T. Schumach. Fungal Syst. Evol. 11: 72. 2023. Fig. 22.

Habitat: Scattered on the ground in coniferous and broadleaf mixed forest.

Distribution: Known from Northern area in China.

Specimens examined: China, Shanxi Province, Linfen City, Pu County, Wulushan mountains, on the ground in coniferous and broadleaf mixed forest, 11 Sep. 2017, T. Li (BJTC FM346-A); ibid., (BJTC FM346-B).

Notes: Helvella nordlandica is a species recently described from Europe (Skrede et al. 2023). Our present analysis showed that H. nordlandica is a rare Helvella species in North China (Fig. 1). Helvella nordlandica shares less than 95.86 % similarity in the ITS region with other Helvella species.

Helvella scyphoides Skrede et al., Persoonia 39: 237. 2017. Fig. 22.

Habitat: Scattered on the ground in coniferous and broad-leaved mixed forest.

Distribution: Known from Northern area in China.

Specimens examined: China, Shanxi Province, Ningwu County, Xiaoshidong, on the ground in coniferous forest, alt. 2 200 m, 3 Aug. 2018, H. Liu (HSA 166); ibid., Luyashan mountains, alt. 2 270 m, 4 Sep. 2018, J.Z. Cao (HSA 336); ibid., Jiaocheng County, Pangquangou, on the ground in coniferous and broad-leaved mixed forest, alt. 2 160 m, 28 Aug. 2018, H. Liu (HSA 239); ibid., Wutai County, Wutaishan mountains, 27 Aug. 2019, Y. Shen (BJTC FM899); ibid., on the ground in coniferous forest, alt. 2 040 m, 3 Sep. 2020, N. Mao (BJTC FM1158).

Notes: Helvella scyphoides is a species recently described from Europe (Skrede et al. 2017). Our present analysis revealed this species is common in Northern China (Figs 1, 2, S3). Helvella scyphoides shared less than 93.9 % similarity in the ITS region with other Helvella species.

DISCUSSION

The species diversity of Helvella in China

Our present study revealed that China is extremely rich in species of Helvella. Chinese species of Helvella were nested in all the four clades recognized based on the samplings worldwide, i.e., Acetabulum clade, Crispa clade, Elastica clade and Lacunosa clade (Fig. 1). There were 93 clusters, which corresponded to 93 phylogenetic species in China, recognized in our phylogenetic analyses based on five genes (Figs 1, 2, S1–S4). Among them, 58 species were identified as known species including five new to China, 18 species were described as new species in this study, and 17 species were proposed as potentially undescribed species and were not treated taxonomically due to the lack or poor condition of ascocarps. Moreover, there are 34 names of Helvella recorded in China before this study, and although their DNA data are unavailable for the time being, three of them at least are morphologically distinct according to our personal observations of specimens or literature (Liu & Cao 1988, Cao et al. 1990). Thus, we infer that the total number of the genus Helvella in China could reach to 96 species with the current diversity observed in the present study.

Phylogeny and morphological correspondence of Helvella

Our five-gene-based phylogenetic analysis resolved the species of Helvella s. str. (Hansen et al. 2019) into four distinct clades, i.e., Acetabulum, Crispa, Elastica, and Lacunosa clades (Fig. 1). Compared to the phylogeny proposed by Skrede et al. (2017), the combination of our Acetabulum, Crispa and Lacunosa clades corresponded to the Clade B suggested by Skrede et al. (2017). Among them, our Acetabulum clade corresponded to their acetabulum-solitaria lineage, our Crispa clade corresponded to their crispa lineage, our Lacunosa clade contained all the other remaining lineages in their Clade B. Our Elastica clade contained the Clade D plus Clade E suggested by Skrede et al. (2017).

The Acetabulum clade occupied a basal position in the phylogenetic tree of the genus Helvella, and is the least diverse clade in species and lineages. Currently a total of nine species are recognized, five species occur in China, and two lineages, i.e., acetabulum lineage and solitaria lineage, were recognized (Figs 1, S1). All the species of the Acetabulum clade are relatively uniform in the appearance of the ascocarp that possess a regularly or irregularly cup-like cap with a robust and ribbed stipe. It is interesting that the species, nested in several lineages in the Lacunosa clade including the costifera lineage, dalgeri lineage and tianshanensis lineage, evolved highly convergent morphological features in ascocarp appearance with the species of the Acetabulum clade. The ascocarps of H. acetabulum (acetabulum lineage, Acetabulum clade), H. costifera (costifera lineage, Lacunosa clade) and H. hyperborea (hyperborea lineage, Lacunosa clade) are very similar so that the three species are often confused with one another (Harmaja 1978, 1979).

The Crispa clade is also a less diverse group in species and lineages compared to the Elastica and Lacunosa clades. A total of 13 species were recognized, including nine from China. The species H. crispa and its allies evolved as the core crispa lineage (Figs 1, S2). Morphologically, species of the crispa lineage in this clade usually have pale ascocarps. The caps of ascocarps are saddle-shaped or irregularly lobed, white, cream white and sometimes grey. The cap margin is completely free from the robust and sometimes chambered stipe. It is notable that some species of the Lacunosa clade also have white or cream-coloured ascocarps; for example, the European H. lactea and the Asian H. sublactea of the lactea lineage, or the European H. pallescens of the atra-pallescens lineage. However, all the white Helvella species in the Lacunosa clade possess a cap margin attached to the stipe at several points, by which they can be differentiated from the species of the crispa lineage in morphology. Helvella maculata from North America and H. maculatoides from China may represent their own lineage, because they each evolved an independent branch outside the crispa lineage (Fig. 1), and the cap surface (hymenium) of their ascocarps is brown or dark, which is quite different from the species of the crispa lineage.

The Elastica clade is a very diverse group in species and lineages. Our present analysis revealed eight evolving lineages in this clade (Fig. 1). Among them, six lineages, i.e., bicolor-elastica lineage, capucina-danica lineage, corbierei-stevensii lineage, fallax-pezizoides lineage, hypocrateriformis lineage, rivularis-sublicia lineage, were suggested in a previous study (Skrede et al. 2017). The carnosa lineage was newly recognized in this study. The macropus lineage was split from the previous fibrosa-macropus lineage suggested by Skrede et al. (2017). Helvella fibrosa and its allies (with ellipsoid ascospores) were not included in the macropus lineage (with subfusiform ascospores), and their phylogenetic positions remain unresolved for the time being. Morphologically, the shared features of Helvella species in the Elastica clade included the terete stipe that is usually thin, solid and definitely lacks ribs and chambers, although a few of grooves can be observed sometimes, and the multiple shaped caps being typical cup-like to saddle-like. Most species in this clade have ellipsoid ascospores, but the species that evolved in the macropus lineage have fusiform to subfusiform ascospores, which seem unique for the species evolved in the macropus lineage in Helvella. The terete stipe is generally clearly thin, but in the European H. leucopus, the Chinese H. bachu and their allies it is robust. It is notable that the species evolved in the alpina-corium lineage, alpestris-nannfeldtii lineage and alpicola lineage within the Lacunosa clade also have a terete stipe, but their stipes are usually clearly shorter, and in that case, their caps are always cup-like and have a dark brown or blackish hymenium. Chinese species evolved in all of the eight lineages mentioned above. There are at least 66 species evolved in this clade based on our analysis (Figs 1, S3), of which 44 occur in China. Eighteen new species are described in this study, and 14 potentially species were proposed but not taxonomically treated for the time being. The Elastica clade is probably the second largest clade in species diversity of Helvella.

Lacunosa clade is the most diverse group in phylogeny and morphology of Helvella. There were at least 13 lineages evolved in this clade worldwide according to Skrede et al. (2017) and this study (Fig. 1). Among them, six lineages, i.e., atra-pallescens lineage, fusca-lactea lineage, lacunosa-helvellula lineage, palustris-philonotis lineage, sulcata-phlebophoroides lineage, phlebophora lineage and the species H. queletiana were gathered into a strongly supported subclade. To improve the following discussion on this clade, we marked this subclade as subclade lacunosa, as in which H. lacunosa was included. The remaining seven lineages, i.e., alpestris-nannfeldtii lineage, alpicola lineage, alpina-corium lineage, costifera lineage, dalgeri lineage, hyperborea lineage, tianshanensis lineage, and the species H. floriforma were treated as a group and marked as "costifera group" (Fig. 1). Among the 13 lineages of the Lacunosa clade, six lineages were suggested by Skrede et al. 2017, including alpestris-nannfeldtii lineage, alpina-corium lineage, atra-pallescens lineage, fusca-lactea lineage, palustris-philonotis lineage, sulcata-phlebophoroides lineage. The remaining seven lineages were newly recognized in this study. Both the Lacunosa-nigra lineage and helvellula lineage suggested by Skrede et al. (2017) merged into a strong support clade in our five-gene-based phylogeny (Fig. 1), which thus was proposed as a new lineage in this study, i.e., lacunosa-helvellula lineage.

The species of the Lacunosa clade are greatly diverse in ascocarp appearance. They share various types of ascocarps with those species respectively evolved in the Acetabulum, Crispa and Elastica clades. In general, the species that evolved in subclade lacunosa possess the saddle-like or irregularly lobbed cap, and the cap margin attached to the stipe at several points except for a few species, such as the European H. helvellua and H. iberica and their allies, which have a free cap margin. The ascocarp of the species of the costifera group is clearly different from those species of the subclade lacunosa. Their ascocarp cap is never saddle-like or lobbed, but instead, regular or irregular cup-like. Some species of the costifera group have the same ascocarp type as those species in the Acetabulum clade. Their ascocarps have a robust and ribbed stipe, for example, the species in the costifera lineage, dalgeri lineage, hyperborea lineage and tianshanensis lineage. Some species have ascocarps with thin and terete stipes, which are the same as that in the Elastica clade, for example, the species in the alpestris-nannfeldtii lineage and alpina-corium lineage.

Some species with different phylogenetic positions in the Lacunosa clade showed a high morphological convergence. The typical example is H. queletiana, H. phlebophora and H. phlebophoroides, which are morphologically highly similar and easy confused with each other in the field, but are phylogenetically distantly related. Similarly, species of the alpestris-nannfeldtii lineage and alpina-corium lineage in the Lacunosa clade were morphological convergent with the species of the fallax-pezizoides lineage in the Elastica clade.

White species and white form in Helvella

The overall white or cream-coloured species are not very common in Helvella. Most of the white species are from the Crispa clade, like H. crispa and its allies, or the fusca-lactea lineage in the Lacunosa clade, like H. lactea and H. sublactea. However, the white or whitish collections of some non-white species are available in this study, the samples include H. capucinoides (BJTC FM1156, BJTC FM1094, Fig. 23D, E) and H. costifera (BJTC FM1705, Fig. 23F). Currently, it remains unclear whether the white form of Helvella species is common or rare, pending further study.

Fig. 23.

Photographs of apothecia in their natural habitat. A. Helvella acetabuloides (BJTC FM1264). B, C. H. capucinoides (B. BJTC FM242. C. BJTC FM1423). D, E. H. capucinoides (white form apothecia, D. BJTC FM1156. E. BJTC FM1094). F. H. costifera (white form apothecia, BJTC FM1705). G, H. H. danica (G. BJTC ZH883. H. BJTC ZH1190). I. H. lacunosa (BJTC FM907). Scale bars = 1 cm.

Mottled hymenium and parasitism

The mottled hymenium has been checked and used to distinguish species in Helvella including H. maculata and H. tinta (Weber 1975, Hyde et al. 2016). We observed the mottled hymenium in individual apothecia of H. tianshanensis and H. sinohyperborea in this study (Figs 17, 24H, I). At the same time, the DNA sequences of the mycoparasitic fungi Hypomyces cervinus and Hypomyces sp. were extracted respectively from these apothecia, but not from the apothecia without mottled hymenia (hymenium colour is uniform). Parasitism is very common in Helvella, especially the species of Hypomyces (Abbott & Currah 1997, Nguyen et al. 2013). A mottled hymenium could thus be a consequence of such an infection.

Fig. 24.

Photographs of apothecia in their natural habitat. A. Helvella magna (BJTC FM2486-A). B. H. orienticrispa (BJTC FM2480). C. H. pseudoreflexa (HSA 332). D. H. pubescens (BJTC FM918). E. H. ravida (HSA 375). F. H. solitaria (BJTC FM417). G. H. sublactea (BJTC FM1082). H. H. tianshanensis (HSA 185). I. H. tianshanensis (apothecia infected by Hypomyces cervinus, BJTC FM175). J. H. vulgata (BJTC FM2621). Scale bars = 1 cm.

The application of ITS sequence in species identification of Helvella

The ITS region is a universal barcode for fungi (Schoch et al. 2012). However, it has not been considered as a good barcode gene for Helvella species. One of the reasons may be the difficulty of obtaining ITS sequence data. In this study, we successfully sequenced almost all species recognized from our Helvella collections. Our molecular analyses also revealed that the topology of phylogenetic trees generated from ITS is almost identical to that generated from the five-gene-combined dataset (ITS/nrLSU/ tef1-α/rpb2/hsp) at clade level, lineage level and species level (Figs 1, 2, S1–S4). These results showed that the ITS region is effective at least for the delimitation of the Chinese Helvella species. In addition, BLASTn analyses for all of Helvella species identified in this study revealed that the intraspecific similarity in ITS sequence ranged from 86 % to 98 %. Therefore, we infer that 98 % ITS identity might be the threshold to delimitate Helvella species.

Previous studies suggested that the amplification success rate of ITS sequence is low, especially in old specimens (Skrede et al. 2017, Wang et al. 2019). Two primer pairs successfully used in our present work are provided in Table 1. We observed that the ITS sequences amplified using the primers of ITS1-F/ ITS4 could result in an inaccurate sequence in several Helvella species, i.e., H. solitaria, H. taiyuanensis, and Helvella sp. 59. Amplifying the ITS2 sequence using the primers ITS3/ITS4 is, however, effective for these species.

Doubtful and excluded species of Helvella in China

A total of 90 Helvella species have been recorded in China before this study. Of these, 53 species were confirmed in this study. The remaining 37 species are documented as follows.

Helvella adhaerens Peck, Ann. Rep. Reg. N.Y. St. Mus. 54: 956. 1902. [1901].

Hevella adhaerens is documented in China (Dai 1979, Zhuang WY 1998b) based on a specimen (HMAS 17262) collected from Beijing in 1955. We re-examined this specimen and identified it as the H. elastica complex according to morphological traits. The DNA sequence of this specimen was unsuccessfully sequenced in this study. As it is difficult and even impossible to identify species of the H. elastica complex accurately without DNA data according to our experience, the taxonomic treatment of this specimen awaits. Hevella adhaerens has been treated as a synonym of H. elastica (Dissing 1966b, Skrede et al. 2017).

Helvella albella Quél. [as 'Elvella'], C. r. Assoc. Franç. Avancem. Sci. 24: 621. 1896. [1895].

This species was reported based on two specimens deposited in the Mycological Herbarium of Shanxi University (MHSU456, MHSU457) (Liu & Cao 1988), but the specimens got lost according to the authors. Helvella albella has been treated as a synonym of H. bicolor (Skrede et al. 2017). None of Chinese collections matched H. bicolor in the present study.

Helvella albipes Fuckel, Hedwigia 5: 15. 1866.

This species was reported in Mao's book (1998), but no specimen was cited. Recent work indicated that H. albipes is a heterotypic synonym of H. monachella (Skrede et al. 2017). Helvella monachella is a European species. Its most similar Chinese species is H. bachu (Zhao et al. 2016a).

Helvella chinensis (Velen.) Nannf. & L. Holm, in Lundell et al., Publications from the Herbarium, University of Uppsala, Sweden 18: 5. 1985.

This name was mentioned in several papers (Lundell et al. 1985, Zhuang 1995, Wang & Chen 2002) but no specimen was cited. No specimens are available for study.

Helvella compressa (Snyder) N.S. Weber, Beih. Nova Hedwigia 51: 35. 1975.

Zhuang & Yang (2008) reported this species based on the specimen HKAS 45788, and HMAS 97524 from Tibet of China, but we are not able to re-examine the two specimens in this study.

Helvella confusa Harmaja, Karstenia 17: 43. 1977.

This species was reported from China by Zhuang (1998b). This species has been transferred to the genus Dissingia as D. confusa (Hansen et al. 2019). The occurrence of Dissingia confusa in China has been confirmed by Wang et al. (2019).

Helvella corium (O. Weberb.) Massee, Brit. Fungus-Fl. 4: 463. 1895.

This is a frequently encountered name of Helvella in Chinese papers (Dai 1979, Liu et al. 1985, Zhuang et al. 2018) but no specimen was cited. A Chinese collection (HKAS 69755) labelled as Helvella cf. corium matched H. xiaohuipan, a new species described in this study (Fig. S3). None of samples from China matched this species in our present molecular analyses. Moreover, according to Cao et al. (1990), the name H. corium is a misapplication for H. rivularis or H. villosa in China.

Helvella crispa (Scop.) Fr., Syst. Mycol. 2: 14. 1822.

The name H. crispa is one of the commonest Helvella species in China. Almost all the white saddle-shaped species with robust ribbed stipe are identified as this species. Recent works revealed that the H. crispa-like saddle fungi represented a different phylogenetic species (Zhao et al. 2015, Tibpromma et al. 2017). Our present analysis also recognized two new species from the H. crispa complex. Helvella crispa is not confirmed in China in this study, but there are at least five species in China that are based on the H. crispa-like samples (Zhao et al. 2015, 2016b, this study). Moreover, some sequences from the USA gathered into isolated clusters, indicating the presence of undescribed species, such as Helvella sp. 3, Helvella sp. 4 (Fig. S2). Therefore, H. crispa might be a species endemic to Europe.

Helvella cupuliformis Dissing & Nannf., Svensk Bot. Tidskr. 60: 326. 1966.

Zhuang (2004) reported this species based on specimens from Xinjiang of north-western China. No DNA sequences were obtained from these specimens in this study. This species has been treated as a synonym of Helvella hypocrateriformis (Skrede et al. 2017).

Helvella cupuliformis var. crassa W.Y. Zhuang, Mycotaxon 90: 38. 2004.

We checked the type specimens (HMAS 83523, HMAS 83524) of this taxon, but their sequences are unsuccessfully isolated in this study. This name is listed as a synonym of H. cupuliformis (= H. hypocrateriformis, Skrede et al. 2017) in Index Fungorum.

Helvella dissingii Korf, Mycotaxon 31: 381. 1988.

Li et al. (2015) listed this species from China but no specimen was cited. Currently, this species is treated as a synonym of Helvella fibrosa (Skrede et al. 2017).

Helvella elastica Bull., Herb. Fr. (Paris) 6: tab. 242. 1785.

Helvella elastica is one of the most common fungal names in China. However, our present study showed that no Chinese specimens matched to this species phylogenetically (Fig. 1). All the morphologically similar specimens are either introduced as new species, or matched other similar species in the elastica-bicolor lineage, carnosa lineage and capucina-danica lineage of the Elastica clade in this study (Fig. 1).

Helvella ephippium Lév., Ann. Sci. Nat., Bot., sér. 2, 16: 240. 1841.

Helvella ephippium was reported in China by Cao (1988). Later, it was mentioned by Zhuang (1989, 2004) and Wang & Chen (2002). The specimen cited by Cao (1988) is lost according to the author. Recent work treated Helvella ephippium as a synonym of H. sublicia (Skrede et al. 2017).

Helvella fargesii Pat., J. Bot. 7: 344. 1893.

Dai (1979) reported this species from China but without citing a specimen. Dissing (1966b) treated it as a synonym of H. elastica. It is treated as an uncertain species (Skrede et al. 2017).

Helvella fusca Gillet, Champ. France Discomyc. 1: 9. 1879. Helvella fusca was reported based on a specimen (HXZE515) from Tibet of China (Xu 2002). We have not re-examined this specimen in this study.

Helvella glutinosa B. Liu & J.Z. Cao, Acta Mycol. Sin. 7: 198. 1988. This species is described from Heilongjiang Province, northeastern China based on a specimen under conifers (MHSU451, holotype) in September 1986 (Liu & Cao 1988). The only specimen had been lost, but according to the original description, it is a morphologically distinct species, which is diagnosed by the gel cap.

Helvella helvellula (Durieu) Dissing, Rev. Mycol. 31: 204. 1966. This species is recorded from Shanxi Province in Northern China based on a specimen under conifers (MHSU 275) (Liu & Cao 1988). The specimen had been lost, but according to the original description given by Liu & Cao (1988), the cap of this specimen is dark brown rather than black as in H. helvellula. It is notable that two specimens newly collected from the same locality are introduced as a new species H. sinohyperborea in this study (Fig. 1).

Helvella hyperborea Harmaja, Karstenia 18: 57. 1978.

Xu (2002) reported this species from Tibet in China based on a specimen (HXZE1023). Wang et al. (2019) recognized this species again in China based on specimens from Shanxi and Xinjiang Provinces. Our present analysis showed that these specimens cited by Wang et al. (2019) are identical with the newly introduced H. sinohyperborea in this study (Fig. 1).

Helvella jiaohensis J.Z. Cao et al., Acta Mycol. Sin. 9: 184. 1990. This species was described from Jiling Province in north-eastern China based on a specimen (HBNNU 0700, holotype) deposited in the Northeast Normal University (Cao et al. 1990). We were not able to re-examine this specimen in this study. This species has subglobose to very broadly ellipsoid ascospores, which suggests it to be a distinct species (Cao et al. 1990).

Helvella jilinensis J.Z. Cao et al., Acta Mycol. Sin. 9: 185. 1990. Helvella jilinensis is described from Jiling Province in northeastern China based on a specimen (HBNNU 0738, holotype) deposited in Northeast Normal University (Cao et al. 1990). We were not able to re-examine this specimen in this study. According to Cao et al. (1990), this species is diagnosed mainly by its thick-walled hyphae in the medullary excipulum. However, whether this feature can be used in species delimitation in Helvella is questionable.

Helvella jimsarica W.Y. Zhuang, Mycotaxon 90: 39. 2004.

This species was described from Xinjiang Uygur Autonomous Region (Zhuang 2004). No specimen is available for study.

Helvella lactea Boud., Icon. Mycol., liste prélim.: 2. 1904.

This species was reported from Shanxi Province, Northern China and Jiling Province, Northeast China based on two specimens (MHSU454, MHSU455) (Liu & Cao 1988). The two specimens had been lost according to one of the authors (Cao, pers. comm). It is notable that all the H. lacteal-like specimens newly collected from China matched H. sublactea in our phylogenetic analyses in this study.

Helvella latíspora Boud., Bull. Soc. Mycol. France 14: 16. 1898. Helvella latispora was firstly reported based on a specimen from Tibet in Southwest China (HXZE1440). We were not able to reexamine this specimen in this study. Recently, Helvella latispora has been treated as a synonym of H. levis (Skrede et al. 2017).

Helvella leucomelaena (Pers.) Nannf., in Lundell & Nannfeldt, Fungi Exsicc. Suecici Fasc. 19-20: 21, no. 952. 1941.

Helvella leucomelaena is documented from China (Teng 1963, Tai 1979, Zhuang 1998b), but it is actually not occurring in China according to Wang et al. (2019). Helvella leucomelaena has been transferred to Dissingia as D. leucomelaena (Hansen et al. 2019).

Helvella leucopus Pers., Mycol. Eur. 1: 213. 1822.

This name in China has been shown to be a misapplication of the Chinese H. bachu (Zhao et al. 2016a). Currently, H. leucopus has been treated as a synonym of H. monachella (Skrede et al. 2017).

Helvella maculata N.S. Weber, Beih. Nova Hedwigia 51: 27. 1975.

This species was reported based on two specimens (MHSU 062, MHSU 063) from Xinjiang in Northwestern China (Liu & Cao 1988). We could not re-examine the two specimens in this study.

Helvella oblongispora Harmaja, Karstenia 18: 57. 1978.

This species has been transferred to the genus Dissingia as D. oblongispora (Hansen et al. 2019). The occurrence of D. oblongispora in China has been confirmed by Wang et al. (2019) and this study.

Helvella pezizoides Afzel., Kongl. Vetensk. Acad. Nya Handl. 4: 308. 1783.

Cao (1988) reported this species from China. According to the author, the specimen is probably lost. Our present analysis showed that none of the Chinese specimens matched H. pezizoides.

Helvella pseudolacunosa Q. Zhao & K.D. Hyde, Fungal Diversity 75: 142. 2015.

This species could be identical to H. lacunosa according to our study (Figs 1, S4) and Wang et al. (2023a).

Helvella rivularis Dissing & Sivertsen, Bot. Tidsskr. 75: 101. 1980. This species was reported based on a specimen from Shanxi Province in Northern China (Cao et al. 1990), but the specimen has been lost according to the author (Cao pers. comm.).

Helvella sinensis B. Liu & J.Z. Cao, Acta Mycol. Sin. 4: 214. 1985. This species is described from Shanxi Province in Northern China (Liu et al. 1985). The type specimen is lost according to the author (Cao, pers. comm.). Helvella sinensis is a species of the H. crispa complex, diagnosed by the red-brown apothecium and broad ascospores. DNA data is lacking for this taxon.

Helvella spadicea Schaeff. [as Elvela], Fung. bavar. palat. nasc. (Ratisbonae) 4: 112. 1774.

The name H. spadicea is a misapplication for H. bachu or H. subspadicea in China (Zhao et al. 2016a). Helvella spadicea is treated as an uncertain species (Skrede et al. 2017).

Helvella subfusispora B. Liu & J.Z. Cao, Acta Mycol. Sin. 4: 211. 1985.

This species is firstly introduced based on a specimen (HBSU 3319) from the Zhoushan islands of Zhejiang Province in Eastern China (Liu et al. 1985). The holotype was destroyed in a fire, thus the specimen HMAS 30483 from Sichuan Province of Southwestern China had been selected as the neotype (Cao et al. 1990). Attempts to obtain a sequence from the neotype was unsuccessful in this study. However, according to the original description, this is a morphologically distinct species, which is diagnosed by its saddle-shaped ascocarps with thin and terete stipe, and subfusiform ascospores.

