Synthesis and Pharmacological Evaluation of Novel Triazole-Pyrimidine Hybrids as Potential Neuroprotective and Anti-neuroinflammatory Agents

Abstract

Objective

Neuroprotection is a precise target for the treatment of neurodegenerative diseases, ischemic stroke, and traumatic brain injury. Pyrimidine and its derivatives have been proven to use antiviral, anticancer, antioxidant, and antimicrobial activity prompting us to study the neuroprotection and anti-inflammatory activity of the triazole-pyrimidine hybrid on human microglia and neuronal cell model.

Methods

A series of novel triazole-pyrimidine-based compounds were designed, synthesized and characterized by mass spectra, 1HNMR, 13CNMR, and a single X-Ray diffraction analysis. Further, the neuroprotective, anti-neuroinflammatory activity was evaluated by cell viability assay (MTT), Elisa, qRT-PCR, western blotting, and molecular docking.

Results

The molecular results revealed that triazole-pyrimidine hybrid compounds have promising neuroprotective and anti-inflammatory properties. Among the 14 synthesized compounds, ZA3-ZA5, ZB2-ZB6, and intermediate S5 showed significant anti-neuroinflammatory properties through inhibition of nitric oxide (NO) and tumor necrosis factor-α (TNF-α) production in LPS-stimulated human microglia cells. From 14 compounds, six (ZA2 to ZA6 and intermediate S5) exhibited promising neuroprotective activity by reduced expression of the endoplasmic reticulum (ER) chaperone, BIP, and apoptosis marker cleaved caspase-3 in human neuronal cells. Also, a molecular docking study showed that lead compounds have favorable interaction with active residues of ATF4 and NF-kB proteins.

Conclusion

The possible mechanism of action was observed through the inhibition of ER stress, apoptosis, and the NF-kB inflammatory pathway. Thus, our study strongly indicates that the novel scaffolds of triazole-pyrimidine-based compounds can potentially be developed as neuroprotective and anti-neuroinflammatory agents.

Introduction

Neuroprotection is characterized by restoring neuronal function and structure; a potential strategy used to prevent or slow disease progression by reducing neuronal death [1]. Neuroprotection is a widely explored target for the treatment of various neurodegenerative diseases, such as Alzheimer’s disease (AD), Huntington’s disease (HD), Parkinson’s disease (PD), Amyotrophic lateral sclerosis (ALS), ischemic stroke, and traumatic brain injury [2]. Mechanisms of age-related neurodegenerative disorders such as AD or PD are complex, involving complex signaling cascades, mitochondrial dysfunction, oxidative and nitrosative stress, apoptosis, and neuroinflammation [3, 4]. Currently, no approved drug has a promising neuroprotective profile to treat the aforementioned conditions. Most neuroprotective therapies have been failed in the clinic due to a limited understanding of mechanisms related to neurodegenerative diseases [5] and suggesting a solitary target as the mechanism of action. It has become clear now that neuroinflammation occupies the center stage of neurodegenerative disease; therefore, it is pivotal to develop agents with neuroprotective and anti-inflammatory properties [6].

The structural framework of pyrimidine and triazole pharmacophores occupies an interesting position in organic and medicinal chemistry due to their diverse biological properties. The development of triazolopyrimidine and its derivatives have attracted continued interest in the medicinal world [7, 8]. Pyrimidine and its derivatives constitute an essential set of scaffolds for the synthesis of potential new bioactive molecules possessing a wide range of biological activities that include antiviral, anticancer, antioxidant, antimicrobial, anti-Alzheimer, anti-inflammatory, and neuroprotective properties [9-13]. The use of click chemistry to prepare drugs with cohesive 1,2,3-triazole via cycloaddition reactions (called “Huisgen 1,3-dipolar cycloaddition”) has been developed to be an efficient tool. The importance of click chemistry is due to its ‘quicker’ methodology that has the capability to create complex and efficient drugs with high yield and purity from simple and cheap starting materials [14]. The triazole scaffold and its derivatives have proved to be promising heterocycles with several properties like anti-inflammatory, antimicrobial, antitumor, antimalarial, anti-oxidant, anti-Parkinson’s, and antidepressant [11, 15, 16]. Studies have reported that compounds having a pyrimidine or triazole skeleton showed significant anti-inflammatory and neuroprotective properties [17, 18]. Howevere, the beforementioned pyrimidine and triazole derivatives are not well studied at molecular level and the mechanism of neuroprotection and antineuroinflammatory is still unknown. In the present work, a pharmacophore-merging strategy was used to design novel compounds by combining the potential anti-neuroinflammatory/neuroprotective phenyl-pyrimidine carboxylate fragment with differently substituted triazoles via piperazine linker. These studies prompting us to design and synthesize novel triazole-pyrimidine derivatives and explore their biological activities against oxygen–glucose deprivation and reperfusion (OGD/R), ER stress, and neuroinflammation models.

The OGD/R model is the most common and widely used in vitro recapitulate cerebral ischemia/reperfusion events [19]. Reperfusion after OGD abolishes the permeability of the cell membrane and induces free radical release, neuroinflammation, and eventually neuronal death [20]. OGD induces oxidative stress in cultured neurons and simulates hypoxic conditions in various neuronal types like hippocampal neurons [21], cortical neurons [22], hippocampal HT22 cells [23], N2A cells [24], and PC12 cells [25]. In the milieu, endoplasmic reticulum (ER) stress causes unfolded/misfolded proteins to aggregate, leading to neuronal death [26]. The human neuroblastoma cell line (SH-SY5Y) exhibits neuron-like phenotypes, chemical features, and electro-physiological properties and is commonly used for testing neuroprotective properties of different compounds using OGD/R models [27]. However, SH-SY5Y cells in several studies have been shown to be non-excitable (lack response to glutamate or other excitatory stimuli); thus, their electrophysiological properties resembling primary neurons are questionable [28, 29]. Also, SH-SY5Y in-vitro cell based model is widely used to study the neuroprotection for AD, PD, ischemia, and ALS [30-33]. During stress conditions, microglia are activated to release cytokines and chemokines, resulting in widespread neuroinflammation and causes neuronal cell death [34]. LPS-challenged human microglia clone 3 cell line (HMC3) is commonly used to test compounds for anti-neuroinflammatory properties. Given the involvement of various mediators in neuronal death, it is vital to model different mechanisms for identifying potential neuroprotective/anti-neuroinflammatory agents.

In this study, we developed a new triazole-pyrimidine derivatives as neuroprotective/anti-neuroinflammatory agents to treat neurodegenerative diseases. These synthesized derivatives were screened for neuroprotective/anti-neuroinflammatory properties using in-vitro models. To further substantiate our results and identify mechanisms of action, we studied the expression of genes and proteins involved in the inflammatory pathways, ER stress pathway, and molecular docking to confirm the favorable interaction of derivatives with inflammatory and ER stress regulators proteins (ATF4 and NF-kB).

Materials and Methods

All the reagents and chemicals used during the synthesis and characterization of the compounds without further purifications were brought from commercial suppliers like Alfa-Aesar, Sigma Aldrich, S.R.L. (Sisco Research Laboratories Pvt. Ltd.), and Spectrochem Pvt. Ltd. (India). The solvents were dried using standard methods. The melting points were determined with the Tanco PLT-276 apparatus and are uncorrected. The Nuclear Magnetic Resonance (NMR) spectra were reported with Bruker Avance NMR spectrometer, ¹H NMR at 400 and 500 MHz, and ¹³C NMR at 101 and 126 MHz deuterated solvents (chloroform-d6 ¹H: 7.26 ppm, ¹³C: 77.47 ppm). The chemical shift was displayed in δ (ppm), and TMS (tetramethylsilane) was taken as an internal standard. The signals of NMR multiplicities are assigned as s (singlet), d (doublet), dd (double doublet), t (triplet), q (quartet), and m (multiplet). Mass spectra of synthesized compounds were acquired with an Agilent 6538 Ultra High-Definition Accurate Mass-Q-TOF (LC-HRMS) instrument. Analytical thin-layer chromatography (TLC) was conducted using pre-coated aluminum sheets with silica gel 60–120 F254 (Merck) thickness (0.25 mm). The TLC plates were visualized in short-wavelength (254 nm). UV and long-wavelength (365 nm). UV lights and in an iodine gas chamber. Flash Column chromatography was conducted on silica gel (SRL No. 63025 mesh 200–400). Some of the reactions were performed under a dry N₂ atmosphere. The purity of target compounds was examined using Aquity ultra performance liquid chromatography (UPLC) united with Column X-bridge C-18 as well as a photo array detector (PDA). Samples were dissolved in dimethylsulfoxide (DMSO) and acetonitrile, and an injection of 1 μL was used. DMSO and acetonitrile were used as mobile gradient phase, and the flow rate was 1 mL/min. All the target compounds reported here displayed > 94% UPLC purity.

Synthesis of ethyl 4-(4-substituted phenyl)-6-methyl-2-oxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate 4(a-b)

To a stirred solution of substituted aldehyde (94 mmol), ethyl acetoacetate (100 mmol), and urea (94 mmol) in ethanol (40 mL) were treated with 4–5 drops of concentrated hydrochloric acid and heated to reflux for 5–6 h. The reaction mixture was cooled to room temperature, and the obtained solid was filtered, washed with cold water (3 × 50 ml), and dried under vacuum to afford pure intermediate ethyl 4-(4-substituted phenyl)-6-methyl-2-oxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate 4(a-b) as a white solid in 60–70% yield.

