miR-122-IGF-1R signaling allied through the dysregulated lncRNA MALAT-1 expression in gastric carcinoma

Abstract

MALAT-1 is extremely elevated in human malignancies thus functions as a prognostic biomarker. Nevertheless, limited data has been discovered concerning MALAT's contribution in stomach cancer. MALAT-1 expression appeared considerably greater in gastric cancer (GC) rats with remote miR-122-IGF-1R impact. MALAT-1 depletion inhibited cell cycle development, cell division and invasion, thus boosting death of GC cells. Likewise, miR-122-IGF-1R expression was linked to MALAT-1 deregulations in GC. Biological markers discovery based on biochemical data alongside detailed genome study might enhance prognosis, diagnosis and therapeutic compliance. This article summed up the most recent developments and techniques in GC biomarkers and may have applications for early detection, precise estimation of treatment strategies, and future perspectives according to molecular classification and profiling. In rats, GC was induced by 20-MCA, followed by DOX, Liposomal DOX, and PEGylated-Dox treatment. In addition to histopathological examinations, GC tumor biomarkers such as CEA, CA12–5, KRAS, AKT, PTEN, TP53, JAK-2, lnc- MALAT-1 and miR-122-IGF-1R were tracked. These findings reveal that MALAT-1 may be oncogenic in GC. Prominent MALAT-1 levels may assist as an indicator of metastasis in GC, and that miR-122-IGF-1R expression is associated via reduced MALAT-1 signaling. Finally, PEG-DOX may be an excellent option for GC therapy.

Graphical Abstract

Highlights

• •Induction of gastric cancer in rats via 20-MCA.
• •Treatment with DOX, Liposomal DOX and PEG-DOX.
• •Monitoring miR-122-IGF and MALAT.
• •Monitoring P53, KRAS, PTEN, JAK2, AKT, CEA and CA12–5.
• •PEG-DOX could be a prospective DDS.

1. Introduction

Globally, GC is the 4th utmost prevalent cancer and is also the 2nd contributor of mortality. Regardless of increased GC detection rates, many patients continue to suffer from metastatic disease [20]. As a result, identifying oncogenes that trigger stomach cancer metastasis is critical. These oncogenes could function as both biomarkers for the development of GC and molecular targets for GC treatment [14]. In spite substantial advances in GC survival rates over the past few years, GC is frequently detected at a late stage, and prognoses remain inadequate owing to the elevated risk of recurrence [30].

LncRNAs are transcripts that exceed 200 nucleotides long and are accompanied with numerous pathogenesis and cellular processes. lncRNAs expression were obviously in a variety of cancers. Various cancers, as hepatocellular carcinoma (HCC), non-small cell lung cancers (NSCLS), renal cell carcinoma (RCC), breast cancer and colorectal carcinoma (CRC), have had extensive research into circulating lncRNAs as indicators for the prognosis and diagnosis. Nonetheless, the specific lnc RNAs associated with GC are still unknown [14].

MALAT-1 is one of the primary cancer-associated lncRNAs. MALAT-1 is widely conserved across species and is found in a wide range of human tissues. A substantial body of evidence suggests that miRNAs are prospective indicators for the prognosis and diagnosis of GC [8]. MALAT-1 expression in GC cases associated with metastasis was significantly high. MALAT-1 knockdown markedly reduced the malignant behavior of GC cells. In GC cells, miR-122-IGF-1R expression was associated via disrupted MALAT-1 signaling [46].

MiRNAs are twenty two non-coding RNAs discovered to possess a vital role in the post-transcriptional regulation of mRNA. miR-122- IGF-1R can trigger cell cycle arrest in SCG7901 cells by promoting p27 expression [46]. Nonetheless, miR-122- IGF-1R promotes apoptosis in SCG7901 cells by targeting MYC. In Fetoprotein (AFP)-producing gastric cancer, miR-122- IGF-1R suppressed apoptosis and accelerated tumor growth via targeting Fork head box O3 (FOXO3), highlighting that miR-122- IGF-1R might be a prospective therapeutic target in GC. GC cell line migration, proliferation and invasion were highly suppressed by miR-122 up regulation via direct targeting of cAMP response element binding protein 1 (CREB1) [11].