Helvella subglabra N.S. Weber, Michigan Bot. 11: 179. 1972. The North American H. subglabra was reported based on five specimens from Southwestern and Northeastern China (Zhao et al. 2016b). Our present analysis based on the ITS phylogenetic analysis (Fig. S4) showed these Chinese samples cited by Zhao et al. (2016) matched the new species H. subglabroides described in this study.

Helvella ulvinenii Harmaja, Karstenia 19: 42. 1979.

This species was reported from China based on a specimen from Yunnan (HKAS 90321) (Zhao et al. 2016b). Helvella ulvinenii has been treated as a synonym of H. solitaria (Skrede et al. 2017), and the sequence cited for this species by Zhao et al. (2016b) also matched H. solitaria in the present analysis (Fig. 1).

Helvella villosa (Hedw.) Dissing & Nannf., Svensk bot. Tidskr. 60: 330. 1966.

Helvella villosa is popularly mentioned in China but without citation of specimens (Cao et al. 1990). Recently, Helvella villosa has been treated as a synonym of H. fibrosa (Skrede et al. 2017).

Helvella xinjiangensis J.Z. Cao et al., Acta Mycol. Sin. 9: 186. 1990. Attempts to obtain a sequence from the type specimen (HMAS 38353) was unsuccessful in this study. Helvella xinjiangensis is treated as a synonym of H. elastica (Zhuang 2004).

Conflict of interest

The authors declare that there is no conflict of interest.

Supplementary material

Fig. S1

Phylogeny of Chinese Helvella species of Acetabulum clade inferred from the Dataset II (ITS) using the maximum likelihood (ML) analysis. Numbers representing likelihood bootstrap support values (MLBS ≥ 70 %, left) and significant Bayesian posterior probability (BPP ≥ 0.95, right) are indicated above the nodes. New species are printed in bold.

Fig. S2

Phylogeny of Chinese Helvella species of Crispa clade inferred from the Dataset III (ITS) using the maximum likelihood (ML) analysis. Numbers representing likelihood bootstrap support values (MLBS ≥ 70 %, left) and significant Bayesian posterior probability (BPP ≥ 0.95, right) are indicated above the nodes. New species are printed in bold.

Fig. S3

Phylogeny of Chinese Helvella species of Elastica clade inferred from the Dataset IV (ITS) using the maximum likelihood (ML) analysis. Numbers representing likelihood bootstrap support values (MLBS ≥ 70 %, left) and significant Bayesian posterior probability (BPP ≥ 0.95, right) are indicated above the nodes. New species are printed in bold.

Fig. S4

Phylogeny of Chinese Helvella species of Lacunosa clade inferred from the Dataset V (ITS) using the maximum likelihood (ML) analysis. Numbers representing likelihood bootstrap support values (MLBS ≥ 70 %, left) and significant Bayesian posterior probability (BPP ≥ 0.95, right) are indicated above the nodes. New species are printed in bold. Table S1.

Table S1.

Specimens used in five combined loci (ITS/nrLSU/tef1-α/rpb2/hsp) phylogenetic analysis and their GenBank accession numbers. Newly generated sequences are in bold.