Synthesis of ethyl 4-(4-substituted phenyl)-6-methyl-2-oxo-1,2-dihydropyrimidine-5-carboxylate 5(a-b)

To a solution of 68–70% nitric acid (140 mL) in an open vessel was added portion-wise 4(a-b) (27.5 mmol) at 0°C. After stirring for 30 min at 0°C, the solution was left to reach room temperature and stirred for an additional 2–3 h. The reaction mixture was poured into crushed ice, neutralized with sodium carbonate (Na₂CO₃) (pH 7–8), and extracted with chloroform (CHCl₃) (3 × 300 mL). Combined organic layers were washed with water, brine, dried over sodium sufate (Na₂SO_4,) and concentrated in vacuo to afford the desired solid ethyl 4-methyl-6-oxo-2-phenyl-5,6-dihydropyridine-3-carboxylate derivatives 5(a-b)in 60–65% yield and used directly in the next step.

Synthesis of ethyl 2-chloro-4-(4-substituted phenyl)-6-methylpyrimidine-5-carboxylate 6(a-b)

Compound 5(a-b) (20 mmol) was refluxed in phosphorus oxychloride (210 mmol) at 105°C for 3–4 h. The resulting mixture was cooled to room temperature, and excess phosphorus oxychloride was reduced in vacuo. The reaction mass was poured into crushed ice, and extracted with ethyl acetate (3 × 100 mL). The combined ethyl acetate layer was dried over anhydrous sodium sulfate and evaporated under reduced pressure. Crude products were purified by column chromatography using Ethyl acetate/petroleum ether(20:80) as a mobile phase to obtain pure 6(a-b) in 70–72% yield.

Synthesis of ethyl 4-(4-substituted phenyl)-6-methyl-2-(piperazin-1-yl)pyrimidine-5-carboxylate 7(a-b)

In a round bottom flask, piperazine (90 mmol) was added to a solution of 6(a-b) (18 mmol) and potassium carbonate (K₂CO₃) (60 mmol) in CHCl₃ (60 ml) at room temperature. The reaction mixture was heated at 70–80°C for 4–5 h under the N₂atmosphere. The reaction progress was monitored through TLC (chloroform/methanol, 80:20). After completion of the reaction, the reaction was then diluted with CHCl₃(400 ml) and washed with water. Water layer was also washed with CHCl₃(2 × 150 ml). Combined organic layers were washed with brine, dried over anhydrous Na₂SO₄, and evaporated under reduced pressure. Crude products were purified by column chromatography using MeOH/CHCl₃(30:70) as a mobile phase to obtain pure 7(a-b) in 70–75% yield.

Synthesis of ethyl 4-(4-substituted phenyl)-6-methyl-2-(4-(prop-2-yn-1-yl)piperazin-1-yl)pyrimidine-5-carboxylate (S5 and U5)

To a stirred solution of 7(a-b)(94 mmol) and K₂CO₃ (60 mmol) in CHCl₃(70 mL), propargyl bromide (150 mmol) was added at room temperature and heated to reflux for 5 h under an N₂ atmosphere. TLC was used to monitor the progress of the reaction. The reaction was then diluted with CHCl₃ (500 mL), and organic layer was washed with water, brine and dried over anhydrous sodium sulfate, and evaporated under reduced pressure. Desired products were purified by column chromatography using ethyl acetate/Petroleum ether (30:70) as a mobile phase to obtain pure light-yellow solid compounds S5 and U5 in 55–60% yield.

ethyl 4-(4-methoxyphenyl)-6-methyl-2-(4-(prop-2-yn-1-yl)piperazin-1-yl)pyrimidine-5-carboxylate) (S5)

Pale yellow solid; yield 85%; mp 110–112°C. ¹H NMR (400 MHz, CDCl₃) δ 7.69 – 7.48 (m, 2H), 7.06 – 6.86 (m, 2H), 4.13 (q, J = 7.2 Hz, 2H), 4.03 – 3.98 (m, 4H), 3.86 (s, 3H), 3.38 (d, J = 2.4 Hz, 2H), 2.66 – 2.62 (m, 4H), 2.48 (s, 3H), 2.28 (t, J = 2.4 Hz, 1H), 1.07 (t, J = 7.2 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.9, 167.1, 165.2, 161.3, 160.6, 132.2, 130.2, 114.1, 78.9, 73.9, 61.4, 55.8, 52.2, 47.5, 43.9, 23.6, 14.2; HRMS in MeOH for C₂₂H₂₆N₄O₃ (Mol. wt = 394.2005 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 395.2091; calculated [M + H]⁺: 395.2078.UPLC purity: 95.27%.

ethyl 4-methyl-6-phenyl-2-(4-(prop-2-yn-1-yl) piperazin-1-yl)pyrimidine-5-carboxylate) (U5)

Off white solid; yield 80%; mp 87–89°C. ¹H NMR (400 MHz, Deuterated chloroform (CDCl₃) δ 7.62 – 7.56 (m, 2H), 7.44–7.40 (m, 3H), 4.06 (q, J = 7.2 Hz, 2H), 4.04 – 4.01 (m, 4H), 3.39 (d, J = 2.4 Hz, 2H), 2.67 – 2.62 (m, 4H), 2.51 (s, 3H), 2.28 (t, J = 2.4 Hz, 1H), 0.97 (t, J = 7.2 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.5, 167.5, 166.2, 160.6, 139.9, 129.8, 128.6, 114.7, 78.9, 73.9, 61.4, 52.2, 47.5, 43.9, 23.6, 14.0; HRMS in MeOH for C₂₁H₂₄N₄O₂ (Mol. wt = 364.1899 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 365.1996; calculated [M + H]⁺: 365.1972.UPLC purity: 97.35%.

Synthesis of substituted azidobenzene (10 a-f)

In a round bottom flask equipped with a magnetic stirring bar, substituted aniline was dissolved (10 mmol) with hydrochloric acid (HCl 6 N −11 mL) in an ice bath at 0–5 C. sodium nitrite (NaNO₂ (16 mmol in 30 mL of H₂O) was added dropwise and the reaction mixture was stirred for 30 min at 0–5°C. Next, a sodium azide solution (50 mmol in 55 mL of H₂O) was added dropwise at 0–5°C and stirred in the reaction mixture for about 30 min. After stirring for 30 min at 0–5°C, the system was stirred for an additional 2 h at room temperature. Next, the mixture was extracted with ethyl acetate (2 × 80 ml), and the combined organic extracts were washed with water brine and dried over anhydrous Na₂SO₄, filtered, and concentrated in vacuo. The residual crude product was used directly without purification.

Synthesis of ethyl 2-(4-((1-(3, 4- disubstituted fluorophenyl)-1H-1,2,3-triazol-4-yl)methyl)piperazin-1-yl)-4-(4-substituted phenyl)-6-methylpyrimidine-5-carboxylate (ZA1-ZA6 and ZB1-ZB6)

A 50 mL round bottom flask was charged with substituted alkyne (S5 and U5) (0.68 mmol) and substituted azide10(a-f) (0.68 mol) in tetrahydrofolate (THF, 20 ml). The solution of sodium ascorbate (0.36 mmol in a minimum amount of water) was added, followed by copper (II) sulfate pentahydrate solution (0.18 mmol in minimum water). The reaction mixture was vigorously stirred at 50–60°C for 3–4 h. After completing the reaction, as noticed by TLC analysis, the mixture was extracted with ethyl acetate (3 × 20 mL). The organic extracts were combined, and the resulting organic layer was washed with water, and brine, dried over anhydrous sodium sulfate, filtrated, and concentrated under reduced pressure. The residue was purified by column chromatography ethyl acetate/Petroleum ether (50:50) as a mobile phase to obtain the pure compound in 80–85% yield.

ethyl 4-(4-methoxyphenyl)-6-methyl-2-(4-((1-(p-tolyl)-1H-1,2,3-triazol-4-yl)methyl)piperazin 1-yl) pyrimidine-5-carboxylate) (ZA1)

Pale yellow solid; yield 80%; mp 98–100°C. ¹H NMR (400 MHz, CDCl₃) δ 7.96 (brs, 1H), 7.64 (d, J = 8.0 Hz, 2H), 7.59 – 7.55 (m, 2H), 7.33 (d, J = 8.0 Hz, 2H), 6.96 – 6.90 (m, 2H), 4.12 (q, J = 7.2 Hz, 2H), 4.01 (s, 4H), 3.87 (s, 2H), 3.85 (s, 3H), 2.67 (s, 4H), 2.48 (s, 3H), 2.43 (s, 3H), 1.06 (t, J = 6.8 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.9, 167.9, 167.1, 165.2, 162.3, 161.3, 160.6, 139.2, 132.2, 130.7, 130.2, 120.9, 114.4, 114.1, 62.5, 61.4, 55.8, 53.4, 44.0, 23.6, 21.5, 14.2; HRMS in MeOH for C₂₉H₃₃N₇O₃ (Mol. wt = 527.2645 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 528.2725; calculated [M + H]⁺: 528.2718.UPLC purity: 94.51%.

ethyl 4-(4-methoxyphenyl)-2-(4-((1-(4-methox yphenyl)-1H-1,2,3-triazol-4-yl)methyl)piperazin-1-yl)-6-methylpyrimidine-5-carboxylate (ZA2)