A new method of applying the carcinogen 20-methylcholanthrene (20-MCA) to the mucosa of specific regions of the stomach in rats has been shown to produce malignant tumors within 16 months [40]. The forestomach was found to be the most susceptible to the carcinogen's effect, producing cornifying squamous cell carcinomas in 17 of 27 rats. The glandular portion of the stomach was also sensitive to the carcinogenic effect of 20-MCA in different ways [4]. The earliest adenocarcinomas appeared when the carcinogen was applied to the pyloric region, but by the end of the experiment, rats with the carcinogen applied to the cardiac area had the greatest number of neoplasms. The mucosa of the cardia, which consists primarily of tubular glands that do not secrete digestive juice, appears to be the most sensitive to carcinogenesis when 20-methylcholanthrene is applied. The stomach's fundus appears to be the least susceptible to carcinogenesis [13]. Previous research indicates that 20-methylcholanthrene is the most active polycyclic hydrocarbon in the induction of glandular stomach tumors [5].

Even with the great advancements in target therapy and radiotherapy nowadays, chemotherapy remains a crucial method for GC therapy specially doxorubicin (DOX) (anthracycline) that inhibit cancer cell division by blocking topoisomerase II enzyme. Nevertheless, chemotherapy's therapeutic benefits are frequently unsatisfactory and may not markedly improve the prognosis for individuals with cancer and may triggers cardio-toxicity. The therapeutic benefits of conventional chemotherapy have been limited; therefore combining liposomal carrier with the chemotherapy could lead to improved antitumor properties and proper targeting for cancer tissue. One more challenge with chemotherapy is that restricted drug concentration post systemic drug administration in tumor sites while having a number of negative consequences. The use of innovative drug delivery techniques is essential in solving these issues. Consequently, creating a system that targets multiple agents and delivers them can be directed straight to the tumor site and released under controlled conditions. Overcome these issues and improve the therapeutic outcomes [35].

Thus the target of this study is to estimate the prospective impact of Liposomal-DOX and PEG- DOX against 20-MCA induced gastric cancer via monitoring miRNA-122-IGF-1R and lnc- MALAT-1 in addition to the expression of TP53, KRAS, JAK-2, AKT and PTEN.

2. Materials and methods

2.1. Chemicals

Doxorubicin was purchased from Sigma-Aldrich Co. (USA) and Liposomal loaded-DOX and PEGylated-DOX (Avanti, USA# 300115 S). RT-PCR kits for KRAS, TP53, PTEN and JAK-2 (Qiagen USA).

2.2. Animals and treatments

40 male Western Albino rats (8–10 weeks old) weighing 170–190 g were taken from the National Research Center's animal house. The controlled environment in which the animals were kept included 21°C, 50% humidity and 10-hour light/dark cycle. They were fed a pelletized form of the standard chow diet and had unlimited access to water. The National Research Center's (19302) and the US National Institute of Health's Animal Care and Use Committee approved the strict adherence to ethical guidelines and policies in all procedures involving the care and treatment of animals.

2.3. Experimental design

Rats were separated into eight groups (8 rats):

G 1: Administered saline (Normal group).

G 2: Gastric cancer prompted in rats via single 20- methyl cholanthrene (10 mg/kg BW) SC dose and left for 4 months (Becker et al., 2015).

G 3: Administered DOX (18 mg/kg BW) IP for 30 days after GC [43].

G 4: Administered Liposomal-DOX (3 mg/kg BW) IP for 30 days [43].

G 5: Administered PEG loaded-DOX (3 mg/kg BW) IP for 30 days [43].

2.4. Blood sampling and tissue preparation

Blood samples were obtained from the rat’s sublingual vein, and then weighed, post being gently sedated with CO₂. Sera were separated by centrifugation at 4000 rpm for 10 min in order to evaluate the biochemical and molecular analysis later on.

The animals were then sacrificed by cervical dislocation following a thorough separation and portioning of the stomach tissue.

2.5. Biochemical parameters

2.5.1. Micro RNA analysis for miR-122-IGF-1R in gastric cancer

miRNA isolation kits relying on phenol: chloroform phase separation combined with silica column-based solid extraction methods were utilized (miScript II RT kit (Qiagen, Cat.# 218161 miScript Reverse Transcriptase Mix (optimized blend of poly (A) polymerase and reverse transcriptase) then 10x miScript nucleics Mix was added to 5x miScript HiSpec buffer then 5x miScript HiFlex Buffer. miScript SYBR Green PCR kit (Qiagen, Cat.# 218073) 2x QuantiTect SYBR Green PCR Master Mix added to 10x miScript universal primer (included in the kit) Hs_miR-122-IGF-1R miScript Primer assay (Qiagen, Cat.# MS00003185). RT-PCR instrument used (Agilent, MxPro qPCR, Mx3000P) Unskirted 96-Well PCR Plates were utilized. GAPDH was used as a loading control in cell RNA [2], [1].

