Skip to main content
NCBI home page
Heliyon logoLink to Heliyon
. 2024 Mar 14;10(6):e27885. doi: 10.1016/j.heliyon.2024.e27885

Richness of yeast community associated with apple fruits in Estonia

Arnold Kristjuhan a, Kersti Kristjuhan a, Tiina Tamm a,⁎
PMCID: PMC10965515  PMID: 38545165

Abstract

Yeasts are single-celled fungi that are widespread around the globe. They are part of a community of microorganisms that use a wide variety of habitats, including fruit surfaces. This study aimed to characterise the culturable epiphytic yeasts associated with apple fruits. The isolated yeast strains were identified by sequencing the 5.8S-ITS region and D1/D2 region of the large subunit ribosomal RNA gene and maintained for long-term storage. A total of 230 yeast isolates belonging to 33 species were recovered. Most of the collected isolates belonged to the phylum Basidiomycota. Members of genera Vishniacozyma, Filobasidium, and Rhodotorula were most frequently isolated. Over half of the species were isolated on only one to three occasions. In seven of the species obtained, the isolates were considerably divergent from their closest relatives and may therefore represent new distinct species. The results of this study demonstrate a high diversity of yeast species associated with apple fruits.

Keywords: Yeast species, Epiphytes, Biodiversity, Malus domestica, Apple fruit

1. Introduction

Yeasts are a taxonomically heterogeneous group of unicellular fungi that are globally distributed [1,2]. Fruits are particularly favourable habitats for yeasts, mainly due to the nutrient availability, low pH, and the presence of active fruit-associated vectors [3]. Yeast species do not grow as pure cultures but form microbial communities with other microorganisms. Many studies on the characterisation of yeast communities have focused on the analysis of grapes and wine-related samples due to their use in the fermentation process [[4], [5], [6], [7]].

One of the main fruit crops grown in large quantities in temperate regions worldwide is the domesticated apple (Malus domestica Borkh). In Eurasia, people have used apples for centuries [8]. Apple-based beverages, such as cider or wine, have been consumed long before apples were grown in home gardens or for commercial production. Nowadays, dessert apples are popular because of their delicious taste and flavour, nutritional value, easy storage, and convenient use. Like many other fruits, apples are colonised by a variety of microorganisms [[9], [10], [11]]. A diversity of yeast species is found on the surface (epiphytic) and inside (endophytic) of apple fruits [[12], [13], [14], [15], [16]]. The species composition of this community is an essential factor in shaping the characteristics of fermented beverages. It also determines the storage potential of fruits sold on local markets, particularly if organic farming is used in fruit production. Yeast species living on the surface of fruits do not have access to the sugar-rich growth environment and are, therefore, not determined to the fermentation process [14]. However, on damaged or rotten fruits, the microbial community is significantly changed [17]. Therefore, epiphytic yeast species can be used as biocontrol for postharvest fruits. In addition, natural yeast communities represent a promising source for species with biotechnological potential (e.g. for production of specific chemicals, flavours, etc.).

The objective of the current study was to characterise the culturable epiphytic yeasts associated with apple fruits. The study is part of a large-scale project aiming to describe the species diversity of yeasts in Estonia. During this study, 230 yeast strains were isolated from 75 different samples. The isolated yeast strains were identified using molecular methods and stored as pure cultures in the Estonian Yeast Stock Collection. The results of the present study reveal the complexity of the natural yeast community associated with apple fruits in the northern part of the temperate climate zone.

2. Experimental procedures

2.1. Sampling, isolation, and maintenance

For the study, apples were collected from different regions of Estonia (Fig. 1). Estonia is located in the northern part of the temperate climate zone and is a transition zone between maritime and continental climates. The sampling was carried out in the autumn period (from the end of August to the beginning of November) in 2018, 2020, 2021, and 2022. During the fruit ripening period (July, August), the average temperature was between 16.7 and 17.8 °C, relative humidity 77–79%, and sunshine duration between 243 and 290 h (Source: Estonian Environmental Agency). The average temperature during the sampling period was considerably lower, 12.2 °C in September and 6.7 °C in October. During the same period, relative humidity rose to 83–86%, and the average number of hours of sunshine decreased by two to three times. Samples were taken from 37 different locations. The choice of these sites was influenced by the locations of the Estonian secondary schools participating in the science popularisation project and the residences of the master's students participating in the University of Tartu practical training.

Fig. 1.

Fig. 1

Open in a new tab

Map of Estonia with locations of sampling sites. The number of trees analysed from each site is shown.

The apples were picked from trees growing in the wild or domestic gardens. Commercial apple plantations were not used for sampling to minimise the impact of the chemicals (e.g. chemical pesticides, plant protection products). The three most analysed local apple varieties were “Liivi Kuldrenett”, “Antonovka” and “Talvenauding”. Selected fruits were all ripe with no apparent spoilage. At each location 1 to 5 trees were selected. 1–3 apples were analysed from each tree. A total of 75 apples were analysed. All fruits were analysed during the day of collection without storage before or after sampling. Each fruit was analysed separately.

The plating method on solid media was used to analyse the abundance and taxonomic structure of true yeasts. Microorganisms growing on the surface of the apples were collected using a sterile swab and spread on the Yeast Extract-Peptone-Dextrose (YPD) agar medium (1% Bacto yeast extract, 2% Bacto peptone, 2% glucose, 2% agar) supplemented with 100 mg/l chloramphenicol. Plates were incubated at 20 °C for 2–4 days. The longer incubation was restricted due to the overgrowth of filamentous fungi. Based on different colony characteristics (size, colour, surface, and border type), the morphotypes were selected for further purification. 1–3 representatives of each colony type per plate were re-streaked on YPD agar plates until the pure yeast culture was obtained. The final stock was prepared in YPD supplemented with 25% glycerol and stored at −80 °C.

2.2. Molecular identification

Identification of yeast species was based on the rDNA sequence (5.8S-ITS region and D1/D2 region of the large subunit, LSU). For some species, the sequence of translation elongation factor 1-alpha (TEF1) gene was also used. The genomic DNA was extracted from single colonies using the LiOAc-SDS protocol [18]. For rDNA sequence analysis, the ITS region was amplified using primers ITS4 (5′-TCCTCCGCTTATTGATATGC) and ITS5 (5′- GGAAGTAAAAGTCGTAACAAGG) [19]. The D1/D2 domain was amplified using primers LR6 (5′-CGCCAGTTCTGCTTACC) and LROR (5′-ACCCGCTGAACTTAAGC) [20,21]. The TEF1 gene was amplified with primers EF1-1018F (5′-GAYTTCATCAAGAACATGAT) and EF1-1620R (5′-GACGTTGAADCCRACRTTGTC) [22]. The amplification of the TEF1 gene was not successful in all species analysed. DNA fragments were sequenced by Sanger sequencing. Sequences were manually curated and compared to sequences in the GenBank database using the Nucleotide BLAST (blastn) tool [23]. The obtained sequences were deposited in the GenBank database. In cases where the same species was identified more than once from the same apple, it was considered a single isolate. The isolate numbers and corresponding GenBank accession numbers are included in Table 1 and Supplementary Table1.