Pale yellow solid; yield 80%; mp 101–103°C. ¹H NMR (400 MHz, CDCl₃) δ 7.91 (s, 1H), 7.65 (d, J = 8.8 Hz, 2H), 7.57 (d, J = 8.8 Hz, 2H), 7.03 (d, J = 9.2 Hz, 2H), 6.93 (d, J = 8.8 Hz, 2H), 4.12 (q, J = 7.2 Hz, 2H), 3.99 (s, 4H), 3.88 (s, 2H), 3.85 (s, 6H), 2.65 (s, 4H), 2.47 (s, 3H), 1.06 (t, J = 7.2 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.9, 167.1, 165.2, 161.3, 160.6, 160.2, 145.1, 132.2, 130.2, 122.6, 121.5, 115.2, 114.3, 114.0, 61.4, 56.1, 55.8, 53.3, 43.9, 23.5, 14.2; HRMS in MeOH for C₂₉H₃₃N₇O₄ (Mol. wt = 543.2594 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 544.2695; calculated [M + H]⁺: 544.2667. UPLC purity: 94.26%.

ethyl 2-(4-((1-(3-chloro-4-fluorophenyl)-1H-1,2,3 -triazol-4-yl)methyl)piperazin-1-yl)-4-(4-methoxyphenyl)-6-methylpyrimidine-5-carboxylate (ZA3)

White solid; yield 80%; mp 91–92°C. ¹H NMR (500 MHz, CDCl₃) δ 7.86 (s, 1H), 7.79 (dd, J = 6.0, 2.5 Hz, 1H), 7.57 (ddd, J = 9.0, 4.0, 2.5 Hz, 1H), 7.48 (d, J = 8.5 Hz, 2H), 7.22 (dd, J = 17.0, 8.5 Hz, 1H), 6.84 (d, J = 8.5 Hz, 2H), 4.04 (q, J = 7.0 Hz, 2H), 3.91 – 3.87 (m, 4H), 3.76 (s, 3H), 3.74 (s, 2H), 2.56 – 2.52 (m, 4H), 2.38 (s, 3H), 0.98 (t, J = 7.0 Hz, 3H); ¹³C NMR (126 MHz, CDCl₃) δ 169.5, 166.7, 164.7, 160.9, 160.5, 158.9, 156.9, 145.5, 133.7, 131.8, 129.7, 122.9, 120.9, 120.2, 117.6, 113.6, 61.0, 55.4, 53.3, 52.9, 43.5, 23.1, 13.8.; HRMS in MeOH for C₂₈H₂₉ClFN₇O₃ (Mol. wt = 565.2004 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 566.2087; calculated [M + H]⁺: 566.2077.UPLC purity: 96.73%.

ethyl 4-(4-methoxyphenyl)-6-methyl-2-(4-((1-(3-(trifluoromethyl)phenyl)-1H-1,2,3-triazol-4-yl)methyl) piperazin-1-yl)pyrimidine-5-carboxylate)(ZA4)

White solid; yield 80%; mp 109–111°C. ¹H NMR (400 MHz, CDCl₃) δ 8.06 (s, 1H), 8.03 – 7.98 (m, 1H), 7.73 – 7.68 (m, 3H), 7.57 (d, J = 8.8 Hz, 2H), 6.93 (d, J = 8.8 Hz, 2H), 4.13 (q, J = 7.2 Hz, 2H), 4.01 – 3.97 (m, 4H), 3.87 (s, 2H), 3.85 (s, 3H), 2.67 – 2.62 (m, 4H), 2.48 (s, 3H), 1.06 (t, J = 7.2 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.9, 167.1, 165.2, 161.3, 160.6, 146.0, 137.9, 132.2, 131.0, 130.2, 125.8, 123.9, 121.2, 117.8, 114.4, 114.1, 61.4, 55.8, 53.8, 53.4, 44.3, 43.9, 23.5, 14.2; HRMS in MeOH for C₂₉H₃₀F₃N₇O₃ (Mol. wt = 581.2362 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 582.2447; calculated [M + H]⁺: 582.2435.UPLC purity: 94.98%.

ethyl 2-(4-((1-(3,4-difluorophenyl)-1H-1,2,3-triazol-4-yl)methyl)piperazin-1-yl)-4-(4-methoxyphenyl)-6-methylpyrimidine-5-carboxylate (ZA5)

Pale yellow solid; yield 80%; mp 96–98°C. ¹H NMR (400 MHz, CDCl₃) δ 7.95 (s, 1H), 7.69 (ddd, J = 10.4, 6.8, 2.4 Hz, 1H), 7.57 (d, J = 8.8 Hz, 2H), 7.53 – 7.47 (m, 1H), 7.34 (dd, J = 17.6, 9.2 Hz, 1H), 6.93 (d, J = 9.2 Hz, 2H), 4.13 (q, J = 7.2 Hz, 2H), 3.99 – 3.96 (m, 4H), 3.85 (s, 3H), 3.83 (s, 2H), 2.65 – 2.61 (m, 4H), 2.47 (s, 3H), 1.06 (t, J = 7.2 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.9, 167.1, 165.4, 161.4, 160.6, 133.9, 132.2, 130.2, 121.3, 118.9, 118.7, 116.7, 114.4, 114.1, 111.1, 110.9, 61.5, 55.8, 53.8, 53.4, 43.9, 23.5, 14.2; HRMS in MeOH for C₂₈H₂₉F₂N₇O₃ (Mol. wt = 549.2300 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 550.2390; calculated [M + H]⁺: 550.2373.UPLC purity: 98.13%.

ethyl 2-(4-((1-(4-fluorophenyl)-1H-1,2,3-triazol-4-yl) methyl)piperazin-1-yl)-4-(4-methoxyphenyl)-6-methylpyrimidine-5-carboxylate (ZA6)

off white solid; yield 80%; mp 93–95°C. ¹H NMR (400 MHz, CDCl₃) δ 7.96 (s, 1H), 7.78 – 7.70 (m, 2H), 7.57 (d, J = 8.8 Hz, 2H), 7.27 – 7.19 (m, 2H), 6.93 (d, J = 8.8 Hz, 2H), 4.13 (q, J = 7.2 Hz, 2H), 4.01 – 3.97 (m, 4H), 3.85 (s, 3H), 3.84 (s, 2H), 2.67 – 2.63 (m, 4H), 2.48 (s, 3H), 1.07 (t, J = 7.2 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.9, 167.2, 165.2, 161.3, 160.6, 145.4, 133.9, 132.2, 130.2, 122.9, 121.6, 117.3, 117.1, 114.1, 61.5, 55.8, 53.8, 53.3, 43.9, 23.6, 14.2; HRMS in MeOH for C₂₈H₃₀FN₇O₃ (Mol. wt = 531.2394 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 532.2493; calculated [M + H]⁺: 532.2467.UPLC purity: 95.43%.

ethyl 4-methyl-6-phenyl-2-(4-((1-(p-tolyl)-1H-1,2,3-triazol-4-yl)methyl)piperazin-1-yl)pyrimidine-5-carboxylate (ZB1)

White solid; yield 80%; mp 87–89°C. ¹H NMR (400 MHz, CDCl₃) δ 7.95 (s, 1H), 7.63 (d, J = 8.4 Hz, 2H), 7.58 (dd, J = 6.8, 2.0 Hz, 2H), 7.44 – 7.40 (m, 3H), 7.33 (d, J = 8.0 Hz, 2H), 4.06 (q, J = 7.2 Hz, 2H), 4.02 – 3.97 (m, 4H), 3.83 (s, 2H), 2.67 – 2.62 (m, 4H), 2.50 (s, 3H), 2.44 (s, 3H), 0.96 (t, J = 7.2 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.5, 167.5, 166.1, 160.6, 145.2, 139.9, 139.2, 135.3, 130.7, 129.8, 128.6, 121.3, 120.9, 114.6, 61.4, 53.9, 53.4, 43.9, 23.6, 21.5, 14.0; HRMS in MeOH for C₂₈H₃₁N₇O₂ (Mol. wt = 497.2539 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 498.2624; calculated [M + H]⁺: 498.2612.UPLC purity: 98.17%.

ethyl 2-(4-((1-(4-methoxyphenyl)-1H-1,2,3-triazol-4-yl)methyl)piperazin-1-yl)-4-methyl-6-phenylpyrimidine-5-carboxylate (ZB2)

White solid; yield 80%; mp 89–91°C. ¹H NMR (400 MHz, CDCl₃) δ 7.90 (s, 1H), 7.65 (d, J = 8.8 Hz, 2H), 7.60 – 7.55 (m, 2H), 7.44 – 7.35 (m, 3H), 7.03 (d, J = 9.2 Hz, 2H), 4.06 (q, J = 6.8 Hz, 2H), 4.01 – 3.97 (m, 4H), 3.88 (s, 3H), 3.82 (s, 2H), 2.66 – 2.62 (m, 4H), 2.50 (s, 3H), 0.96 (t, J = 7.2 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.5, 167.5, 166.1, 160.6, 160.3, 145.2, 139.9, 131.1, 129.8, 128.6, 122.6, 121.5, 115.2, 114.6, 61.4, 56.1, 53.9, 53.4, 43.9, 23.6, 14.0; HRMS in MeOH for C₂₈H₃₁N₇O₃ (Mol. wt = 513.2488 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 514.2565; calculated [M + H]⁺: 514.2561.UPLC purity: 98.78%.

ethyl 2-(4-((1-(3-chloro-4-fluorophenyl)-1H-1,2,3 -triazol-4-yl)methyl)piperazin-1-yl)-4-methyl-6-phenylpyrimidine-5-carboxylate (ZB3)