Taxa Name in Analysis	Taxon name	Voucher specimen	Country	ITS GenBank	LSU GenBank	tef1-α GenBank	rpb2 GenBank	hsp GenBank
Dissingia oblongispora H132 Norway	Dissingia oblongispora	H132, O-166316	Norway	——	KY772983	——	KY772515	KY784265
Dissingia oblongispora HKAS 87726 China	Dissingia oblongispora	HKAS 87726	China	——	OR355353	OR359089	OR359197	OR366158
Dissingia oblongispora HKAS 87744 China	Dissingia oblongispora	HKAS 87744	China	——	OR355354	——	——	OR366159
Dissingia oblongispora HSA 137 China	Dissingia oblongispora	HSA 137	China	OR355181	OR355355	OR359091	OR359198	OR366160
Dissingia oblongispora HSA 169 China	Dissingia oblongispora	HSA 169	China	OR355182	OR355356	OR359092	OR359199	OR366161
Helvella acetabuloides CFSZ2044 holotype China	Helvella acetabuloides	CFSZ2044, holotype	China, Inner Mongolia	OR355015	OR355185	OR358967	OR359094	MK652219
Helvella acetabuloides BJTC FM1264 China	Helvella acetabuloides	BJTC FM1264	China	OR355166	OR355337	OR359075	OR359186	OR366140
Helvella acetabulum H410 epitype Sweden	Helvella acetabulum	H410, epitype	Sweden, Oestergoetland	——	KY773154	——	KY772752	KY784506
Helvella acetabulum H225 Norway	Helvella acetabulum	O-253212, H225	Norway, Oppland	——	KY773055	KY772894	KY772594	KY784344
Helvella acetabulum H134 Norway	Helvella acetabulum	O-64925, H134	Norway, Oestfold	——	KY772985	KY772876	KY772517	KY784267
Helvella albopatella BJTC FM2610-A holotype China	Helvella albopatella	BJTC FM2610-A, holotype	China	OR355082	OR355252	OR359014	OR359137	OR366079
Helvella albopatella BJTC FM2610-B China	Helvella albopatella	BJTC FM2610-B	China	OR355176	OR355350	OR359085	OR359195	OR366151
Helvella alborava BJTC C316-A holotype China	Helvella alborava	BJTC C316-A, holotype	China	OR355106	OR355276	OR359033	OR359155	OR366098
Helvella alborava BJTC C316-B China	Helvella alborava	BJTC C316-B	China	OR355173	OR355347	OR359082	OR359193	OR366148
Helvella alpestris H014 epitype Norway	Helvella alpestris	O-253221, H014, epitype	Norway, Oppland	——	KY772909	KY772826	KY772435	KY784191
Helvella alpestris H013 Norway	Helvella alpestris	O-253220, H013	Norway, Oppland	——	KY772908	KY772825	KY772434	KY784190
Helvella alpicola TROM-F-610062 Norway	Helvella alpicola	TROM-F-610062	Norway, Nordland	——	MN655848	MN658207	MN692297	MN692345
Helvella alpicola H175 holotype Norway	Helvella alpicola	O-185924, H175, holotype	Norway, Nordland	——	KY773020	——	KY772554	KY784304
Helvella alpina H223 holotype France	Helvella alpina	O-253228, H223, holotype	France, Savoie	——	KY773054	MN658192	KY772593	KY784343
Helvella alpina KH.12.69(S) Sweden	Helvella alpina	KH.12.69(S)	Sweden, Lappland	——	MK100261	MK113876	MK113850	MK179405
Helvella arctoalpina H293 holotype Norway	Helvella arctoalpina	O-72616, H293, holotype	Norway, Hordaland	——	——	——	KY772655	KY784406
Helvella arctoalpina H084 Norway	Helvella arctoalpina	O-253240, H084	Norway, Oppland	——	KY772956	KY772866	KY772483	KY784236
Helvella arctoalpina H083 Norway	Helvella arctoalpina	O-253239, H083	Norway, Oppland	——	KY772955	KY772865	KY772482	KY784235
Helvella atra H406 holotype Sweden	Helvella atra	H406, holotype	Sweden, Uppland	——	——	——	KY772748	KY784502
Helvella atra H016 Norway	Helvella atra	O-253251, H016	Norway, Oppland	——	KY772911	KY772828	KY772437	KY784193
Helvella atra KH.10.97(S) Sweden	Helvella atra	KH.10.97(S)	Sweden, Lycksele Lappmark	KC122809	KC122771	MK113877	MK113851	MK179402
Helvella atra HMAS 290900 China	Helvella atra	HMAS 290900	China	OQ600286	OQ586677	OQ597533	——	OQ597592
Helvella atra HMAS 290901 China	Helvella atra	HMAS 290901	China	OQ600287	OQ586678	OQ597534	——	OQ597593
Helvella atroides MFLU23-0102 holotype China	Helvella atroides	MFLU23-0102, holotype	China	——	OQ866059	OQ863552	——	OQ863541
Helvella atroides HKAS 90544 China	Helvella atroides	HKAS 90544	China	——	OQ866060	OQ863553	——	OQ863542
Helvella austrooccidentalis HMAS 290902 China	Helvella austrooccidentalis	HMAS 290902	China	OQ600290	OQ586680	OQ597537	——	OQ597597
Helvella austrooccidentalis HMAS 290903 holotype China	Helvella austrooccidentalis	HMAS 290903, holotype	China	OQ600291	OQ586681	OQ597538	——	OQ597598
Helvella bachu HKAS 88105 holotype China	Helvella bachu	HKAS 88105, holotype	China, xinjiang	KU739791	KU739815	KU739842	——	——
Helvella bachu BJTC FM382 China	Helvella bachu	BJTC FM382	China	OR355062	OR355232	OR358997	OR359121	OR366059
Helvella bicolor O-255759 Norway	Helvella bicolor	O-255759	Norway, Nordland	MN656168	MN655851	——	MN692298	MN692352
Helvella bicolor H289 epitype Sweden	Helvella bicolor	C-F-45334, H289, epitype	Sweden, Gastrikland	——	KY773097	——	KY772651	KY784402
Helvella borealis HMAS 290905 holotype China	Helvella borealis	HMAS 290905, holotype	China	OQ600293	OQ586683	OQ597539	——	OQ597600
Helvella bresadolae H1038 holotype Norway	Helvella bresadolae	H1038, holotype	Norway	——	OQ626668	——	OQ631094	OQ633402
Helvella bresadolae H992 Austria	Helvella bresadolae	H992	Austria	——	——	——	OQ631109	OQ680208
Helvella brunneogaleriformis BJTC FM269 China	Helvella brunneogaleriformis	BJTC FM269	China	OR355063	OR355233	OR358998	OR359122	OR366060
Helvella brunneogaleriformis BJTC FM272 China	Helvella brunneogaleriformis	BJTC FM272	China	OR355064	OR355234	OR358999	OR359123	OR366061
Helvella brunneogaleriformis BJTC FM911 holotype China	Helvella brunneogaleriformis	BJTC FM911, holotype	China	OR355065	OR355235	OR359000	OR359124	OR366062
Helvella caespitosa HSA 379-A holotype China	Helvella caespitosa	HSA 379-A, holotype	China	OR355091	OR355261	OR359022	——	OR366087
Helvella caespitosa HSA 379-B China	Helvella caespitosa	HSA 379-B	China	OR355092	OR355262	——	——	OR366088
Helvella calycina H022 epitype Norway	Helvella calycina	O-253255, H022, epitype	Norway, Oppland	MN656158	KY772915	KY772833	KY772442	KY784198
Helvella calycina HMAS 279704 China	Helvella calycina	CFSZ2658, HMAS 279704	Inner Mongolia, China	OR355013	MK592100	OR358963	OR359093	MK652179
Helvella capucina H208 epitype France	Helvella capucina	O-253256, H208, epitype	France, Savoie	——	KY773041	——	KY772582	KY784331
Helvella capucina H046 Norway	Helvella capucina	O-253261, H046	Norway, Oppland	——	KY772935	KY772849	KY772461	KY784216
Helvella capucinoides H113 USA	Helvella capucinoides	FH, H113	USA, Maine	——	KY772969	——	KY772501	KY784251
Helvella capucinoides BJTC FM1094 China	Helvella capucinoides	BJTC FM1094	China	OR355037	OR355207	OR358978	OR359105	OR366040
Helvella capucinoides BJTC FM242 China	Helvella capucinoides	BJTC FM242	China	OR355040	OR355210	OR358979	OR359106	OR366041
Helvella capucinoides BJTC FM909 China	Helvella capucinoides	BJTC FM909	China	OR355042	OR355212	OR358980	OR359107	OR366042
Helvella capucinoides HMJAU 33777 China	Helvella capucinoides	HMJAU 33777	China	OR355043	OR355213	OR358981	OR359108	OR366043
Helvella carnosa KH.10.277(S) Sweden	Helvella carnosa	KH.10.277(S)	Sweden, Gotland	——	KY660042	KY660043	KY660044	——
Helvella carnosa H146 holotype Norway	Helvella carnosa	O-68100, H146, holotype	Norway, Oslo	——	KY772995	——	KY772529	——
Helvella carnosa BJTC BP060 China	Helvella carnosa	BJTC BP060	China	OR355018	OR355188	OR358969	OR359096	OR366034
Helvella carnosa BJTC FM1032 China	Helvella carnosa	BJTC FM1032	China	OR355021	OR355191	OR358970	OR359097	OR366035
Helvella carnosa BJTC FM274 China	Helvella carnosa	BJTC FM274	China	OR355022	OR355192	OR358971	OR359098	OR366036
Helvella carnosa BJTC FM316 China	Helvella carnosa	BJTC FM316	China	OR355025	OR355195	OR358972	OR359099	OR366037
Helvella carnosa BJTC FM376 China	Helvella carnosa	BJTC FM376	China	OR355026	OR355196	OR358973	OR359100	——
Helvella carnosa BJTC BP060 China	Helvella carnosa	BJTC FM953	China	OR355027	OR355197	OR358974	OR359101	OR366038
Helvella carnosa HSA 360 China	Helvella carnosa	HSA 360	China	OR355028	OR355198	OR358975	OR359102	——
Helvella compressa H112 USA	Helvella compressa	FH, H112	USA, California	——	KY772968	——	KY772500	KY784250
Helvella convexa H761 holotype Sweden	Helvella convexa	H761, holotype	Sweden	OQ641537	OQ626670	——	OQ631107	OQ633414
Helvella convexa H746 Sweden	Helvella convexa	H746	Sweden	——	OQ626669	——	OQ631108	OQ633415
Helvella corbierei PTR 763 USA	Helvella corbierei	PTR 763, UC 1999259	USA, CA	——	MK100263	MK113879		MK179406
Helvella corbierei H392 epitype Switzerland	Helvella corbierei	C-F-57133, H392, epitype	Switzerland, Graubunden	——	——	——	KY772737	KY784489
Helvella corbierei H346 USA	Helvella corbierei	C-F-56503, H346	USA, Oregon	——	KY773121	——	KY772699	KY784448
Helvella corbierei HSA 138 China	Helvella corbierei	HSA 138	China	OR355071	OR355241	OR359006	OR359129	OR366068
Helvella corbierei HSA 181 China	Helvella corbierei	HSA 181	China	OR355072	OR355242	OR359007	OR359130	OR366069
Helvella corium H352 epitype Denmark	Helvella corium	C-F-71638, H352, epitype	Denmark, Mid Zealand	——	——	——	KY772704	KY784453
Helvella corium O-255756 Svalbard	Helvella corium	O-255756	Svalbard, Longyearbyen	MN656185	MN655873	MN658196	MN692314	MN692370
Helvella corium O-255757 France	Helvella corium	O-255757	France, Savoie	MN656165	MN655870	MN658197	MN692309	MN692363
Helvella costifera H247 Norway	Helvella costifera	O-253283, H247	Norway, Oppland	——	KY773074	KY772900	KY772613	KY784365
Helvella costifera H131 Norway	Helvella costifera	O-68514, H131	Norway, Akershus	——	KY772982	KY772874	KY772514	KY784264
Helvella costifera BJTC FM1705 China	Helvella costifera	BJTC FM1705	China	OR355128	OR355299	OR359052	OR359166	OR366117
Helvella costifera BJTC FM1742 China	Helvella costifera	BJTC FM1742	China	OR355129	OR355300	OR359053	OR359167	OR366118
Helvella costifera HMAS 187120 China	Helvella costifera	HMAS 187120	China	OR355179	MK592102	——	——	MK652183
Helvella costifera HMAS 280301 China	Helvella costifera	HMAS 280301	China	OR355180	MK592103	OR359090	——	MK652184
Helvella cremeoinvoluta BJTC FM941-A holotype China	Helvella cremeoinvoluta	BJTC FM941-A, holotype	China	OR355153	OR355324	OR359066	OR359178	OR366131
Helvella cremeoinvoluta BJTC FM941-B China	Helvella cremeoinvoluta	BJTC FM941-B	China	OR355154	OR355325	OR359067	OR359179	OR366132
Helvella crispa H408 epitype Sweden	Helvella crispa	H408, epitype	Sweden	——	——	——	KY772750	KY784504
Helvella crispa KH.09.186(S) Sweden	Helvella crispa	KH.09.186(S)	Sweden, Gotland	——	MK100266	MK113882		MK179400
Helvella crispa H135 Norway	Helvella crispa	O-18774, H135	Norway, Akershus	——	KY772986	——	KY772518	KY784268
Helvella crispoides HKAS 90585 China	Helvella crispoides	HKAS 90585	China	KX507002	OR355183	OR358964	——	OR366032
Helvella crispoides HKAS 90583 China	Helvella crispoides	HKAS 90583	China	KX507001	OR355184	OR358965	——	OR366033
Helvella crispoides HKAS 90535 holotype China	Helvella crispoides	HKAS 90535, holotype	China	KU739803	——	——	——	——
Helvella cystidiata HKAS 74316 China	Helvella cystidiata	HKAS 74316	China	KX239840	KX239803	——	——	——
Helvella cystidiata HKAS 78941 holotype China	Helvella cystidiata	HKAS 78941, holotype	China	KX239839	KX239802	——	——	——
Helvella cystidiata HMJAU 52 China	Helvella cystidiata	HMJAU 52	China	OQ600295	OQ586684	OQ597540	——	OQ597602
Helvella cystidiata HMJAU 150 China	Helvella cystidiata	HMJAU 150	China	OQ600296	OQ586685	OQ597541	——	OQ597603
Helvella dalgeri O-F-256528 Spain	Helvella dalgeri	O-F-256528	Spain, Albacete	——	——	——	MN626814	MN598202
Helvella dalgeri O-F-256527 Spain	Helvella dalgeri	O-F-256527	Spain, Girona	——	——	——	MN626782	MN598125
Helvella danica H177 Norway	Helvella danica	O-129543, H177	Norway, Finnmark	——	KY773022	——	KY772556	KY784306
Helvella danica H058 Norway	Helvella danica	O-253288, H058	Norway, Akershus	——	KY772942	——	KY772469	KY784222
Helvella danica H263 holotype Denmark	Helvella danica	C-F-85205, H263, holotype	Denmark	——	KY773083	——	KY772627	KY784378
Helvella danica BJTC BP398 China	Helvella danica	BJTC BP398	China	OR355044	OR355214	OR358982	——	OR366044
Helvella danica BJTC L235 China	Helvella danica	BJTC L235	China	OR355047	OR355217	OR358983	OR359109	OR366045
Helvella danica BJTC ZH1249 China	Helvella danica	BJTC ZH1249	China	OR355049	OR355219	OR358984	OR359110	OR366046
Helvella danica BJTC ZH370 China	Helvella danica	BJTC ZH370	China	OR355050	OR355220	OR358985	OR359111	OR366047
Helvella danica BJTC ZH883 China	Helvella danica	BJTC ZH883	China	OR355051	OR355221	OR358986	OR359112	OR366048
Helvella danica BJTC FM1053 China	Helvella danica	BJTC FM1053	China	OR355052	OR355222	OR358987	——	OR366049
Helvella danica BJTC ZH1122 China	Helvella danica	BJTC ZH1122	China	OR355053	OR355223	OR358988	OR359113	OR366050
Helvella danica BJTC BP544 China	Helvella danica	BJTC BP544	China	OR355054	OR355224	OR358989	——	OR366051
Helvella danica BJTC ZH522 China	Helvella danica	BJTC ZH522	China	OR355055	OR355225	OR358990	OR359114	OR366052
Helvella danica BJTC ZH1190 China	Helvella danica	BJTC ZH1190	China	OR355056	OR355226	OR358991	OR359115	OR366053
Helvella danica BJTC BP255 China	Helvella danica	BJTC BP255	China	OR355057	OR355227	OR358992	OR359116	OR366054
Helvella danica BJTC FM2577 China	Helvella danica	BJTC FM2577	China	OR355058	OR355228	OR358993	OR359117	OR366055
Helvella danica BJTC ZH1360 China	Helvella danica	BJTC ZH1360	China	OR355177	OR355351	OR359086	——	OR366152
Helvella deflexa HSA 240-A1 holotype China	Helvella deflexa	HSA 240-A1, holotype	China	OR355069	OR355239	OR359004	OR359127	OR366066
Helvella deflexa HSA 240-A2 China	Helvella deflexa	HSA 240-A2	China	OR355070	OR355240	OR359005	OR359128	OR366067
Helvella dryadophila H302 holotype Norway	Helvella dryadophila	O-72617, H302, holotype	Norway, Oppland	——	——	——	KY772661	KY784412
Helvella dryadophila H183 Norway	Helvella dryadophila	O-253308, H183	Norway, Oppland	——	KY773026	KY772886	KY772561	KY784311
Helvella dryadophila H180 Norway	Helvella dryadophila	O-253307, H180	Norway, Oppland	——	KY773024	KY772883	KY772559	KY784309
Helvella elastica H329 Russia	Helvella elastica	C-F-51672, H329	Russia, Sakha	——	——	——	KY772684	KY784433
Helvella elastica H066 Sweden	Helvella elastica	O-253311, H066	Sweden, Hallan	——	KY772950	KY772858	KY772476	KY784230
Helvella ephippioides H085 Japan	Helvella ephippioides	O-253267, H085	Japan, Honshu	——	KY772957	KY772867	KY772484	KY784237
Helvella ephippioides HMJAU 44584 China	Helvella ephippioides	HMJAU 44584	China	OR355107	OR355277	OR359034	——	OR366099
Helvella fallax H339 epitype France	Helvella fallax	C-F-84621, H339, epitype	France, Savoie	——	KY773117	——	KY772693	KY784442
Helvella fallax H018 Norway	Helvella fallax	O-253351, H018	Norway, Oppland	——	KY772913	KY772830	KY772439	KY784195
Helvella fallax KH.10.94(S) Sweden	Helvella fallax	KH.10.94(S)	Sweden, Lycksele Lappmark	——	MK100267	MK113892	——	MK179401
Helvella fibrosa H240 Norway	Helvella fibrosa	O-291352, H240	Norway, Soer-Troendelag	——	KY773069	KY772898	KY772607	KY784358
Helvella fibrosa H369 Finland	Helvella fibrosa	C-F-92109, H369	Finland, Oulun	——	KY773136	——	KY772719	KY784469
Helvella fistulosa H241 neotype Norway	Helvella fistulosa	O-291887, H241, neotype	Norway, Hordaland	——	KY773070	——	KY772608	KY784359
Helvella fistulosa H205 Japan	Helvella fistulosa	O-253314, H205	Japan, Honshu	——	KY773039	——	KY772580	KY784329
Helvella fulva HMAS 290906 holotype China	Helvella fulva	HMAS 290906, holotype	China	OQ600297	OQ586686	OQ597542	——	OQ597604
Helvella fistulosa BJTC 1976 China	Helvella fistulosa	BJTC 1976	China	OR355061	OR355231	OR358996	OR359120	OR366058
Helvella flavostipitata HSA 387-A holotype China	Helvella flavostipitata	HSA 387-A, holotype	China	OR355035	OR355205	OR358976	OR359103	——
Helvella flavostipitata HSA 387-B China	Helvella flavostipitata	HSA 387-B	China	OR355036	OR355206	OR358977	OR359104	OR366039
Helvella floriforma HKAS 90224 holotype China	Helvella floriforma	HKAS 90224, holotype	China	——	KX239771	——	——
Helvella fusca H305 Hungary	Helvella fusca	C-F-92122, H305	Hungary, Kiskunsag National Park	——	KY773101	——	KY772664	KY784415
Helvella fusca H304 Netherlands	Helvella fusca	C-F-89381, H304	Netherlands, Zuid-Holland	——	——	——	KY772663	KY784414
Helvella fuscolacunosa TRH-12623 Spain	Helvella fuscolacunosa	TRH-12623	Spain, Islas Baleares	——	MN644496	——	——	MN598179
Helvella fuscolacunosa TRH-12618 holotype Spain	Helvella fuscolacunosa	TRH-12618, holotype	Spain, Islas Baleares	——	MN644495	——	——	MN598173
Helvella galeriformis HSA 232 epitype China	Helvella galeriformis	HSA 232, epitype	China	OR355066	OR355236	OR359001	OR359125	OR366063
Helvella galeriformis HSA 240-B China	Helvella galeriformis	HSA 240-B	China	OR355067	OR355237	OR359002	——	OR366064
Helvella galeriformis BJTC FM2574 China	Helvella galeriformis	BJTC FM2574	China	OR355068	OR355238	OR359003	OR359126	OR366065
Helvella griseoalba H306 USA	Helvella griseoalba	C-F-92112, H306	USA, Michigan	——	——	——	KY772665	KY784416
Helvella guttata HKAS 87759 China	Helvella guttata	HKAS 87759	China	——	OQ866049	OQ863547	——	OQ863531
Helvella guttata HKAS 67836 holotype China	Helvella guttata	HKAS 67836, holotype	China	——	OQ866045	OQ863543	——	OQ863527
Helvella helvellula H308 epitype Spain	Helvella helvellula	C-F-92128, H308, epitype	Spain, Canary islands	——	——	——	KY772667	KY784418
Helvella helvellula H278 France	Helvella helvellula	C-F-45507, H278	France, Dpt	——	KY773090	——	KY772641	KY784393
Helvella helvellula H309 France	Helvella helvellula	C-F-45469, H309	France, Cote Atlantique	——	KY773103	——	KY772668	KY784419
Helvella hispanica O-F-256537 holotype Spain	Helvella hispanica	O-F-256537, holotype	Spain, Rioja	——	——	——	MN626786	MN598129
Helvella hispanica O-F-256536 Spain	Helvella hispanica	O-F-256536	Spain, Rioja	——	MN644504	——	MN626771	MN598112
Helvella huangii HMAS 290907 China	Helvella huangii	HMAS 290907	China	OQ600298	OQ586687	OQ597543	——	OQ597605
Helvella huangii HMAS 45031 holotype China	Helvella huangii	HMAS 45031, holotype	China	OQ600299	OQ586688	——	——	OQ597606
Helvella huangii HMJAU 3488 China	Helvella huangii	HMJAU 3488	China	OQ600300	OQ586689	OQ597544	——	OQ597607
Helvella huangii BJTC C375 China	Helvella huangii	BJTC C375	China	OR355175	OR355349	OR359084	——	OR366150
Helvella hyperborea H491 Finland	Helvella hyperborea	C-F-45306, H491	Finland, Kuusamo	——	——	——	KY772812	KY784569
Helvella hyperborea H389 Norway	Helvella hyperborea	C-F-54473, H389	Norway, Nordland	——	——	——	KY772734	KY784486
“Helvella hyperborea” HMAS 85673 China	“Helvella hyperborea”	HMAS 85673	China	MK592136	——	——	——	MK652199
“Helvella hyperborea” HMAS 85591 China	“Helvella hyperborea”	HMAS 85591	China	MK592134	——	——	——	MK652198
“Helvella hyperborea” HMAS 83511 China	“Helvella hyperborea”	HMAS 83511	China	MK592131	——	MK652160	——	MK652195
“Helvella hyperborea” HMAS 86043 China	“Helvella hyperborea”	HMAS 86043	China	MK592136	——	MK652161	——	MK652200
Helvella hypocrateriformis H300 Sweden	Helvella hypocrateriformis	C-F-92131, H300	Sweden, Uppland	——	——	——	KY772659	KY784410
Helvella hypocrateriformis H275 Switzerland	Helvella hypocrateriformis	C-F-57126, H275	Switzerland	——	——	——	KY772638	KY784390
Helvella iberica O-F-256538 Spain	Helvella iberica	O-F-256538	Spain, Rioja	——	MN644497	——	MN626767	MN598108
Helvella iberica O-F-256539 holotype Spain	Helvella iberica	O-F-256539, holotype	Spain, Rioja	——	MN644498	——	MN626769	MN598109
Helvella inexpectata O-F-256541 holotype Spain	Helvella inexpectata	O-F-256541, holotype	Spain, Rioja	——	——	——	MN626792	MN598148
Helvella inexpectata O-F-256540 Spain	Helvella inexpectata	O-F-256540	Spain, Rioja	——	——	——	MN626768	MN598192
Helvella involuta HKAS 74281 holotype China	Helvella involuta	HKAS 74281, holotype	China	KT215608	KR493492	KT254500	——	——
Helvella involuta HKAS 69966 China	Helvella involuta	HKAS 69966	China	JX462589	KR493497	KT254504	——	——
Helvella involuta BJTC FM2940 China	Helvella involuta	BJTC FM2940	China	OR355157	OR355328	OR359070	OR359182	OR366135
Helvella japonica H093 holotype Japan	Helvella japonica	H093, holotype	Japan	OQ645455	KY772961	——	KY772490	KY784243
Helvella japonica H2147 Norway	Helvella japonica	H2147	Norway	OQ645454	——	——	OQ631099	OQ680211
Helvella jizushanica HMAS 290908 holotype China	Helvella jizushanica	HMAS 290908, holotype	China	OQ600301	OQ586690	OQ597545	——	OQ597609
Helvella jizushanica HMAS 59718 China	Helvella jizushanica	HMAS 59718	China	OQ600302	OQ586691	——	——	OQ597610
Helvella jocatoi CB08326 holotype Mexico	Helvella jocatoi	CB08326, holotype	Mexico	KC016115	MH399851	——	——	——
Helvella jocatoi Landeros3581 Mexico	Helvella jocatoi	Landeros3581	Mexico	MT334416	MT334419	——	——	——
Helvella juniperi MCVE20997 Italy	Helvella juniperi	MCVE20997	Italy, Lu, Viareggio	——	——	——	MN626807	MN598194
Helvella juniperi H415 Portugal	Helvella juniperi	C-F-42193, H415	Portugal, Minho	——	——	——	KY772754	KY784510
Helvella lactea H374 Denmark	Helvella lactea	C-F-39379, H374	Denmark, Zealand,	——	——	——	KY772722	KY784473
Helvella lactea H262 Sweden	Helvella lactea	C Fungi Exs. Suec. 1355, H262	Sweden, Uppland	——	——	——	KY772626	KY784377
Helvella liui HMAS 85725 holotype China	Helvella liui	HMAS 85725, holotype	China	OQ600310	——	——	——	OQ597622
Helvella lobata HMAS 290910 holotype China	Helvella lobata	HMAS 290910, holotype	China	OQ600311	OQ586698	——	——	OQ597623
Helvella pseudolacunosa HKAS 87594 holotype China	Helvella lacunosa	HKAS 87594, holotype	China	KR493476	——	——	——	——
Helvella lacunosa BJTC FM1162 China	Helvella lacunosa	BJTC FM1162	China	OR355108	OR355278	OR359035	OR359156	OR366100
Helvella lacunosa BJTC FM546 China	Helvella lacunosa	BJTC FM546	China	OR355110	OR355280	OR359036	OR359157	OR366101
Helvella lacunosa BJTC FM813 China	Helvella lacunosa	BJTC FM813	China	OR355112	OR355282	OR359037	——	OR366102
Helvella lacunosa BJTC FM907 China	Helvella lacunosa	BJTC FM907	China	OR355113	OR355283	OR359038	OR359158	OR366103
Helvella lacunosa H407 epitype Sweden	Helvella lacunosa	H407, epitype	Sweden, Smaaland	——	KY773152	——	KY772749	KY784503
Helvella lacunosa H327 Russia	Helvella lacunosa	C-F-34477, H327	Russia, River Kotuy Khan	——	KY773112	——	KY772682	KY784431
Helvella leucophaea H274	Helvella leucophaea	H274	France	——	KY773088	——	KY772637	KY784389
Helvella levis H393 Denmark	Helvella levis	C-F-40830, H393	Denmark, E Jutland	——	KY773148	——	KY772738	KY784490
Helvella levis H290 epitype Denmark	Helvella levis	C-F-55188, H290, epitype	Denmark, M Zealand	——	KY773098	——	KY772652	KY784403