2.5.2. Long non coding gene analysis for lnc MALAT-1

The mRNA MALAT-1T was detected via (qRT-PCR) in stomach tissue. RNA was extracted via RT²-miscript kits (Qiagen, USA) specific for Lnc genes extraction followed by RT²-SYBR green kits for quantitative RT-PCR determination of MALAT-1 (Lnc gene). RT² First Strand Kit contains a proprietary genomic DNA elimination step to eradicate any residual contamination in RNA samples prior to reverse transcription, to avoid false positive signals. In addition, an artificial RNA control template is included that can be used to follow the reverse transcription efficiency across samples and monitor against RNase contamination. Each of the real-time instrument-specific RT² SYBR Green Mastermixes contains SYBR Green and an appropriate reference dye to match the instrumentation. RT² SYBR Green Mastermixes are performed for MALAT-1(Lnc gene) determination by real-time PCR instruments [27].

2.5.3. mRNA gene expression of kidney KRAS, PTEN,TP53 and JAK-2

Real-time PCR primers for KRAS, PTEN, TP53and JAK-2 (Table 1). Total RNA was extracted from stomach tissue. A final volume of 50 L was used for the reactions (25 L SYBRGreen (2x), 0.5 L cDNA, 2 L primer pair mix (5 pmol/Leach primer), and 22.5 L water). The thermal profile was: 50°C for 3 min, 94°C for 15 min, 95°C for 40–50°C for 30 s, 68°C for 30 s, and 70°C for 15 min [[26], [25]].

Table 1.

Primers sequence designed for RT-PCR gene expression.

Primers	Sequence
MALAT1	Forward: 5′-CTTCCCTAGGGGATTTCAGG-3′
	Reverse: 5′-GCCCACAGGAACAAGTCCTA-3′
miRNA-122-IGF-1R	Forward: 5′-TGGAGTGCTGTATGCCTCTG-3′
	Reverse: 5′-CCCTTGGCAACTCCTTCATA-3′
k-RAS	Forward: 5′-ATTATAAGGCCTGCTGAAAATGACTGA-3′
	Reverse: 5′- ATATGCATATTAAAACAAGATTTACCTCTA −3′
PTEN	Forward: 5′ -GGA ACT CCA ACA AGG GAG CA-3′
	Reverse: 5′ -TTC GGG GTC GGA AGA CCT TA-3′
β-actin	Forward: 5′-CTTTGATGTCACGCACGATTTC-3′
	Reverse: 5′-GGGCCGCTCTAGGCACCAA-3′
GAPDH	forward 5′-CAAGGCCAACCGCGAGAA-3′
	reverse 5′-CCCTCGTAGATGGGCACAGT-3′

2.5.4. ELISA determination of gastric tumor biomarkers CEA, CA12-5 and P-AKT

CEA, CA12–5, PI3K and P-AKT activities were assessed using ELISA kit (R&D systems, MN, USA). Briefly, the micro plate was pre-coated with specific antibodies. Then, the immobilized antibody that bound to CEA, CA12–5, PI3K and P-AKT were provided, and the wells were provided with secondary antibody specific for CEA, CA12–5, PI3K and P-AKT. Afterward, the absorbance was determined at 450 nm. (Agient BioTek Microplate reader, Neo2) [[25], [23]].

2.6. Statistical analysis

Results examined via one-way ANOVA, SPSS 16 and Graphpad prism 10.0 at p ≤0.05 and were accessible as mean ±SEM [3], [24].

3. Results

3.1. Modulation of lnc MALAT-1 and miRNA-122-IGF-1R

Cholanthrene intoxication induced a marked increment in MALAT-1 expression on the other hand miRNA-122-IGF-1R level was ameliorated by nearly 7 and 0.7 folds regarding the control value (Fig. 1). DOX, liposomal-DOX and PEG loaded-DOX significantly modulated these altered miRNA and lncRNA, as compared to 20-MCA group. Obviously, PEG-DOX regimen was superior in this field by 2 and 1 folds as compared to the control value.

Fig. 1.