Pale yellow solid; yield 80%; mp 123–125°C. ¹H NMR (500 MHz, CDCl3) δ 7.91 (s, 1H), 7.86 (dd, J = 6.5, 3.0 Hz, 1H), 7.64 (ddd, J = 9.0, 4.0, 2.5 Hz, 1H), 7.58 – 7.53 (m, 2H), 7.44 – 7.38 (m, 3H), 7.31 (t, J = 8.5 Hz, 1H), 4.04 (q, J = 7.5 Hz, 2H), 3.99 – 3.95 (m, 4H), 3.81 (s, 2H), 2.63 – 2.59 (m, 4H), 2.48 (s, 3H), 0.94 (t, J = 7.0 Hz, 3H); ¹³C NMR (126 MHz, CDCl3) δ 169.08, 167.05, 160.18, 159.32, 156.94, 145.63, 139.49, 129.40, 128.16, 128.11, 123.00, 120.81, 120.21, 120.15, 117.75, 117.57, 114.22, 60.96, 53.36, 52.95, 43.57, 23.19, 13.56; HRMS in MeOH for C₂₇H₂₇ClFN₇O₂ (Mol. wt = 535.1899 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 536.1981; calculated [M + H]⁺: 536.1972.UPLC purity: 96.25%.

ethyl 4-methyl-6-phenyl-2-(4-((1-(3-(trifluoromet hyl)phenyl)-1H-1,2,3-triazol-4-yl)methyl)piperazin-1-yl)pyrimidine-5-carboxylate (ZB4)

White solid; yield 80%; mp 96–98°C. ¹H NMR (400 MHz, CDCl₃) δ 8.06 (s, 1H), 8.03 – 7.99 (m, 1H), 7.73 – 7.68 (m, 2H), 7.60 – 7.56 (m, 3H), 7.44 – 7.39 (m, 3H), 4.06 (q, J = 7.1 Hz, 2H), 4.02 – 3.98 (m, 4H), 3.85 (s, 2H), 2.67 – 2.63 (m, 4H), 2.50 (s, 3H), 0.96 (t, J = 7.2 Hz, 3H); ¹³C NMR (101 MHz, CDCl₃) δ 169.5, 167.5, 166.1, 160.6, 146.1, 139.9, 137.9, 133.1, 131.0, 129.8, 128.6, 125.8, 123.9, 121.2, 117.8, 114.7, 61.4, 53.8, 53.4, 43.9, 23.6, 14.0; HRMS in MeOH for C₂₈H₂₈F₃N₇O₂ (Mol. wt = 551.2257 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 552.2346; calculated [M + H]⁺: 552.2329.UPLC purity: 99.04%.

ethyl 2-(4-((1-(3,4-difluorophenyl)-1H-1,2,3-triazol-4-yl)methyl)piperazin-1-yl)-4-methyl-6-phenylpyrimidine-5-carboxylate (ZB5)

Pale yellow solid; yield 80%; mp 98–100°C. ¹H NMR (500 MHz, CDCl₃) δ 7.85 (s, 1H), 7.64 – 7.57 (m, 1H), 7.48 (dd, J = 7.0, 1.5 Hz, 2H), 7.41 (dd, J = 8.5, 3.5 Hz, 1H), 7.34 – 7.29 (m, 3H), 7.26 (dd, J = 17.5, 9.0 Hz, 1H), 3.97 (q, J = 7.0 Hz, 2H), 3.92 – 3.88 (m, 4H), 3.74 (s, 2H), 2.56 – 2.52 (m, 4H), 2.41 (s, 3H), 0.87 (t, J = 7.0 Hz, 3H); ¹³C NMR (126 MHz, CDCl₃) δ 169.1, 167.0, 165.7, 160.2, 145.6, 139.5, 129.4, 128.2, 128.1, 120.8, 118.5, 118.3, 116.3, 114.2, 110.7, 110.5, 60.9, 53.3, 52.9, 43.5, 23.2, 13.6; HRMS m/z in MeOH for C₂₇H₂₇F₂N₇O₂ (Mol. wt = 519.2194 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 520.2289; calculated [M + H]⁺: 520.2267.UPLC purity: 97.13%.

ethyl 2-(4-((1-(4-fluorophenyl)-1H-1,2,3-triazol-4-yl) methyl)piperazin-1-yl)-4-methyl-6-phenylpyrimidine-5-carboxylate (ZB6)

Pale yellow solid; yield 80%; mp 89–91°C. ¹H NMR (500 MHz, CDCl₃) δ 7.84 (s, 1H), 7.64 (dd, J = 9.0, 4.5 Hz, 2H), 7.48 (dd, J = 7.0, 1.5 Hz, 2H), 7.36 – 7.29 (m, 3H), 7.17 – 7.11 (m, 2H), 3.97 (q, J = 7.0 Hz, 2H), 3.91 – 3.88 (m, 4H), 3.73 (s, 2H), 2.56 – 2.52 (m, 4H), 2.41 (s, 3H), 0.87 (t, J = 7.0 Hz, 3H); ¹³C NMR (126 MHz, CDCl₃) δ 168.1, 166.0, 164.7, 160.4, 159.15, 144.2, 138.5, 128.4, 127.1, 121.5, 121.4, 119.9, 115.8, 113.2, 59.9, 52.4, 51.9, 42.5, 22.2, 12.5; HRMS in MeOH for C₂₇H₂₈F₁N₇O₂ (Mol. wt = 501.2289 g mol⁻¹) (ESI, m/z): observed [M + H]⁺: 502.2389; calculated [M + H]⁺: 502.2361.UPLC purity: 98.67%.

X-ray Crystallographic Procedure

The Crystal structure of compounds ZB4, ZB5, and ZB6 were acquired by single-crystal X-ray diffraction method. The colorless rectangular block crystals of complex ZB4, ZB5, and ZB6 were obtained from a mixture of methanol and chloroform on slow evaporation. These crystals were mounted on loops with mineral oil. All the geometric data and intensity data were determined by an automated Bruker SMART APEX CCD diffractometer equipped with a refined focus sealed tube (1.75 kW) Mo Kα X-ray source (λ = 0.71073 Å) with increasing ω (per frame width 0.3°) at 5 s frame⁻¹ scanning speed. ω-2θ scan mode was utilized to collect intensity data and then corrected for Lorentz-polarization and absorption effects [55]. The crystal structures were solved and refined using WinGx suit of programs (version 1.63.04a) via SHELXL-2013 method [56]. All non-hydrogen atoms were refined with coefficients of anisotropic displacement, and non-hydrogen atoms coordinates were allowed to be on their respective carbon atoms. The atomic position of all atoms, isotropic thermal parameters for hydrogen atoms, and anisotropic thermal parameters for non-hydrogen was implicated in the final refinement. The structural view of crystallized molecules (ZB4, ZB5, and ZB6) ORTEP was procured with ORTEP[57]. In addition, the details like crystallographic parameters, bond distances, and angles data are given in Table I. The CCDC deposition numbers for ZB4 are 2005969, ZB5 is 2005972, and ZB6 is 2005973.

Table I.

Selected Crystal Data and Structure Refinement for ZB4, ZB5 and ZB6

	ZB4	ZB5	ZB6
Empirical formula	C28H28F3N7O2	C27H27F2N7O2	C27H28FN7O2
Fw/g M−1	551.57	519.55	501.56
Crystal system	Triclinic	Triclinic	Triclinic
Space group	Pī	Pī	Pī
a/Å	10.5035(8)	10.0153(7)	9.9286(14)
b/Å	11.2643(9)	10.5517(8)	10.5571(15)
c/Å	12.6542(11)	13.4443(10)	13.5141(19)
α/°	80.614(3)	81.693(2)	82.000(4)
β/°	80.977(2)	77.723(2)	76.653(4)
γ/°	71.151(2)	72.327(2)	72.849(4)
V/Å3	1389.2(2)	1317.88(17)	1313.1(3)
Z	2	2	2
T, K	298	298(2)	296(2)
ρcalcd/Mg m−3	1.319	1.309	1.269
λ/Å (Mo-Kα)	0.71073 Å	0.71073 Å	0.71073 Å
Data/restraints/param	4876/7/363	4625/0/356	4333/0/347
F(000)	576	544	528
GOF	1.102	1.063	1.028
R(Fo),a I > 2 σ(I) [wR(Fo)b]	0.0832 [0.2576]	0.0529 [0.1476]	0.0812 [0.1712]
R (all data) [wR (all data)]	0.1214 [0.2825]	1.063 [0.1576]	0.1530 [0.1967]
Largest diff peak, hole (e Å−3)	0.766, −0.350	0.207, −0.209	0.181, −0.2056
w = 1/[(σFo)2 + (AP)2 + (BP)]	A = 0.1574	A = 0.0801	A = 0.0897
	B = 0.3668	B = 0.2397	B = 0.2619

^aR = Σ∣∣F_o∣–∣F_c∣Σ/∣∣F_o∣.

^bwR = {Σ[w(F_o²– F_c²)²]/Σ[w(F_o)²]}^1/2,where P = (F_o² + 2F_c²)/3

Biological Evaluation

Cell Culture

Human neuroblastoma SH-SY5Y cells (neuroblastoma derived from a metastatic bone tumor) were incubated at 37°C in a humidified atmosphere containing 5% CO₂. The cells were cultured in a 50:50 (DMEM/F12) medium (HyClone, ThermoScientific, West Palm Beach, FL, USA) with10% fetal bovine serum (FBS) and 1% penicillin/streptomycin.SH-SY5Y were seeded at a density of 0.5 × 10⁵ cells/well on poly-D-lysine (PDL) coated 24-well culture plates for MTT viability assays. For ER stress study, SH-SY5Y cells were plated at a density of 2X10⁵ cells/well on Poly-D-lysine coated 6-well culture plates. After 24 h of incubation, qRT-PCR and western blotting were conducted.