Helvella macropus H412 epitype Sweden	Helvella macropus	H412_epitype	Sweden, Uppland	——	——	——	KY772753	KY784507
Helvella macropus H239 Norway	Helvella macropus	O-291391, H239	Norway, Rogaland	——	KY773068	KY772897	KY772606	KY784357
Helvella macropus H238 Norway	Helvella macropus	O-291425, H238	Norway, Rogaland	——	KY773067	KY772896	KY772605	KY784356
Helvella macrosperma H029 Norway	Helvella macrosperma	O-253328, H029	Norway, Oppland	MN656159	KY772921	KY772838	KY772449	KY784205
Helvella macrosperma TROM-F-610001 Norway	Helvella macrosperma	TROM-F-610001	Norway, Troms	MN656176	MN655842	MN689297	MN692282	MN692319
Helvella maculata H303 USA	Helvella maculata	C-F-45400, H303	USA, Alaska	——	——	——	KY772662	KY784413
Helvella maculatoides HKAS 90590 holotype China	Helvella maculatoides	HKAS 90590, holotype	China	KU739858	KU167473	——	——	——
Helvella magna HMAS 60679 holotype China	Helvella magna	HMAS 60679, holotype	China	OQ600315	OQ586702	OQ597555	——	OQ597627
Helvella magna HMAS 290911 China	Helvella magna	HMAS 290911	China	OQ600312	OQ586699	OQ597552	——	OQ597624
Helvella magna HMAS 290912 China	Helvella magna	HMAS 290912	China	OQ600313	OQ586700	OQ597553	——	OQ597625
Helvella magna BJTC FM1046 China	Helvella magna	BJTC FM1046	China	——	OR355287	OR359040	——	OR366105
Helvella magna BJTC FM2486-A China	Helvella magna	BJTC FM2486-A	China	OR355117	OR355288	OR359041	——	OR366106
Helvella magna BJTC FM2486-B China	Helvella magna	BJTC FM2486-B	China	OR355118	OR355289	OR359042	——	OR366107
Helvella neofistulosa BJTC ZH1213 holotype China	Helvella neofistulosa	BJTC ZH1213, holotype	China	OR355059	OR355229	OR358994	OR359118	OR366056
Helvella neofistulosa BJTC ZH1251 China	Helvella neofistulosa	BJTC ZH1251	China	OR355060	OR355230	OR358995	OR359119	OR366057
Helvella multiformis BJTC FM1130 holotype China	Helvella multiformis	BJTC FM1130, holotype	China	OR355100	OR355270	OR359027	OR359149	OR366092
Helvella multiformis BJTC FM1131 China	Helvella multiformis	BJTC FM1131	China	OR355101	OR355271	OR359028	OR359150	OR366093
Helvella multiformis BJTC FM264 China	Helvella multiformis	BJTC FM264	China	OR355102	OR355272	OR359029	OR359151	OR366094
Helvella multiformis BJTC FM305 China	Helvella multiformis	BJTC FM305	China	OR355103	OR355273	OR359030	OR359152	OR366095
Helvella multiformis BJTC FM2484 China	Helvella multiformis	BJTC FM2484	China	OR355104	OR355274	OR359031	OR359153	OR366096
Helvella multiformis HSA 362 China	Helvella multiformis	HSA 362	China	OR355172	OR355343	OR359079	OR359190	OR366144
Helvella nannfeldtii H027 holotype Norway	Helvella nannfeldtii	O-253338, H027, holotype	Norway, Oppland	——	KY772919	KY772836	KY772447	KY784203
Helvella nannfeldtii H216 France	Helvella nannfeldtii	O-253333, H216	France, Savoie	——	KY773048	KY772891	KY772589	KY784337
Helvella neopallescens O-F-256550 holotype Spain	Helvella neopallescens	O-F-256550, holotype	Spain, Rioja,	——	MN644500	——	——	MN598111
Helvella neopallescens TRH-12607 Spain	Helvella neopallescens	TRH-12607	Spain, Islas Baleares	——	MN644501	——	——	MN598174
Helvella nigra H068 Sweden	Helvella nigra	O-253345, H063, epitype	Sweden, Hallan	——	KY772947	KY772855	KY772473	KY784227
Helvella nigra H063 epitype Sweden	Helvella nigra	O-253347, H068	Sweden, Halland	——	KY772952	KY772860	KY772477	——
Helvella nordlandica H1338 holotype Norway	Helvella nordlandica	H1338, holotype	Norway	——	——	——		OQ633416
Helvella nordlandica H2536 Norway	Helvella nordlandica	H2536	Norway		OQ626672	——	OQ631101	OQ633409
Helvella nordlandica H1341 Norway	Helvella nordlandica	H1341	Norway	——	——	——	OQ631097	OQ633405
Helvella nordlandica BJTC FM346-A China	Helvella nordlandica	BJTC FM346-A	China	OR355081	OR355251	OR359013	OR359136	OR366078
Helvella nordlandica FM346-B China	Helvella nordlandica	BJTC FM346-B	China	——	OR355344	——	——	OR366145
Helvella nigrorava BJTC ZH67 holotype China	Helvella nigrorava	BJTC ZH67, holotype	China	OR355105	OR355275	OR359032	OR359154	OR366097
Helvella oroarctica H1983 Norway	Helvella oroarctica	H1983	Norway	MN656177	OQ626671	——	OQ631098	OQ633408
Helvella oroarctica H2586 holotype Norway	Helvella oroarctica	H2586, holotype	Norway	——	——	——	OQ631103	OQ633411
Helvella orienticrispa HKAS 74319 holotype China	Helvella orienticrispa	HKAS 74319, holotype	China	JX462598	KR493503	——	——	——
Helvella orienticrispa BJTC BP066 China	Helvella orienticrispa	BJTC BP066	China	OR355158	OR355329	OR359071	OR359183	OR366136
Helvella orienticrispa BJTC FM418 China	Helvella orienticrispa	BJTC FM418	China	OR355160	OR355331	OR359072	——	OR366137
Helvella orienticrispa BJTC SBP126 China	Helvella orienticrispa	BJTC SBP126	China	OR355161	OR355332	OR359073	OR359184	OR366138
Helvella orienticrispa BJTC ZH744 China	Helvella orienticrispa	BJTC ZH744	China	OR355162	OR355333	OR359074	OR359185	OR366139
Helvella orienticrispa BJTC ZH1364 China	Helvella orienticrispa	BJTC ZH1364	China	OR355178	OR355352	OR359087	——	OR366153
Helvella orentitomentosa MFLU23-0099 holotype China	Helvella orentitomentosa	MFLU23-0099, holotype	China	——	OQ866056	——	——	OQ863538
Helvella orentitomentosa HKAS 90543 China	Helvella orentitomentosa	HKAS 90543	China	——	OQ866057	——	——	OQ863539
Helvella pallescens H138 epitype Norway	Helvella pallescens	O-66205, H138, epitype	Norway, Moere og Romsdal	——	KY772988	KY772878	KY772521	KY784271
Helvella pallescens H136 Norway	Helvella pallescens	O-220306, H136	Norway, Hordaland	——	KY772987	KY772877	KY772519	KY784269
Helvella palustris H043 Norway	Helvella palustris	O-253359, H043	Norway, Oppland	——	KY772933	KY772848	KY772458	KY784214
Helvella palustris H019 Norway	Helvella palustris	O-253358, H019	Norway, Oppland	——	KY772914	KY772831	KY772440	KY784196
Helvella palustris HMAS 30755 China	Helvella palustris	HMAS 30755	China	——	——	——	——	OQ597638
Helvella panormitana H130 Norway	Helvella panormitana	O-171969, H130	Norway, Moere og Romsdal	——	KY772981	——	KY772513	KY784263
Helvella panormitana H064 epitype Sweden	Helvella panormitana	O-253363, H064, epitype	Sweden, Hallan	——	KY772948	KY772856	KY772474	KY784228
Helvella paraphysitorquata H271 isotype Spain	Helvella paraphysitorquata	C-F-45305, H271, isotype	Spain, Teruel	——	KY773085	——	KY772634	KY784386
Helvella parva HMAS 290914 holotype China	Helvella parva	HMAS 290914, holotype	China	OQ600323	OQ586710	OQ597560	——	OQ597639
Helvella pezizoides H061 epitype Sweden	Helvella pezizoides	O-253366, H061, epitype	Sweden, Hallan	——	KY772945	KY772854	KY772471	KY784225
Helvella pezizoides H065 Sweden	Helvella pezizoides	O-253367, H065	Sweden, Hallan	——	KY772949	KY772857	KY772475	KY784229
Helvella philonotis HMAS 290915 China	Helvella philonotis	HMAS 290915	China	OQ600324	OQ586711	OQ597561	——	OQ597640
Helvella philonotis HMAS 264754 China	Helvella philonotis	HMAS 264754	China	OQ600327	OQ586712	OQ597563	——	OQ597644
Helvella philonotis O-255760 Norway	Helvella philonotis	O-255760	Norway, Oppland	MN656182	MN655853	MN689303	MN692301	MN692353
Helvella philonotis H492 holotype Iceland	Helvella philonotis	H492, holotype	Iceland, Hveragerdi	——	——	——	KY772813	KY784570
Helvella phlebophora H273 epitype Iceland	Helvella phlebophora	C-F-45405, H273, epitype	Iceland, Austur-Skaftafellsysla	——	KY773087	——	KY772636	KY784388
Helvella phlebophora HMAS 268001 China	Helvella phlebophora	HMAS 268001	China	OQ600328	OQ586713	OQ597564	——	OQ597645
Helvella phlebophoroides O-F-256565 holotype Spain	Helvella phlebophoroides	O-F-256565, holotype	Spain, Rioja,	——	MN644506	——	MN626775	MN598116
Helvella phlebophoroides C-F-17373 Denmark	Helvella phlebophoroides	C-F-17373	Denmark, NEZ	——	MN644507	——	MN626779	MN598088
Helvella phlebophoropsis HMAS 85654 holotype China	Helvella phlebophoropsis	HMAS 85654, holotype	China	OQ600329	——	——	——	OQ597646
Helvella plateata HMAS 290916 China	Helvella plateata	HMAS 290916	China	OQ600330	OQ586714	OQ597565	——	OQ597648
Helvella plateata HMAS 270642 holotype China	Helvella plateata	HMAS 270642, holotype	China	OQ600331	OQ586715	OQ597566	——	OQ597649
Helvella plateata HMAS 290917 China	Helvella plateata	HMAS 290917	China	OQ600332	OQ586716	OQ597567	——	OQ597650
Helvella platypodia O-F-256566 epitype Spain	Helvella platypodia	O-F-256566, epitype	Spain, Rioja	——	——	——	MN626790	MN598139
Helvella platypodia C-F-64490 Denmark	Helvella platypodia	C-F-64490	Denmark, EJ	——	——	——	——	MN598122
Helvella poculiformis O-F-256567 holotype Spain	Helvella poculiformis	O-F-256567, holotype	Spain, Zaragoza	——	——	——	MN626791	MN598143
Helvella pseudoalpina TROM-F-610049 Norway	Helvella pseudoalpina	TROM-F-610049	Norway, Troms. Balsfjord	——	MN655868	MN658195	MN692304	MN692356
Helvella pseudoalpina TROM-F-610048 Norway	Helvella pseudoalpina	TROM-F-610048	Norway, Troms.	MN656173	MN655866	MN658194	MN692303	MN692355
Helvella pseudoalpina O-255748 Svalbard	Helvella pseudoalpina	O-255748	Svalbard, Longyearbyen	——	MN655869	MN689292	MN692302	MN692354
Helvella pseudoelastica BJTC C351-A holotype China	Helvella pseudoelastica	BJTC C351-A, holotype	China	OR355170	OR355341	OR359078	OR359189	OR366143
Helvella pseudoelastica BJTC C351-B China	Helvella pseudoelastica	BJTC C351-B	China	OR355174	OR355348	OR359083	OR359194	OR366149
Helvella pseudofallax HSA 356 holotype China	Helvella pseudofallax	HSA 356, holotype	China	OR355083	OR355253	OR359015	OR359138	OR366080
Helvella pseudofallax BJTC ZH1283 China	Helvella pseudofallax	BJTC ZH1283	China	OR355084	OR355254	OR359016	OR359139	OR366081
Helvella pseudofallax BJTC FM1148 China	Helvella pseudofallax	BJTC FM1148	China	OR355085	OR355255	OR359017	OR359140	OR366082
Helvella pseudopezizoides BJTC FM1045-A China	Helvella pseudopezizoides	BJTC FM1045-A	China	OR355089	OR355259	OR359020	OR359143	OR366085
Helvella pseudopezizoides BJTC FM1045-B China	Helvella pseudopezizoides	BJTC FM1045-B	China	OR355090	OR355260	OR359021	OR359144	OR366086
Helvella pseudoreflexa HKAS 74311 holotype China	Helvella pseudoreflexa	HKAS 74311, holotype	China	JX462593	——	——	——	——
Helvella pseudoreflexa HKAS 75438 China	Helvella pseudoreflexa	HKAS 75438	China	JX462595	——	——	——	——
Helvella pseudoreflexa BJTC BP228 China	Helvella pseudoreflexa	BJTC BP228	China	OR355135	OR355306	OR359058	OR359171	OR366123
Helvella pseudoreflexa BJTC C549 China	Helvella pseudoreflexa	BJTC C549	China	OR355137	OR355308	OR359059	——	OR366124
Helvella pseudoreflexa BJTC FM1019 China	Helvella pseudoreflexa	BJTC FM1019	China	OR355138	OR355309	OR359060	OR359172	OR366125
Helvella pseudoreflexa BJTC FM1409 China	Helvella pseudoreflexa	BJTC FM1409	China	OR355139	OR355310	OR359061	OR359173	OR366126
Helvella pseudoreflexa BJTC FM270 China	Helvella pseudoreflexa	BJTC FM270	China	OR355140	OR355311	OR359062	OR359174	OR366127
Helvella pseudoreflexa BJTC L489 China	Helvella pseudoreflexa	BJTC L489	China	OR355143	OR355314	OR359063	OR359175	OR366128
Helvella pseudoreflexa HSA 313 China	Helvella pseudoreflexa	HSA 313	China	OR355145	OR355316	OR359064	OR359176	OR366129
Helvella pseudoreflexa HSA 332 China	Helvella pseudoreflexa	HSA 332	China	OR355146	OR355317	OR359065	OR359177	OR366130
Helvella pubescens H121 holotype Canada	Helvella pubescens	FH, H121, holotype	Canada, Albert	——	KY772975	——	KY772506	KY784257
Helvella pubescens H334 USA	Helvella pubescens	C-F-56502, H334	USA, Oregon	——	KY773114	——	KY772688	KY784437
Helvella pubescens BJTC BP020 China	Helvella pubescens	BJTC BP020	China	OR355093	OR355263	OR359023	OR359145	OR366089
Helvella pubescens BJTC C511 China	Helvella pubescens	BJTC C511	China	OR355094	OR355264	OR359024	OR359146	OR366090
Helvella pubescens BJTC FM259 China	Helvella pubescens	BJTC FM259	China	OR355097	OR355267	OR359025	OR359147	OR366091
Helvella pubescens BJTC FM918 China	Helvella pubescens	BJTC FM918	China	OR355098	OR355268	OR359026	OR359148	——
Helvella pulla H259 Norway	Helvella pulla	O-253370, H259	Norway, Oestfold	——	KY773080	——	KY772623	KY784374
Helvella pulla H149 epitype Norway	Helvella pulla	O-69282, H149, epitype	Norway, Moere og Romsdal	——	KY772998	——	KY772532	KY784282
Helvella queletiana C-F-39372 Denmark	Helvella queletiana	C-F-39372	Denmark, Zealand,	——	——	——	MN626778	MN598119
Helvella queletiana H403 neotype Denmark	Helvella queletiana	C-F-45303, H403, neotype	Denmark, Zealand,	——	KY773151	——	KY772746	KY784499
Helvella ravida HMAS 290919 holotype China	Helvella ravida	HMAS 290919, holotype	China	OQ600334	OQ586718	OQ597568	——	OQ597652
Helvella ravida HMAS 61920 China	Helvella ravida	HMAS 61920	China	OQ600335	OQ586719	——	——	OQ597653
Helvella ravida HSA 375 holotype China	Helvella ravida	HSA 375	China	OR355124	OR355295	OR359048	——	OR366113
Helvella retinervis ARAN3008363 holotype Spain	Helvella retinervis	ARAN3008363, holotype	Spain, Gipuzkoa	——	——	——	MN626783	MN598126
Helvella retinervis UPS-F-122183 Sweden	Helvella retinervis	UPS-F-122183	Sweden, Narke	——	——	——	MN626764	MN598097
Helvella rivularis H276 holotype Norway	Helvella rivularis	C-F-59447, H276, holotype	Norway, Nordland	——	KY773089	——	KY772639	KY784391
Helvella rivularis O-255764 Norway	Helvella rivularis	O-255764	Norway, Troms	MN656175	MN655850	MN689306	MN692295	MN692371
Helvella rugosa HKAS 87587 holotype China	Helvella rugosa	HKAS 87587, holotype	China	KR493478	MG871320	MG980690	——	——
Helvella rugosa HMAS 290920 China	Helvella rugosa	HMAS 290920	China	OQ600336	OQ586720	OQ597569	——	OQ597654
Helvella rugosa HMAS 290921 China	Helvella rugosa	HMAS 290921	China	OQ600337	OQ586721	OQ597570	——	OQ597655
Helvella scyphoides H140 holotype Norway	Helvella scyphoides	O-65348, H140, holotype	Norway, Hedmark	——	KY772989	KY772879	KY772523	KY784273
Helvella scyphoides BJTC FM1158 China	Helvella scyphoides	BJTC FM1158	China	OR355073	OR355243	OR359008	OR359131	OR366070
Helvella scyphoides BJTC FM899 China	Helvella scyphoides	BJTC FM899	China	OR355074	OR355244	——	——	OR366071
Helvella scyphoides HSA 166 China	Helvella scyphoides	HSA 166	China	OR355075	OR355245	OR359009	OR359132	OR366072
Helvella scyphoides HSA 239 China	Helvella scyphoides	HSA 239	China	OR355076	OR355246	——	——	OR366073
Helvella scyphoides HSA 336 China	Helvella scyphoides	HSA 336	China	OR355077	OR355247	——	——	OR366074
Helvella semiobruta H277 isotype France	Helvella semiobruta	C-F-45507, H277, isotype	France, Rhone	——	——	——	KY772640	KY784392
Helvella sichuanensis 10706 holotype China	Helvella sichuanensis	10706, holotype	China	OR355014	MK592107	OR358968	OR359095	MK652221
Helvella sinocrispa BJTC FM96-A holotype China	Helvella sinocrispa	BJTC FM96-A, holotype	China	OR355155	OR355326	OR359068	OR359180	OR366133
Helvella sinocrispa BJTC FM96-B China	Helvella sinocrispa	BJTC FM96-B	China	OR355156	OR355327	OR359069	OR359181	OR366134
Helvella sinohyperborea BJTC FM105 holotype China	Helvella sinohyperborea	BJTC FM105, holotype	China	OR355132	OR355303	OR359056	OR359170	OR366121
Helvella sinohyperborea BJTC FM165 China	Helvella sinohyperborea	BJTC FM165	China	OR355133	OR355304	OR359057	——	OR366122
Helvella solitaria H370 epitype Sweden	Helvella solitaria	H370, epitype	Sweden, Uppsala	——	——	——	KY772720	KY784470
Helvella solitaria H215 Norway	Helvella solitaria	O-253379, H215	Norway, Soer-Troendelag	——	KY773047	KY772890	KY772588	KY784336
Helvella solitaria H090 France	Helvella solitaria	O-253371, H090	France, Savoie	——	KY772959	KY772868	KY772488	KY784241
Helvella solitaria BJTC FM417 China	Helvella solitaria	BJTC FM417	China	OR355131	OR355302	OR359055	OR359169	OR366120
Helvella sp. BJTC ZH139 China	Helvella sp. 31	BJTC ZH139	China	OR355080	OR355250	OR359012	OR359135	OR366077
Helvella sp. HSA 150-A China	Helvella sp. 59	HSA 150-A	China	——	OR355345	OR359080	OR359191	OR366146
Helvella sp. HSA 150-B China	Helvella sp. 59	HSA 150-B	China	——	OR355346	OR359081	OR359192	OR366147
Helvella stevensii H394 USA	Helvella stevensii	C-F-92117, H394	USA, Michigan	——	——	——	KY772739	KY784491
Helvella stevensii H297 USA	Helvella stevensii	C-F-45350, H297	USA, Michigan,	——	——	——	KY772657	KY784408
Helvella subglabra H280 topotype USA	Helvella subglabra	C-F-65405, H280, topotype	USA, Michigan	——	——	——	KY772643	KY784394
Helvella subglabroides BJTC C614 China	Helvella subglabroides	BJTC C614	China	OR355086	OR355256	OR359018	OR359141	OR366083
Helvella subglabroides BJTC FM1049 China	Helvella subglabroides	BJTC FM1049	China	OR355087	OR355257	——	——	——
Helvella subglabroides BJTC FM2686 holotype China	Helvella subglabroides	BJTC FM2686, holotype	China	OR355088	OR355258	OR359019	OR359142	OR366084
Helvella sublactea HKAS 74226 China	Helvella sublactea	HKAS 74226	China	KT894827	——	——	——	——
Helvella sublactea HKAS 90607 China	Helvella sublactea	HKAS 90607	China	KT894826	——	——	——	——
Helvella sublactea BJTC FM1082 China	Helvella sublactea	BJTC FM1082	China	OR355122	OR355293	OR359046	——	OR366111
Helvella sublactea BJTC FM347 China	Helvella sublactea	BJTC FM347	China	OR355123	OR355294	OR359047	OR359162	OR366112
Helvella sublactea	Helvella sublactea	HKAS 69753	China	KT894825	KT894832	——	——	OR366154
Helvella sublicia H417 epitype Denmark	Helvella sublicia	C-F-39823, H417, epitype	Denmark, Soroe	——	KY773155	——	KY772756	KY784512
Helvella sublicia KH.11.84(S) Sweden	Helvella sublicia	KH.11.84(S)	Sweden, Gotland	——	MK100273	MK113894	——	MK179403
Helvella sublicia H148 Norway	Helvella sublicia	O-70080, H148	Norway, Akershus	——	KY772997	KY772880	KY772531	KY784281
Helvella subspadicea HKAS 90624 China	Helvella subspadicea	HKAS 90624	China, xinjiang	KU739797	KU739822	KU739849	——	——
Helvella subspadicea HKAS 56656 holotype China	Helvella subspadicea	HKAS 56656, holotype	China, xinjiang	——	KU739821	KU739848	——	——
Helvella subtinta HKAS 104666 holotype China	Helvella subtinta	HKAS 104666, holotype	China, Yunnan	MN449991	MN449992	——	——	——
Helvella subtinta BJTC FM1307 China	Helvella subtinta	BJTC FM1307	China	OR355130	OR355301	OR359054	OR359168	OR366119
Helvella sulcata H152 epitype Norway	Helvella sulcata	O-68095, H152, epitype	Norway, Oslo	——	KY773001	KY772882	KY772535	KY784284
Helvella sulcata O-F-256588 Spain	Helvella sulcata	O-F-256588	Spain, Rioja	——	MN644505	——	MN626774	MN598115
Helvella sulcatoides BJTC FM1416 holotype China	Helvella sulcatoides	BJTC FM1416, holotype	China	OR355119	OR355290	OR359043	OR359160	OR366108
Helvella sulcatoides BJTC FM263 China	Helvella sulcatoides	BJTC FM263	China	OR355120	OR355291	OR359044	OR359161	OR366109
Helvella sulcatoides BJTC ZH1231 China	Helvella sulcatoides	BJTC ZH1231	China	OR355121	OR355292	OR359045	——	OR366110
Helvella taiyuanensis HMAS 277500 China	Helvella taiyuanensis	HMAS 277500	China	MK592152	MK592105	MK652166	——	MK652216
Helvella taiyuanensis 119250 China	Helvella taiyuanensis	119250	China	MK592151	MK592104	OR358966	——	MK652215
Helvella taiyuanensis BJTC FM192 China	Helvella taiyuanensis	BJTC FM192	China	OR355167	OR355338	OR359076	OR359187	OR366141
Helvella taiyuanensis BJTC FM861 China	Helvella taiyuanensis	BJTC FM861	China	OR355168	OR355339	OR359077	OR359188	OR366142
Helvella terricola O-F-256562 holotype Spain	Helvella terricola	O-F-256562, holotype	Spain, Huesca	——	——	——	MN626809	MN598197
Helvella terricola HMAS 38355 China	Helvella terricola	HMAS 38355	China	OQ600354	——	——	——	OQ597679
Helvella tianshanensis HMAS 88611 China	Helvella tianshanensis	HMAS 88611	China	MK592158	——	——	——	MK652223
Helvella tianshanensis HMAS 86040 holotype China	Helvella tianshanensis	HMAS 86040, holotype	China	MK592157	MK592108	MK652170	——	MK652222
Helvella tianshanensis BJTC FM175 China	Helvella tianshanensis	BJTC FM175	China	OR355125	OR355296	OR359049	OR359163	OR366114
Helvella tianshanensis HSA 179 China	Helvella tianshanensis	HSA 179	China	OR355126	OR355297	OR359050	OR359164	OR366115
Helvella tianshanensis HSA 185 China	Helvella tianshanensis	HSA 185	China	OR355127	OR355298	OR359051	OR359165	OR366116
Helvella tinta HKAS 82560 holotype China	Helvella tinta	HKAS 82560, holotype	China	KX239842	KX239772	OR358962	——	OR366031
Helvella ulvinenii HKAS 90321 China	Helvella ulvinenii	HKAS 90321	China	——	KU167483	OR359088	OR359196	OR366155
Helvella varia HMAS 270932 holotype China	Helvella varia	HMAS 270932, holotype	China	OQ600357	OQ586737	OQ597585	——	OQ597682
Helvella varia HMAS 290929 China	Helvella varia	HMAS 290929	China	OQ600359	OQ586738	OQ597587	——	OQ597684
Helvella vespertina H116 USA	Helvella vespertina	FH, H116	USA, Maine	——	KY772971	——	KY772502	KY784254
Helvella vespertina H102 USA	Helvella vespertina	FH, H102	USA, California	——	KY772963	——	KY772492	KY784245
Helvella vitrea HMAS 290932 holotype China	Helvella vitrea	HMAS 290932, holotype	China	OQ600362	OQ586741	——	——	OQ597687
Helvella vulgata HMAS 53683 holotype China	Helvella vulgata	HMAS 53683, holotype	China	OQ600363	OQ586742	——	——	OQ597688
Helvella vulgata HMIGD 25964 China	Helvella vulgata	HMIGD 25964	China	OQ600365	OQ586743	OQ597589	——	OQ597690
Helvella vulgata BJTC FM2621 China	Helvella vulgata	BJTC FM2621	China	OR355116	OR355286	OR359039	OR359159	OR366104
Helvella xiaohuipan BJTC FM367 China	Helvella xiaohuipan	BJTC FM367	China	OR355078	OR355248	OR359010	OR359133	OR366075
Helvella xiaohuipan BJTC FM2317 holotype China	Helvella xiaohuipan	BJTC FM2317, holotype	China	OR355079	OR355249	OR359011	OR359134	OR366076
Helvella yunnanensis HMAS 290933 holotype China	Helvella yunnanensis	HMAS 290933, holotype	China	OQ600366	OQ586744	OQ597590	——	OQ597691
Helvella yunnanensis HMAS 290934 China	Helvella yunnanensis	HMAS 290934	China	OQ600367	OQ586745	OQ597591	——	OQ597692
Helvella zhongtiaoensis HKAS 74338 holotype China	Helvella zhongtiaoensis	HKAS 74338, holotype	China	JX462581	KR493487	KT254495	——	——
Helvella zhongtiaoensis HKAS 74336 China	Helvella zhongtiaoensis	HKAS 74336	China	JX462579	KR493485	KT254493	——	——
Helvella zhongtiaoensis HKAS 74335 China	Helvella zhongtiaoensis	HKAS 74335	China	JX462578	KR493484	——	——	OR366156
Helvella zhongtiaoensis HKAS 74343 China	Helvella zhongtiaoensis	HKAS 74343	China	JX462583	KR493489	——	——	OR366157
Pindara terrestris S-F327988 Sweden	Pindara terrestris	S-F327988	Sweden	——	MK100280	MK113896	MK113867	——
Pindara terrestris KH.12.67(S) Sweden	Pindara terrestris	KH.12.67(S)	Sweden	——	MK100279	MK113889	MK113866	——
Pindara terrestris H284 Norway	Pindara terrestris	H284	Norway	——	KY773094	——	KY772647	KY784398