Table 1.

List of yeast species isolated from apples.

Yeast species No of isolates Representative strain (GenBank accession ITS; D1/D2) Type strain (GenBank accession ITS; D1/D2) Identity (%) to type strain sequences ITS; D1/D2
Bullera alba 4 EPV538K2 (OR123525; OR123651) CBS 500 (NR_111083; KY106261) 100; 99.78
Curvibasidium cygneicollum 3 EPV358K5 (OR123526; OR123652) CBS 4551 (KY102976; KY107291) 99.81; 100
Cystofilobasidium capitatum 2 EPV601K3 (OR123527; OR123653) CBS 6358 (KY103158; KY107453) 99.62; 100
Cystofilobasidium infirmominiatum 3 EPV609K2 (OR123528; OR123654) CBS 323 (NR_073232; KY107467) 100; 100
Cystofilobasidium aff. macerans 6 EPV598K4 (OR123529; OR123655) CBS 10757 a (KY103183; KY107473) 96.67; 99.68
Debaryomyces hansenii 3 EPV582K1 (OR123530; OR123656) JCM 1990 (NR_120016; KY107531) 99.82; 100
Dioszegia aff. patagonica 1 EPV358K3 (OR123531; OR123657) CRUB 1147 b (KY449061; EF595753) 98.80; 98.42
Filobasidium magnum 1 EPV621K2 (OR123532; n.d.) CBS 140 (NR_130655; N/A) 99.81; N/A
Filobasidium oeirense 1 EPV604K5 (OR123533; OR123658) CBS 8681 (AF444349; NG_070508) 99.64; 100
Filobasidium stepposum 2 EPV460K2 (OR123534; OR123659) CBS 10265 (NR_111207; KY107724) 99.82; 99.62
Filobasidium wieringae 40 EPV161K1 (OR123535; OR123660) CBS 1937 (KY103446; KY107733) 100; 100
Hanseniaspora uvarum 4 EPV582K3 (OR123536; OR123661) CBS 314 (KY103558; KY107844) 99.85: 100
Holtermanniella festucosa 1 EPV165K3 (OR123537; OR123662) CBS 10162 (KY102693; KY107040) 99.79; 100
Holtermanniella takashimae 1 EPV140K6 (OR123538; OR123663) CBS 11174 (NR_137721; NG_060626) 100; 100
Metschnikowia pulcherrima 19 EPV344K3 (OR475099; OR475100) Consensus sequences from Sipitczki 2022a 100; 100
Microstroma bacarum 2 EPV606K10 (OR123539; OR123664) CBS 6526 (KY104729; KY108990) 98.99; 100
Papiliotrema flavescens 3 EPV280K8 (OR123540; OR123665) CBS 12258 (KY104463; AB035042) 100; 100
Papiliotrema wisconsinensis 1 EPV606K3 (OR123541; OR123666) CBS 13895 (NR_160324; NG_060134) 100; 100
Pichia kluyveri 1 EPV600K6 (OR123542; OR123667) CBS 188 (NR_138210; KY108824) 99.15; 99.77
Pichia nakasei 1 EPV600K3 (n.d.; OR123668) NRRL Y-7686 (N/A; NG_055119) N/A; 100
Pseudomicrostroma juglandis 1 EPV603K6 (OR123543; OR123669) LF1018 (MG786554; KJ507254) 99.83; 99.18
Pseudomicrostroma phylloplanum 1 EPV604K7 (OR123544; OR123670) CBS 8073 (KY104261; KY108550) 100; 99.89
Rhodosporidiobolus colostri 4 EPV443K7 (OR123545; OR123671) CBS 348 (KY104695; KY108962) 100; 99.11
Rhodotorula babjevae 14 EPV464K1 (OR123546; OR123672) CBS 7808 (NR_077096; NG_042339) 99.61; 99.83
Rhodotorula graminis 7 EPV599K5 (OR123547; OR123673) CBS 2826 (NR_073273; NG_068963) 100; 100
Sporobolomyces roseus 10 EPV140K7 (OR123548; OR123674) CBS 486 (KY105523; KY109761) 100; 98.37
Sporobolomyces ruberrimus 1 EPV603K1 (OR123549; OR123675) CBS 7500 (HM014033; NG_067252) 100; 99.83
Taphrina carpini 1 EPV420K6 (OR123550; OR123676) PYCC 5558 (NR_119488; NG_042399) 99.81; 100
Vishniacozyma carnescens 9 EPV117K4 (OR123551; OR123677) CBS 973 (KY105817; KY110023) 100; 99.89
Vishniacozyma aff. carnescens 7 EPV151K4 (OR123552; OR123678) 97.93; 98.89
Vishniacozyma foliicola 1 EPV158K7 (OR123553; OR123679) CBS 9920 (KY105821; KY110026) 99.77; 99.47
Vishniacozyma heimaeyensis 5 EPV536K4 (OR123554; OR123680) CBS 8933 (HQ875391; KY110029) 99.54; 100
Vishniacozyma tephrensis 1 EPV216K5 (OR123557; OR123683) CBS 8935 (NR_144812; DQ000318) 100; 100
Vishniacozyma aff. tephrensis A 7 EPV158K5 (OR123556; OR123682) 97.70; 99.83
Vishniacozyma aff. tephrensis B 8 EPV122K6 (OR123555; OR123681) 98.16; 99.48
Vishniacozyma victoriae 47 EPV355K2 (OR123558; OR123684) CBS 8685 (AF444469; NG_057678) 100; 100
Vishniacozyma aff. victoriae A 6 EPV420K1 (OR123560; OR123686) 97.23; 99.67
Vishniacozyma aff. victoriae B 1 EPV464K5 (OR123561; OR123687) 96.99; 99.33
Open in a new tab
a

Type strain for Cystofilobasidium macerans.

b

Type strain for Dioszegia patagonica.