Human microglia clone 3 cells (HMC3, derived from the human fetal brain) were grown in a 50:50 (DMEM/F12) medium with 5% horse serum (HR), 5% fetal bovine serum (FBS), and 1% penicillin/streptomycin. HMC3 cells were plated at a density of 0.1X10⁵ cells/well on PDL coated 24-well culture plates to assess the inflammatory activity using ELISA and NO assays.

Treatment With Tunicamycin

Tunicamycin was obtained from Sigma-Aldrich (Catalog# T7765-1MG)and dissolved in DMSO at a 10 mg/mL concentration as a stock solution. SH-SY5Y media was replaced with serum/ penicillin/streptomycin-free media. SH-SY5Y cells were treated with different concentrations of tunicamycin (1, 2, 5, and 10 μg/mL) or treated with the tunicamycin (5 μg/mL) and the 14 target compounds (0.5, 1, 5, 10, 20, and 50 μM) for 24 h followed by cell viability assessment.

Oxygen–Glucose Deprivation/Reperfusion (OGD/R)

SH-SY5Y cells were deprived of oxygen and glucose as previously described [58]. Briefly, the growth medium was removed and replaced with a glucose-free medium (sterile HBSS media, (3.5 mM KCl, 140 mM NaCl, 5 mM NaHCO3, 0.4 mM KH2PO4, 1.2 mM MgSO4, 1.3 mM CaCl2, 20 mM HEPES, pH 7.5, bubbled with 95% N2 and 5% CO2) and placed in the incubator at 37°C for 1.5 h in a tightly closed oxygen-free chamber. The HBSS media was replaced with a fresh growth medium along with treatment (14-compounds) for 24 h to simulate reperfusion.

Assessment of Cell Viability

The cells were treated with tunicamycin or with tunicamycin and different compounds for 24 h, and cell viability was determined using the 3-[4,5 dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich) according to the manufacturer’s instructions. Briefly, the cells were incubated with MTT (0.5 mg/ mL) for 3 h at 37°C. The media was removed, and DMSO was added to dissolve formazan crystals. The optical density (OD) was analyzed at 540 nm on a microplate reader (SynergyH1, BioTek, U.S.A.). At least three independent experiments were performed.

Lipopolysaccharide (LPS) Induced Microglial Activation

LPS was purchased from Sigma-Aldrich (Catalog# L6529-1MG) and dissolved in PBS at a 1 mg/mL concentration as a stock solution. HMC3 media was replaced with serumfree media. LPS (100 ng/mL) was used to stimulate HMC3 microglia cells in all experiments. The cell supernatant was collected to measure the NO and TNF-α levels using Griess and ELISA assays.

Griess Assay

HMC3 cells were plated in 24-well plates, treated with 100 ng/mL LPS for 24 h followed by 10 μM compound treatment for another 24 h. Cell culture media from the different wells was mixed with an equal volume of Griess reagents (1:1 ratio) (reagent A, 1% sulphanilamide dissolved in 5% phosphoric acid, and reagent B, 0.1% naphthyl ethylenediamine dihydrochloride dissolved in deionized water)and analyzed by colorimetry at 540 nm.

ELISA Assay

HMC3 cells were cultured in 24-well plates and then stimulated with LPS (100 ng/mL) for 24 h. After that, they were treated with 10 μM compounds for another 24 h. According to the manufacturer protocol, the levels of TNF-α released into the cell culture medium were quantified using a commercially available ELISA kit (R and D system, Minneapolis, MN, USA, Catalog# DY2100-05).

RNA isolation and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Cells were treated with (5 μg/mL) tunicamycin and 10 μM of compounds (ZA2 to ZA6and S5) for 24 h. Total RNA was isolated using the TRIzol reagent (Thermo Fisher Scientific), and 20 μL of M-MuLVreverse transcriptase was used to dilute 1 μg of RNA, and this mix was used to synthesize cDNA with a cDNA synthesis kit. To study the gene expression of BiP, CHOP and PDI, quantitative real-time PCR was performed using the 2 × Universal Cyber Green supermix (catalog# 172–5270 from Bio-Rad) and quantitative realtime PCR (Bio-RadSystem) according to the manufacturer specifications. The sequence of the primers used for amplification was the following: BiP, Forward, ACGGGCAAAGATGTCAGGAAG, reverseAGGGCCTTGGCCTTTTCTACC; CHOP, ATGAACGGCTCAAGCAGGAA, reverse GGGAAAGGTGGGTAGTGTGG; and PDI, forward TCCAGGACACACCCTAGAAC, reverse AGTCGAGTCCATCTTGGCGA; β-Actin, forward GATTCCTATGTGGGCGACGA; reverse TGTAGAAGGTGTGGTGCCAG; The relative gene expressions were determined by the 2 −ΔΔCT method for real-time quantitative PCR.

Western Blot Analysis

Cells were treated with tunicamycin (5 μg/mL) and 10 μM of compounds (ZA2 to ZA6 and S5) for 24 h. Cells were washed with 1 × PBS, and cell lysate was prepared in ice-cold lysis buffer (1%Triton X-100, 1% deoxycholate, and 0.1% sodium dodecyl sulfate). Protein concentration was determined using the Bradford assay (Bio-Rad; Hercules, CA, USA). Total protein in each sample (25 μg) was resolved using 10% SDS–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidenedifluoride (PVDF) membrane, and incubated with the appropriate antibodies. The proteins were visualized using an enhanced chemiluminescence detection system (Thermo Fisher Scientific, USA) with horseradish peroxidase-conjugated anti-rabbit or secondary antibody. Western blotting was used to determine the levels of BiP (1:1000 dilution), Cleaved caspase 3 (1:1000 dilution), caspase 3 (1:1000 dilution), and β-actin (1:3000) used as a loading control (Cell Signaling Technology, USA).

Docking Studies

The molecular docking was performed to determine the potential binding interaction of drug molecules with ATF4 and NF-kB. The coordinates of the ATF4 and NF-kB were obtained from RCSB in protein databank (PDB) format having PDB ID: 1CI6 and 1LE9, respectively [59]. The docking was performed for protein by removing the co-crystallized DNA and water from NF-kB and water from ATF4. AutoDock 4.2 software was used for molecular docking using Lamarckian genetic algorithm (LGA) [60]. During molecular docking, the protein was fixed, and drug molecules were allowed to move in the conformational space. Docking of ZA2, ZA3, ZA4, ZA5, and ZA6 with ATF4 was done using a grid size of 58 Å x 84 Å x 40 Å. The size of the grid box in docking of NF-kB was taken as 30 Å x 30 Å x 30 Å. Rest of the docking parameters were as described in an earlier study [61].

Results and Discussion

Pyrimidine and triazole derivatives have shown promising pharmacological scaffolds and are the scaffolds of many essential drugs. These nitrogen-rich scaffolds are well-known heterocyclic backbones that act on different pharmacological targets and exhibit neuroprotective properties [35, 36]. Additionally, these scaffolds have been demonstrated to have antibacterial, anticancer, antifungal, anti-tubercular, antimalarial, antiviral, and anti-neurodegenerative properties [37-40]. In recent years, the design and modification of neuroprotective agents based on triazole and pyrimidinelinked hybrids have remained the research focus for developing novel compounds. In the present work, two phenylpyrimidine carboxylates were conjugated with differently substituted phenyl triazoles through a piperazine linker in an attempt to enhance the neuroprotective and anti-neuroinflammatory properties. The pyrimidine 5-carboxylate scaffold is extensively used for designing and synthesizing neuroprotective and anti-neuroinflammatory agents. We designed new triazole-pyrimidine-based compounds as potential neuroprotective agents. The compounds were developed based on different pharmacophore combination strategies (Fig. 1. Compound I (benzyl 7-(4-hydroxy-3-methoxyphenyl)-5-methyl-4,7-dihydrotetrazolo[1,5-a]pyrimidine-6-carboxylate) (Fig. 1) was found to reduce MPTP-induced death in dopaminergic neurons and improved behavior deficiencies in Zebrafish, promoting the quest for their possible neuroprotective activities. The protective action of compound I against MPP⁺ toxicity in SH-SY5Y cells was observed by restoring dysfunctional changes in mitochondrial membrane potential and various apoptotic regulators [41]. Li et al. recently explored the therapeutic effects of compound I on ischemic stroke. Compound I displayed neuroprotection against transient middle cerebral artery occlusion (MCAO)-induced ischemic injury by reducing apoptosis, blood – brain barrier disruption, microglial M1 activation, and increased M2 polarization. Furthermore, compound I also displayed neuroprotective properties against OGD/R-induced cell death. Compound I inhibited microglial activation by blocking NF-κB signaling and increasing cAMP-response element-binding protein (CREB) and phosphorylation of protein kinase A (PKA) [42]. Tacrine-1,4-dihydropyridine (II) hybrids (Fig. 1) exhibited a selective and potent acetylcholinesterase inhibitory activity and displayed a compelling neuroprotective profile and modest Ca²⁺ channel blockade effect [43]. Pyrimidine carboxylate derivative(III) (Fig. 1) significantly inhibited the acetylcholinesterase activity and Aβ aggregation with promising neuroprotection and antiinflammatory properties [44]. The compound 4-methyl-2-(1,2,3,6-tetrahydropyridin-4-yl)pyrimidine (IV) (Fig. 1) displayed the most effective 5-HT1A receptor potency with 1000-fold selectivity for both α1-adrenergic and D2 receptors and exhibited prominent neuroprotective activities in the t-MCAO model [45]. Compound (E)-3-(1-(((1-(3-nitrophenyl)-1H-1,2,3-triazole-4-yl)methoxy)imino) ethyl)-2H-chromen-2-one (V) (Fig. 1) displayed highest cell viability against H₂O₂-induced cell death in PC12 cell line at a concentration 50 μg/ml and exhibited effective neuroprotective properties with reduced toxicity [46].