Table S2.

Specimens used in two combined loci (ITS/nrLSU) phylogenetic analysis and their GenBank accession numbers. Newly generated sequences are in bold.

Taxa Name in Analysis	Taxon name	Voucher specimen	Country	ITS GenBank	LSU GenBank
Dissingia oblongispora HSA 137 China	Dissingia oblongispora	HSA 137	China	OR355181	OR355355
Dissingia oblongispora HSA 169 China	Dissingia oblongispora	HSA 169	China	OR355182	OR355356
Helvella acetabuloides BJTC FM1264 China	Helvella acetabuloides	BJTC FM1264	China	OR355166	OR355337
Helvella acetabuloides CFSZ2044 holotype China	Helvella acetabuloides	CFSZ2044, holotype	China	OR355015	OR355185
Helvella acetabulum HMAS 23839 China	Helvella acetabulum	HMAS 23839	China	MK592112	——
Helvella acetabulum HMAS 75176 China	Helvella acetabulum	HMAS 75176	China	MK592117	——
Helvella albopatella BJTC FM2610-A holotype China	Helvella albopatella	BJTC FM2610-A	China	OR355082	OR355252
Helvella albopatella BJTC FM2610-B China	Helvella albopatella	BJTC FM2610-B	China	OR355176	OR355350
Uncultured Pezizales LP110032 China	Helvella albopatella	LP110032	China	JQ318620	——
Uncultured Pezizales LP110049 China	Helvella albopatella	LP110049	China	JQ318637	——
Helvella alborava BJTC C316-A holotype China	Helvella alborava	BJTC C316-A, holotype	China	OR355106	OR355276
Helvella alborava BJTC C316-B China	Helvella alborava	BJTC C316-B	China	OR355173	OR355347
Uncultured Helvella XT12876 China	Helvella alborava	XT12876	China	MF405781	——
Helvella alpina H223 holotype France	Helvella alpina	H223, holotype	France	——	KY773054
Helvella atra HMAS 290900 China	Helvella atra	HMAS 290900	China	OQ600286	OQ586677
Helvella atra HMAS 290901 China	Helvella atra	HMAS 290901	China	OQ600287	OQ586678
Helvella atra zhao2111 China	Helvella atra	zhao2111	China	KT894823	KT894830
Helvella lacunosa zhao2112 China	Helvella atra	zhao2112	China	KT894824	KT894831
Helvella sp. HKAS 69065 China	Helvella atroides	HKAS 69065	China	KX507000	——
Helvella austrooccidentalis HMAS 290902 China	Helvella austrooccidentalis	HMAS 290902	China	OQ600290	OQ586680
Helvella austrooccidentalis HMAS 290903 holotype China	Helvella austrooccidentalis	HMAS 290903, holotype	China	OQ600291	OQ586681
Helvella bachu BJTC FM382 China	Helvella bachu	BJTC FM382	China	OR355062	OR355232
Helvella bachu HKAS 88106 China	Helvella bachu	HKAS 88106	China	KU739792	KU739816
Helvella bachu HKAS 88105 holotype China	Helvella bachu	HKAS 88105, holotype	China	KU739791	NG_059662
Helvella borealis HMAS 290905 holotype China	Helvella borealis	HMAS 290905, holotype	China	OQ600293	OQ586683
Helvella brunneogaleriformis BJTC FM269 China	Helvella brunneogaleriformis	BJTC FM269	China	OR355063	OR355233
Helvella brunneogaleriformis BJTC FM272 China	Helvella brunneogaleriformis	BJTC FM272	China	OR355064	OR355234
Helvella brunneogaleriformis BJTC FM911 holotype China	Helvella brunneogaleriformis	BJTC FM911, holotype	China	OR355065	OR355235
Helvella caespitosa HSA 379-A holotype China	Helvella caespitosa	HSA 379-A, holotype	China	OR355091	OR355261
Helvella caespitosa HSA 379-B China	Helvella caespitosa	HSA 379-B	China	OR355092	OR355262
Uncultured fungus NX3-129 China	Helvella caespitosa	NX3-129	China	LC623411	——
Helvella calycina HMAS 279704 China	Helvella calycina	HMAS 279704	China: Inner Mongolia	OR355013	MK592100
Helvella capucinoides BJTC FM1094 China	Helvella capucinoides	BJTC FM1094	China	OR355037	OR355207
Helvella capucinoides BJTC FM1156 China	Helvella capucinoides	BJTC FM1156	China	OR355038	OR355208
Helvella capucinoides BJTC FM1423 China	Helvella capucinoides	BJTC FM1423	China	OR355039	OR355209
Helvella capucinoides BJTC FM242 China	Helvella capucinoides	BJTC FM242	China	OR355040	OR355210
Helvella capucinoides BJTC FM884 China	Helvella capucinoides	BJTC FM884	China	OR355041	OR355211
Helvella capucinoides BJTC FM909 China	Helvella capucinoides	BJTC FM909	China	OR355042	OR355212
Helvella capucinoides HMJAU 33777 China	Helvella capucinoides	HMJAU 33777	China	OR355043	OR355213
Helvella capucinoides BJTC FM923 China	Helvella capucinoides	BJTC FM923	China	OR355169	OR355340
Helvella carnosa BJTC BP030 China	Helvella carnosa	BJTC BP030	China	OR355016	OR355186
Helvella carnosa BJTC BP043 China	Helvella carnosa	BJTC BP043	China	OR355017	OR355187
Helvella carnosa BJTC BP060 China	Helvella carnosa	BJTC BP060	China	OR355018	OR355188
Helvella carnosa BJTC BP718 China	Helvella carnosa	BJTC BP718	China	OR355019	OR355189
Helvella carnosa BJTC BP724 China	Helvella carnosa	BJTC BP724	China	OR355020	OR355190
Helvella carnosa BJTC FM1032 China	Helvella carnosa	BJTC FM1032	China	OR355021	OR355191
Helvella carnosa BJTC FM274 China	Helvella carnosa	BJTC FM274	China	OR355022	OR355192
Helvella carnosa BJTC FM297 China	Helvella carnosa	BJTC FM297	China	OR355023	OR355193
Helvella carnosa BJTC FM298 China	Helvella carnosa	BJTC FM298	China	OR355024	OR355194
Helvella carnosa BJTC FM316 China	Helvella carnosa	BJTC FM316	China	OR355025	OR355195
Helvella carnosa BJTC FM376 China	Helvella carnosa	BJTC FM376	China	OR355026	OR355196
Helvella carnosa BJTC FM953 China	Helvella carnosa	BJTC FM953	China	OR355027	OR355197
Helvella carnosa HSA 360 China	Helvella carnosa	HSA 360	China	OR355028	OR355198
Helvella carnosa HSA 434 China	Helvella carnosa	HSA 434	China	OR355029	OR355199
Helvella carnosa BJTC SBP287	Helvella carnosa	BJTC SBP287	China	OR355030	OR355200
Helvella carnosa BJTC FM2619 China	Helvella carnosa	BJTC FM2619	China	OR355031	OR355201
Helvella carnosa BJTC FM2478 China	Helvella carnosa	BJTC FM2478	China	OR355032	OR355202
Helvella carnosa BJTC FM2479 China	Helvella carnosa	BJTC FM2479	China	OR355033	OR355203
Helvella carnosa BJTC FM2499 China	Helvella carnosa	BJTC FM2499	China	OR355034	OR355204
Helvella macropus HKAS 84887 China	Helvella macropus	HKAS 84887	China	KX506989	KX506944
Helvella corbierei HSA 138 China	Helvella corbierei	HSA 138	China	OR355071	OR355241
Helvella corbierei HSA 181 China	Helvella corbierei	HSA 181	China	OR355072	OR355242
Helvella corium O-255756 Svalbard	Helvella corium	O-255756	Svalbard	MN656185	MN655873
Helvella corium O-255757 France	Helvella corium	O-255757	France	MN656165	MN655870
Helvella costifera BJTC FM1705 China	Helvella costifera	BJTC FM1705	China	OR355128	OR355299
Helvella costifera BJTC FM1742 China	Helvella costifera	BJTC FM1742	China	OR355129	OR355300
Helvella costifera HMAS 280301 China	Helvella costifera	HMAS 280301	China	MK592123	MK592103
Helvella costifera HMAS 187120 China	Helvella costifera	HMAS 187120	China	MK592122	MK592102
Helvella cremeoinvoluta BJTC FM941-A holotype China	Helvella cremeoinvoluta	BJTC FM941-A, holotype	China	OR355153	OR355324
Helvella cremeoinvoluta BJTC FM941-B China	Helvella cremeoinvoluta	BJTC FM941-B	China	OR355154	OR355325
Helvella crispoides HKAS 90585 China	Helvella crispoides	HKAS 90585	China	KX507002	OR355183
Helvella crispoides HKAS 90583 China	Helvella crispoides	HKAS 90583	China	KX507001	OR355184
Helvella crispoides HKAS 90535 holotype China	Helvella crispoides	HKAS 90535, holotype	China	KU739803	——
Helvella cystidiata HKAS 74316 China	Helvella cystidiata	HKAS 74316	China	KX239840	KX239803
Helvella cystidiata HKAS 78941 holotype China	Helvella cystidiata	HKAS 78941, holotype	China	KX239839	KX239802
Helvella cystidiata HMJAU 52 China	Helvella cystidiata	HMJAU 52	China	OQ600295	OQ586684
Helvella cystidiata HMJAU 150 China	Helvella cystidiata	HMJAU 150	China	OQ600296	OQ586685
Helvella danica BJTC BP398 China	Helvella danica	BJTC BP398	China	OR355044	OR355214
Helvella danica BJTC BP428 China	Helvella danica	BJTC BP428	China	OR355045	OR355215
Helvella danica BJTC BP649 China	Helvella danica	BJTC BP649	China	OR355046	OR355216
Helvella danica BJTC L235 China	Helvella danica	BJTC L235	China	OR355047	OR355217
Helvella danica BJTC SBP022 China	Helvella danica	BJTC SBP022	China	OR355048	OR355218
Helvella danica BJTC ZH1249 China	Helvella danica	BJTC ZH1249	China	OR355049	OR355219
Helvella danica BJTC ZH370 China	Helvella danica	BJTC ZH370	China	OR355050	OR355220
Helvella danica BJTC ZH883 China	Helvella danica	BJTC ZH883	China	OR355051	OR355221
Helvella danica BJTC FM1053 China	Helvella danica	BJTC FM1053	China	OR355052	OR355222
Helvella danica BJTC ZH1122 China	Helvella danica	BJTC ZH1122	China	OR355053	OR355223
Helvella danica BJTC BP544 China	Helvella danica	BJTC BP544	China	OR355054	OR355224
Helvella danica BJTC ZH522 China	Helvella danica	BJTC ZH522	China	OR355055	OR355225
Helvella danica BJTC ZH1190 China	Helvella danica	BJTC ZH1190	China	OR355056	OR355226
Helvella danica BJTC BP255 China	Helvella danica	BJTC BP255	China	OR355057	OR355227
Helvella danica BJTC FM2577 China	Helvella danica	BJTC FM2577	China	OR355058	OR355228
Helvella danica BJTC SBP199 China	Helvella danica	BJTC SBP199	China	OR355171	OR355342
Helvella danica BJTC ZH1360 China	Helvella danica	BJTC ZH1360	China	OR355177	OR355351
Helvella deflexa HSA 240-A1 holotype China	Helvella deflexa	HSA 240-A1, holotype	China	OR355069	OR355239
Helvella deflexa HSA 240-A2 China	Helvella deflexa	HSA 240-A2	China	OR355070	OR355240
Helvella ephippioides HMJAU 44584 China	Helvella ephippioides	HMJAU 44584	China	OR355107	OR355277
Helvella sp. HMJAU 20134 China	Helvella ephippioides	HMJAU 20134	China	KX506996	KX506951
Helvella macropus Y090607 China	Helvella ephippioides	Y090607	China	OL678130	——
Helvella fistulosa BJTC 1976 China	Helvella fistulosa	BJTC 1976	China	OR355061	OR355231
Helvella flavostipitata HSA 387-A holotype China	Helvella flavostipitata	HSA 387-A, holotype	China	OR355035	OR355205
Helvella flavostipitata HSA 387-B China	Helvella flavostipitata	HSA 387-B	China	OR355036	OR355206
Uncultured fungus NX3-109 China	Helvella flavostipitata	NX3-109	China	LC623405	——
Helvella floriforma HKAS 90224 holotype China	Helvella floriforma	HKAS90224	China	——	KX239771
Helvella fulva HMAS 290906 holotype China	Helvella fulva	HMAS 290906, holotype	China	OQ600297	OQ586686
Helvella galeriformis HSA 232 epitype China	Helvella galeriformis	HSA 232, epitype	China	OR355066	OR355236
Helvella galeriformis HSA 240-B China	Helvella galeriformis	HSA 240-B	China	OR355067	OR355237
Helvella galeriformis BJTC FM2574 China	Helvella galeriformis	BJTC FM2574	China	OR355068	OR355238
Helvella sp. HKAS 68122 China	Helvella guttata	HKAS 68122	China	KX506976	KX506931
Helvella sp. HKAS 57139 China	Helvella guttata	HKAS 57439	China	KX506975	KX506930
Helvella sp. HKAS 87759 China	Helvella guttata	HKAS 87759	China	KX506974	KX506929
Helvella huangii HMAS 290907 China	Helvella huangii	HMAS 290907	China	OQ600298	OQ586687
Helvella huangii HMAS 45031 holotype China	Helvella huangii	HMAS 45031, holotype	China	OQ600299	OQ586688
Helvella huangii HMJAU 3488 China	Helvella huangii	HMJAU 3488	China	OQ600300	OQ586689
Helvella huangii BJTC C375 China	Helvella huangii	BJTC C375	China	OR355175	OR355349
Helvella involuta BJTC FM2940 China	Helvella involuta	BJTC FM2940	China	OR355157	OR355328
Helvella involuta HKAS 74281 holotype China	Helvella involuta	HKAS 74281, holotype	China	KT215608	KR493492
Helvella involuta HKAS 69966 China	Helvella involuta	HKAS 69966	China	JX462589	KR493497
Helvella jizushanica HMAS 290908 holotype China	Helvella jizushanica	HMAS 290908, holotype	China	OQ600301	OQ586690
Helvella jizushanica HMAS 59718 China	Helvella jizushanica	HMAS 59718	China	OQ600302	OQ586691
Helvella sp. HKAS 69079 China	Helvella jizushanica	HKAS 69079	China	KX239830	KX239793
Helvella sp. HKAS 72598 China	Helvella jizushanica	HKAS 72598	China	KX239829	KX239792
Helvella sp. HKAS 90221 China	Helvella jizushanica	HKAS 90221	China	KX239828	KX239791
Helvella sp. HKAS 69079 China	Helvella jizushanica	HKAS 69079	China	KX239830	KX239793
Helvella sp. HKAS 72598 China	Helvella jizushanica	HKAS 72598	China	KX239829	KX239792
Helvella sp. HKAS 90221 China	Helvella jizushanica	HKAS 90221	China	KX239828	KX239791
Helvella lacunosa BJTC FM1162 China	Helvella lacunosa	BJTC FM1162	China	OR355108	OR355278
Helvella lacunosa BJTC FM1414 China	Helvella lacunosa	BJTC FM1414	China	OR355109	OR355279
Helvella lacunosa BJTC FM546 China	Helvella lacunosa	BJTC FM546	China	OR355110	OR355280
Helvella lacunosa BJTC FM573 China	Helvella lacunosa	BJTC FM573	China	OR355111	OR355281
Helvella lacunosa BJTC FM813 China	Helvella lacunosa	BJTC FM813	China	OR355112	OR355282
Helvella lacunosa BJTC FM907 China	Helvella lacunosa	BJTC FM907	China	OR355113	OR355283
Helvella lacunosa BJTC FM917 China	Helvella lacunosa	BJTC FM914	China	OR355114	OR355284
Helvella lacunosa BJTC FM947 China	Helvella lacunosa	BJTC FM947	China	OR355115	OR355285
Helvella pseudolacunosa HKAS 87594 holotype China	Helvella lacunosa	HKAS 87594, holotype	China	KR493476	KU739814
Helvella pseudolacunosa HMJAU 4533 China	Helvella lacunosa	HMJAU 4533	China	MG871284	MG871319
Helvella liui HMAS 85725 holotype China	Helvella liui	HMAS 85725, holotype	China	OQ600310	——
Uncultured Helvella XT13106 China	Helvella liui	XT13106	China	MF405782	——
Uncultured Helvella Q-L-OTU66 China	Helvella liui	Q-L-OTU66	China	KY684424	——
Helvella lobata HMAS 290910 holotype China	Helvella lobata	HMAS 290910, holotype	China	OQ600311	OQ586698
Helvella maculatoides HKAS 87827 China	Helvella maculatoides	HKAS 87827	China	KU739859	KU167472
Helvella maculatoides HKAS 90590 holotype China	Helvella maculatoides	HKAS 90590, holotype	China	KU739858	KU167473
Helvella magna HMAS 60679 holotype China	Helvella magna	HMAS 60679, holotype	China	OQ600315	OQ586702
Helvella magna HMAS 290911 China	Helvella magna	HMAS 290911	China	OQ600312	OQ586699
Helvella magna HMAS 290912 China	Helvella magna	HMAS 290912	China	OQ600313	OQ586700
Helvella magna BJTC FM1046 China	Helvella magna	BJTC FM1046	China	——	OR355287
Helvella magna BJTC FM2486-A China	Helvella magna	BJTC FM2486-A	China	OR355117	OR355288
Helvella magna BJTC FM2486-B China	Helvella magna	BJTC FM2486-B	China	OR355118	OR355289
Uncultured Helvella XJG9 China	Helvella magna	XJG9	China: Inner Mongolia	JX129157	——
Uncultured fungus QH142 China	Helvella magna	QH-142	China:Qinghai Province	LC623504	——
Helvella multiformis BJTC FM1130 holotype China	Helvella multiformis	BJTC FM1130	China	OR355100	OR355270
Helvella multiformis BJTC FM1131 China	Helvella multiformis	BJTC FM1131	China	OR355101	OR355271
Helvella multiformis BJTC FM264 China	Helvella multiformis	BJTC FM264	China	OR355102	OR355272
Helvella multiformis BJTC FM305 China	Helvella multiformis	BJTC FM305	China	OR355103	OR355273
Helvella multiformis BJTC FM2484 China	Helvella multiformis	BJTC FM2484	China	OR355104	OR355274
Helvella multiformis HSA 362 China	Helvella multiformis	HSA 362	China	OR355172	OR355343
Helvella neofistulosa BJTC ZH1213 holotype China	Helvella neofistulosa	BJTC ZH1213, holotype	China	OR355059	OR355229
Helvella neofistulosa BJTC ZH1251 China	Helvella neofistulosa	BJTC ZH1251	China	OR355060	OR355230
Helvella nigrorava BJTC ZH67 holotype China	Helvella nigrorava	BJTC ZH67	China	OR355105	OR355275
Uncultured Helvella XT12787 China	Helvella nigrorava	XT12787	China	MF405780	——
Helvella nordlandica BJTC FM346-A China	Helvella nordlandica	BJTC FM346-A	China	OR355081	OR355251
Helvella nordlandica BJTC FM346-B China	Helvella nordlandica	BJTC FM346-B	China	——	OR355344
Helvella orienticrispa BJTC ZH1364 China	Helvella orienticrispa	BJTC ZH1364	China	OR355178	OR355352
Helvella orienticrispa BJTC BP066 China	Helvella orienticrispa	BJTC BP066	China	OR355158	OR355329
Helvella orienticrispa BJTC C578 China	Helvella orienticrispa	BJTC C578	China	OR355159	OR355330
Helvella orienticrispa BJTC FM418 China	Helvella orienticrispa	BJTC FM418	China	OR355160	OR355331
Helvella orienticrispa BJTC SBP126 China	Helvella orienticrispa	BJTC SBP126	China	OR355161	OR355332
Helvella orienticrispa BJTC ZH744 China	Helvella orienticrispa	BJTC ZH744	China	OR355162	OR355333
Helvella orienticrispa BJTC FM2480 China	Helvella orienticrispa	BJTC FM2480	China	OR355163	OR355334
Helvella orienticrispa BJTC FM2481 China	Helvella orienticrispa	BJTC FM2481	China	OR355164	OR355335
Helvella orienticrispa BJTC FM2482 China	Helvella orienticrispa	BJTC FM2482	China	OR355165	OR355336
Helvella orienticrispa HKAS 74319 holotype China	Helvella orienticrispa	HKAS 74319, holotype	China	JX462598	KR493503
Helvella sp. HKAS 90531 China	Helvella orentitomentosa	HKAS 90531	China	KX506999	——
Helvella parva HMAS 290914 holotype China	Helvella parva	HMAS 290914, holotype	China	OQ600323	OQ586710
Helvella philonotis HMAS 290915 China	Helvella philonotis	HMAS 290915	China	OQ600324	OQ586711
Helvella philonotis HMAS 264754 China	Helvella philonotis	HMAS 264754	China	OQ600327	OQ586712
Helvella phlebophora HMAS 268001 China	Helvella phlebophora	HMAS 268001	China	OQ600328	OQ586713
Helvella phlebophoropsis HMAS 85654 holotype China	Helvella phlebophoropsis	HMAS 85654, holotype	China	OQ600329	——
Helvella plateata HMAS 290916 China	Helvella plateata	HMAS 290916	China	OQ600330	OQ586714
Helvella plateata HMAS 270642 holotype China	Helvella plateata	HMAS 270642, holotype	China	OQ600331	OQ586715
Helvella plateata HMAS 290917 China	Helvella plateata	HMAS 290917	China	OQ600332	OQ586716
Helvella pseudoalpina TROM-F-610048 Norway	Helvella pseudoalpina	TROM-F-610048	Norway	MN656173	MN655866
Helvella pseudoelastica BJTC C351-A holotype China	Helvella pseudoelastica	BJTC C351-A?holotype	China	OR355170	OR355341
Helvella pseudoelastica BJTC C351-B China	Helvella pseudoelastica	BJTC C351-B	China	OR355174	OR355348
Helvella pseudofallax HSA 356 holotype China	Helvella pseudofallax	HAS 356, holotype	China	OR355083	OR355253
Helvella pseudofallax BJTC ZH1283 China	Helvella pseudofallax	BJTC ZH1283	China	OR355084	OR355254
Helvella pseudofallax BJTC FM1148 China	Helvella pseudofallax	BJTC FM1148	China	OR355085	OR355255
Helvella pseudopezizoides BJTC FM1045-A holotype China	Helvella pseudopezizoides	BJTC FM1045-A, holotype	China	OR355089	OR355259
Helvella pseudopezizoides BJTC FM1045-B China	Helvella pseudopezizoides	BJTC FM1045-B	China	OR355090	OR355260
Uncultured Helvella DLS1758 China	Helvella pseudopezizoides	DLS1758	China	KX444420	——
Helvella pseudoreflexa BJTC BP163 China	Helvella pseudoreflexa	BJTC BP163	China	OR355134	OR355305
Helvella pseudoreflexa BJTC BP228 China	Helvella pseudoreflexa	BJTC BP228	China	OR355135	OR355306
Helvella pseudoreflexa BJTC BP760 China	Helvella pseudoreflexa	BJTC BP760	China	OR355136	OR355307
Helvella pseudoreflexa BJTC C549 China	Helvella pseudoreflexa	BJTC C549	China	OR355137	OR355308
Helvella pseudoreflexa BJTC FM1019 China	Helvella pseudoreflexa	BJTC FM1019	China	OR355138	OR355309
Helvella pseudoreflexa BJTC FM1409 China	Helvella pseudoreflexa	BJTC FM1409	China	OR355139	OR355310
Helvella pseudoreflexa BJTC FM270 China	Helvella pseudoreflexa	BJTC FM270	China	OR355140	OR355311
Helvella pseudoreflexa BJTC FM271 China	Helvella pseudoreflexa	BJTC FM271	China	OR355141	OR355312
Helvella pseudoreflexa BJTC FM284 China	Helvella pseudoreflexa	BJTC FM284	China	OR355142	OR355313
Helvella pseudoreflexa BJTC L489 China	Helvella pseudoreflexa	BJTC L489	China	OR355143	OR355314
Helvella pseudoreflexa HSA 225 China	Helvella pseudoreflexa	HSA 225	China	OR355144	OR355315
Helvella pseudoreflexa HSA 313 China	Helvella pseudoreflexa	HSA 313	China	OR355145	OR355316
Helvella pseudoreflexa HSA 332 China	Helvella pseudoreflexa	HSA 332	China	OR355146	OR355317
Helvella pseudoreflexa HSA 364 China	Helvella pseudoreflexa	HSA 364	China	OR355147	OR355318
Helvella pseudoreflexa HSA 404 China	Helvella pseudoreflexa	HSA 404	China	OR355148	OR355319
Helvella pseudoreflexa BJTC ZH1229 China	Helvella pseudoreflexa	BJTC ZH1229	China	OR355149	OR355320
Helvella pseudoreflexa BJTC ZH1269 China	Helvella pseudoreflexa	BJTC ZH1269	China	OR355150	OR355321
Helvella pseudoreflexa BJTC ZH1303 China	Helvella pseudoreflexa	BJTC ZH1303	China	OR355151	OR355322
Helvella pseudoreflexa BJTC FM2490 China	Helvella pseudoreflexa	BJTC FM2490	China	OR355152	OR355323
Helvella pseudoreflexa HKAS 75438 China	Helvella pseudoreflexa	HKAS 74311, holotype	China	JX462593	KR493500
Helvella pseudoreflexa HKAS 74311 holotype China	Helvella pseudoreflexa	HKAS 75438	China	JX462595	KR493499
Helvella pubescens BJTC BP020 China	Helvella pubescens	BJTC BP020	China	OR355093	OR355263
Helvella pubescens BJTC C511 China	Helvella pubescens	BJTC C511	China	OR355094	OR355264
Helvella pubescens BJTC FM1167 China	Helvella pubescens	BJTC FM1167	China	OR355095	OR355265
Helvella pubescens BJTC FM244 China	Helvella pubescens	BJTC FM244	China	OR355096	OR355266
Helvella pubescens BJTC FM259 China	Helvella pubescens	BJTC FM259	China	OR355097	OR355267
Helvella pubescens BJTC FM918 China	Helvella pubescens	BJTC FM918	China	OR355098	OR355268
Helvella pubescens BJTC SBP025 China	Helvella pubescens	BJTC SBP025	China	OR355099	OR355269
Helvella ravida HMAS 290919 holotype China	Helvella ravida	HMAS 290919, holotype	China	OQ600334	OQ586718
Helvella ravida HMAS 61920 China	Helvella ravida	HMAS 61920	China	OQ600335	OQ586719
Uncultured Helvella China	Helvella ravida	——	China	LT967133	——
Helvella ravida HSA 375	Helvella ravida	HSA 375	China	OR355124	OR355295
Helvella rugosa HKAS 87587 holotype China	Helvella rugosa	HKAS 87587, holotype	China: Yunnan province	KR493478	MG871320
Helvella sp. HKAS 75442 China	Helvella rugosa	HKAS 75442	China: Yunnan province	KR493475	KR493511
Helvella rugosa HMAS 290920 China	Helvella rugosa	HMAS 290920	China	OQ600336	OQ586720
Helvella rugosa HMAS 290921 China	Helvella rugosa	HMAS 290921	China	OQ600337	OQ586721
Helvella scyphoides BJTC FM1158 China	Helvella scyphoides	BJTC FM1158	China	OR355073	OR355243
Helvella scyphoides BJTC FM899 China	Helvella scyphoides	BJTC FM899	China	OR355074	OR355244
Helvella scyphoides HSA 166 China	Helvella scyphoides	HSA 166	China	OR355075	OR355245
Helvella scyphoides HSA 239 China	Helvella scyphoides	HSA 239	China	OR355076	OR355246
Helvella scyphoides HSA 336 China	Helvella scyphoides	HSA 336	China	OR355077	OR355247
Helvella sichuanensis 10706 holotype China	Helvella sichuanensis	10706, holotype	China	OR355014	MK592107
Helvella sinocrispa BJTC FM96-A holotype China	Helvella sinocrispa	BJTC FM96-A?holotype	China	OR355155	OR355326
Helvella sinocrispa BJTC FM96-B China	Helvella sinocrispa	BJTC FM96-B	China	OR355156	OR355327
Helvella cf. crispa HKAS 80056 China	Helvella sinocrispa	HKAS 80056	China	KU739898	——
Helvella cf. crispa HKAS 90591 China	Helvella sinocrispa	HKAS 90591	China	KU739897	——
Helvella sinohyperborea BJTC FM105 holotype China	Helvella sinohyperborea	BJTC FM105?holotype	China	OR355132	OR355303
Helvella sinohyperborea BJTC FM165 China	Helvella sinohyperborea	BJTC FM165	China	OR355133	OR355304
Uncultured Helvella NXHLS462 China	Helvella sinohyperborea	NXHLS462	China: Helan Mountains	KX510013	——
Uncultured Helvella 1 China	Helvella sinohyperborea	1	China: inner Mongolia	FJ803929	——
Helvella solitaria BJTC FM417 China	Helvella solitaria	BJTC FM417	China	OR355131	OR355302
Helvella solitaria HMAS 27727 China	Helvella solitaria	HMAS 27727	China	MK592147	——
Helvella sp. HKAS 54995 China	Helvella sp. 5	HKAS 54995	China	KR493473	KR493505
Uncultured Helvella M11305 China	Helvella sp. 5	M11305	China	KR493446	——
Helvella cf. compressa HKAS 49364 China	Helvella sp. 14	HKAS 49364	China	JX462569	——
Helvella compressa HKAS 45788 China	Helvella sp. 15	HKAS 45788	China	KU739801	KU739829
Helvella sp. HKAS 54996 China	Helvella sp. 18	HKAS 54996	China	KX506992	——
Helvella sp. HKAS 74023 China	Helvella sp. 18	HKAS 74023	China	KX506991	——
Uncultured Helvella XT13139 China	Helvella sp. 18	XT13139	China	MF405783	——
Uncultured fungus BJ-397 China	Helvella sp. 22	BJ-397	China	LC623053	——
Helvella sp. HKAS 90567 China	Helvella sp. 23	HKAS 90567	China	KX506961	KX506913
Helvella sp. HKAS 90569 China	Helvella sp. 23	HKAS 90569	China	KX506963	KX506915
Helvella sp. HKAS 90568 China	Helvella sp. 23	HKAS 90568	China	KX506962	KX506914
Helvella sp. HKAS 90605 China	Helvella sp. 24	HKAS 90605	China	KX506965	KX506918
Helvella sp. HKAS 87864 China	Helvella sp. 24	HKAS 87864	China	MG871286	MG871322
Helvella sp. HKAS 90626 China	Helvella sp. 25	HKAS 90626	China	KX506967	KX506920
Helvella sp. HKAS 67939 China	Helvella sp. 26	HKAS 67939	China	KX506966	KX506919
Helvella sp. HKAS 76318 China	Helvella sp. 27	HKAS 76318	China	KX506981	KX506936
Helvella sp. HKAS 78930 China	Helvella sp. 27	HKAS 78930	China	KX506978	KX506933
Helvella sp. HKAS 70217 China	Helvella sp. 27	HKAS 70217	China	KX506977	KX506932
Helvella sp. HKAS 90604 China	Helvella sp. 28	HKAS 90604	China	KX506995	KX506950
Helvella sp. HKAS 95081 China	Helvella sp. 29	HKAS 95081	China	KX506985	KX506940
Helvella sp. HKAS 95080 China	Helvella sp. 29	HKAS 95080	China	KX506984	KX506939
Helvella sp. HKAS 90627 China	Helvella sp. 29	HKAS 90627	China	KX506983	KX506938
Helvella sp. HKAS 87779 China	Helvella sp. 30	HKAS 87779	China	KX506970	KX506923
Helvella sp. HKAS 78921 China	Helvella sp. 30	HKAS 78921	China	KX506969	KX506922
Helvella sp. HKAS 90574 China	Helvella sp. 30	HKAS 90574	China	KX506971	KX506924
Helvella sp. BJTC ZH139 China	Helvella sp. 31	BJTC ZH139	China	OR355080	OR355250
Uncultured Helvella LKS1028 China	Helvella sp. 31	LKS1028	China: Shanxi Province	KX444354	——
Uncultured fungus NX1-4504 China	Helvella sp. 32	NX1-4504	China:Ningxia Hui Autonomous Region	LC622784	——
Uncultured fungus NX2-123 China	Helvella sp. 32	NX2-123	China:Ningxia Hui Autonomous Region	LC623361	——
Helvella sp. HKAS 87756 China	Helvella sp. 42	HKAS 87756	China	KX239836	KX239799
Helvella sp. HKAS 87757 China	Helvella sp. 42	HKAS 87757	China	KX239837	KX239800
Helvella sp. HKAS 87755 China	Helvella sp. 42	HKAS 87755	China	KX239835	KX239798
Helvella sp. HSA 150-A China	Helvella sp. 59	HSA 150-A	China	——	OR355345
Helvella sp. HSA 150-B China	Helvella sp. 59	HSA 150-B	China	——	OR355346
Helvella subglabroides BJTC C614 China	Helvella subglabroides	BJTC C614	China	OR355086	OR355256
Helvella subglabroides BJTC FM1049 China	Helvella subglabroides	BJTC FM1049	China	OR355087	OR355257
Helvella subglabroides BJTC FM2686 holotype China	Helvella subglabroides	BJTC FM2686, holotype	China	OR355088	OR355258
Helvella sublactea BJTC FM1082 China	Helvella sublactea	BJTC FM1082	China	OR355122	OR355293
Helvella sublactea BJTC FM347 China	Helvella sublactea	BJTC FM347	China	OR355123	OR355294
Helvella sublactea HKAS 69753 holotype China	Helvella sublactea	HKAS 69753, holotype	China	KT894825	KT894832
Helvella subspadicea HKAS 90624 China	Helvella subspadicea	HKAS 90624	China	KU739797	KU739822
Helvella subspadicea HKAS 56656 holotype China	Helvella subspadicea	HKAS 56656, holotype	China	JX462574	NG_059663
Helvella subtinta BJTC FM1307 China	Helvella subtinta	BJTC FM1307	China	OR355130	OR355301
Helvella subtinta HKAS 104666 holotype China	Helvella subtinta	HKAS 104666, holotype	China	MN449991	MN449992
Helvella sulcatoides BJTC FM1416 holotype China	Helvella sulcatoides	BJTC FM1416, holotype	China	OR355119	OR355290
Helvella sulcatoides BJTC FM263 China	Helvella sulcatoides	BJTC FM263	China	OR355120	OR355291
Helvella sulcatoides BJTC ZH1231 China	Helvella sulcatoides	BJTC ZH1231	China	OR355121	OR355292
Helvella taiyuanensis BJTC FM192 China	Helvella taiyuanensis	BJTC FM192	China	OR355167	OR355338
Helvella taiyuanensis BJTC FM861 China	Helvella taiyuanensis	BJTC FM861	China	OR355168	OR355339
Helvella taiyuanensis HMAS 277500 China	Helvella taiyuanensis	HMAS 277500	China	MK592152	MK592105
Helvella terricola HMAS 38355 China	Helvella terricola	HMAS 38355	China	OQ600354	——
Helvella tianshanensis BJTC FM175 China	Helvella tianshanensis	BJTC FM175	China	OR355125	OR355296
Helvella tianshanensis HSA 179 China	Helvella tianshanensis	HSA 179	China	OR355126	OR355297
Helvella tianshanensis HSA 185 China	Helvella tianshanensis	HSA 185	China	OR355127	OR355298
Helvella tianshanensis HMAS 86040 holotype China	Helvella tianshanensis	HMAS 86040, holotype	China	MK592157	MK592108
Helvella tinta HKAS 82560 holotype China	Helvella tinta	HKAS 82560, holotype	China	KX239842	KX239772
Helvella varia HMAS 270932 holotype China	Helvella varia	HMAS 270932, holotype	China	OQ600357	OQ586737
Helvella varia HMAS 290929 China	Helvella varia	HMAS 290929	China	OQ600359	OQ586738
Helvella sp. HKAS 78919 China	Helvella varia	HKAS 78919	China	KX239818	KX239781
Helvella sp. HKAS 78918 China	Helvella varia	HKAS 78918	China	KX239817	KX239780
Helvella sp. HKAS 90554 China	Helvella varia	HKAS 90554	China	KX239821	KX239784
Helvella vulgata BJTC FM2621 China	Helvella vulgata	BJTC FM2621	China	OR355116	OR355286
Helvella xiaohuipan BJTC FM367 China	Helvella xiaohuipan	BJTC FM367	China	OR355078	OR355248
Helvella xiaohuipan BJTC FM2317 holotype China	Helvella xiaohuipan	BJTC FM2317, holotype	China	OR355079	OR355249
Helvella yunnanensis HMAS 290933 holotype China	Helvella yunnanensis	HMAS 290933, holotype	China	OQ600366	OQ586744
Helvella yunnanensis HMAS 290934 China	Helvella yunnanensis	HMAS 290934	China	OQ600367	OQ586745
Helvella zhongtiaoensis HKAS 74343 China	Helvella zhongtiaoensis	HKAS 74343	China	JX462583	KR493489
Helvella zhongtiaoensis HKAS 74335 China	Helvella zhongtiaoensis	HKAS 74335	China	JX462578	KR493484
Helvella zhongtiaoensis HKAS 74339 China	Helvella zhongtiaoensis	HKAS 74339	China	JX462582	KR493488

Table S3.

Specimens used in Acetabulum clade ITS phylogenetic analysis and their GenBank accession numbers. Newly generated

Taxa Name in Analysis	Taxon name	Voucher specimen	Country	ITS GenBank
Dissingia oblongispora HSA 137 China	Dissingia oblongispora	HSA 137	China	OR355181
Dissingia oblongispora HSA 169 China	Dissingia oblongispora	HSA 169	China	OR355182
Helvella acetabuloides CFSZ2044 holotype China	Helvella acetabuloides	CFSZ2044, holotype	China	OR355015
Helvella acetabuloides BJTC FM1264 China	Helvella acetabuloides	BJTC FM1264	China	OR355166
Helvella acetabulum HMAS 23839 China	Helvella acetabulum	HMAS 23839	China	MK592112
Helvella acetabulum HMAS 75176 Chin	Helvella acetabulum	HMAS 75176	China	MK592117
Helvella acetabulum HMAS 7046 Czech	Helvella acetabulum	HMAS 7046	Czech	MK592116
Helvella acetabulum HMAS 23841 China	Helvella acetabulum	HMAS 23841	China	MK592113
uncultured ectomycorrhiza 2 Italy	Helvella acetabulum	2	Italy	AJ879678
Helvella acetabulum HMAS 38129 China	Helvella acetabulum	HMAS 38129	China	MK592115
Helvella acetabulum HMAS 243823 UK	Helvella acetabulum	HMAS 243823	UK	MK592114
Helvella sichuanensis 10706 holotype China	Helvella sichuanensis	10706, holotype	China	OR355014
Helvella solitaria BJTC FM417 China	Helvella solitaria	BJTC FM417	China	OR355131
Helvella solitaria HMAS 41140 China	Helvella solitaria	HMAS 41140	China	MK592148
Helvella ulvinenii HKAS 87723 China	Helvella solitaria	HKAS 87723	China	KU739866
uncultured Helvella	Helvella solitaria	——	China	OW846376
Helvella solitaria HMAS 27727 China	Helvella solitaria	HMAS 27727	China	MK592147
Helvella sp. OTU 533s	Helvella solitaria	OTU 533s	——	MT095652
Helvella sp. OTU 19	Helvella solitaria	OTU 19	——	MK959127
Helvella solitaria HMAS 75175 China	Helvella solitaria	HMAS 75175	China	MK592150
Helvella solitaria HMAS 73509 China	Helvella solitaria	HMAS 73509	China	MK592149
Helvella acetabulum N01 Iran	Helvella sp. 1	N01	Iran	MK088073
Helvella acetabulum N11 Iran	Helvella sp. 1	N11	Iran	MK088072
Helvella sp. OTU 535s	Helvella sp. 2	OTU 535s	——	MT095654
Helvella taiyuanensis BJTC FM192 China	Helvella taiyuanensis	BJTC FM192	China	OR355167
Helvella taiyuanensis BJTC FM861 China	Helvella taiyuanensis	BJTC FM861	China	OR355168
Helvella taiyuanensis MCCNNU6499 China	Helvella taiyuanensis	MCCNNU6499	China	MK592154
Helvella taiyuanensis HMAS 85689 neotype China	Helvella taiyuanensis	HMAS 85689, neotype	China	MK592153
Helvella taiyuanensis HMAS 277500 China	Helvella taiyuanensis	HMAS 277500	China	MK592152
Helvella taiyuanensis 119250 China	Helvella taiyuanensis	119250	China	MK592151

Table S4.

Specimens used in Crispa clade ITS phylogenetic analysis and their GenBank accession numbers. Newly generated sequences are in bold.