2.3. Statistical analysis

The sequence comparison was done by pair-wise and multiple sequences alignment using MUSCLE software [24] built-in version of MEGA X (version 10.0.5) [25] with the default parameters. The phylogenetic relationships were inferred by using the Maximum Likelihood method and Tamura-Nei model [26]. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach and then selecting the topology with superior log likelihood value. Evolutionary analyses were conducted in MEGA X with the default parameters. The “use all sites” option was chosen for the Gaps/Missing Data Treatment. The trees are drawn to scale, with branch lengths measured in the number of substitutions per site. The species accumulation curve was calculated using the rarefaction method with 1000 permutations (EstimateS, version 9.1.0 [27]), and 95% confidence was employed.

3. Results

3.1. Diversity of yeast species

In this study, the species composition of the epiphytic yeast community from apple fruits was analysed. A total of 230 yeast isolates were collected from 75 apple fruits. These were classified into 33 species (Table 1, Supplementary Table1).

Of all analysed isolates, 12.6% belonged to the phylum Ascomycota. The phylum was represented by six species, distributed in the subphylum Saccharomycotina (5 species, 28 isolates) and Taphrinomycotina (1 species, 1 isolate). Two-thirds of the Ascomycota isolates (19 isolates) produced a characteristic maroon-red halo around their colonies. This halo results from pulcherriminic acid secreted by the cells, which, together with iron ions, forms an insoluble complex called pulcherrimin. The yeasts producing pulcherrimin are grouped in the so-called pulcherrima clade of the genus Metschnikowia [28]. Until recently, this clade consisted of 10 species [29]. In this clade, the sequence-based species identification was problematic because of the frequent presence of ambiguous (di- or polymorphic) nucleotides in the 5.8S-ITS region and D1/D2 domain [30,31]. A recent in-depth analysis demonstrated that these species cannot be distinguished from each other by any phenotypic, phylogenetic, and biological species concept criteria [32,33]. Therefore, it was proposed to merge the species of the pulcherrima clade into a single species under the name M. pulcherrima. All 19 isolates collected in this study showed identity to the consensus sequence generated for the D1/D2 domain sequence of the pulcherrima clade species and were therefore assigned to M. pulcherrima (Table 1, Supplementary Table 1).

The phylum Basidiomycota was represented by 27 species, grouped into three subphyla: Agricomycotina (18 species, 158 isolates), Pucciniomycotina (6 species, 39 isolates) and Ustilaginomycotina (3 species, 4 isolates) (Table 1, Supplementary Table 1). About three-quarters of the Agricomycotina isolates were identified as described species (122 isolates), while one-quarter showed nucleotide heterogeneity relative to the type strain sequence (36 isolates). The two species, Filobasidium stepposum and Filobasidium chernovii, cannot be distinguished based on the 5.8S-ITS region and D1/D2 domain sequences. Therefore, the TEF1 sequence was used to identify F. stepposium. An analysis of the frequency of occurrence showed that twelve species were isolated only once. Three species were isolated twice, and three species were isolated three times. Together, these species represent 55% of the identified Basidiomycota species. The most common yeast species were Vishniacozyma victoriae (54 isolates) and Filobasidium wieringae (40 isolates), accounting for 41% of all isolates (Fig. 2A).

Fig. 2.

Fig. 2

Open in a new tab

Taxonomic composition and diversity of the yeast community isolated from apple fruits. A. Most frequently isolated yeast species. The two most commonly isolated yeast species are shown in green. Species isolated 1–3 times and 4–6 times are grouped into separate groups (shown in blue). B. Species accumulation curve was elaborated using the rarefaction method (1000 permutations). The vertical lines represent the standard deviations. C. The number of yeast species isolated per sample.

The mean species richness per sample was 2.9. The species accumulation curve did not become saturated, indicating a variety of species yet to be identified (Fig. 2B). Out of fifteen samples, only one yeast species was isolated, while the maximum richness in a single sample was seven species (Fig. 2C).

3.2. Genetic heterogeneity of isolated yeast species

Sequence analysis of the 5.8S-ITS region and D1/D2 domain revealed that isolates from five species showed genetic heterogeneity with the type strain of these species. They all belong to the subphylum Agaricomycotina and represent 16% of all isolates.

All six isolates (representative strain EPV598K4) from the genus Cystofilobasidium carry the identical sequences of the 5.8S-ITS region and contain 15 nucleotide substitutions, 2 deletions and 1 insertion from Cystofilobasidium macerans. Several yeast isolates with identical 5.8S-ITS sequences have been isolated previously (for example, from terrestrial snails, GenBank Accession MT988271; from the skin of the neotenic cave salamander, GenBank Accession ON261262; from oilseed rape; GenBank Accession JF817308; etc.) [[34], [35], [36]]. In addition, a number of identical sequences from environmental samples have been uploaded to the GenBank database. Typically, these yeast strains are defined as Cystofilobasidium sp. or Cystofilobasidium aff. macerans. Phylogenetic analysis of the concatenated nucleotide sequences from the 5.8S-ITS region and D1/D2 domain revealed that all isolates collected from the apples cluster together with Cystofilobasidium macerans and were therefore named as Cystofilobasidium aff. macerans (Fig. 3). Another example of genetic heterogeneity is the isolate (representative strain EPV358K3) which belongs to the genus Dioszegia and is closely related to the species Dioszegia patagonica (5 nucleotide substitutions in 5.8S-ITS region; 8 nucleotide substitutions, 1 deletion and 1 insertion in D1/D2 domain). Yeasts included in this genus are generally characterised by salmon, pink or red colour colonies and are isolated from plant leaves, roots, and soil as well as in cold water, ice, and glacial sediments [[37], [38], [39], [40], [41], [42], [43], [44], [45], [46], [47]]. Phylogenetic analysis using recognized Dioszegia species confirmed that this isolate grouped with Dioszegia patagonica and was therefore named Dioszegia aff. patagonica (Fig. 4).

Fig. 3.

Fig. 3

Open in a new tab

The phylogenetic relationship of the yeasts from the genus Cystofilobasidium obtained by maximum likelihood analysis of the concatenated sequence of the 5.8S-ITS region and D1/D2 domain of the LSU rRNA gene. Names of the species and GenBank accession numbers (5.8S-ITS/D1/D2 domain) of the analysed sequences are indicated. The isolate of this study is shown in red and the strain number is given in parentheses. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site.

Fig. 4.

Fig. 4

Open in a new tab

The phylogenetic relationship of the genus Dioszegia based on the concatenated sequence of the 5.8S-ITS region and D1/D2 domain of the LSU rRNA gene. Names of the species and GenBank accession numbers (5.8S-ITS/D1/D2 domain) of the analysed sequences are indicated. The isolate of this study is shown in red and the strain number is given in parentheses. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site.