Fig. 1.

DesignStrategy for novel triazole-pyrimidine hybrids as neuroprotective/anti-neuroinflammatory agents.

In this study, phenyl-pyrimidine carboxylate core was retained in the designed compounds to maintain the neuroprotective and anti-inflammatory properties. The designed triazole-pyrimidine derivatives were synthesized and biological evaluation against OGD/R, ER stress, and neuroinflammation models was determined. Molecular docking studies also suggest that the designed triazolepyrimidine derivatives had a favorable interaction with the active site of ATF4 and NF-kB proteins, which are involved in the regulation of ER stress and inflammatory cytokine synthesis.

Chemistry

The synthetic route for the design of 6-methyl pyrimidine-5-carboxylate derivatives is shown in Scheme 1. In Scheme 1, the intermediate compounds 4(a-b) were synthesized via Biginelli-reaction three components in one pot, between substituted aldehyde 1(a-b), ethyl acetoacetate (2), and urea (3) in ethanol in the presence of HCl as a catalyst. To obtain 5(a-b) intermediate,4 (a-c) were oxidized with nitric acid at room temperature. The derivatives 5(a-b) were refluxed in POCl₃ to obtain 6(a-b). The 6(a-b) were reacted with piperazine in CHCl₃ solvent in the presence of base K₂CO₃ to get 7(a-b). To obtain S5 and U5, the 7(a-b) were reacted with propargyl bromide in CHCl₃ solvent in the presence of the same base K₂CO₃. On the other hand, the different phenyl azides 10(a-l) were synthesized from different anilines9(a-f), as shown in Scheme 1. Finally, target compounds pyrimidine-1,2,3-triazoles (ZA1-ZA6 and ZB1-ZB6) derivatives were synthesized via Huisgen 1,3 dipolar addition [47-49] of the substituted alkyne (S5 and U5) with phenyl azide derivatives 10(a-l) in mixture H₂O: THF solvent in the presence of CuSO₄.5H₂O and sodium ascorbate. All the target compounds were purified by column chromatography. The structure of synthesized target compounds was confirmed by ¹HNMR, ¹³CNMR, and High-resolution mass spectrometry (HRMS). The ¹HNMR for CH₃- and CH₂- protons of carboxylate-pyrimidine in all final compounds were observed as a triplet and quartet peak in the range δ 0.87–1.07 and δ 3.97–4.13 ppm, respectively. The peak for CH₃ of pyrimidine ring was observed as a singlet in the range δ 2.38–2.50 ppm. The two ¹HNMR peaks of piperazine ring were detected in the range of δ 3.91–4.02 and δ2.56–2.67 ppm. The peak for −OCH₃ of phenyl-pyrimidine ring was found in the range δ 2.38–2.50 ppm as a singlet peak. The triazole C-H peak de-shielded more and was detected as a singlet in the region δ 7.84–8.06 ppm. Protons of other aromatic substituents of the compounds were examined as expected. In a similar fashion common carbon peaks for synthesized triazole pyrimidine hybrids were observed in their respective positions in ¹³C NMR spectra. The peak for methyl and ethyl of carboxylate-pyrimidine was observed around δ 14 and 61.5 ppm, respectively. In all compounds, the methyl of pyrimidine ring was found around δ 23 ppm. The two carbon peaks of piperazine ring were detected in the region δ 52–53 ppm. The carbon peak of CH₂ between the triazole and piperazine was found to be around δ 61 ppm. The carbon atoms of the aromatic substituents were found to be placed at the expected positions in the aromatic region. Besides, ZB4, ZB5, and ZB6 were further characterized by X-ray crystallography. The purity of all target compounds was determined by TLC and UPLC (ultra-performance liquid chromatography). The ESI-mass spectra of all the target compounds S5, U5, ZA1-ZA6, and ZB1-ZB6 in MeOH displayed [M + H]⁺ under m/z calculated values.

Scheme 1. Reagents and conditions:

(i) EtOH, cat. HCl, reflux(5–6 h); (ii) HNO₃ (68–70%), 0°C to rt; (iii) POCl₃, reflux 3–4 h (iv)Piperazine, K₂CO₃, CHCl₃, reflux4-5 h; (v) propargyl bromide, K₂CO₃, CHCl₃, reflux5 h; N₂(vi) NaNO₂, HCl 6 N; NaN₃, 0°C to rt; (vii) CuSO₄.5H₂O, sodium ascorbate, H₂O: THF, 50–60°C, 3 h.

Crystallography Study

Compound ZB4, ZB5, and ZB6 were structurally characterized via single-crystal X-ray crystallography (Fig. 2 and Table I, and Figures S47 – S52 supporting information). The compounds ZB4 (Fig. 2A), ZB5 (Fig. 2B), and ZB6 (Fig. 2C) were all crystallized in Pī space group of the triclinic crystal system. The unit-cell packing diagram of ZB4, ZB5, and ZB6 displayed the H-bonding interaction between the H-atoms of the aromatic phenyl ring and triazole ring with O-donor of carboxylate group of the pyrimidine ring and ZB5 and ZB6 showed the H-bonding interaction between the H-atom of piperazine and N-donor atom of the pyrimidine ring. The distance between the O-donor atom and H-atom of the triazole group in compounds ZB4, ZB5, and ZB6 is 2.365, 2.371, and 2.379 Å, respectively. The distance between the O-donor atom and H-aromatic phenyl group in compounds ZB4, ZB5, and ZB6 is 2.365, 2.393, and 2.430 Å, respectively. The distance between the N-donor atom of pyrimidine and H-atom of the piperazine group in compounds ZB5 and ZB6 is 2.736 and 2.739 Å, respectively. The unit cell packing diagrams of ZB4, ZB5, and ZB6 showed short contact bonding with adjacent atoms. All the unit cell packing diagrams of respective ZB4, ZB5, and ZB6 compounds is given in supporting information (Figures S47 – S52 supporting information).

Fig. 2.

ORTEP diagram of compounds ZB4 (A), ZB5 (B), and ZB6 (C) (50% probability level of thermal ellipsoids). Color codes: Carbon, light blue; Nitrogen: lavender; Oxygen: red and Fluorine, green. Hydrogen atoms are hidden for clarity.

Biological Evaluation

Neuroprotective Properties of Synthesized Compounds

We first assessed whether compounds are toxic to SH-SY5Y cells. We treated SH-SY5Y cells with different concentrations of 14 compounds, and after 24 h, we performed MTT assay and observed no toxicity (Figure S1 supporting information). Next, we evaluated the neuroprotective properties of ZA1-ZA6, ZB1-ZB6, S5, and U5 in the SH-SY5Y cell line subjected to the OGD/R model, followed by an MTT assay to assess the cell viability. SH-SY5Y cells were exposed to OGD for 90 min and 24 h of reperfusion. Different compounds (ZA1 to ZA6, ZB1 to ZB6, and intermediates S5 and U5) with concentrations (1, 5, and 10 μM) were added to the cell cultures after OGD and at the time of reperfusion. After 24 h of reperfusion, cells were harvested for MTT assay. OGD/R induced ~ 35–40% cell death compared to control (p < 0.001). Control cells were not exposed to OGD/R and left in the growth medium; therefore, 100% cell survival. Neuroprotective was reported as a percent change relative to control. Among 14 candidate compounds, nine (ZA3 to ZA5, ZB2 to ZB6, and intermediate S5) showed increased cell viability compared with the OGDgroup (Fig. 3a and b). These nine compounds showed 16–11% cell viability at concentrations of 1, 5, and 10 μM. The ZA1, ZA2, ZA6, ZB1, and intermediate U5 showed negligible neuroprotection. According to the results of pharmacological screening, IC₅₀ values for ZA3 to ZA5, ZB2 to ZB6, and intermediate S5 were determined in SHSY5Y cells subjected to OGD at concentrations of 0.5, 1, 10, 20, and 50 μM. It was found that the nine selective compounds exhibit significant neuroprotective activities with IC₅₀ ranging from 11.00 μM to 34.71 μM (Table II supporting).

Fig. 3.

(a and b): Neuroprotective properties of various synthesized compounds in OGD/R model: SH-SY5Y cells were exposed to OGD for 90 min, and at reperfusion, compounds ZA1-ZA6, ZB1-ZB6, U5, and S5 (1, 5, and 10 μM), were added for 24 h. MTT assay was performed for cell viability. Data expressed as mean ± SEM where the p < 0.05 was considered significant. ^#Difference within control and OGD (^###p < 0.001). *Difference within different concentrations relative to OGD/R (**p < 0.01, ***p < 0.001). (One way ANOVA followed by Tukey’s post hoc comparisons, n = 3 independent experiment).

Table II.