Taxon name in analyses	Taxon name	Voucher specimen	Country	ITS GenBank
Dissingia oblongispora	Dissingia oblongispora	HSA 137	China	OR355181
Dissingia oblongispora	Dissingia oblongispora	HSA 169	China	OR355182
Helvella cremeoinvoluta BJTC FM941-A holotype China	Helvella cremeoinvoluta	BJTC FM941-A, holotype	China	OR355153
Helvella cremeoinvoluta BJTC FM941-B China	Helvella cremeoinvoluta	BJTC FM941-B	China	OR355154
Helvella cf. crispa HKAS 69968 China	Helvella crispoides	HKAS 69968	China	KR493474
Helvella crispoides HKAS 90585 China	Helvella crispoides	HKAS 90585	China	KX507002
Helvella crispoides HKAS 90583 China	Helvella crispoides	HKAS 90583	China	KX507001
Helvella crispoides HKAS 90535 holotype China	Helvella crispoides	HKAS 90535, holotype	China	KU739803
Helvella involuta HKAS 78906 China	Helvella involuta	HKAS 78906	China	KU739877
Helvella involuta HKAS 78920 China	Helvella involuta	HKAS 78920	China	KU739878
Helvella reflexa HKAS 69818 China	Helvella involuta	HKAS6 69818	China	JX462591
Helvella reflexa HKAS 69819 China	Helvella involuta	HKAS6 69819	China	JX462590
Helvella involuta HKAS 78992 China	Helvella involuta	HKAS 78992	China	KU739883
uncultured Helvella M11300 China	Helvella involuta	M11300	China	KR493441
Helvella reflexa HKAS 69723 China	Helvella involuta	HKAS 69723	China	JX462587
Helvella involuta FA372 Pakistan	Helvella involuta	FA372	Pakistan	MW447509
Helvella involuta HKAS 78781 China	Helvella involuta	HKAS 78781	China	KU739884
Helvella involuta HKAS 87833 China	Helvella involuta	HKAS 87833	China	KU739888
Helvella involuta HKAS 87786 China	Helvella involuta	HKAS 87786	China	KU739885
Helvella involuta HKAS 90223 China	Helvella involuta	HKAS 90223	China	KU739887
Helvella involuta HKAS 78929 China	Helvella involuta	HKAS 78929	China	KU739879
Helvella involuta HKAS 78986 China	Helvella involuta	HKAS 78986	China	KU739882
Helvella involuta HKAS 78933 China	Helvella involuta	HKAS 78933	China	KU739880
Helvella involuta HKAS 78982 China	Helvella involuta	HKAS 78982	China	KU739881
Helvella sp. HKAS 90584 China	Helvella involuta	HKAS 90584	China	KX506998
Helvella involuta HKAS 90220 China	Helvella involuta	HKAS 90220	China	KU739886
Helvella reflexa HKAS 69938 China	Helvella involuta	HKAS 69938	China	JX462588
Helvella involuta HKAS 88101 China	Helvella involuta	HKAS 88101	China	KU739889
Helvella involuta HKAS 74281 holotype China	Helvella involuta	HKAS 74281, holotype	China	KT215608
Helvella involuta HKAS 69966 China	Helvella involuta	HKAS 69966	China	JX462589
Helvella involuta BJTC FM2940 China	Helvella involuta	BJTC FM2940	China	OR355157
Helvella maculatoides HKAS 90592 China	Helvella maculatoides	HKAS 90592	China	KU739860
Helvella maculatoides HKAS 87827 China	Helvella maculatoides	HKAS 87827	China	KU739859
Helvella maculatoides HKAS 80058 China	Helvella maculatoides	HKAS 80058	China	KX507003
uncultured Helvella China	Helvella maculatoides		China	OW846951
Helvella maculatoides HKAS 90590 holotype China	Helvella maculatoides	HKAS 90590, holotype	China	KU739858
Helvella maculatoides HKAS 80057 China	Helvella maculatoides	HKAS 80057	China	KU739861
Helvella sp. OTU 532s	Helvella maculatoides	OTU 532s	——	MT095651
uncultured Helvella M11302 China	Helvella orienticrispa	M11302	China	KR493443
Helvella orienticrispa HKAS 78907 China	Helvella orienticrispa	HKAS 78907	China	KU739892
uncultured fungus BJ-270 China	Helvella orienticrispa	BJ-270	China	LC623028
Helvella orienticrispa HKAS 75440 China	Helvella orienticrispa	HKAS 75440	China	KR493472
Helvella orienticrispa HKAS 54998 China	Helvella orienticrispa	HKAS 54998	China	JX462596
Helvella orienticrispa HKAS 90362 China	Helvella orienticrispa	HKAS 90362	China	KU739890
Helvella crispa ZQ8164 China	Helvella orienticrispa	ZQ8164	China	FJ859345
Helvella orienticrispa HKAS 74319 holotype China	Helvella orienticrispa	HKAS 74319, holotype	China	JX462598
Helvella orienticrispa HKAS 75435 China	Helvella orienticrispa	HKAS 75435	China	KR493471
Helvella orienticrispa HKAS 75439 China	Helvella orienticrispa	HKAS 75439	China	JX462597
Helvella orienticrispa BJTC FM2481 China	Helvella orienticrispa	BJTC FM2481	China	OR355164
Helvella orienticrispa BJTC SBP126 China	Helvella orienticrispa	BJTC SBP126	China	OR355161
Helvella orienticrispa BJTC C578 China	Helvella orienticrispa	BJTC C578	China	OR355159
Helvella orienticrispa BJTC ZH744 China	Helvella orienticrispa	BJTC ZH744	China	OR355162
Helvella orienticrispa BJTC FM418 China	Helvella orienticrispa	BJTC FM418	China	OR355160
Helvella orienticrispa BJTC BP066 China	Helvella orienticrispa	BJTC BP066	China	OR355158
Helvella orienticrispa BJTC FM2482 China	Helvella orienticrispa	BJTC FM2482	China	OR355165
Helvella orienticrispa BJTC FM2480 China	Helvella orienticrispa	BJTC FM2480	China	OR355163
Helvella orienticrispa BJTC ZH1364 China	Helvella orienticrispa	BJTC ZH1364	China	OR355178
Uncultured Helvella M11303	Helvella pseudoreflexa	M11303	——	KR493444
Helvella pseudoreflexa HKAS 88100 China	Helvella pseudoreflexa	HKAS 88100	China	KU739893
Helvella pseudoreflexa HKAS 58050 China	Helvella pseudoreflexa	HKAS 58050	China	JX462594
Uncultured fungus SX-439 China	Helvella pseudoreflexa	SX-439	China	LC622906
Uncultured Helvella NXHLS549b China	Helvella pseudoreflexa	NXHLS549b	China	KX510012
Helvella sp. HMJAU 7549 China	Helvella pseudoreflexa	HMJAU 7549	China	KR493468
Helvella sp. HMJAU 20049 China	Helvella pseudoreflexa	HMJAU 20049	China	KR493469
Helvella pseudoreflexa HMJAU 20733 China	Helvella pseudoreflexa	HMJAU 20733	China	KU739894
Helvella pseudoreflexa HKAS 90606 China	Helvella pseudoreflexa	HKAS 90606	China	KU739896
Helvella pseudoreflexa HKAS 74311 holotype China	Helvella pseudoreflexa	HKAS 74311, holotype	China	JX462593
Helvella pseudoreflexa HKAS 75438 China	Helvella pseudoreflexa	HKAS 75438	China	JX462595
Helvella pseudoreflexa HKAS 69751 China	Helvella pseudoreflexa	HKAS 69751	China	JX462592
Helvella pseudoreflexa HSA 404 China	Helvella pseudoreflexa	HSA 404	China	OR355148
Helvella pseudoreflexa HSA 364 China	Helvella pseudoreflexa	HSA 364	China	OR355147
Helvella pseudoreflexa BJTC FM270 China	Helvella pseudoreflexa	BJTC FM270	China	OR355140
Helvella pseudoreflexa BJTC FM271 China	Helvella pseudoreflexa	BJTC FM271	China	OR355141
Helvella pseudoreflexa BJTC C549 China	Helvella pseudoreflexa	BJTC C549	China	OR355137
Helvella pseudoreflexa BJTC FM1019 China	Helvella pseudoreflexa	BJTC FM1019	China	OR355138
Helvella pseudoreflexa BJTC BP228 China	Helvella pseudoreflexa	BJTC BP228	China	OR355135
Helvella pseudoreflexa BJTC FM284 China	Helvella pseudoreflexa	BJTC FM284	China	OR355142
Helvella pseudoreflexa BJTC FM2490 China	Helvella pseudoreflexa	BJTC FM2490	China	OR355152
Helvella pseudoreflexa BJTC ZH1269 China	Helvella pseudoreflexa	BJTC ZH1269	China	OR355150
Helvella pseudoreflexa HSA 332 China	Helvella pseudoreflexa	HSA 332	China	OR355146
Helvella pseudoreflexa BJTC FM1409 China	Helvella pseudoreflexa	BJTC FM1409	China	OR355139
Helvella pseudoreflexa HSA 313 China	Helvella pseudoreflexa	HSA 313	China	OR355145
Helvella pseudoreflexa BJTC ZH1229 China	Helvella pseudoreflexa	BJTC ZH1229	China	OR355149
Helvella pseudoreflexa BJTC L489 China	Helvella pseudoreflexa	BJTC L489	China	OR355143
Helvella pseudoreflexa BJTC ZH1303 China	Helvella pseudoreflexa	BJTC ZH1303	China	OR355151
Helvella pseudoreflexa BJTC BP163 China	Helvella pseudoreflexa	BJTC BP163	China	OR355134
Helvella pseudoreflexa BJTC BP760 China	Helvella pseudoreflexa	BJTC BP760	China	OR355136
Helvella pseudoreflexa HSA 225 China	Helvella pseudoreflexa	HSA 225	China	OR355144
Helvella sinocrispa BJTC FM96-A holotype China	Helvella sinocrispa	BJTC FM96-A, holotype	China	OR355155
Helvella sinocrispa BJTC FM96-B China	Helvella sinocrispa	BJTC FM96-B	China	OR355156
Helvella orienticrispa OTU 531s	Helvella sinocrispa	OTU 531s	——	MT095650
Helvella cf. crispa HKAS 80056 China	Helvella sinocrispa	HKAS 80056	China	KU739898
Helvella cf. crispa HKAS 90591 China	Helvella sinocrispa	HKAS 90591	China	KU739897
Helvella crispa DBG:F-029853 USA	Helvella sinocrispa	DBG:F-029853	USA	OP178203
Fungal sp. ARIZPM082D USA	Helvella sp. 3	ARIZ:PM082D	USA	MG761293
Fungal sp. ARIZPM082E USA	Helvella sp. 3	ARIZ:PM082E	USA	MG761294
Helvella sp. S.D. Russell MycoMap 7717 USA	Helvella sp. 4	S.D. Russell MycoMap 7717	USA	MK532852
Uncultured Helvella	Helvella sp. 5	M11305	China	KR493446
Helvella sp. HKAS 54995 China	Helvella sp. 5	HKAS 54995	China	KR493473
Helvella crispa ZQ8292	Helvella sp. 5	ZQ8292	——	FJ859344
Helvella crispa HKAS 84894 Germany	Helvella sp. 6	HKAS 84894	Germany	KU739871
Helvella crispa HKAS 75434 Germany	Helvella sp. 6	HKAS 75434	Germany	JX462572
Uncultured Helvella LMBC21b-10 France	Helvella sp. 7	LMBC21b-10	France	JF506760
Uncultured Helvella clone M11304 China	Helvella zhongtiaoensis	clone M11304	China	KR493445
Helvella zhongtiaoensis HKAS 74343 China	Helvella zhongtiaoensis	HKAS 74343	China	JX462583
Helvella zhongtiaoensis HKAS 74335 China	Helvella zhongtiaoensis	HKAS 74335	China	JX462578
Helvella zhongtiaoensis HKAS 74339 China	Helvella zhongtiaoensis	HKAS 74339	China	JX462582
Uncultured Helvella clone M11306	Helvella zhongtiaoensis	clone M11306	——	KR493447
Helvella zhongtiaoensis HKAS 78932 China	Helvella zhongtiaoensis	HKAS 78932	China	KU739873
Helvella zhongtiaoensis HKAS 74320 China	Helvella zhongtiaoensis	HKAS 74320	China	JX462577
Helvella zhongtiaoensis HMJAU 5983 China	Helvella zhongtiaoensis	HMJAU 5983	China	KR493466
Helvella zhongtiaoensis HKAS 82414 Chin	Helvella zhongtiaoensis	HKAS 82414	China	KU739872
Helvella zhongtiaoensis HKAS 75436 China	Helvella zhongtiaoensis	HKAS 75436	China	JX462585
Helvella zhongtiaoensis HKAS 75437 China	Helvella zhongtiaoensis	HKAS 75437	China	JX462586
Helvella zhongtiaoensis HKAS 87832 China	Helvella zhongtiaoensis	HKAS 87832	China	KU739876
Helvella zhongtiaoensis HKAS 75441 China	Helvella zhongtiaoensis	HKAS 75441	China	JX462584
uncultured fungus hozan2022-336PREMIX-NC2-2-1-TDCHIkuro336 Japan	Helvella zhongtiaoensis	hozan2022_336-PREMIX_NC2_2_1_TDCHIkuro336	Japan	LC711401
Helvella zhongtiaoensis 11299 China	Helvella zhongtiaoensis	11299	China	MG847000
Helvella zhongtiaoensis HKAS 78987 China	Helvella zhongtiaoensis	HKAS 78987	China	KU739874
uncultured fungus 745_CC1_M10_1_sucha Japan	Helvella zhongtiaoensis	745_CC1_M10_1_sucha	Japan	LC711402
Helvella zhongtiaoensis HKAS87828 China	Helvella zhongtiaoensis	HKAS 87828	China	KU739875
Helvella crispa HMJAU 37502 China	Helvella zhongtiaoensis	HMJAU 37502	China	OL678122
Helvella zhongtiaoensis HKAS 74338 China	Helvella zhongtiaoensis	HKAS 74338	China	JX462581
Helvella zhongtiaoensis HKAS 74337 China	Helvella zhongtiaoensis	HKAS 74337	China	JX462580
Helvella zhongtiaoensis HKAS 74336 China	Helvella zhongtiaoensis	HKAS 74336	China	JX462579
Helvella zhongtiaoensis UnivM10 Iraq	Helvella zhongtiaoensis	Univ.M10	Iraq	ON256165

Table S5.

Specimens used in Elastica clade ITS phylogenetic analysis and their GenBank accession numbers. Newly generated sequences are in bold.