The remaining species showing genetic heterogeneity belong to the genus Vishniacozyma. Isolates (n = 16) with rDNA nucleotide sequences similar to the Vishniacozyma carnescens type strain were divided into two groups. The first group consisted of isolates (n = 9) with 5.8S-ITS region sequences identical to the type strain and was defined as Vishniacozyma carnescens (representative strain EPV117K4). The rDNA sequences of isolates in the second group (n = 7) (representative strain EPV151K4) were identical but diverged from the type strain (8 substitutions and 1 insertion in 5.8S-ITS region; 9 substitutions and 1 deletion in D1/D2 domain). This species was named Vishniacozyma aff. carnescens. The same 5.8S-ITS sequence was identified when several environmental samples (e.g. soil, freshwater plastic, indoor dust, wetland reed, etc.) were studied [[48], [49], [50], [51]]. A total of 16 isolates were closely related to Vishniacozyma tephrensis. Only one of the 5.8S-ITS sequences from these isolates was identical to the type strain sequence. The seven isolates (representative strain EPV158K5) formed a distinct group and differed from type strain by 10 substitutions in the 5.8S-ITS region. The remaining eight isolates (representative strain EPV122K6) were grouped into a separate clade because their 5.8S-ITS sequence differed from the type strain sequence by 7 substitutions and 1 insertion. The two groups of isolates identified in this study were named Vishniacozyma aff. tephrensis A and Vishniacozyma aff. tephrensis B, respectively (Table 1). The species Vishniacozyma victoriae and Vishniacozyma aff. victoriae were the most frequently isolated yeasts, accounting for 34% of all Agaricomycotina isolates. The main group of 47 isolates either shared an identical sequence to the type strain of Vishniacozyma victoriae or differed in a few but variable positions. The remaining seven isolates were more divergent and grouped into two clusters. Vishniacozyma aff. victoriae A contained six isolates (representative strain EPV420K1) with 11 substitutions and 1 insertion in the 5.8S-ITS region. One isolate (strain EPV464K5), defined as Vishniacozyma aff. victoriae B, differed in 13 positions. These Vishniacozyma aff. victoriae groups differed from each other in 18 substitutions and 1 deletion in the 5.8S-ITS region and 6 substitutions in the D1/D2 domain. From the phylogenetic analysis, isolates of the genus Vishniacozyma clustered together with recognized type strains but were still distinct (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

The phylogenetic relationship of the genus Vishniacozyma determined from the maximum likelihood analysis of the concatenated sequence of the 5.8S-ITS region and D1/D2 domain of the LSU rRNA gene. Names of the species and GenBank accession numbers (5.8S-ITS/D1/D2 domain) of the analysed sequences are indicated. The isolates of this study are shown in red and the strain numbers are given in parentheses. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site.

4. Discussion

Wild yeasts can be isolated from diverse habitats and ecological niches, including soil, plant leaves and flowers, tree bark, fruits, insect bodies, etc. In the present study, the yeast community on the surface of apple fruits was characterised. A total of 230 yeast isolates were collected and their species identity was determined by rDNA gene sequence (5.8S-ITS region and D1/D2 domain of LSU) analysis. The 33 species identified were clustered into three groups. The first group consisted of 19 species isolated only on 1–3 occasions. The second group included two species, Filobasidium wieringae and Vishniacozyma victoriae, which were isolated most frequently. Of apples analysed, 80% (n = 60) were found to harbour at least one of these species. The third group comprised the remaining 12 species isolated 4–19 times (Fig. 2A).

Previous studies have revealed that yeast communities colonising the surface of apple fruits are diverse and vary in species composition [[12], [13], [14], [15]]. Yeast species from the genera Filobasidium, Hanseniaspora, Metschnikowia, Papiliotrema, Pichia, and Rhodotorula were the most frequent. However, the dominant species varied from one study to another. For example, Hanseniaspora uvarum, Rhodotorula glutinis, Papiliotrema flavescens, Pichia guillermondii, and Pichia kluyveri were the five dominant species isolated from apple skins collected from two main ecological regions in China [15]. On the other hand, an analysis of apple fruits harvested in the Moscow region (Russia) showed that almost half of the isolates were of the species Filobasidium wieringae [14]. The current study identified two dominant species - Filobasidium wieringae and Vishniacozyma victoriae - covering 41% of all isolates. These were followed by Metschnikowia pulcherrima and Vishniacozyma carnescens. Many factors can significantly impact yeast community composition, such as ecosystem type, human activity/land management, and vegetation type [52,53]. In addition, microbial communities can also be influenced by climatic conditions such as temperature, UV exposure, relative humidity, and rainfall frequency. Research on vineyard-associated fungal communities in Chili, Spain, and Greece has shown that the diversity of yeast species in grapes can be influenced by maximum temperature and precipitation levels [[54], [55], [56], [57]]. The epiphytic yeasts on apples have been analysed in geographically different locations – China, Russia, and Estonia. The Moscow region and Estonia are located in the temperate zones, with Moscow in a humid continental climate and Estonia in a transition zone between maritime and continental climates. The Chinese Loess Plateau and Bo Hai Gulf Area have a typical temperate continental monsoon climate characterised by dray winters and hot rainy summers. Thus, one reason why the dominant apple-fruits associated yeast species differed could be differences in climate conditions.

Another aspect that has emerged from studies of yeast communities colonising on the surface of apple fruits is the variation in the total number of species identified. A moderate number of yeast species were identified in studies where the same sampling sites were used over a longer period [13,14]. By contrast, 71 different yeast species were isolated from samples collected from 43 locations in China [15]. In the current study, the samples were collected from 37 locations, and 33 different yeast species were identified. The study of epiphytic yeasts on the surface of mountain ash fruits demonstrated that yeast communities on fruits at similar developmental stages are more similar when located close to each other [58]. The formation of a similar microbial community on neighbouring trees depends on cell migration. Since fruits are accessible substrates for a limited period, the presence of suitable vectors plays an essential role in forming yeast communities. Thus, variations in the yeast community structure in different geographical areas can be explained by differences in the conditions of their formation. The results suggest that the number of yeast species in a single location is rather limited. For the isolation of many different species, a large number of geographically widespread sampling locations are required.