: Impact of DOX, Liposomal-DOX and PEG-DOX on gastric miRNA-122-IGF-1R and lnc MALAT-1 expression post 20-MCA gastric cancer induction. Data are expressed as means ±SEM (n = 8), P<0.05. Groups having different letters are considered significantly different, while, groups having similar letters are not significantly different from each other. GAPDH was used as reference gene.

3.2. Modulation of gastric cancer biomarkers

As shown in Fig. 2, 20-MCA intoxication increased significantly serum CEA and CA12–5 levels by a mean value of 100 &170 respectively, as compared with the control value. On the other hand, groups administered DOX, Liposomal-DOX and PEG loaded-DOX, the levels of gastric cancer biomarkers were comparatively lower than the 20-MCA-intoxicated group with PEG-DOX revealing the most significant impact by a mean value of 20 & 30, implying the possible therapeutic impact of DOX loaded nano-carriers in GC.

Fig. 2.

: Impact of DOX, Liposomal-DOX and PEG-DOX on gastric tumour markers CEA and CA12-5protein expression post 20-MCA gastric cancer induction. Data are expressed as means ±SEM (n = 8), P<0.05. Groups having different letters are considered significantly different, while, groups having similar letters are not significantly different from each other.

3.3. Modulation of gastric mRNA gene expression of KRAS and PTEN

Fig. 3&4 deduced that 20-MCA intoxication implicated a noticeable down-regulation in mRNA gene expression of KRAS and up-regulation in PTEN by nearly 0.2 and 15 folds regarding the control. Nevertheless, a significant up-regulation was apparent in rats treated with DOX, liposomal-DOX and PEG loaded-DOX. Besides, PEG-DOX regimen considerably reversed the level of these genes as compared with 20-MCA by 0.8 and 3 folds as compared to the control value.

Fig. 3.

: Impact of DOX, Liposomal-DOX and PEG-DOX on gastric KRAS gene expression post 20-MCA gastric cancer induction. Data are expressed as means ±SEM (n = 8), P<0.05. Groups having different letters are considered significantly different, while, groups having similar letters are not significantly different from each other. β-actin was used as reference gene.

Fig. 4.

: Impact of DOX, Liposomal-DOX and PEG-DOX on gastric PTEN gene expression post 20-MCA gastric cancer induction. Data are expressed as means ±SEM (n = 8), P<0.05. Groups having different letters are considered significantly different, while, groups having similar letters are not significantly different from each other. β-actin was used as reference gene.

3.4. Modulation of gastric protein expression of P-AKT, TP53 and JAK-2

Data in Fig. 5&6 deduced that 20-MCA intoxication caused a significant down-regulation in the gene expression of TP53, JAK-2 and P-AKT by a mean value of 0.4, 0.3 & 9 respectively, regarding the control. Nonetheless, a marked up-regulation was obvious in DOX, liposomal-DOX and PEG loaded-DOX. Besides, PEG-DOX regimen considerably reversed the level of these genes as compared with 20-MCA by a mean value of 1, 1.2& 2.5 respectively.

Fig. 5.

: Impact of DOX, Liposomal-DOX and PEG-DOX on gastric TP53 and JAK-2 protein expression post 20-MCA gastric cancer induction. Data are expressed as means ±SEM (n = 8), P<0.05. Groups having different letters are considered significantly different, while, groups having similar letters are not significantly different from each other.

Fig. 6.

: Impact of DOX, Liposomal-DOX and PEG-DOX on gastric AKT protein expression post 20-MCA gastric cancer induction. Data are expressed as means ±SEM (n = 8), P<0.05. Groups having different letters are considered significantly different, while, groups having similar letters are not significantly different from each other.

3.5. Modulation of gastric cancer oxidative and nitrosative stress biomarkers

As shown in Fig. 7, 20-MCA intoxication increased significantly gastric MDA and NO levels by a mean value of 80 & 15 respectively, regarding the control. Conversely, DOX, Liposomal-DOX and PEG loaded-DOX, reduced these biomarkers with respect to 20-MCA group with the PEG-DOX upper hand by a mean value of 40 & 10 respectively. In addition to, heatmap representing different genes expression and their correlation; Red represents high score while blue represent low scores (Fig. 8).

Fig. 7.

: Impact of DOX, Liposomal-DOX and PEG-DOX on gastric NO and MDA levels post 20-MCA gastric cancer induction. Data are expressed as means ±SEM (n = 8), P<0.05. Groups having different letters are considered significantly different, while, groups having similar letters are not significantly different from each other.