Taxa Name in Analysis	Taxon name	Voucher specimen	Country	ITS GenBank
Dissingia oblongispora HSA 137 China	Dissingia oblongispora	HSA 137	China	OR355181
Dissingia oblongispora HSA 169 China	Dissingia oblongispora	HSA 169	China	OR355182
Helvella albopatella BJTC FM2610-A holotype China	Helvella albopatella	BJTC FM2610-A, holotype	China	OR355082
Uncultured Pezizales LP110032 China	Helvella albopatella	LP110032	China	JQ318620
Uncultured Pezizales LP110049 China	Helvella albopatella	LP110049	China	JQ318637
Uncultured Pezizales Q-L-OTU137 China	Helvella albopatella	Q-L-OTU137	China	KY684495
Helvella elastica 420526MF0358 China	Helvella albopatella	420526MF0358	China	MH142031
Helvella albopatella BJTC FM2610-B China	Helvella albopatella	BJTC FM2610-B	China	OR355176
Helvella alborava BJTC C316-B China	Helvella alborava	BJTC C316-B	China	OR355106
Helvella alborava BJTC C316-A holotype China	Helvella alborava	BJTC C316-A, holotype	China	OR355173
Uncultured Helvella XT12876 China	Helvella alborava	XT12876	China	MF405781
Uncultured fungus DLS1356 China	Helvella alborava	DLS1356	China	KX444422
Helvella sp. HKAS 90550 Thailand	Helvella atroides	HKAS 90550	Thailand	KU739813
Helvella sp. HKAS 90546 Thailand	Helvella atroides	HKAS 90546	Thailand	KU739812
Helvella sp. HKAS 69065 China	Helvella atroides	HKAS 69065	China	KX507000
Helvella bachu BJTC FM382 China	Helvella bachu	BJTC FM382	China	OR355062
Helvella bachu HKAS 88106 China	Helvella bachu	HKAS 88106	China	KU739792
Helvella bachu HKAS 88105 holotype China	Helvella bachu	HKAS 88105, holotype	China	KU739791
Helvella leucopus RaShTa-IRAQ-10 Iraq	Helvella bachu	RaShTa-IRAQ-10	Iraq	ON667918
Helvella leucopus Kashi1 China	Helvella bachu	Kashi1	China	KC137337
Helvella bachu HKAS 90620 China	Helvella bachu	HKAS 90620	China	KU739795
Helvella bachu HKAS 90618 China	Helvella bachu	HKAS 90618	China	KU739793
Helvella bachu HKAS 90619 China	Helvella bachu	HKAS 90619	China	KU739794
Helvella bicolor O-255759 Norway Nordland	Helvella bicolor	O-255759	Norway: Nordland	MN656168
Helvella albella H05081501 Italy	Helvella bicolor	H05081501	Italy	JX462568
Helvella brunneogaleriformis BJTC FM272 China	Helvella brunneogaleriformis	BJTC FM272	China	OR355064
Helvella brunneogaleriformis BJTC FM269 China	Helvella brunneogaleriformis	BJTC FM269	China	OR355063
Helvella brunneogaleriformis BJTC FM911 holotype China	Helvella brunneogaleriformis	BJTC FM911, holotype	China	OR355065
Helvella caespitosa HSA 379-A holotype China	Helvella caespitosa	HSA 379-A, holotype	China	OR355091
Helvella caespitosa HSA 379-B China	Helvella caespitosa	HSA 379-B	China	OR355092
Uncultured fungus NX3-129 China	Helvella caespitosa	NX3-129	China	LC623411
Uncultured fungus NX1-4330 China	Helvella caespitosa	NX1-4330	China	LC622748
Uncultured Helvella NXHLS248 China	Helvella caespitosa	NXHLS248	China	KX510014
Helvella capucinoides BJTC FM1094 China	Helvella capucinoides	BJTC FM1094	China	OR355037
Helvella capucinoides BJTC FM909 China	Helvella capucinoides	BJTC FM909	China	OR355042
Helvella capucinoides HMJAU 33777 China	Helvella capucinoides	HMJAU 33777	China	OR355043
Helvella capucinoides BJTC FM1156 China	Helvella capucinoides	BJTC FM1156	China	OR355038
Helvella capucinoides BJTC FM884 China	Helvella capucinoides	BJTC FM884	China	OR355041
Helvella capucinoides BJTC FM1423 China	Helvella capucinoides	BJTC FM1423	China	OR355039
Helvella capucinoides BJTC FM242 China	Helvella capucinoides	BJTC FM242	China	OR355040
Uncultured fungus hozan2022_621-PREMIX_NC3_9_1_TDsu621 Japan	Helvella capucinoides	hozan2022_621-PREMIX_NC3_9_1_TDsu621	Japan	LC711404
Helvella compressa UBC: F21000 Canada	Helvella capucinoides	UBC: F21000	Canada	MZ970429
Fungal sp. H12B4 USA	Helvella capucinoides	H12B4	USA	MZ017386
Helvella elastica HB451 China	Helvella capucinoides	HB451	China	MH366774
Helvella capucinoides BJTC FM923 China	Helvella capucinoides	BJTC FM923	China	OR355169
Helvella carnosa BJTC FM2478 China	Helvella carnosa	BJTC FM2478	China	OR355032
Helvella carnosa BJTC FM274 China	Helvella carnosa	BJTC FM274	China	OR355022
Helvella carnosa BJTC FM316 China	Helvella carnosa	BJTC FM316	China	OR355025
Helvella carnosa BJTC FM1032 China	Helvella carnosa	BJTC FM1032	China	OR355021
Helvella carnosa BJTC FM298 China	Helvella carnosa	BJTC FM298	China	OR355024
Helvella carnosa BJTC FM297 China	Helvella carnosa	BJTC FM297	China	OR355023
Helvella carnosa BJTC FM2479 China	Helvella carnosa	BJTC FM2479	China	OR355033
Helvella carnosa BJTC FM376 China	Helvella carnosa	BJTC FM376	China	OR355026
Helvella carnosa BJTC BP043 China	Helvella carnosa	BJTC BP043	China	OR355017
Helvella carnosa HSA 343 China	Helvella carnosa	HSA 434	China	OR355029
Helvella carnosa BJTC FM2499 China	Helvella carnosa	BJTC FM2499	China	OR355034
Helvella carnosa BJTC FM2619 China	Helvella carnosa	BJTC FM2619	China	OR355031
Helvella carnosa BJTC BP724 China	Helvella carnosa	BJTC BP724	China	OR355020
Helvella carnosa BJTC BP718 China	Helvella carnosa	BJTC BP718	China	OR355019
Helvella carnosa BJTC SBP287 China	Helvella carnosa	BJTC SBP287	China	OR355030
Helvella carnosa BJTC BP030 China	Helvella carnosa	BJTC BP030	China	OR355016
Helvella carnosa HSA 360 China	Helvella carnosa	HSA 360	China	OR355028
Helvella carnosa BJTC FM2494 China	Helvella carnosa	BJTC FM953	China	OR355027
Helvella carnosa BJTC FM2495 China	Helvella carnosa	BJTC BP060	China	OR355018
Uncultured fungus QH-207 China	Helvella carnosa	QH-207	China	LC623523
Uncultured fungus QH-203 China	Helvella carnosa	QH-203	China	LC623521
Uncultured fungus QH-183 China	Helvella carnosa	QH-183	China	LC623515
Uncultured fungus QH-118 China	Helvella carnosa	QH-118	China	LC623498
Uncultured fungus QH-115 China	Helvella carnosa	QH-115	China	LC623497
Uncultured fungus NX3-295 China	Helvella carnosa	NX3-295	China	LC623459
Uncultured fungus SN3-173 China	Helvella carnosa	SN3-173	China	LC623299
Uncultured fungus QH-195 China	Helvella carnosa	QH-195	China	LC623520
Uncultured fungus SX-442 China	Helvella carnosa	SX-442	China	LC622907
Uncultured fungus SX-151 China	Helvella carnosa	SX-151	China	LC622839
Helvella albella ZQ822	Helvella carnosa	ZQ822	——	FJ859342
Uncultured Helvella NXHLS309a China	Helvella carnosa	NXHLS309a	China	KX510011
Uncultured fungus AG_K_106 Poland	Helvella carnosa	AG_K_106	Poland	ON417272
Helvella capucina H090918031 Italy	Helvella cf. capucina	H090918031	Italy	JX462564
Helvella capucina OTU 095r root tip	Helvella cf. capucina	OTU095r_root tip	——	MT095215
Helvella compressa UBC: F27885 Canada	Helvella compressa	UBC: F27885	Canada	MZ970434
Helvella compressa UBC: F32721 Canada	Helvella compressa	UBC: F32721	Canada	MZ970439
Helvella compressa UBC: F25915 Canada	Helvella compressa	UBC: F25915	Canada	MZ970431
Helvella compressa UBC: F24339 Canada	Helvella compressa	UBC: F24339	Canada	MZ970430
Helvella compressa UBC: F28817 Canada	Helvella compressa	UBC: F28817	Canada	MZ970435
Helvella compressa UBC: F29255 Canada	Helvella compressa	UBC: F29255	Canada	MZ970437
Helvella compressa UBC: F28820 Canada	Helvella compressa	UBC: F28820	Canada	MZ970436
Helvella sp. JLF3283 USA	Helvella compressa	JLF3283	USA	MH363719
Helvella convexa H761 Sweden	Helvella convexa	H761, holotype	Sweden	OQ641537
Helvella latispora H07090608 Italy	Helvella corbierei	H07090608	Italy	JX462562
Helvella corbierei HSA 138 China	Helvella corbierei	HSA 138	China	OR355071
Helvella corbierei HSA 181 China	Helvella corbierei	HSA 181	China	OR355072
Helvella danica BJTC BP428 China	Helvella danica	BJTC BP428	China	OR355045
Helvella danica BJTC SBP022 China	Helvella danica	BJTC SBP022	China	OR355048
Helvella danica BJTC FM1053 China	Helvella danica	BJTC FM1053	China	OR355052
Helvella danica BJTC ZH370 China	Helvella danica	BJTC ZH370	China	OR355050
Helvella danica BJTC ZH1249 China	Helvella danica	BJTC ZH1249	China	OR355049
Helvella danica BJTC BP398 China	Helvella danica	BJTC BP398	China	OR355044
Helvella danica BJTC ZH883 China	Helvella danica	BJTC ZH883	China	OR355051
Helvella danica BJTC L235 China	Helvella danica	BJTC L235	China	OR355047
Helvella danica BJTC BP649 China	Helvella danica	BJTC BP649	China	OR355046
Helvella danica BJTC BP544 China	Helvella danica	BJTC BP544	China	OR355054
Helvella danica BJTC ZH1122 China	Helvella danica	BJTC ZH1122	China	OR355053
Helvella danica BJTC ZH1190 China	Helvella danica	BJTC ZH1190	China	OR355056
Helvella danica BJTC FM2577 China	Helvella danica	BJTC FM2577	China	OR355058
Helvella danica BJTC BP255 China	Helvella danica	BJTC BP255	China	OR355057
Helvella danica BJTC ZH522 China	Helvella danica	BJTC ZH522	China	OR355055
Helvella elastica HBAU 15710	Helvella danica	HBAU 15710	——	MW862351
Uncultured fungus BJ-26 China	Helvella danica	BJ-26	China	LC622970
Uncultured Helvella LKS1190 China	Helvella danica	LKS1190	China:	KX444353
Uncultured fungus hozan2022_519-PREMIX_NC3_1_KOsu519 Japan	Helvella danica	hozan2022_519-PREMIX_NC3_2_1_KOsu519	Japan	LC711407
Helvella aff. elastica UC 1999287 USA	Helvella danica	UC 1999287	USA	KC147670
Helvella elastica S5 Russia	Helvella danica	S.5	Russia	MG844979
Helvella danica BJTC ZH1360 China	Helvella danica	BJTC ZH1360	China	OR355177
Helvella danica BJTC SBP199 China	Helvella danica	BJTC SBP199	China	OR355171
Helvella deflexa HSA 240-A1 holotype China	Helvella deflexa	HSA 240-A1, holotype	China	OR355069
Helvella deflexa HSA 240-A2 China	Helvella deflexa	HSA 240-A2	China	OR355070
Helvella ephippioides HMJAU 44584 China	Helvella ephippioides	HMJAU 44584	China	OR355107
Helvella sp. HMJAU 20134 China	Helvella ephippioides	HMJAU 20134	China	KX506996
uncultured fungus d1048 PC2_MaTD_4_2_Tdsuhanhan Japan	Helvella ephippioides	d1048_PC2_MaTD_4_2_Tdsuhanhan	Japan	LC711390
uncultured fungus 739_CC1_M9_2_orecha Japan	Helvella ephippioides	739_CC1_M9_2_orecha	Japan	LC711395
Helvella sp. OBASE00146 Japan	Helvella ephippioides	OBASE00146	Japan	LC556122
Helvella macropusY090607 China	Helvella ephippioides	Y090607	China	OL678130
uncultured Helvella szYM1451 Russia	Helvella ephippioides	szYM1451	Russia	LC547536
Helvella sp. OBASE00179	Helvella ephippioides	OBASE00179	——	LC556123
Helvella fistulosa BJTC 1976 China	Helvella fistulosa	BJTC 1976	China	OR355061
Helvella elastica HKAS 88091	Helvella fistulosa	HKAS 88091	——	MG871285
Helvella elastica ZQ8297	Helvella fistulosa	ZQ8297	——	FJ859340
Helvella sp. HKAS 90547 Thailand	Helvella fistulosa	HKAS 90547	Thailand	KU739810
Helvella sp. HKAS 90549 Thailand	Helvella fistulosa	HKAS 90549	Thailand	KU739811
Helvella sp. HKAS 90545 Thailand	Helvella fistulosa	HKAS 90545	Thailand	KU739809
Uncultured fungus NX3-109 China	Helvella flavostipitata	NX3-109	China	LC623405
Helvella albella KH278 Pakistan	Helvella flavostipitata	KH278	Pakistan	MN814023
Helvella albella G802	Helvella flavostipitata	G802	——	FJ859343
Helvella atra ENA22938 Pakistan	Helvella flavostipitata	ENA22938	Pakistan	KF679807
Helvella albella FA364	Helvella flavostipitata	FA364	——	MN747800
Helvella flavostipitata	Helvella flavostipitata	HSA 387-A	China	OR355035
Helvella flavostipitata	Helvella flavostipitata	HSA 387-B	China	OR355036
Helvella galeriformis HSA 240-B China	Helvella galeriformis	HSA 240-B	China	OR355067
Helvella galeriformis HSA 232 epitype China	Helvella galeriformis	HSA 232, epitype	China	OR355066
Helvella galeriformis BJTC FM2574 China	Helvella galeriformis	BJTC FM2574	China	OR355068
Helvella sp. HKAS 68122 China	Helvella guttata	HKAS 68122	China	KX506976
Helvella sp. HKAS 57439 China	Helvella guttata	HKAS 57439	China	KX506975
Helvella sp. HKAS 87759 China	Helvella guttata	HKAS 87759	China	KX506974
Helvella sp. HKAS 69733 China	Helvella guttata	HKAS 69733	China	KX506973
uncultured fungus HKAS 57439_06 China	Helvella guttata	HKAS 57439_06	China	KR493465
uncultured fungus HKAS 57439_05 China	Helvella guttata	HKAS 57439_05	China	KR493464
uncultured fungus HKAS 57439_07 China	Helvella guttata	HKAS 57439_07	China	KR493463
Helvella japonica H093 Japan	Helvella japonica	H093, holotype	Japan	OQ645455
Helvella japonica H2147 Norway	Helvella japonica	H2147	Norway	OQ645454
Uncultured mycorrhizal fungus Iwate3-Helvella Japan	Helvella japonica	Iwate3-Helvella	Japan	AB428791
Helvella aff. ephippium UC 1999252 USA	Helvella japonica	UC 1999252	USA	KC147669
Helvella macropus HKAS 84887 China	Helvella macropus	HKAS 84887	China	KX506989
Helvella macropus HKAS 84891 Austria	Helvella macropus	HKAS 84891	Austria	KX506988
Helvella macropus HKAS 84895 Austria	Helvella macropus	HKAS 84895	Austria	KX506987
Helvella macropus HKAS 84893 Germany	Helvella macropus	HKAS 84893	Germany	KX506986
Helvella macropus TENN 071798 USA North Carolina	Helvella macropus	TENN 071798	USA: North Carolina	MG773834
Helvella macropus TENN 071657 USA Tennessee	Helvella macropus	TENN 071657	USA: Tennessee	MF992152
Helvella macropus OKA 199 Turkey Artvin	Helvella macropus	OKA 199	Turkey: Artvin	MF228806
Helvella macropus HKAS 78756 China	Helvella macropus	HKAS 78756	China	KX506990
Uncultured ectomycorrhiza P11 Denmark	Helvella macropus	P11	Denmark	AJ969435
Helvella macropus RAS214 USA	Helvella macropus	RAS214	USA	MG773828
Uncultured fungus JS160923-58 South Korea	Helvella macropus	JS160923-58	South Korea	MG407675
Uncultured fungus Japan	Helvella macropus	——	Japan	LC711396
Helvella sp. S.D. Russell ONT NAMA2022 USA	Helvella macropus	S.D. Russell ONT NAMA2022	USA	OP743632
Helvella spadicea HKAS 83154 Italy	Helvella monachella	HKAS 83154	Italy	KU739798
Helvella leucopus H09050305 Italy	Helvella monachella	H09050305	Italy	JX462565
Helvella multiformis BJTC FM264 China	Helvella multiformis	BJTC FM264	China	OR355102
Helvella multiformis BJTC FM1131 China	Helvella multiformis	BJTC FM1131	China	OR355101
Helvella multiformis HSA 362 China	Helvella multiformis	HSA 362	China	OR355172
Helvella multiformis BJTC FM2484 China	Helvella multiformis	BJTC FM2484	China	OR355104
Helvella multiformis BJTC FM305 China	Helvella multiformis	BJTC FM305	China	OR355103
Helvella multiformis BJTC FM1130 holotype China	Helvella multiformis	BJTC FM1130, holotype	China	OR355100
Helvella sp. OTU 53	Helvella multiformis	OTU53	——	MK959132
Uncultured fungus SX-381 China	Helvella multiformis	SX-381	China	LC622890
Uncultured fungus NX1-4373 China	Helvella multiformis	NX1-4373	China	LC622756
Helvella sp. 20210169	Helvella multiformis	20210169	——	OP805931
Helvella elastica F164 China	Helvella neofistulosa	F164	China	FJ859341
Uncultured fungus hozan2022_668-PREMIX_NC3_12_1_KOsiro668 Japan	Helvella neofistulosa	hozan2022_668-PREMIX_NC3_12_1_KOsiro668	Japan	LC711405
Helvella neofistulosa BJTC ZH1251 China	Helvella neofistulosa	BJTC ZH1251	China	OR355060
Helvella neofistulosa BJTC ZH1213 holotype China	Helvella neofistulosa	BJTC ZH1213, holotype	China	OR355059
Helvella nordlandica BJTC FM346-A China	Helvella nordlandica	BJTC FM346-A	China	OR355081
Helvella nigrorava BJTC ZH67 holotype China	Helvella nigrorava	BJTC ZH67	China	OR355105
Uncultured Helvella XT12787 China	Helvella nigrorava	XT12787	China	MF405780
Helvella tomentosa HKAS 90543 Thailand	Helvella orentitomentosa	HKAS 90543	Thailand	KU739808
Helvella tomentosa HKAS 90542 Thailand	Helvella orentitomentosa	HKAS 90542	Thailand	KU739807
Helvella sp. HKAS 90531 China	Helvella orentitomentosa	HKAS 90531	China	KX506999
Helvella oroarctica H1983 Norway	Helvella oroarctica	H1983	Norway	MN656177
Helvella pseudoelastica BJTC C351-A China	Helvella pseudoelastica	BJTC C351-A, holotype	China	OR355170
Helvella elastica KA12-1701 South Korea	Helvella pseudoelastica	KA12-1701	South Korea	KR673633
Helvella pseudoelastica BJTC C351-B China	Helvella pseudoelastica	BJTC C351-B	China	OR355174
Helvella pseudofallax BJTC FM1148 China	Helvella pseudofallax	BJTC FM1148	China	OR355085
Helvella pseudofallax HSA 356 holotype China	Helvella pseudofallax	HSA 356, holotype	China	OR355083
Helvella pseudofallax BJTC ZH1283 China	Helvella pseudofallax	BJTC ZH1283	China	OR355084
Helvella pseudopezizoides BJTC FM1045-A holotype China	Helvella pseudopezizoides	BJTC FM1045-A, holotype	China	OR355089
Helvella pseudopezizoides BJTC FM1045-B China	Helvella pseudopezizoides	BJTC FM1045-B	China	OR355090
Uncultured Helvella DLS1758 China	Helvella pseudopezizoides	DLS1758	China	KX444420
Helvella pubescens BJTC FM259 China	Helvella pubescens	BJTC FM259	China	OR355097
Helvella pubescens BJTC FM244 China	Helvella pubescens	BJTC FM244	China	OR355096
Helvella pubescens BJTC C511 China	Helvella pubescens	BJTC C511	China	OR355094
Helvella pubescens BJTC SBP025 China	Helvella pubescens	BJTC SBP025	China	OR355099
Helvella pubescens BJTC FM918 China	Helvella pubescens	BJTC FM918	China	OR355098
Helvella pubescens BJTC BP020 China	Helvella pubescens	BJTC BP020	China	OR355093
Helvella pubescens BJTC FM1167 China	Helvella pubescens	BJTC FM1167	China	OR355095
Helvella sp. LMKR1123 United Kingdom	Helvella pubescens	LMKR1123	United Kingdom	MF352714
Helvella pulla H149 Norway	Helvella pulla	O-69282, H149	Norway	MN656161
Helvella sp. OTU199	Helvella pulla	OTU199	——	MK959129
Uncultured Pezizales OTU449 Belgium	Helvella pulla	OTU449	Belgium	KU587035
Helvella rivularis O-255764 Norway	Helvella rivularis	O-255764	Norway	MN656175
Helvella sp. OTU 540s	Helvella rivularis	OTU540s	——	MT095659
Helvella scyphoides HSA 166 China	Helvella scyphoides	HSA 166	China	OR355075
Helvella scyphoides HSA 239 China	Helvella scyphoides	HSA 239	China	OR355076
Helvella scyphoides HSA 336 China	Helvella scyphoides	HSA 336	China	OR355077
Helvella scyphoides BJTC FM899 China	Helvella scyphoides	BJTC FM899	China	OR355074
Helvella scyphoides BJTC FM1158 China	Helvella scyphoides	BJTC FM1158	China	OR355073
Helvella pezizoides HKAS 90006	Helvella scyphoides	HKAS 90006	——	MG871299
Helvella sp. 1 SE-2015 USA	Helvella sp. 8	1 SE-2015	USA	KT275607
Helvella elastica HKAS 83158 Italy	Helvella sp. 9	HKAS 83158	Italy	KU739800
Helvella elastica HKAS 83157 Italy	Helvella sp. 9	HKAS 83157	Italy	KU739799
Uncultured Helvella 14059 Spain	Helvella sp. 9	14059	Spain	MW282724
Uncultured fungus PR_E08 Switzerland	Helvella sp. 9	PR_E08	Switzerland	KX886014
Helvella elastica H06092701 Italy	Helvella sp. 9	H06092701	Italy	JX462566
Helvella sp. KA12-1302 South Korea	Helvella sp. 10	KA12-1302	South Korea	KR673535
Helvella sp. Japan	Helvella sp. 11	——	Japan: Aomori Pref	LC098743
Helvella elastica TNS:F91339 Japan	Helvella sp. 11	TNS:F91339	Japan	LC619227
uncultured fungus Japan	Helvella sp. 11	——	Japan	LC711398
Helvella elastica HC-PNNT-255 Mexico	Helvella sp. 12	HC-PNNT-255	Mexico: Mexico State	KT875009
Helvella elastica F14055,UBC	Helvella sp. 12	F14055, UBC	——	AF335455
Helvella elastica PA7 Latvia	Helvella sp. 12	PA7	Latvia	KR019787
Helvella compressa UBC: F26571 USA	Helvella sp. 12	UBC: F26571	USA	MZ970432
Fungal sp. C32A6 USA	Helvella sp. 12	C32A6	USA	MZ017173
Fungal sp. C32A3 USA	Helvella sp. 12	C32A3	USA	MZ017172
Helvella sp. ZQ8220	Helvella sp. 13	ZQ8220	——	FJ859337
Helvella sp. ZQ7219	Helvella sp. 13	ZQ7219	——	FJ859336
Helvella sp. ZQ8242	Helvella sp. 13	ZQ8242	——	FJ859335
Helvella sp. T680	Helvella sp. 13	T680	——	FJ859338
Helvella atra G869	Helvella sp. 14	G869	——	FJ859339
Helvella cf. compressa HKAS 49364 China	Helvella sp. 14	HKAS 49364	China	JX462569
Helvella compressa HKAS 45788 China	Helvella sp. 15	HKAS 45788	China	KU739801
Helvella sp. OTU543s	Helvella sp. 16	OTU 543s	——	MT095662
Helvella sp. iNAT:15188138 USA	Helvella sp. 17	iNAT: 15188138	USA	MZ171124
Helvella sp. FLAS-F-68382 USA	Helvella sp. 17	FLAS-F-68382	USA	OM672754
Fungal sp. H22A1 USA	Helvella sp. 17	H22A1	USA	MZ017397
Helvella sp. HKAS 54996 China	Helvella sp. 18	HKAS 54996	China	KX506992
Helvella sp. HKAS 74023 China	Helvella sp. 18	HKAS 74023	China	KX506991
Helvella sp. ZQ8296	Helvella sp. 18	ZQ8296	——	FJ859346
Uncultured Helvella XT13139 China	Helvella sp. 18	XT13139	China	MF405783
Helvella sp. FLAS-F-63899 USA	Helvella sp. 19	FLAS-F-63899	USA	MN653036
Uncultured fungus BJ-397 China	Helvella sp. 20	BJ-397	China	LC623053
Uncultured Helvella P15E4_P16E3 USA	Helvella sp. 21	P15E4_P16E3	USA	KU238898
Helvella sp. MES2176 USA	Helvella sp. 21	MES2176	USA	MN653019
Helvella sp. FLAS-F-59998 USA	Helvella sp. 21	FLAS-F-59998	USA	KY654713
Helvella sp. FLAS-F-63281 RH1703 USA MN	Helvella sp. 22	FLAS-F-63281 RH1703	USA: MN	MT373915
Helvella sp. RH20140725 USA	Helvella sp. 22	RH20140725	USA: MA	MT373910
Helvella sp. HKAS 87784 China	Helvella sp. 23	HKAS 87784	China	KX506957
Helvella sp. HKAS 87783 China	Helvella sp. 23	HKAS 87783	China	KX506956
Helvella sp. HKAS 90567 China	Helvella sp. 23	HKAS 90567	China	KX506961
Helvella sp. HKAS 90566 China	Helvella sp. 23	HKAS 90566	China	KX506960
Helvella sp. HKAS 90571 China	Helvella sp. 23	HKAS 90571	China	KX506964
Helvella sp. HKAS 90581 China	Helvella sp. 23	HKAS 90581	China	KX506958
Helvella sp. HKAS 90569 China	Helvella sp. 23	HKAS 90569	China	KX506963
Helvella sp. HKAS 90568 China	Helvella sp. 23	HKAS 90568	China	KX506962
Helvella sp. HKAS 90605 China	Helvella sp. 24	HKAS 90605	China	KX506965
Helvella sp. HKAS 87864 China	Helvella sp. 24	HKAS 87864	China	MG871286
Helvella sp. HKAS 90626 China	Helvella sp. 25	HKAS 90626	China	KX506967
Uncultured fungus d159_SL2_chi_12_1_su26 Japan	Helvella sp. 26	d159_SL2_chi_12_1_su26	Japan	LC711399
Helvella sp. HKAS 67939 China	Helvella sp. 26	HKAS 67939	China	KX506966
Helvella sp. HKAS 76318 China	Helvella sp. 27	HKAS 76318	China	KX506981
Helvella sp. HKAS 78930 China	Helvella sp. 27	HKAS 78930	China	KX506978
Uncultured Helvella M11307 China	Helvella sp. 27	M11307	China	KR493448
Helvella sp. HKAS 70217 China	Helvella sp. 27	HKAS 70217	China	KX506977
Helvella sp. HKAS 90593 China	Helvella sp. 27	HKAS 90593	China	KX506982
Helvella sp. HKAS 57739 China	Helvella sp. 27	HKAS 57739	China	KX506980
Helvella sp. HKAS 78944 China	Helvella sp. 27	HKAS 78944	China	KX506979
Helvella sp. HKAS 90604 China	Helvella sp. 28	HKAS 90604	China	KX506995
Uncultured ectomycorrhizal fungus South Korea	Helvella sp. 28	——	South Korea	AB587758
Helvella macropus KA12-1317 South Korea	Helvella sp. 28	KA12-1317	South Korea	KR673547
Helvella sp. HKAS 95081 China	Helvella sp. 29	HKAS 95081	China	KX506985
Helvella sp. HKAS 95080 China	Helvella sp. 29	HKAS 95080	China	KX506984
Helvella sp. HKAS 90627 China	Helvella sp. 29	HKAS 90627	China	KX506983
Helvella sp. HKAS 87779 China	Helvella sp. 30	HKAS 87779	China	KX506970
Helvella sp. HKAS 78921 China	Helvella sp. 30	HKAS 78921	China	KX506969
Helvella sp. HKAS 90574 China	Helvella sp. 30	HKAS 90574	China	KX506971
Helvella sp. HKAS 78901 China	Helvella sp. 30	HKAS 78901	China	KX506968
Helvella sp. HKAS 90565 China	Helvella sp. 30	HKAS 90565	China	KX506954
Helvella sp. HKAS 90564 China	Helvella sp. 30	HKAS 90564	China	KX506953
Helvella sp. HKAS 90570 China	Helvella sp. 30	HKAS 90570	China	KX506955
Helvella sp. BJTC ZH139 China	Helvella sp. 31	BJTC ZH139	China	OR355080
Uncultured Helvella LKS1028 China	Helvella sp. 31	LKS1028	China	KX444354
Helvella sp. RMS0000652 USA	Helvella sp. 32	RMS0000652	USA	OP723991
Uncultured fungus NX1-4504 China	Helvella sp. 32	NX1-4504	China	LC622784
Uncultured fungus NX2-123 China	Helvella sp. 32	NX2-123	China	LC623361
Helvella sp. RH1470 USA	Helvella sp. 33	RH1470	USA: IA	MT373911
Helvella sp. RH1473 USA	Helvella sp. 33	RH1473	USA: IA	MN653024
Helvella subglabra HKAS 78940 China	Helvella subglabroides	HKAS 78940	China	KU739802
Helvella subglabra HMJAU 3866 China	Helvella subglabroides	HMJAU 3866	China	KU739862
Helvella subglabra HKAS 79007 China	Helvella subglabroides	HKAS 79007	China	KU739864
Helvella subglabra HKAS 74283 China	Helvella subglabroides	HKAS 74283	China	KU739865
Helvella subglabra HKAS 78939 China	Helvella subglabroides	HKAS 78939	China	KU739863
Helvella subglabroides BJTC FM2686 holotype China	Helvella subglabroides	BJTC FM2686, holotype	China	OR355088
Helvella subglabroides BJTC C614 China	Helvella subglabroides	BJTC C614	China	OR355086
Helvella subglabroides BJTC FM1049 China	Helvella subglabroides	BJTC FM1049	China	OR355087
Helvella sp. ChL9 Poland	Helvella sublicia	ChL9	Poland	KX438327
Helvellaceae sp. LM3615 Germany	Helvella sublicia	LM3615	Germany	KM576412
Helvella sublicia H148 Norway	Helvella sublicia	H148	Norway	MN656160
Helvella sp. SREF1730 France	Helvella sublicia	SREF1730	France	MN660460
Helvella sp. OTU 300	Helvella sublicia	OTU 300	——	MK959119
Helvella sp. SREF284 France	Helvella sublicia	SREF284	France: Daix	MN660727
Helvella sp. OTU11 Italy	Helvella sublicia	OTU11	Italy: Cadriano	MH681182
Helvella sp. KL23 Poland	Helvella sublicia	KL23	Poland	KX438328
Helvella fibrosa OKA-100 Turkey	Helvella sublicia	OKA-100	Turkey: Istanbul	MF228805
Uncultured ectomycorrhizal fungus L2299	Helvella sublicia	L2299	——	FM993121
Uncultured Helvella R71p4 Czech Republic	Helvella sublicia	R71p4	Czech Republic	GU327422
Uncultured Helvella 13372 C12 Spain	Helvella sublicia	13372 C12	Spain	MW282693
Helvella subspadicea HKAS 90624 China	Helvella subspadicea	HKAS 90624	China	KU739797
Helvella subspadicea HKAS 56656 holotype China	Helvella subspadicea	HKAS 56656, holotype	China	JX462574
Helvella xiaohuipan BJTC FM367 China	Helvella xiaohuipan	BJTC FM367	China	OR355078
Helvella xiaohuipan BJTC FM2317 holotype China	Helvella xiaohuipan	BJTC FM2317, holotype	——	OR355079
Helvella cf. corium HKAS 69755	Helvella xiaohuipan	HKAS 69755	——	JX462576

Table S6.

Specimens used in Lacunosa clade ITS phylogenetic analysis and their GenBank accession numbers. Newly generated sequences are in bold.