The current study also shows that phylogenetically distinct yeasts colonise the surface of apple fruits. Most of the collected isolates belonged to the phylum Basidiomycota. Only 12.6% of the isolates were classified to the phylum Ascomycota. The predominance of basidiomycetous yeasts on fruits has been reported before [14,[59], [60], [61]]. It has been proposed that these yeasts are adapted to grow under more variable or even extreme conditions due to physiological adaptation, such as pigmentation, production of extracellular polysaccharides, etc. [62,63]. The availability of nutrients, which is dependent on geographic location, climatic conditions, and the ripening stage of the fruits, can influence the composition of the yeast communities [64,65]. However, some studies have identified a higher number of ascomycetous yeast species [15,66]. Ascomycetous yeasts are more abundant in high-sugar environments [67,68]. They prefer carbon sources where the composition of available sugars is simpler, such as flowers and nectar [[69], [70], [71]]. The prevalence of Ascomycota species was also observed when samples were enriched under fermentation conditions [13]. The predominance of this phylum across the entire eukaryotic microorganism population was reported when a metagenomic analysis was used [66,72].

In the course of this study, 33 different yeast species were isolated. Nevertheless, apple fruits grown in Estonia may have a much richer yeast community. The direct plating method used in the present study is only suited for detecting species of fast growth and minimal abundance. This method may underestimate the frequency of species represented by only a few cells per sample. In addition, because of the overgrowth of filamentous fungi, it was impossible to isolate slow-growing yeast species. Interestingly, the isolation of epiphytic yeasts from apple fruits did not detect Saccharomyces species [[13], [14], [15]]. It is known, however, that microbial community changes during the fermentation process [11,73,74]. The dominant species carry out the first phase of fermentation. In the second phase where the alcohol fermentation occurs, non-Saccharomyces yeasts are replaced by the stronger fermenting Saccharomyces yeasts. In addition, species requiring specific growth conditions may be missed. Further investigations using enrichment cultures will make it possible to investigate the distribution of rare yeast species on Estonian apple fruits.

The isolated and identified yeast species constitute an important contribution to the Estonian Yeast Stock Collection. Several yeast species isolated in this study have been reported to have biotechnological potential. For example, yeasts from the genus Metschnikowia, which produce the red pigment pulcherrimin, are effective antagonists against fungi associated with fruit decay and have been successfully used as biocontrol agents [59,[75], [76], [77], [78]]. The availability of stocks prepared from pure cultures allows the analysis of existing species for specific characteristics and speeds up their use in various biotechnological applications.

FUNDING STATEMENT

This work was supported by the Developmental Fund of the University of Tartu, the Estonian Research Council science popularisation grant “Isolation and identification of Estonian yeast strains“ and the Estonian Research Council grants (grant numbers: PRG1741 and PRG757).

5. Ethics declarations

Review and/or approval by an ethics committee was not needed for this study.

Informed consent was not required for this study.

Data availability STATEMENT

The DNA sequences generated during and/or analysed during the current study are available in the GenBank repository (accession numbers: OQ644241, OR123525-OR123558; OR123560; OR123561; OR123651-OR123684; OR123686; OR123687; OR139193-OR139198; OR139201-OR139203; OR475099; OR475100).

CRediT authorship contribution statement

Arnold Kristjuhan: Writing – review & editing, Visualization, Resources, Investigation, Funding acquisition, Formal analysis, Data curation. Kersti Kristjuhan: Writing – review & editing, Investigation. Tiina Tamm: Writing – original draft, Visualization, Resources, Investigation, Funding acquisition, Data curation, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

We thank all the students and teachers from Estonian secondary schools for their participation in collecting the samples during the project “101 Yeast Strains from Estonian Nature”. We also thank all students at the University of Tartu who took part in the course „Yeast Genetics“, and helped to collect and analyse the samples. We are grateful to all our colleagues at the Institute of Molecular and Cell Biology, University of Tartu who contributed to establishing of the Estonian Yeast Stock Collection “Eesti Pärmivaramu”. We thank Kaspar Reier for his help with statistical analysis.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e27885.

Contributor Information

Arnold Kristjuhan, Email: arnold.kristjuhan@ut.ee.

Kersti Kristjuhan, Email: kersti.kristjuhan@ut.ee.

Tiina Tamm, Email: ttamm@ut.ee.

Appendix A. Supplementary data

The following is the Supplementary data to this article.

Multimedia component 1
mmc1.xlsx (23.3KB, xlsx)