The IC₅₀ Values From Survival Curves

Compounds	IC50 ± SEM (μM)
ZA3	11.00 ± 1.76
ZA4	34.71 ± 1.56
ZA5	19.64 ± 1.95
ZB2	28.10 ± 1.89
ZB3	13.13 ± 1.63
ZB4	17.13 ± 1.55
ZB5	19.61 ± 2.04
ZB6	20.75 ± 1.54
S5	27.73 ± 4.19

Anti-Neuroinflammatory Properties of Lead Compounds

Next, our objective was to investigate the anti-neuroinflammatory properties of active compounds that showed increased cell viability, including ZA3-ZA5, ZB2-ZB6, and intermediate S5. HMC3 cells were challenged with LPS (100 ng/mL) for 24 h to release nitric oxide (NO) and tumor necrosis factor-alpha (TNF-α), followed by treatments with 5 and 10 μM ZA3 to ZA5, ZB2 to ZB6, and intermediate S5 for another 24 h. Griess assay was performed to measure NO release, which was significantly increased after LPS (p < 0.001) insult and reduced with the treatment of 5 and 10 μM of ZA3 to ZA5, ZB2 to ZB6, and intermediate S5 (p < 0.001) (Fig. 4a and b). The levels of TNF-α were significantly diminished with the treatment of 5 μM of ZA4 to ZA5 and ZB2 to ZB5, and intermediate S5; or by 10 μM of ZA3 to ZA5, ZB2 to ZB6, and intermediate S5 in LPS-stimulated HMC3 cells (Fig. 5a and b). These results are consistent with the cell viability of the test compounds and indicate that the nine compounds have potential neuroprotective properties and anti-neuroinflammatory properties.

Fig. 4.

Anti-neuroinflammatory properties of synthesized compounds in LPS-challenged HMC3 cells. HMC3 cells were treated with LPS (100 ng/mL) for 24 h followed by treatment with (a) 5 and (b) 10 μM of compounds ZA3 to ZA5, ZB2 to ZB6 and intermediate S5. After 24 h incubation, the supernatants (100 μl) were mixed with Griess reagents (100 μl). NO release data represented as mean ± SEM, where the p < 0.05 was considered significant. ^#Difference within control and LPS (^###p < 0.001).* Difference within groups relative to LPS (***p < 0.001, n = 3, one way ANOVA followed by Tukey’s post hoc comparisons).

Fig. 5.

Anti-TNF-α effects of synthesized compounds in LPS-stimulated HMC3 cells. HMC3 cells were treated with LPS (100 ng/mL) for 24 h followed by addition of (a) 5 and (b) 10 μM of compounds, ZA3 to ZA5, ZB2 to ZB6 and intermediate S5. After 24 h incubation, the supernatants were taken and TNF-α level was measured by ELISA. The TNF-α release data represented as mean ± SEM, where the p < 0.05 was considered significant. ^#Difference within control and LPS (^###p < 0.001).*Difference within groups relative to LPS (*p < 0.05***p < 0.001, n = 3, one way ANOVA followed by Tukey’s post hoc comparisons).

Anti-ER Stress Properties of Synthesized Compounds

We further investigated the protective effects of Triazole-Pyrimidine hybrids compounds (ZA1-ZA6, ZB1-ZB6, S5, and U5 on ER stress induced by tunicamycin in SH-SY5Y cells. First, we aimed to optimize the effects of tunicamycin in SH-SY5Ycells in our experimental conditions. SH-SY5Y cells were treated with tunicamycin at different concentrations (1, 2, 5, and 10 μg/mL) for 24 h, and cell viability was assessed using MTT assay. Reduction of cell viability was observed after 24 h with 1, 2, 5, and 10 μg/mL of tunicamycin. We observed cell death; ~ 40% for 1 and 2 μg/mL and ~ 50% for 5 and 10 μg/mL compared to the control (Figure S2 supporting information). Untreated control cells (0 μg/mL) were 100% viable. Tunicamycin treatment (5 μg/mL) to SH-SY5Y cells reduced viability (~ 50% ± 0.38, vs. control, p < 0.001), which was equal to ~ IC₅₀, therefore, we used 5 μg/mL concentration for the rest of the experiments. SH-SY5Y cells were treated with tunicamycin (5 μg/mL) in the absence or presence of different compounds (ZA1to ZA6, ZB1 to ZB6, intermediates S5 and U5) at different concentrations (1, 5, and 10 μM) for 24 h followed by MTT assay to assess cell death. A series of ZA derivatives and intermediate S5 exhibited a neuroprotective effect against ER stress (Fig. 6a and b). Neuroprotection was reported as a percent change relative to the control group. Compounds ZA2 to ZA6 and intermediate S5 showed significant viability at 10 μM. In addition, compounds ZA5 and intermediate S5 were observed to have significant protection with concentrations of 5 μM. Among these six compounds, ZA4 and ZA5 showed the strongest protective activity with recovery up to (89.30% and 89.72%, respectively), followed by ZA6, ZA2, ZA3, and intermediate S5 (88.84%, 83.44%, 78.57%, and 65.07%, respectively) (p < 0.01). Compounds ZA1, ZB1 to ZB6, and intermediate U5 showed no protection against ER stress.

Fig. 6.

(a and b). Neuroprotective properties of synthesized compounds in ER stress (a and b): Tunicamycin (TN) decreased the viability of SH-SY5Y cells (~50% ± 0.38, vs. control, p < 0.001). SH-SY5Y cells were treated with tunicamycin (5 μg/mL) or with tunicamycin (5 μg/mL) and ZA1 to ZA6, ZB1 to ZB6, and intermediates S5, and U5 at different concentrations (1, 5, and 10 μM) for 24 h. Cell viability was determined by MTT-assay. Data represented as mean ± SEM, where the p < 0.05 was considered significant ^#Difference within control and TN (^###p < 0.001). *Difference within control and different concentrations of compounds relative to tunicamycin (*p < 0.05, **p < 0.01). (One way ANOVA followed by Tukey’s post hoc comparisons, n = 3 independent experiment).

Mechanism of Action of Lead Compounds

The neuroprotective mechanisms of these compounds were investigated by the mRNA expression of ER stress markers (BIP, CHOP, and PDI) and protein expression of BIP and apoptosis markers (caspase-3 and cleaved caspase-3). The mRNA expression of BIP was increased in SH-SY5Y cells when treated with tunicamycin (TN). However, BIP was down-regulated after the treatment of ZA2 to ZA6 and intermediate S5 (Fig. 7a). The CHOP mRNA expression was significantly reduced in ZA5, and intermediate S5 treated cells, and there was no change in the mRNA expression of PDI (Fig. 7b). Under ER stress, the transcription factor ATF4 regulates the transcription of genes (BIP, CHOP) involved in the unfolded protein response (UPR)[50]. The BIP is a molecular chaper-one that binds to misfolded proteins to prevent the accumulation of misfolded or unfolded protein aggregates and assists in proper refolding [51, 52]. The PDI mRNA expression was not changed in TN treated cells (Figure S3 supporting information), which could be due to post-translationally modified protein involved in protein folding and disulfide bond formation through protein glycosylation in the ER [53].

Fig. 7.

mRNA expression of genes involved in ER stress (a) BIP and (b) CHOP. Cells were treated with 5 μg/ml tunicamycin and 10 μM/ml of compounds (ZA2 to ZA6 and S5) for 24 h, DMSO was used as a control. Total RNA was isolated, and 1.0 μg of total RNA was used for cDNA synthesis. The cDNA was used for the quantitative expression analysis of genes involved in ER stress pathway as described in method section. The β-Actin was used as an endogenous control. The data represent the means ± SD (*P < 0.05) of three separate experiments. The statistical significance was determined by One way ANOVA followed by Tukey’s post hoc comparisons and ^#Difference within control and TN (^#p < 0.05). *Difference within control and different concentrations of compounds relative to tunicamycin (*p < 0.05, ***p < 0.001, and ****p < 0.0001).

The protein expression of BIP and cleaved caspase-3 significantly increased in SH-SY5Y cells when treated with TN. However, the BIP and cleaved caspase-3 expression were significantly down-regulated with the treatment of 10 μM concentration of triazole-pyrimidine hybrids derivatives (ZA2 to ZA6 and intermediate S5) (Fig. 8 and Figure S3 supporting information). The total caspase-3 expression was also reduced in ZA2, ZA5, and intermediate S5 treated cells (Fig. 8c). The protein expression of BIP and cleaved caspase-3 supported to mRNA and cell viability results, suggesting that triazole-pyrimidine hybrids derivatives and intermediate S5 have neuroprotective activities against ER-stress-induced neurotoxicity.

Fig. 8.

Protein expression of BIP (b) and Caspase-3 (c), and cleaved caspase-3 (d). SH-SY5Y cells were treated with 5 μg/ml tunicamycin and 10 μM/ml of different drugs (ZA2 to ZA6 and S5), for 24 h and control cells were treated with DMSO. Cell lysate was prepared and quantified for the protein, then equal amounts of proteins (25 μg) were separated in 10% SDS PAGE and immunoblotting was performed as described in detail in methods section. The protein expression bands were quantified with Image-J software and normalized with β-actin (a). The data represent the means ± SD of three separate experiments. The statistical significance was determined by One way ANOVA followed by Tukey’s post hoc comparisons. ^#Difference within control and TN (^#p < 0.05). *Difference within control and different concentrations of compounds relative to tunicamycin (*p < 0.05, **p < 0.01, and ***p < 0.001).