Taxa Name in Analysis	Taxon name	Voucher specimen	Country	ITS GenBank
Dissingia oblongispora	Dissingia oblongispora	HSA 137	China	OR355181
Dissingia oblongispora	Dissingia oblongispora	HSA 169	China	OR355182
Helvella alpestris O-255737 Norway	Helvella alpestris	O-255737	Norway	MN656183
Helvella alpestris O-255736 France	Helvella alpestris	O-255736	France	MN656166
Helvella alpestris H460 Canada	Helvella alpestris	H460	Canada	MN656163
Helvella alpina O-255751 Norway	Helvella alpina	O-255751	Norway	MN656181
Helvella atra O-255762 Norway	Helvella atra	O-255762	Norway	MN656170
Helvella lacunosa KH.10.97(S) Sweden	Helvella atra	KH.10.97 (S)	Sweden	KC122809
Helvella atra zhao2111 China	Helvella atra	zhao2111	China	KT894823
Helvella sp. OTU 1450	Helvella atra	OTU_1450	——	MK959124
Helvella lacunosa zhao2112 China	Helvella atra	zhao2112	China	KT894824
Helvella atra HMAS 290900 China	Helvella atra	HMAS 290900	China	OQ600286
Helvella atra HMAS 290901 China	Helvella atra	HMAS 290901	China	OQ600287
Helvella austrooccidentalis HMAS 290902 China	Helvella austrooccidentalis	HMAS 290902	China	OQ600290
Helvella austrooccidentalis HMAS 290903 holotype China	Helvella austrooccidentalis	HMAS 290903, holotype	China	OQ600291
Helvella borealis HMAS 290905 holotype China	Helvella borealis	HMAS 290905, holotype	China	OQ600293
Helvella cf. calycina UBC F28816 Canada	Helvella calycina	UBC F28816	Canada	MZ970428
Helvella costifera S.D. Russell MycoMap 5873 USA	Helvella calycina	S.D. Russell MycoMap 5873	USA	ON561610
Uncultured fungus China	Helvella calycina	——	China	LS963398
Helvella calycina H022 epitype Norway	Helvella calycina	H022, epitype	Norway	MN656158
Helvella calycina HMAS 279704 China	Helvella calycina	HMAS 279704	China	OR355013
Helvella fusca ZT_Myc_64135 Switzerland	Helvella cf. fusca	ZT_Myc_64135	Switzerland	MW677578
Helvella lactea IBL24 Poland	Helvella cf. lactea	IBL24	Poland	MZ410653
uncultured ectomycorrhiza 3 Italy	Helvella cf. lactea	3	Italy	AJ879682
Helvella corium TROM-F-610014 Norway	Helvella corium	TROM-F-610014	Norway	MN656172
Helvella corium MQ17150QFB29658HRL2444 Canada	Helvella corium	MQ17150-QFB29658-HRL2444	Canada	MN992597
Helvella corium MQ17051QFB29559HRL2438 Canada	Helvella corium	MQ17051-QFB29559-HRL2438	Canada	MN992596
Helvella corium O-255757 France	Helvella corium	O-255757	France	MN656165
Helvella corium O-255756 Svalbard	Helvella corium	O-255756	Svalbard	MN656185
Helvella costifera BJTC FM1742 China	Helvella costifera	BJTC FM1742	China	OR355129
Helvella costifera BJTC FM1705 China	Helvella costifera	BJTC FM1705	China	OR355128
Uncultured fungus NX3-152 China	Helvella costifera	NX3-152	China	LC623419
Helvella costifera HMAS 280301 China	Helvella costifera	HMAS 280301	China	MK592123
Helvella costifera HMAS 187120 China	Helvella costifera	HMAS 187120	China	MK592122
Helvella cystidiata HKAS 74316 China	Helvella cystidiata	HKAS 74316	China	KX239840
Helvella cystidiata HKAS 78941 China	Helvella cystidiata	HKAS 78941	China	KX239839
Helvella cystidiata HMJAU 52 China	Helvella cystidiata	HMJAU 52	China	OQ600295
Helvella cystidiata HMJAU 150 China	Helvella cystidiata	HMJAU 150	China	OQ600296
Helvella dryophila UC 1999233 holotype USA	Helvella dryophila	UC 1999233, holotype	USA	KC122861
Helvella dryophila UC 1999234 USA	Helvella dryophila	UC 1999234	USA	KC122836
Helvella fulva HMAS 290906 holotype China	Helvella fulva	HMAS 290906, holotype	China	OQ600297
Helvella huangii HMAS 290907 China	Helvella huangii	HMAS 290907	China	OQ600298
Helvella huangii HMAS 45031 holotype China	Helvella huangii	HMAS 45031, holotype	China	OQ600299
Helvella huangii HMJAU 3488 China	Helvella huangii	HMJAU 3488	China	OQ600300
Helvella huangii BJTC C375 China	Helvella huangii	BJTC C375	China	OR355175
Helvella jizushanica HMAS 290908 holotype China	Helvella jizushanica	HMAS 290908, holotype	China	OQ600301
Helvella jizushanica HMAS 59718 China	Helvella jizushanica	HMAS 59718	China	OQ600302
Helvella sp. HKAS 69079 China	Helvella jizushanica	HKAS 69079	China	KX239830
Helvella sp. HKAS 72598 China	Helvella jizushanica	HKAS 72598	China	KX239829
Helvella sp. HKAS 90221 China	Helvella jizushanica	HKAS 90221	China	KX239828
Helvella sp. HKAS 87775 China	Helvella jizushanica	HKAS 87775	China	KX239827
Helvella jocatoi CB08326 holotype Mexico	Helvella jocatoi	CB08326, holotype	Mexico	KC016115
Helvella jocatoi Landeros3581 Mexico	Helvella jocatoi	Landeros3581	Mexico	MT334416
Helvella lacunosa BJTC FM813 China	Helvella lacunosa	BJTC FM813	China	OR355112
Helvella lacunosa BJTC FM573 China	Helvella lacunosa	BJTC FM573	China	OR355111
Helvella lacunosa BJTC FM1414 China	Helvella lacunosa	BJTC FM1414	China	OR355109
Helvella lacunosa BJTC FM907 China	Helvella lacunosa	BJTC FM907	China	OR355113
Helvella lacunosa BJTC FM947 China	Helvella lacunosa	BJTC FM947	China	OR355115
Helvella lacunosa BJTC FM914 China	Helvella lacunosa	BJTC FM914	China	OR355114
Helvella lacunosa BJTC FM546 China	Helvella lacunosa	BJTC FM546	China	OR355110
Helvella lacunosa BJTC FM1162 China	Helvella lacunosa	BJTC FM1162	China	OR355108
Helvella sp. XLN(1)	Helvella lacunosa	XLN(1)	——	KY865326
Helvella sp. XLN(3)	Helvella lacunosa	XLN(3)	——	KY865327
Uncultured Helvella Sym5068 Russia	Helvella lacunosa	Sym5068	Russia	LC574338
Helvella lacunosa O-255761 Norway	Helvella lacunosa	O-255761	Norway	MN656169
Helvella lacunosa UC 1999245 Denmark	Helvella lacunosa	UC 1999245	Denmark	KC122820
Helvella pseudolacunosa HKAS 87594 holotype China	Helvella lacunosa	HKAS 87594, holotype	China	KR493476
Helvella pseudolacunosa HMJAU 4533 China	Helvella lacunosa	HMJAU 4533	China	MG871284
Helvella sp. PA8 Latvia	Helvella lacunosa	PA8	Latvia	KR019788
Helvella liui HMAS 85725 holotype China	Helvella liui	HMAS 85725, holotype	China	OQ600310
Uncultured Helvella XT13106 China	Helvella liui	XT13106	China	MF405782
Uncultured Helvella Q-L-OTU66 China	Helvella liui	Q-L-OTU66	China	KY684424
Helvella lobata HMAS 290910 holotype China	Helvella lobata	HMAS 290910, holotype	China	OQ600311
Helvella macrosperma TROM-F-610001 Norway	Helvella macrosperma	TROM-F-610001	Norway	MN656176
Helvella macrosperma O-253328 Norway	Helvella macrosperma	O-253328	Norway	MN656159
Helvella macrosperma O-F-285169 Norway	Helvella macrosperma	O-F-285169	Norway	MN656184
Helvella macrosperma TROM-F-610004 Norway	Helvella macrosperma	TROM-F-610004	Norway	MN656180
Helvella magna BJTC FM2486-A China	Helvella magna	BJTC FM2486-A	China	OR355117
Helvella magna BJTC FM2486-B China	Helvella magna	BJTC FM2486-B	China	OR355118
Uncultured Helvella XJG9 China	Helvella magna	XJG9	China	JX129157
Uncultured fungus QH-142 China	Helvella magna	QH-142	China	LC623504
Uncultured fungus QH-100 China	Helvella magna	QH-100	China	LC623493
Uncultured fungus NX3-54 China	Helvella magna	NX3-54	China	LC623390
Uncultured fungus NX3-37 China	Helvella magna	NX3-37	China	LC623387
Uncultured fungus NX3-280 China	Helvella magna	NX3-280	China	LC623455
uncultured fungus NX3-34 China	Helvella magna	NX3-34	China	LC623386
Uncultured fungus NX3-31 China	Helvella magna	NX3-31	China	LC623384
Uncultured Helvella QL062 China	Helvella magna	QL062	China	HM105544
Uncultured Helvella ZWL491 China	Helvella magna	ZWL491	China	KX444290
Uncultured fungus BJ-214 China	Helvella magna	BJ-214	China	LC623015
Uncultured Helvella DLS1624 China	Helvella magna	DLS1624	China	KX444418
Helvella magna HMAS 60679 holotype China	Helvella magna	HMAS 60679, holotype	China	OQ600315
Helvella magna HMAS 290911 China	Helvella magna	HMAS 290911	China	OQ600312
Helvella magna HMAS 290912 China	Helvella magna	HMAS 290912	China	OQ600313
Helvella nannfeldtii TROM-F-610034 Norway	Helvella nannfeldtii	TROM-F-610034	Norway	MN656174
Helvella nannfeldtii O-255744 Norway	Helvella nannfeldtii	O-255744	Norway	MN656167
Helvella parva HMAS 290914 holotype China	Helvella parva	HMAS 290914, holotype	China	OQ600323
Uncultured fungus HKAS 50833 China	Helvella philonotis	HKAS 50833	China	KR493462
Uncultured Ascomycota OTU583 China	Helvella philonotis	OTU583	China	MW049805
Uncultured ectomycorrhiza 855 Austria	Helvella philonotis	855	Austria	EU498735
Helvella philonotis O-255760 Norway	Helvella philonotis	O-255760	Norway	MN656182
Helvella dovrensis OTU 096r	Helvella philonotis	OTU 096r	——	MT095216
Helvella dovrensis ARON 2626 (1995)	Helvella philonotis	ARON 2626 (1995)	——	AF046223
Helvella philonotis HMAS 290915 China	Helvella philonotis	HMAS 290915	China	OQ600324
Helvella philonotis HMAS 264754 China	Helvella philonotis	HMAS 264754	China	OQ600327
Helvella phlebophora HMAS 268001 China	Helvella phlebophora	HMAS 268001	China	OQ600328
Helvella phlebophoropsis HMAS 85654 holotype China	Helvella phlebophoropsis	HMAS 85654, holotype	China	OQ600329
Helvella plateata HMAS 290916 China	Helvella plateata	HMAS 290916	China	OQ600330
Helvella plateata HMAS 270642 holotype China	Helvella plateata	HMAS 270642, holotype	China	OQ600331
Helvella plateata HMAS 290917 China	Helvella plateata	HMAS 290917	China	OQ600332
Helvella pseudoalpina TROM-F-610048 Norway	Helvella pseudoalpina	TROM-F-610048	Norway	MN656173
Helvella ravida HSA 375 holotype China	Helvella ravida	HSA 375	China	OR355124
uncultured Helvella China	Helvella ravida	——	China	LT967133
Helvella sp. OTU 098r	Helvella ravida	OTU 098r	——	MT095218
Helvella ravida HMAS 290919 holotype China	Helvella ravida	HMAS 290919, holotype	China	OQ600334
Helvella ravida HMAS 61920 China	Helvella ravida	HMAS 61920	China	OQ600335
Helvella rugosa HKAS 87587 holotype China	Helvella rugosa	HKAS 87587, holotype	China	KR493478
Helvella aff. sulcata UC 1999239 China	Helvella rugosa	UC 1999239	China	KC122812
Helvella aff. sulcata UC 1999240 China	Helvella rugosa	UC 1999240	China	KC122813
Helvella sp. HKAS 75442 China	Helvella rugosa	HKAS 75442	China	KR493475
Uncultured Helvella M11314 China	Helvella rugosa	M11314	China	KR493455
Uncultured Helvella M11312 China	Helvella rugosa	M11312	China	KR493453
Helvella rugosa HKAS 90536 Thailand	Helvella rugosa	HKAS 90536	Thailand	KU739805
Helvella rugosa HKAS 90534	Helvella rugosa	HKAS 90534	——	KU739804
Helvella rugosa HKAS 90597 China	Helvella rugosa	HKAS 90597	China	KX507005
Helvella rugosa HKAS 90595 China	Helvella rugosa	HKAS 90595	China	KX507004
Helvella rugosa HMAS 290920 China	Helvella rugosa	HMAS 290920	China	OQ600336
Helvella rugosa HMAS 290921 China	Helvella rugosa	HMAS 290921	China	OQ600337
Helvella sinohyperborea BJTC FM105 holotype China	Helvella sinohyperborea	BJTC FM105, holotype	China	OR355132
Helvella sinohyperborea BJTC FM165 China	Helvella sinohyperborea	BJTC FM165	China	OR355133
Uncultured Helvella NXHLS462 China	Helvella sinohyperborea	NXHLS462	China	KX510013
Uncultured Helvella 1 China	Helvella sinohyperborea	1	China	FJ803929
Uncultured Helvella UDB019758 Switzerland	Helvella sp. 34	UDB019758	Switzerland	MN970731
Uncultured fungus European Alpine System	Helvella sp. 34	——	European Alpine System	LS953425
Uncultured fungus European Alpine System	Helvella sp. 34	——	European Alpine System	LS972604
Helvella sp. UC 1999221 USA	Helvella sp. 34	UC 1999221	USA	KC122819
Helvella lacunosa MIN 451143 Netherlands	Helvella sp. 34	MIN 451143	Netherlands	KC122818
Helvella lacunosa OTU 2161	Helvella sp. 34	OTU 2161	——	MK959122
Helvella lacunosa DMS-9344856 Denmark	Helvella sp. 34	DMS-9344856	Denmark	MT644923
Helvella sp. KWT1 Austria	Helvella sp. 34	KWT1	Austria	AJ544210
Helvella sp. 3430 Mexico	Helvella sp. 35	3430	Mexico	MK397160
Helvella cf. vespertina Mushroom Observer 329684 USA	Helvella sp. 36	Mushroom Observer 329684	USA	MN204489
Helvella jocatoi LGD9002 Mexico	Helvella sp. 37	LGD9002	Mexico	MT334417
Helvella sp. GO-2009-313 Mexico	Helvella sp. 37	GO-2009-313	Mexico	KC152112
Helvella lacunosa HC-PNNT-059 Mexico	Helvella sp. 38	HC-PNNT-059	Mexico	KC016124
Helvella lacunosa HC-PNNT-235 Mexico	Helvella sp. 39	HC-PNNT-235	Mexico	KC016123
Helvella sp. UC 1999237 USA	Helvella sp. 40	UC 1999237	USA	KC122810
Helvella sp. UC 1999244 USA	Helvella sp. 41	UC 1999244	USA	KC122863
Helvella sp. HKAS 87756 China	Helvella sp. 42	HKAS 87756	China	KX239836
Helvella sp. HKAS 87757 China	Helvella sp. 42	HKAS 87757	China	KX239837
Helvella sp. HKAS 90622 China	Helvella sp. 42	HKAS 90622	China	KX239833
Helvella sp. HKAS 87702 China	Helvella sp. 42	HKAS 87702	China	KX239831
Helvella sp. HKAS 90623 China	Helvella sp. 42	HKAS 90623	China	KX239834
Helvella sp. HKAS 87755 China	Helvella sp. 42	HKAS 87755	China	KX239835
Helvellaceae sp. LM5050 Hungary	Helvella sp. 43	LM5050	Hungary	KM576411
Helvella lacunosa UC 1999242 Montenegro	Helvella sp. 43	UC 1999242	Montenegro	KC122823
Helvella lacunosa UC 1999243 Montenegro	Helvella sp. 43	UC 1999243	Montenegro	KC122824
Helvella lacunosa Tip 330 Germany	Helvella sp. 43	Tip 330	Germany	MW695300
Helvella sp. Otu0550	Helvella sp. 43	Otu0550	——	MW039947
Uncultured Helvella LMBC23a-10 France	Helvella sp. 44	LMBC23a-10	France	JF506761
Helvellaceae sp. S117B Cameroon	Helvella sp. 44	S117B	Cameroon	KR819045
Uncultured Helvella s0m002 Italy	Helvella sp. 44	s0m002	Italy	HF565060
Helvella sp. OTU 1710	Helvella sp. 44	OTU 1710	——	MK959128
Helvella sp. OTU10 Italy	Helvella sp. 44	OTU10	Italy	MH681181
Helvella sp. FLAS-F-68270 USA	Helvella sp. 45	FLAS-F-68270	USA	OM672712
Helvella sp. FLAS-F-68525 USA	Helvella sp. 45	FLAS-F-68525	USA	OM672836
Helvella sp. S.D. Russell ONT iNaturalist 136737536 USA	Helvella sp. 45	S.D. Russell ONT iNaturalist 136737536	USA	OP749738
Helvella lacunosa CNV84	Helvella sp. 45	CNV84	——	MT345260
Helvella sp. S.D. Russell ONT-iNaturalist 129729182 USA	Helvella sp. 46	S.D. Russell ONT iNaturalist 129729182	USA	OP643219
Helvella sp. S.D. Russell ONT iNaturalist 130137837 USA	Helvella sp. 46	S.D. Russell ONT iNaturalist 130137837	USA	OP643323
Helvella sp. S.D. Russell ONT-iNaturalist 131004622 USA	Helvella sp. 46	S.D. Russell ONT iNaturalist 131004622	USA	OP643454
Pezizales sp. RT00056	Helvella sp. 46	RT00056	——	EU819533
Helvella lacunosa F 1142883 USA	Helvella sp. 46	F 1142883	USA	KC122825
Helvella sp. OTU 541s	Helvella sp. 47	OTU 541s	——	MT095660
Helvella sp. OTU 530s	Helvella sp. 48	OTU 530s	——	MT095649
Helvella sp. O-255739 Norway	Helvella sp. 49	O-255739	Norway	MN656179
Helvella sp. O-255738 Norway	Helvella sp. 49	O-255738	Norway	MN656178
Helvella sp. OTU_528s	Helvella sp. 50	OTU_528s	——	MT095647
Helvella corium ARON 2610	Helvella sp. 51	ARON 2610	——	AF046226
Helvella sp. OTU 527s	Helvella sp. 51	OTU 527s	——	MT095646
Uncultured fungus AG_K_112 Poland	Helvella sp. 52	AG_K_112	Poland	ON417278
Helvella costifera TENN: 071510 USA	Helvella sp. 53	TENN: 071510	USA	MG663264
Helvella cf. acetabulum SOC1181 USA	Helvella sp. 53	SOC1181	USA	FJ235151
Uncultured Helvella 2008AGG10	Helvella sp. 54	2008AGG10	——	HQ204665
Helvella sp. OTU 71	Helvella sp. 54	OTU 71	——	MK959125
Helvella sublactea M01452264 Estonia	Helvella sp. 55	M01452264	Estonia	LR874455
Helvella sublactea M01452264 Estonia	Helvella sp. 55	M01452264	Estonia	LR874454
Helvella sp. FLAS-F-68282 USA	Helvella sp. 56	FLAS-F-68282	USA	OM672723
Helvella aff. latispora UC 1999198 USA	Helvella sp. 56	UC 1999198	USA	KC122814
Helvella aff. latispora WCG 306 USA	Helvella sp. 56	WCG 306	USA	KC122817
Helvella lactea WCG 1393 USA	Helvella sp. 57	WCG 1393	USA	KC122826
Helvella lactea RH1704 USA	Helvella sp. 57	RH1704	USA	MT373912
Helvella lactea FLAS-F-61490 USA	Helvella sp. 57	FLAS-F-61490	USA	MH211926
Helvella lacunosa OTU 663	Helvella sp. 58	OTU 663	——	MK959121
Helvella sublactea BJTC FM347 China	Helvella sublactea	BJTC FM347	China	OR355123
Helvella sublactea BJTC FM1082 China	Helvella sublactea	BJTC FM1082	China	OR355122
Helvella sp. w04 China	Helvella sublactea	w04	China	KT894828
Helvella sublactea zhao1273 China	Helvella sublactea	zhao1273	China	KT894827
Uncultured Helvella ZWL215 China	Helvella sublactea	ZWL215	China	KX444291
Uncultured Helvella DLS1701 China	Helvella sublactea	DLS1701	China	KX444421
Helvella sublactea t1359 China	Helvella sublactea	t1359	China	KT894829
Helvella sublactea HKAS 69753 China	Helvella sublactea	HKAS 69753	China	KT894825
Helvella sublactea HKAS 90607 China	Helvella sublactea	HKAS 90607	China	KT894826
Helvella subtinta BJTC FM1307 China	Helvella subtinta	BJTC FM1307	China	OR355130
Helvella subtinta HKAS 104666 holotype China	Helvella subtinta	HKAS 104666, holotype	China	MN449991
Helvella sulcatoides BJTC ZH1231 China	Helvella sulcatoides	BJTC ZH1231	China	OR355121
Helvella sulcatoides BJTC FM263 China	Helvella sulcatoides	BJTC FM263	China	OR355120
Helvella sulcatoides BJTC FM1416 holotype China	Helvella sulcatoides	BJTC FM1416, holotype	China	OR355119
Helvella terricola HMAS 38355 China	Helvella terricola	HMAS 38355	China	OQ600354
Helvella tianshanensis HSA 179 China	Helvella tianshanensis	HSA 179	China	OR355126
Helvella tianshanensis HSA 185 China	Helvella tianshanensis	HSA 185	China	OR355127
Helvella tianshanensis BJTC FM175 China	Helvella tianshanensis	BJTC FM175	China	OR355125
uncultured Helvella China	Helvella tianshanensis	——	China	OW846958
Helvella tianshanensis HMAS 88611 China	Helvella tianshanensis	HMAS 88611	China	MK592158
Helvella tianshanensis HMAS 86040 China	Helvella tianshanensis	HMAS 86040	China	MK592157
Helvella tinta HKAS 82560 holotype China	Helvella tinta	HKAS 82560, holotype	China	KX239842
Helvella sp. HKAS 78919 China	Helvella varia	HKAS 78919	China	KX239818
Helvella sp. HKAS 78918 China	Helvella varia	HKAS 78918	China	KX239817
Helvella sp. HKAS 90590 China	Helvella varia	HKAS 90590	China	KX239824
Helvella sp. HKAS 90598 China	Helvella varia	HKAS 90598	China	KX239823
Helvella sp. HKAS 90554 China	Helvella varia	HKAS 90554	China	KX239821
Helvella sp. HKAS 90595 China	Helvella varia	HKAS 90595	China	KX239822
Helvella sp. HKAS 78905 China	Helvella varia	HKAS 78905	China	KX239816
Helvella sp. HKAS 90610 China	Helvella varia	HKAS 90610	China	KX239825
Helvella sp. HKAS 90611 China	Helvella varia	HKAS 90611	China	KX239826
Helvella sp. HKAS 87789 China	Helvella varia	HKAS 87789	China	KX239819
Uncultured Helvella M11308 China	Helvella varia	M11308	China	KR493449
Helvella sp. HKAS 74662 China	Helvella varia	HKAS 74662	China	KX239812
Helvella sp. HKAS 74280 China	Helvella varia	HKAS 74280	China	KX239811
Helvella sp. HKAS 74675 China	Helvella varia	HKAS 74675	China	KX239814
Helvella sp. HKAS 78903 China	Helvella varia	HKAS 78903	China	KX239815
Helvella sp. HKAS 74674 China	Helvella varia	HKAS 74674	China	KX239813
Helvella varia HMAS 270932 holotype China	Helvella varia	HMAS 270932, holotype	China	OQ600357
Helvella varia HMAS 290929 China	Helvella varia	HMAS 290929	China	OQ600359
Uncultured Helvella 1_81M3 USA	Helvella vespertina	1_81M3	USA	JQ393060
Uncultured Helvella 1_B10_9 USA	Helvella vespertina	1_B10_9	USA	JX198535
Uncultured Helvella RD7 USA	Helvella vespertina	RD7	USA	HM021164
Helvella vespertina UC 1999204 holotype USA	Helvella vespertina	UC 1999204, holotype	USA	KC122858
Helvella vespertina UBC F15597 Canada	Helvella vespertina	UBC F15597	Canada	MZ970442
Helvella vespertina SB12 USA	Helvella vespertina	SB12	USA	MF186831
Helvella vespertina F319 USA	Helvella vespertina	F319	USA	KC122853
Helvella vitrea HMAS 290932 holotype China	Helvella vitrea	HMAS 290932, holotype	China	OQ600362
Helvella shanxiensis BJTC FM2621 China	Helvella vulgata	BJTC FM2621	China	OR355116
Helvella vulgata HMAS 53683 holotype China	Helvella vulgata	HMAS 53683, holotype	China	OQ600363
Helvella vulgata HMIGD 25964 China	Helvella vulgata	HMIGD 25964	China	OQ600365
Helvella yunnanensis HMAS 290933 holotype China	Helvella yunnanensis	HMAS 290933, holotype	China	OQ600366
Helvella yunnanensis HMAS 290934 China	Helvella yunnanensis	HMAS 290934	China	OQ600367

Table S7.

The list of Helvella species confirmed in China.

Species	Type locality	Lineage	Clade
Helvella acetabuloides	China: Inner Mongolia Autonomous Region	acetabulum	Acetabulum
H. acetabulum	Sweden: Östergötland (epitype)	acetabulum	Acetabulum
H. albopatella	China: Shanxi	hypocrateriformis	Elastica
H. alborava	China: Shanxi	rivularis-sublicia	Elastica
H. atra	Denmark	atra-pallescens	Lacunosa
H. atroides	Thailand	—	Elastica
H. austrooccidentalis	China: Tibet	lacunosa-helvellula	Lacunosa
H. bachu	China: Xinjiang Autonomous Region	capucina-danica	Elastica
H. borealis	China: Jilin	sulcata-phlebophoroides	Lacunosa
H. brunneogaleriformis	China: Shanxi	capucina-danica	Elastica
H. caespitosa	China: Shanxi	fallax-pezizoides	Elastica
H. calycina	Norway: Oppland (epitype)	costifera	Lacunosa
H. capucinoides	USA	bicolor-elastica	Elastica
H. carnosa	Norway: Oslo	carnosa	Elastica
H. corbierei	Switzerland: Graubünden (epitype)	corbierei-stevensii	Elastica
H. costifera	Sweden: Uppland (epitype)	costifera	Lacunosa
H. cremeoinvoluta	China: Shanxi	crispa	Crispa
H. crispoides	Thailand: Chiang Mai	crispa	Crispa
H. cystidiata	China: Yunnan	lacunosa-helvellula	Lacunosa
H. danica	Denmark: Jutland	capucina-danica	Elastica
H. deflexa	China: Shanxi	capucina-danica	Elastica
H. ephippioides	Japan	macropus	Elastica
H. fistulosa	Norway: Hordaland (neotype)	capucina-danica	Elastica
H. flavostipitata	China: Shanxi	carnosa	Elastica
H. floriforma	China: Yunnan	—	Lacunosa
H. fulva	China: Tibet	phlebophora	Lacunosa
H. galeriformis	China: Shanxi	capucina-danica	Elastica
H. guttata	China: Yunnan	macropus	Elastica
H. huangii	China: Beijing	phlebophora	Lacunosa
H. involuta	China: Yunnan	crispa	Crispa
H. jizushanica	China: Yunnan	sulcata-phlebophoroides	Lacunosa
H. lacunosa	Sweden: Femsjö(epitype)	lacunosa-helvellula	Lacunosa
H. liui	China: Shanxi	fusca-lactea	Lacunosa
H. lobata	China: Jiangsu	phlebophora	Lacunosa
H. macropus	Sweden: Uppland (epitype)	macropus	Elastica
H. maculatoides	China: Sichuan	—	Crispa
H. magna	China: Gansu	sulcata-phlebophoroides	Lacunosa
H. multiformis	China: Shanxi	rivularis-sublicia	Elastica
H. neofistulosa	China: Beijing	capucina-danica	Elastica
H. nigrorava	China: Beijing	rivularis-sublicia	Elastica
H. nordlandica	Norway: Nordland	hypocrateriformis	Elastica
H. orentitomentosa	Thailand	—	Elastica
H. orienticrispa	China: Yunnan	crispa	Crispa
H. palustris	USA: New York	palustris-philonotis	Lacunosa
H. parva	China: Yunnan	phlebophora	Lacunosa
H. philonotis	Norway: Oppland	palustris-philonotis	Lacunosa
H. phlebophora	Iceland (epitype)	phlebophora	Lacunosa
H. phlebophoropsis	China: Shanxi	phlebophora	Lacunosa
H. plateata	China: Tibet	lacunosa-helvellula	Lacunosa
H. pseudoelastica	China: Beijing	capucina-danica	Elastica
H. pseudofallax	China: Shanxi	fallax-pezizoides	Elastica
H. pseudopezizoides	China: Shanxi	fallax-pezizoides	Elastica
H. pseudoreflexa	China: Yunnan	crispa	Crispa
H. pubescens	Canada: Alberta	rivularis-sublicia	Elastica
H. ravida	China: Sichuan	fusca-lactea	Lacunosa
H. rugosa	China: Yunnan	atra-pallescens	Lacunosa
H. scyphoides	Norway: Hedmark	hypocrateriformis	Elastica
H. sichuanensis	China: Sichuan	acetabulum	Acetabulum
H. sinocrispa	China: Shanxi	crispa	Crispa
H. sinohyperborea	China: Shanxi	hyperborea	Lacunosa
H. solitaria	Sweden: Uppsala (epitype)	solitaria	Acetabulum
H. subglabroides	China: Shanxi	fallax-pezizoides	Elastica
H. sublactea	China: Yunnan	fusca-lactea	Lacunosa
H. subspadicea	China: Xinjiang Autonomous Region	capucina-danica	Elastica
H. subtinta	China: Yunnan	alpina-corium	Lacunosa
H. sulcatoides	China: Shanxi	sulcata-phlebophoroides	Lacunosa
H. taiyuanensis	China: Shanxi	solitaria	Acetabulum
H. terricola	Spain	palustris-philonotis	Lacunosa
H. tianshanensis	China: Xinjiang Autonomous Region	tianshanensis	Lacunosa
H. tinta	China: Sichuan	hyperborea	Lacunosa
H. varia	China: Guangdong	atra-pallescens	Lacunosa
H. vitrea	China: Jiangsu	phlebophora	Lacunosa
H. vulgata	China: Hubei	atra-pallescens	Lacunosa
H. xiaohuipan	China: Shanxi	fallax-pezizoides	Elastica
H. yunnanensis	China: Yunnan	sulcata-phlebophoroides	Lacunosa
H. zhongtiaoensis	China: Shanxi	crispa	Crispa