References

  • 1.Péter G., Takashima M., Čadež N. In: Yeasts in Natural Ecosystems: Ecology. Buzzini P., Lachance M.-A., Yurkov A., editors. Springer International Publishing; Cham: 2017. Yeast habitats: different but global; pp. 39–71. [Google Scholar]
  • 2.Boekhout T., Amend A.S., El Baidouri F., Gabaldón T., Geml J., Mittelbach M., et al. Trends in yeast diversity discovery. Fungal Divers. 2022;114:491–537. doi: 10.1007/s13225-021-00494-6. [DOI] [Google Scholar]
  • 3.Vegas C., Zavaleta A.I., Canales P.E., Esteve-Zarzoso B. Yeasts associated with various amazonian native fruits. Pol. J. Microbiol. 2020;69:1–11. doi: 10.33073/pjm-2020-027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Fleet G.H. Yeast interactions and wine flavour. Int. J. Food Microbiol. 2003;86:11–22. doi: 10.1016/s0168-1605(03)00245-9. [DOI] [PubMed] [Google Scholar]
  • 5.Barata A., Malfeito-Ferreira M., Loureiro V. The microbial ecology of wine grape berries. Int. J. Food Microbiol. 2012;153:243–259. doi: 10.1016/j.ijfoodmicro.2011.11.025. [DOI] [PubMed] [Google Scholar]
  • 6.Zhu L., Li T., Xu X., Shi X., Wang B. Succession of fungal communities at different developmental stages of cabernet sauvignon grapes from an organic vineyard in xinjiang. Front. Microbiol. 2021;12 doi: 10.3389/fmicb.2021.718261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hawkins D.L., Ryder J., Lee S.A., Parish‐Virtue K., Fedrizzi B., Goddard M.R., et al. Mixed yeast communities contribute to regionally distinct wine attributes. FEMS Yeast Res. 2023;23:1–10. doi: 10.1093/femsyr/foad005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cornille A., Giraud T., Smulders M.J., Roldan-Ruiz I., Gladieux P. The domestication and evolutionary ecology of apples. Trends Genet. : TIG (Trends Genet.) 2014;30:57–65. doi: 10.1016/j.tig.2013.10.002. [DOI] [PubMed] [Google Scholar]
  • 9.Pando Bedrinana R., Querol Simon A., Suarez Valles B. Genetic and phenotypic diversity of autochthonous cider yeasts in a cellar from asturias. Food microbiology. 2010;27:503–508. doi: 10.1016/j.fm.2009.11.018. [DOI] [PubMed] [Google Scholar]
  • 10.Lorenzini M., Simonato B., Zapparoli G. Yeast species diversity in apple juice for cider production evidenced by culture-based method. Folia microbiologica. 2018;63:677–684. doi: 10.1007/s12223-018-0609-0. [DOI] [PubMed] [Google Scholar]
  • 11.Cousin F.J., Le Guellec R., Schlusselhuber M., Dalmasso M., Laplace J.-M., Cretenet M. Microorganisms in fermented apple beverages: current knowledge and future directions. Microorganisms. 2017;5:39. doi: 10.3390/microorganisms5030039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chand-Goyal T., Spotts R.A. Enumeration of bacterial and yeast colonists of apple fruits and identification of epiphytic yeasts on pear fruits in the pacific northwest United States. Microbiol. Res. 1996;151:427–432. doi: 10.1016/S0944-5013(96)80013-9. [DOI] [PubMed] [Google Scholar]
  • 13.Vadkertiova R., Molnarova J., Vranova D., Slavikova E. Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees. Can. J. Microbiol. 2012;58:1344–1352. doi: 10.1139/cjm-2012-0468. [DOI] [PubMed] [Google Scholar]
  • 14.Glushakova A.M., Kachalkin A.V. Endophytic yeasts in malus domestica and pyrus communis fruits under anthropogenic impact. Microbiology. 2017;86:128–135. doi: 10.1134/S0026261716060102. [DOI] [PubMed] [Google Scholar]
  • 15.Wei J., Niu C., Liu B., Yuan Y., Yue T. Identification and characterization of epiphytic yeasts on apples in China. RSC Adv. 2017;7:44766–44772. doi: 10.1039/C7RA08234G. [DOI] [Google Scholar]
  • 16.Camatti-Sartori V., da Silva-Ribeiro R.T., Valdebenito-Sanhueza R.M., Pagnocca F.C., Echeverrigaray S., Azevedo J.L. Endophytic yeasts and filamentous fungi associated with southern brazilian apple (malus domestica) orchards subjected to conventional, integrated or organic cultivation. J. Basic Microbiol. 2005;45:397–402. doi: 10.1002/jobm.200410547. [DOI] [PubMed] [Google Scholar]
  • 17.Zhang Q., Shi W., Zhou B., Du H., Xi L., Zou M., et al. Variable characteristics of microbial communities on the surface of sweet cherries under different storage conditions. Postharvest Biol. Technol. 2021;173 doi: 10.1016/j.postharvbio.2020.111408. [DOI] [Google Scholar]
  • 18.Lõoke M., Kristjuhan K., Kristjuhan A. Extraction of genomic DNA from yeasts for pcr-based applications. Biotechniques. 2011;50:325–328. doi: 10.2144/000113672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.White T.J., Bruns T., Lee S., Taylor J. Academic Press; London: 1990. Amplification and Direct Sequencing of Fungal Ribosomal Rna Genes for Phylogenetics. [DOI] [Google Scholar]
  • 20.Vilgalys R., Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several cryptococcus species. J. Bacteriol. 1990;172:4238–4246. doi: 10.1128/jb.172.8.4238-4246.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Rehner S.A., Samuels G.J. Molecular systematics of the hypocreales: a teleomorph gene phylogeny and the status of their anamorphs. Botany. 1995;73:816–823. [Google Scholar]
  • 22.Stielow J.B., Levesque C.A., Seifert K.A., Meyer W., Iriny L., Smits D., et al. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes. Persoonia. 2015;35:242–263. doi: 10.3767/003158515X689135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Altschul S.F., Gish W., Miller W., Myers E.W., Lipman D.J. Basic local alignment search tool. Journal of molecular biology. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 24.Muscle R.C. Edgar. Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kumar S., Stecher G., Li M., Knyaz C., Tamura K. Mega x: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018;35:1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Tamura K., Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993;10:512–526. doi: 10.1093/oxfordjournals.molbev.a040023. [DOI] [PubMed] [Google Scholar]
  • 27.Colwell R.K., Elsensohn J.E. Estimates turns 20: statistical estimation of species richness and shared species from samples, with non-parametric extrapolation. Ecography. 2014;37:609–613. doi: 10.1111/ecog.00814. [DOI] [Google Scholar]
  • 28.Sipiczki M. Metschnikowia pulcherrima and related pulcherrimin-producing yeasts: fuzzy species boundaries and complex antimicrobial antagonism. Microorganisms. 2020;8:1029. doi: 10.3390/microorganisms8071029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Metschnikowia M.A. Lachance. Half tetrads, a regicide and the fountain of youth. Yeast. 2016;33:563–574. doi: 10.1002/yea.3208. [DOI] [PubMed] [Google Scholar]