Fig. 8.

: Heatmap representing different gene expressions.

4. Discussion

Recent research has shown that lncRNAs take part in cancer progress. MALAT-1 is lncRNA that is over expressed in different human cancers. MALAT-1 over expression triggers cancer development. MALAT-1 was noticed in the plasma of GC patients and greater in metastatic tumors and in late phases of cancer [15].

Overall, the current study suggests that MALAT-1 was elevated in GC, and that miR-122-IGF-1R was reduced. These data added to our understanding of gastric tumorigenesis. Meanwhile, treatment with DOX, Lip-DOX and PEG-DOX modulated these altered miRNA and LncRNA with the upper hand of PEG-DOX. MALAT-1 may stimulate progression of tumors in different kinds of cancer via various pathways. A number of researches have shown that MALAT-1 can act as a promoter of GC metastasis and cell proliferation. Multiple prospective MALAT-1 target proteins incorporated in cell apoptosis, mobility, and invasion have already been investigated [36]. MALAT-1 knock-down could hinder N-Bcl-xl, cadherin and Cyclin D1 expression, which could clarify why MALAT-1 knock-down significantly inhibits cell invasion and proliferation in GC cells [44].

MALAT-1 was only found to be elevated in GC/DM. miR-122 was observed to be reduced in GC metastasis patients. MALAT-1 levels in the blood were inversely proportional to miR-122 levels. In GC cell lines, IGF-1R signaling, which is a target of miR-122, was directly proportional to MALAT1 expression [[7], [12]].Consequently we wanted to discover if miR-122 could influence MALAT1 levels in GC cells. Indeed, miR-122 has been shown to reduce MALAT1 expression. Additional investigation suggests that the procedure by which miR-122 reduced MALAT1 signaling may be correlated with IGF-1R. Prior work has shown that promoted IGF-1R expression can increase catenin action, and a new investigation found that catenin may stimulate MALAT1 expression at the transcriptional level [[29], [42]].

Non-coding regulatory RNA dysregulation may be linked to cancer progression and initiation. MicroRNAs are small non-coding RNA strands of 18–24 nucleotides in length that bind to the 3′UTR part of their target gene and control its expression by hindering translation [Xu et al., 2017]. MicroRNAs perform critical roles in the regulation of multiple biological functions as cell migration, differentiation and proliferation [16].

MicroRNA expression profiling has revealed distinct signatures of these small regulatory RNAs in various tumors, as GC. Various microRNAs were involved in GC [[32], [45]]. miRNAs may take part in cancer cell progression from EMT to metastasis via reducing ZEB2 and E-cadherin expression. It is well documented that miRNAs can either elevated or reduce oncogenes or tumor suppressor genes. A plethora of various expressed miRNAs were linked to various phases of GC. miRNAs like miR-23a, miR-27a, miR-130b, miR-199a, and miR-370 have been linked to GC oncogenic activity. MiR-122-IGF, miR-125a, miR-128, miR-212, miR-219, and miR-449, on the other hand, showed tumor suppressive activity [45].

lncRNAs can act as oncogenes or tumor suppressors. LncRNAs function as transcriptional mediators, splicing regulators, post-transcriptional processors, enhancers, miRNA molecular sponges, and chromatin remodelers. Because lncRNAs are commonly expressed in developmental contexts and disease, they have the potential to be used as biomarkers [21]. Over 56000 human lncRNAs were identified in the human genome, and approximately 135 lncRNAs have been altered in GC, implying that they are closely related to tumorgensis, metastasis, and prognosis. In patients with GC, ncRuPAR expression was significantly associated with lymph node metastasis, TNM and tumor size. GACAT2 and GACAT1 down regulation in GC might be a prognostic indicator [[10], [48]] PVT1 and MALAT-1 lncRNAs are noticeably over expressed in GC, indicating that they could be used as independent prognostic biomarkers. Despite the fact that biological researchers have published many new findings regarding GC biomarkers, only traditional indicators CA19–9, CEA and HER2 are the precise clinical biomarkers [33].

Herein, (CA)12–5 and CEA gastric tumor biomarkers were highly elevated in gastric cancer model. Meanwhile, treatment with DOX, Lip-DOX and PEG-DOX modulated these altered biomarkers with the upper hand to PEG-DOX. Despite, numerous indicators for GC have been identified, as BCA22–5, AFP and CA72–4 still CEA and CA12–5 the commonly utilized indicators in GC clinical trials [41].