Structure–Activity Relationship (SAR) Studies

In the current study, the triazole-pyrimidine compounds were assessed for their neuroprotective/anti-inflammatory properties in different models. The substituent diversity of this pharmacophore influenced neuroprotective/anti-neuroinflammatory properties and their structure–activity relationships (SAR). In the OGD/R-induced cell death model, most compounds (ZA3-ZA5, ZB2-ZB6, and S5)displayed neuroprotective/anti-inflammatory properties and significantly decreased NO and TNF-α production. It was observed that the derivatives ZA3, ZA4, and ZA5 displaying these properties, have electrondonating methoxy (R₁ = −OCH₃) group attached to the phenyl ring of pyrimidine with two or more electron-withdrawing halogen groups attached to the phenyl ring of triazole (ZA3, R₂ = F, R₃ = Cl; ZA4, R₂ = H, R₃ = −CF₃ and ZA5, R₂ = F, R₃ = F) whereas S5 contains the only electron-donating methoxy (R₁ = −OCH₃) group attached to the phenyl ring of pyrimidine. However, the compounds ZB3-ZB6do not have electrondonating methoxy (R₁ = −OCH₃) group, but these compounds contain electron-withdrawing halogen group at phenyl ring of triazole (ZB3, R₂ = F, R₃ = Cl;ZB4; R₂ = H, R₃ = −CF₃; ZB5, R₂ = F, R₃ = F and ZB6, R₂ = F also displayed significant neuroprotective properties.Whereas ZB2 has an electron-donating methoxy group attached to the phenyl ring of triazole displayed remarkable neuroprotective properties. It is safe to conclude that smaller and more compact electron clouds and smaller and more compact electron clouds containing halogen and methoxy substituents to the phenyl ring of triazole have attributable the neuroprotective/anti-inflammatory properties.

Furthermore, the compounds ZA2 to ZA6 and S5 displayed protective properties against ER stress, whereas ZA1, ZB1 to ZB6, and U5 did not show significant neuroprotection. The neuroprotective activity of compounds ZA2 to ZA6 and S5 was also confirmed by the mRNA expression of ER stress marker (BiP, CHOP, and PDI) and protein expression of BiP and apoptosis (caspase-3 and cleaved caspase-3). The derivatives ZA2 to ZA6 and S5 have electron-donating methoxy (R₁ = −OCH3) group attached to the phenyl ring of pyrimidine, therefore, attributable to the neuroprotection against ER-stress. On the other hand, the ZB1 to ZB6 derivatives do not have methoxy substitutes (R₁ = H). Still, most of the compounds containing electron-withdrawing halogen groups attached to the phenyl ring of triazole did not show activity against ER stress. It can be concluded that due to the electron-donating methoxy (R₁ = −OCH₃) group attached to the phenyl ring of pyrimidine, neuroprotection against ER stress was observed. It was also previously reported that the flavone compounds bearing the electron-donating methoxy group showed neuroprotective properties in ER stress [54].The SAR analysis suggested that the triazole-pyrimidine compounds bearing electron-donating methoxy groups might be used as lead molecules and developed as neuroprotective agents.

Molecular Docking

For the rationalization of ligand-receptor interaction, a molecular docking study was performed to analyze the interaction of new lead triazole-pyrimidine derivatives within the active site of ATF4 and NF-kB protein. These transcription factors are involved in transcription regulation BIP (ER stress) and TNF-α (inflammatory pathways). We have taken the lowest energy structure of each protein–ligand complex as a representative structure. The docking energy and the interacting residue are shown in (Table III supporting information).

Table III.

Binding Energy and the Interacting Residues of ATF4 and NF-kB with Lead Drug Molecules

S. No	Protein	Molecule	Docking energy	Interacting residues
1	ATF4	ZA2	−4.49	Lys271, Glu274, Ser326, Ala328, Lys329, Glu330, Ile331, Gln332, Tyr333, Lys335
2	ATF4	ZA3	−4.35	Lys281, Phe282, Gln284, Lys285, Leu337 Ile338, Glu340, Val341
3	ATF4	ZA4	−4.3	Arg279, Phe282, Lys283, Lys285, Glu330 Tyr333, Leu334, Ly337, Val341
4	ATF4	ZA5	−5.22	Arg279, Leu281, Phe282, Gln284, Lys285 Glu330, Tyr333, Leu334, Ly337, Ile338, Val341
5	ATF4	ZA6	−4.57	Gln251, Val254, Leu255, Thr258 Leu306, Glu309, Glu312, Leu313, Lys316
6	NF-kB	ZA3	−4.27	Lys128, Lys241, Arg246, Gln247, Lys272, Arg305, Gln307, Phe307
7	NF-kB	ZA4	−3.28	Tyr36, His88, Val121, Lys122, Lys123, Arg124, Leu154, Asn155, Asp185, Arg187, Lys218
8	NF-kB	ZA5	−3.09	Tyr36, Cys38, Glu39, Lys122, Lys123, Leu154, Asn155, Asp185, Arg187, Ala188
9	NF-kB	ZB2	−3.44	Tyr36, Val121, Lys122, Lys123, Arg124, Asn155, Asp185, Arg187, Ala188, Lys218
10	NF-kB	ZB3	−3.71	Tyr36, Val121, Lys122, Lys123, Arg124, Leu154, Asn155, Asp185, Arg187, Lys218
11	NF-kB	ZB4	−3.45	Tyr36, Val121, Lys122, Lys123, Arg124, Asn155, Asp185, Arg187, Ala188, Lys218
12	NF-kB	ZB5	−3.36	Tyr36, Val121, Lys122, Lys123, Asn155, Asp185, Arg187, Pro189, Lys218, Gln220, Gln247
13	NF-kB	ZB6	−3.66	Val121, Lys122, Lys123, Asn155, Asp185, Arg187, Ala188, Pro189, Lys218, Gln247

It has been observed that ZA2, ZA3, ZA4, ZA5, and ZA6 drug molecules are showing hydrophobic interaction with the binding pocket residues of ATF4 (Fig. 9). However, the interaction of ZA3, ZA4, ZA5, ZB2, ZB3, ZB4, ZB5, and ZB6 with NF-kB is stabilized by hydrogen bonds hydrophobic interaction (Fig. 10). The side-chain oxygen of Tyr36 of NF-kB is forming a hydrogen bond with ZA4, ZB2, ZB3, and ZB4 with hydrogen bond distances of 2.40 Å, 2.21 Å, 2.37 Å, and 2.83 Å, respectively. In the case of ZB5 and ZB6, the nitrogen atom of the Lys218 side chain is forming a hydrogen bond with a distance of 1.72 Å and 2.09 Å, respectively. In ZA5, the side chain carboxyl oxygen atom of Asp185 forms a hydrogen bond with a distance of 2.25 Å. However, the interactions around ZA3 show hydrophobic interaction and hydrogen bond with Arg305 reside of NF-kB with a hydrogen bond donor–acceptor distance of 3.51 Å. These observations showed that the interaction of ZA3, ZA4, ZA5, ZB2, ZB3, ZB4, ZB5, and ZB6 with NF-kB is stabilized by both hydrogen bonds and hydrophobic interaction. On the other hand, the interactions of ATF4 with ZA2, ZA3, ZA4, ZA5, and ZA6 involve only hydrophobic interaction.

Fig. 9.

Interaction of ZA2 (Figure A), ZA3 (Figure B), ZA4 (Figure C), ZA5 (Figure D), and ZA6 (Figure E) with ATF4 protein in the lowest energy pose obtained from molecular docking. The small molecules are shown in green color in ball and stick representation. The interacting residue of ATF4 are shown in golden color in stick representation.

Fig. 10.

Interaction of ZA3 (Figure A), ZA4 (Figure B), ZA5 (Figure C), ZB2 (Figure D), ZB3 (Figure E), ZB4 (Figure F), ZB5 (Figure G) and ZB6 (Figure H) with NF-kB protein in the lowest energy pose obtained from molecular docking. The small molecules are shown in green color in ball and stick representation. The interacting residue of NF-kB are shown in pink color in stick representation.

Conclusions

The present study clearly showed that series of novel triazolepyrimidine hybrids molecules has potential neuroprotective properties. Compounds ZA3-ZA5, ZB2-ZB6, and intermediate S5 showed increased cell viability when subjected to OGD condition. These compounds were found to reduce the levels of TNF-α and NO in LPS-induced microglial activation. The compounds ZA1, ZA2, ZA6, ZB1, and intermediate S5 did not show any protection against OGD. The neuroprotective effects of synthesized compounds (ZA2 to ZA6 and intermediate S5) significantly reduced the ER stress and increased cell viability. Also, mRNA and protein expression of BIP, cleaved caspase-3, and caspase3 were reduced compared with tunicamycin treated cells. This study suggest that ZA2 to ZA6 and S5 compounds protecting the neuronal cells and reducing the inflammatory response through the inhibition of ER stress, apoptosis, and NF-kB pathway respectively. The molecular docking study implies favorable interactions between the ligand and active residues of proteins, while the ligand accommodates accurately into the active pocket of the protein. These results strongly suggest that triazole-pyrimidine derivatives could be used as lead molecules for further research to develop new safe, and effective therapeutic agents for neurodegenerative diseases. Future studies are warranted to compare the neuroprotective activity of the active compounds with positive control and to address the outcome in differentiated SH-SY5Y cells as well as the SH-SY5Y and HMC-3 co-culture impact on neuronal viability.

Abbreviations

AD

Alzheimer’s disease

BBB

Blood-brain barrier

CHCl₃

Chloroform

DMSO

Dimethyl sulfoxide

ER

Endoplasmic reticulum

HMC3

Human microglia clone 3 cells

LPS

Lipopolysaccharide

MeOH

Methanol

Mp

Melting point

NMR

Nuclear Magnetic Resonance

OGD/R

Oxygen-glucose deprivation/Reperfusion

PD

Parkinson’s disease

ppm

Parts per million

POCl₃

Phosphorus oxychloride

K₂CO₃

Potassium carbonate

qRT-PCR

Quantitative Real-Time Polymerase Chain Reaction

Rt

Room temperature

THF

Tetrahydrofuran

TLC

Thin-layer chromatography

UV

Ultraviolet