  • 30.Sipiczki M., Pfliegler W.P., Holb I.J. Metschnikowia species share a pool of diverse rrna genes differing in regions that determine hairpin-loop structures and evolve by reticulation. PLoS One. 2013;8 doi: 10.1371/journal.pone.0067384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lachance M.-A. In: The Yeasts. fifth ed. Kurtzman C.P., Fell J.W., Boekhout T., editors. Elsevier; London: 2011. Chapter 46 - metschnikowia kamienski (1899) pp. 575–620. [Google Scholar]
  • 32.Sipiczki M. When barcoding fails: genome chimerization (admixing) and reticulation obscure phylogenetic and taxonomic relationships. Molecular ecology resources. 2022;22:1762–1785. doi: 10.1111/1755-0998.13586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sipiczki M. Taxonomic revision of the pulcherrima clade of metschnikowia (fungi): merger of species. Taxonomy. 2022;2:107–123. doi: 10.3390/taxonomy2010009. [DOI] [Google Scholar]
  • 34.Zhang Q., Zhang J., Yang L., Zhang L., Jiang D., Chen W., et al. Diversity and biocontrol potential of endophytic fungi in brassica napus. Biol. Control. 2014;72:98–108. doi: 10.1016/j.biocontrol.2014.02.018. [DOI] [Google Scholar]
  • 35.Akan M., Michling F., Matti K., Krause S., Muno-Bender J., Wendland J. Snails as taxis for a large yeast biodiversity. Fermentation. 2020;6:90. doi: 10.3390/fermentation6030090. [DOI] [Google Scholar]
  • 36.Zalar P., Gubensek A., Gostincar C., Kostanjsek R., Bizjak-Mali L., Gunde-Cimerman N. Cultivable skin mycobiota of healthy and diseased blind cave salamander (proteus anguinus) Front. Microbiol. 2022;13 doi: 10.3389/fmicb.2022.926558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Takashima M., Deak T., Nakase T. Emendation of dioszegia with redescription of dioszegia hungarica and two new combinations, dioszegia aurantiaca and dioszegia crocea. J. Gen. Appl. Microbiol. 2001;47:75–84. doi: 10.2323/jgam.47.75. [DOI] [PubMed] [Google Scholar]
  • 38.Bai F.Y., Takashima M., Jia J.H., Nakase T. Dioszegia zsoltii sp. Nov., a new ballistoconidium-forming yeast species with two varieties. J. Gen. Appl. Microbiol. 2002;48:17–23. doi: 10.2323/jgam.48.17. [DOI] [PubMed] [Google Scholar]
  • 39.Thomas-Hall S., Watson K., Scorzetti G. Cryptococcus statzelliae sp. Nov. And three novel strains of cryptococcus victoriae, yeasts isolated from antarctic soils. Int. J. Syst. Evol. Microbiol. 2002;52:2303–2308. doi: 10.1099/00207713-52-6-2303. [DOI] [PubMed] [Google Scholar]
  • 40.Libkind D., Brizzio S., Ruffini A., Gadanho M., van Broock M., Paulo Sampaio J. Molecular characterization of carotenogenic yeasts from aquatic environments in patagonia, Argentina. Antonie Leeuwenhoek. 2003;84:313–322. doi: 10.1023/a:1026058116545. [DOI] [PubMed] [Google Scholar]
  • 41.Wang Q.M., Jia J.H., Bai F.Y. Diversity of basidiomycetous phylloplane yeasts belonging to the genus dioszegia (tremellales) and description of dioszegia athyri sp. Nov., dioszegia butyracea sp. Nov. And dioszegia xingshanensis sp. Nov. Antonie Leeuwenhoek. 2008;93:391–399. doi: 10.1007/s10482-007-9216-9. [DOI] [PubMed] [Google Scholar]
  • 42.Wang Q.M., Bai F.Y., Zhao J.H., Jia J.H. Dioszegia changbaiensis sp. Nov., a basidiomycetous yeast species isolated from northeast China. J. Gen. Appl. Microbiol. 2003;49:295–299. doi: 10.2323/jgam.49.295. [DOI] [PubMed] [Google Scholar]
  • 43.Madhour A., Anke H., Mucci A., Davoli P., Weber R.W. Biosynthesis of the xanthophyll plectaniaxanthin as a stress response in the red yeast dioszegia (tremellales, heterobasidiomycetes, fungi) Phytochemistry. 2005;66:2617–2626. doi: 10.1016/j.phytochem.2005.09.010. [DOI] [PubMed] [Google Scholar]
  • 44.Libkind D., Moline M., Sampaio J.P., van Broock M. Yeasts from high-altitude lakes: influence of uv radiation. FEMS Microbiol. Ecol. 2009;69:353–362. doi: 10.1111/j.1574-6941.2009.00728.x. [DOI] [PubMed] [Google Scholar]
  • 45.Connell L.B., Redman R., Rodriguez R., Barrett A., Iszard M., Fonseca A. Dioszegia Antarctica sp. Nov. And dioszegia cryoxerica sp. Nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica. Int. J. Syst. Evol. Microbiol. 2010;60:1466–1472. doi: 10.1099/ijs.0.015412-0. [DOI] [PubMed] [Google Scholar]
  • 46.Takashima M., Van B.H., An K.D., Ohkuma M. Dioszegia rishiriensis sp. Nov., a novel yeast species from soil collected on rishiri island, hokkaido, Japan. Int. J. Syst. Evol. Microbiol. 2011;61:1736–1739. doi: 10.1099/ijs.0.025254-0. [DOI] [PubMed] [Google Scholar]
  • 47.Trochine A., Turchetti B., Vaz A.B.M., Brandao L., Rosa L.H., Buzzini P., et al. Description of dioszegia patagonica sp. Nov., a novel carotenogenic yeast isolated from cold environments. Int. J. Syst. Evol. Microbiol. 2017;67:4332–4339. doi: 10.1099/ijsem.0.002211. [DOI] [PubMed] [Google Scholar]
  • 48.O'Brien H.E., Parrent J.L., Jackson J.A., Moncalvo J.M., Vilgalys R. Fungal community analysis by large-scale sequencing of environmental samples. Appl. Environ. Microbiol. 2005;71:5544–5550. doi: 10.1128/AEM.71.9.5544-5550.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Neubert K., Mendgen K., Brinkmann H., Wirsel S.G. Only a few fungal species dominate highly diverse mycofloras associated with the common reed. Appl. Environ. Microbiol. 2006;72:1118–1128. doi: 10.1128/AEM.72.2.1118-1128.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Pitkaranta M., Meklin T., Hyvarinen A., Paulin L., Auvinen P., Nevalainen A., et al. Analysis of fungal flora in indoor dust by ribosomal DNA sequence analysis, quantitative pcr, and culture. Appl. Environ. Microbiol. 2008;74:233–244. doi: 10.1128/AEM.00692-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Moll J., Hoppe B., Konig S., Wubet T., Buscot F., Kruger D. Spatial distribution of fungal communities in an arable soil. PLoS One. 2016;11 doi: 10.1371/journal.pone.0148130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Yurkov A.M., Kemler M., Begerow D. Assessment of yeast diversity in soils under different management regimes. Fungal Ecology. 2012;5:24–35. doi: 10.1016/j.funeco.2011.07.004. [DOI] [Google Scholar]
  • 53.Yurkov A.M., Rohl O., Pontes A., Carvalho C., Maldonado C., Sampaio J.P. Local climatic conditions constrain soil yeast diversity patterns in mediterranean forests, woodlands and scrub biome. FEMS Yeast Res. 2016;16:fov103. doi: 10.1093/femsyr/fov103. [DOI] [PubMed] [Google Scholar]