CEA is the most frequently employed clinical marker in digestive tract cancer [39]. Elevated CEA levels exist in a subset of GC patients in advanced stages [6]. CA125, a tumor marker, has been widely used in the diagnosis of GC [47].

Herein, Up-regulation of KRAS, AKT, and PTEN was a significant biomarker for gastric cancer, and down-regulation of TP53 and JAK-2 signaling may also be involved in gastric cancer apoptosis. Meanwhile, DOX, Lip-DOX, and PEG-DOX all modulated these altered genes, with PEG-DOX being the most effective. This is reflected by the fact that PI3K/PTEN/Akt pathway is a critical indicator of various vital cellular processes, including cell cycle, survival, metastasis and genomic instability [17]. PTEN, which codes for the major phosphatidylinositol phosphatase, is the major mutated tumor suppressor genes. Alteration in the AKT/PI3Ksignaling can arise as a result of PIK3CA oncogenic mutations. Dysregulation in the AKT/PI3K pathway have been found to be common in GC. The expression of PI3K/Akt was linked to poor survival and lymph node status. The PI3KCA gene has been indicated in GC subjects. PIK3CA mutations take a vital part in antitumor drug resistance and the development of metastatic potential. P-AKT declined tumors are more vigorous than P-AKT raised tumors in GC subjects [[19], [37]].

Contrary, the TP53 gene is a critical tumor suppressor and the key regulator of various cellular processes such as DNA damage, growth arrest and apoptosis. The mutational site of p53 in GC is diverse, with stated incidences ranging from 3.2% to 65%. The TP53 mutation is commonly found in GC [[31], [34]].

Abnormal DNA methylation in KRAS, RUNX3, and TFPI2 has been proposed as a serological indicator in determining the presence of GC [[9]]. KRAS methylation is being discovered to be considerably greater in mucosa from individuals with GC than in healthy gastrointestinal tissue. KRAS-R promoter methylation is linked to differentiation of tumors. DNA methylation is being linked to the development of GC and is a useful indicator for GC risk assessment [38].

An investigation designed that identified variations in copy number and mutations discovered the fact that the most frequently altered genes were TP53, SYNE1, PIK3CA, ARID1A, and PKHD [28]. Copy number deviation in the JAK-2 and KRAS genes was discovered to be raised tris distinct entire genome amplifications [18].

Liposomes are an exceptionally prospective drug delivery technology because of their excellent biocompatibilities, lack of allergic, toxic, or antigenic reactions, and simple biodegradation. In addition to shielding the host against the drug's unwanted adverse reactions, liposomes can stop the entrapped drug's contents from being prematurely inactivated by the physiological medium.

Furthermore, liposomes possess the power to be a targeted DDS, either through an immune relationship and magnetic field direction (Active targeted) or through triggered permeability and retention impact (RP). Furthermore, certain liposomes have properties like microwave, pH, and thermo-sensitivity that allow for controlled release of medications [35].

PEG-DOX possesses distinctive properties; lack of immunogenicity and no adverse reactions; furthermore, the amphophilic properties of phospholipid, which enhance solubility; nearly all of liposomes are present in the bloodstream as biodegradable liposomes; upon liposomes degradation, the medication is produced gradually; The typical size of the particles is approximately 90 nm. Because of the RP impact, tumor vascular permeability rises, and liposomes become reduced, allowing them to permit the imperfect blood vessels, expanding the local amount of medication in cancer cells by more than triple the amount of standard DOX. DOX adverse reactions, particularly cardio-toxicity, are being considerably decreased, perhaps because of the small peak of free DOX concentration in blood following PEG-DOX treatment [22].

5. Conclusion

PEG-DOX possesses a distinctive properties; lack of immunogenicity and no adverse reactions thus could be a prospective anti-gastric cancer therapy via modulating MALAT-1, miRNA-122-IGF, TP53, KRAS, JAK-2, AKT and PTEN.

Ethics approval and consent to participate

Ethics number is 19302 in our institute (NRC).

Funding

This work has No financial support.

Author statement

All authors have revised the manuscript and agree to publish in your respectable journal. The manuscript is solely submitted to this journal and not sent else where.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Handling Editor: Prof. L.H. Lash

Data Availability

No data was used for the research described in the article.