  • 54.Jara C., Laurie V.F., Mas A., Romero J. Microbial terroir in chilean valleys: diversity of non-conventional yeast. Front. Microbiol. 2016;7:663. doi: 10.3389/fmicb.2016.00663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Longo E., Cansado J., Agrelo D., Villa T.G. Effect of climatic conditions on yeast diversity in grape musts from northwest Spain. Am. J. Enol. Vitic. 1991;42:141–144. doi: 10.5344/ajev.1991.42.2.141. [DOI] [Google Scholar]
  • 56.Chalvantzi I., Banilas G., Tassou C., Nisiotou A. Biogeographical regionalization of wine yeast communities in Greece and environmental drivers of species distribution at a local scale. Front. Microbiol. 2021;12 doi: 10.3389/fmicb.2021.705001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Castrillo D., Blanco P. Influence of vintage, geographical location and agricultural management on yeast populations in Galician grape musts (nw Spain) OENO One. 2022;56:65–79. doi: 10.20870/oeno-one.2022.56.4.4898. [DOI] [Google Scholar]
  • 58.Maksimova I.A., Yurkov A.M., Chernov I.Y. Spatial structure of epiphytic yeast communities on fruits of sorbus aucuparia l. Biol. Bull. 2009;36:613–618. doi: 10.1134/S1062359009060107. [DOI] [PubMed] [Google Scholar]
  • 59.Janisiewicz W.J., Jurick W.M., 2nd, Peter K.A., Kurtzman C.P., Buyer J.S. Yeasts associated with plums and their potential for controlling brown rot after harvest. Yeast. 2014;31:207–218. doi: 10.1002/yea.3009. [DOI] [PubMed] [Google Scholar]
  • 60.Janisiewicz W.J., Kurtzman C.P., Buyer J.S. Yeasts associated with nectarines and their potential for biological control of brown rot. Yeast. 2010;27:389–398. doi: 10.1002/yea.1763. [DOI] [PubMed] [Google Scholar]
  • 61.Volschenk Q., du Plessis E.M., Duvenage F.J., Korsten L. Effect of postharvest practices on the culturable filamentous fungi and yeast microbiota associated with the pear carpoplane. Postharvest Biol. Technol. 2016;118:87–95. doi: 10.1016/j.postharvbio.2016.03.020. [DOI] [Google Scholar]
  • 62.Limtong S., Nasanit R. In: Yeasts in Natural Ecosystems: Diversity. Buzzini P., Lachance M.-A., Yurkov A., editors. Springer International Publishing; Cham: 2017. Phylloplane yeasts in tropical climates; pp. 199–223. [Google Scholar]
  • 63.Casanova Navarro H.M., Félix C.R., Paulino G.V.B., Almeida J.H., Valente P., Landell M.F. Richness and biotechnological potential of the yeast community associated with the bromeliad phylloplane in the brazilian neotropical forest. Mycol. Prog. 2020;19:1387–1401. doi: 10.1007/s11557-020-01631-2. [DOI] [Google Scholar]
  • 64.Andrews J.H., Harris R.F. The ecology and biogeography of microorganisms on plant surfaces. Annu. Rev. Phytopathol. 2000;38:145–180. doi: 10.1146/annurev.phyto.38.1.145. [DOI] [PubMed] [Google Scholar]
  • 65.Lindow S.E., Brandl M.T. Microbiology of the phyllosphere. Appl. Environ. Microbiol. 2003;69:1875–1883. doi: 10.1128/AEM.69.4.1875-1883.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Vepstaite-Monstavice I., Luksa J., Staneviciene R., Strazdaite-Zieliene Z., Yurchenko V., Serva S., et al. Distribution of apple and blackcurrant microbiota in Lithuania and the Czech republic. Microbiol. Res. 2018;206:1–8. doi: 10.1016/j.micres.2017.09.004. [DOI] [PubMed] [Google Scholar]
  • 67.Lachance M.-A. The ecological genomics of fungi; 2013. The Biodiversity, Ecology, and Biogeography of Ascomycetous Yeasts; pp. 355–370. [Google Scholar]
  • 68.Cray J.A., Bell A.N., Bhaganna P., Mswaka A.Y., Timson D.J., Hallsworth J.E. The biology of habitat dominance; can microbes behave as weeds? Microb. Biotechnol. 2013;6:453–492. doi: 10.1111/1751-7915.12027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Pozo M.I., Herrera C.M., Bazaga P. Species richness of yeast communities in floral nectar of southern Spanish plants. Microb. Ecol. 2011;61:82–91. doi: 10.1007/s00248-010-9682-x. [DOI] [PubMed] [Google Scholar]
  • 70.Canto A., Herrera C.M., Rodriguez R. Nectar-living yeasts of a tropical host plant community: diversity and effects on community-wide floral nectar traits. PeerJ. 2017;5 doi: 10.7717/peerj.3517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Morris M.M., Frixione N.J., Burkert A.C., Dinsdale E.A., Vannette R.L. Microbial abundance, composition, and function in nectar are shaped by flower visitor identity. FEMS Microbiol. Ecol. 2020;96 doi: 10.1093/femsec/fiaa003. fiaa003. [DOI] [PubMed] [Google Scholar]
  • 72.Abdelfattah A., Wisniewski M., Droby S., Schena L. Spatial and compositional variation in the fungal communities of organic and conventionally grown apple fruit at the consumer point-of-purchase. Horticulture research. 2016;3 doi: 10.1038/hortres.2016.47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Coton E., Coton M., Levert D., Casaregola S., Sohier D. Yeast ecology in French cider and black olive natural fermentations. Int. J. Food Microbiol. 2006;108:130–135. doi: 10.1016/j.ijfoodmicro.2005.10.016. [DOI] [PubMed] [Google Scholar]
  • 74.Morrissey W.F., Davenport B., Querol A., Dobson A.D. The role of indigenous yeasts in traditional Irish cider fermentations. J. Appl. Microbiol. 2004;97:647–655. doi: 10.1111/j.1365-2672.2004.02354.x. [DOI] [PubMed] [Google Scholar]
  • 75.Kurtzman C.P., Droby S. Metschnikowia fructicola, a new ascosporic yeast with potential for biocontrol of postharvest fruit rots. Syst. Appl. Microbiol. 2001;24:395–399. doi: 10.1078/0723-2020-00045. [DOI] [PubMed] [Google Scholar]
  • 76.Manso T., Nunes C. Metschnikowia andauensis as a new biocontrol agent of fruit postharvest diseases. Postharvest Biol. Technol. 2011;61:64–71. doi: 10.1016/j.postharvbio.2011.02.004. [DOI] [Google Scholar]
  • 77.Freimoser F.M., Rueda-Mejia M.P., Tilocca B., Migheli Q. Biocontrol yeasts: mechanisms and applications. World journal of microbiology & biotechnology. 2019;35:154. doi: 10.1007/s11274-019-2728-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Wang S., Ruan C., Yi L., Deng L., Yao S., Zeng K. Biocontrol ability and action mechanism of metschnikowia citriensis against geotrichum citri-aurantii causing sour rot of postharvest citrus fruit. Food microbiology. 2020;87 doi: 10.1016/j.fm.2019.103375. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.xlsx (23.3KB, xlsx)

Data Availability Statement

The DNA sequences generated during and/or analysed during the current study are available in the GenBank repository (accession numbers: OQ644241, OR123525-OR123558; OR123560; OR123561; OR123651-OR123684; OR123686; OR123687; OR139193-OR139198; OR139201-OR139203; OR475099; OR475100).

Articles from Heliyon are provided here courtesy of Elsevier

RESOURCES