Abstract
Recent studies have revealed that endophytes in plants can produce metabolites with activity that is comparable to or identical to the host. Dendrobine has attracted much attention in the field of neurodegenerative diseases by exhibiting anti-oxidative stress and neuroprotective effects. This study aimed to investigate the protective effects and mechanisms of metabolites of dendrobium endophytes Pseudomonas protegens CM-YJ44 and Priestia megaterium D-HT207 against H2O2-induced oxidative stress injury in SH-SY5Y cells. Results showed that there were 50 neuroprotective compounds in CM-YJ44 and 72 neuroprotective compounds in D-HT207. Those both increased significantly cell viability, decreased contents of ROS in H2O2-induced SH-SY5Y cells. It was confirmed that metabolites of CM-YJ44 and D-HT207 inhibited the H2O2-induced oxidative stress injury in SH-SY5Y cells, which mechanism is related to inhibition of ROS production, alteration of MMP, and inhibition of apoptosis and inflammatory factors expression via the Nrf2/Keap1 pathway.
Keywords: Dendrobium endophytes, Neuroprotection, SH-SY5Y, Oxidative stress, Nrf2
1. Introduction
Neurodegenerative diseases (NDDs) are chronic progressive damage diseases of the nervous system caused by the loss of neuronal cells in the brain and spinal cord. Such as Alzheimer's disease and Parkinson's disease. Current studies suggest that its main mechanism is a chain reaction caused by oxidative stress [1].
Oxidative stress is a pathological state resulting from an imbalance between cellular oxidative and antioxidant homeostasis, which leads to an excess of reactive oxygen species. Furthermore, it contributes to inflammation, apoptosis, autophagy and mitochondrial dysfunction in the body, ultimately leading to neuronal cell death [2]. Nuclear factor erythroid 2-Related (Nrf2) is a key factor in antioxidant defense and enhances the expression of antioxidant system in the development of oxidative stress. The antioxidant response element (ARE) is triggered when Nrf2 dissociates from Kelch-like ECH-associated protein 1 (Keap1) in response to oxidative stress. The expression of proteins that prevent oxidative stress, including superoxide dismutase (SOD), glutathione (GSH), and catalase (CAT), is upregulated when ARE is activated [3]. Meanwhile, Nrf2 plays a critical role in suppressing oxidative stress by promoting the transcription of its downstream genes such as heme oxygenase-1 (HO-1) and activating antioxidant responses [4]. In this way, Nrf2 reduces neuronal cell death induced by oxidative stress.
Known as a medicine food homology herb, Dendrobium has been used as a tonic that enhance immunity in China for thousand years. Nowadays pharmacological research shows that dendrobine, as the main component of dendrobium, exhibits anti-oxidative stress and neuroprotective effects through multiple pathways and targets [[5], [6], [7]]. Li, L. et al. [8] found that dendrobine-type sesquiterpenoid alkaloids (DSAs) could penetrate the blood-brain barrier and showed neuropharmacological effects such as anti-Alzheimer's disease and protected neurons from damage. Several studies have confirmed that medicinal plant endophytes can produce the same or comparable active metabolites as their hosts [9]. For example, the secondary metabolites of Stagonosporopsis oculihominis showed similar anti-inflammatory and antibacterial effects as the host plant Dendrobium huoshanense [10]; the endophytic bacteria from Dendrobium officinale have been implicated them as a valuable source for new anticancer and antibiotics agents [11]. Results from Chua et al.’s study indicated the potential of endophytic fungi from medicinal orchids (Dendrobium sp.) as natural sources of bioactive compounds could be developed into novel antioxidants and anticancer drugs [12]. Meanwhile, the metabolites of dendrobium endophytes Pseudomonas protegens CM-YJ44 and Priestia megaterium D-HT207 have been found showing better anti-inflammatory and antioxidant effects than other endophytes in our previous research [13,14]. Therefore, it is prospected to find new drugs from endophytes for treating newly developing diseases in humans, plants, and animals.
The objective of this study was to assess the protective effects and mechanisms of metabolites of dendrobium endophytes Pseudomonas protegens CM-YJ44 and Priestia megaterium D-HT207 against H2O2-induced oxidative stress injury in SH-SY5Y cells. Furthermore, the anti-oxidative stress mechanism of metabolites of dendrobium endophytes Pseudomonas protegens CM-YJ44 and Priestia megaterium D-HT207 was revealed from the perspective of Nrf2/HO-1 pathway.
2. Materials and methods
2.1. Materials
Dendrobine (purity ≥98%) was obtained from Shanghai yuanye Bio-Technology Co., Ltd (Shanghai, China). Two endophytic strains were isolated from Dendrobium in our previous studies and named as Pseudomonas protegens CM-YJ44 (National Center for Biotechnology Information NCBI accession No.MZ674076), Priestia megaterium D-HT207 (NCBI accession No.MK389456), respectively. The dried extract of CM-YJ44 and D-HT207 was collected following the method by Wang et al. [13]. The extracts were redissolved in 1 mL Dimethyl Sulfoxide (DMSO) for the following experiments.
The human neuroblastoma SH-SY5Y cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Beijing, China). Dulbecco's modified Eagle's minimum (DMEM) was purchased from Thermo Scientific; fetal bovine serum (FBS) from Gibco; cell Counting Kit-8 (CCK-8) test, ROS kit, MDA kit, GSH kit, CAT kit from Solarbio; the 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-benzimidazolyl-carbocyanine iodide (JC-1) fluorescent probe, SOD kit, NO kit and LDH kit from Beyotime; annexin V-FITC Apoptosis Detection Kit from BD; prime Script RT reagent Kit, SYBR Premix Ex Taq from TaKaRa.
2.2. LC/MS analysis of CM-YJ44 and D-HT207
The sample pre-treatment was referenced the method in Wang et al. [13]. Chromatographic separation of the metabolites was performed on UHPLC-Q Exactive HF-X (Thermo, USA) equipped with an ACQUITY UPLC HSS T3 column (100 mm × 2.1 mm i.d., 1.8 μm; Waters, Milford, USA). The optimal conditions were set as listed (Tables S1–3).
After LC/MS analysis, the raw data were imported into the Progenesis QI (Waters Corporation, Milford, USA). The extracted data included the mass-to-charge ratio (m/z) values, peak intensity, and retention time (RT). These metabolites were identified by using the mass spectra and characteristic peaks searching from biochemical databases such as Metlin (https://metlin.scripps.edu/).
2.3. Cell culture and treatment
The SH-SY5Y cells were expanded in DMEM including 10% fetal bovine serum and were raised at 37 °C with 5% CO2. Cells in the logarithmic growth phase were taken for tests and inoculated at a density of 1 × 104 cells/well in 96-well plates or 1 × 106 cells/well in 6-well plates.
2.4. Cell viability assay
Using the CCK-8 test, cell viability was evaluated. Dendrobine and drugs were added to pre-activate the cells for 12 h, and then H2O2 (200 μM) was added to each well to co-stimulate the cells for 24 h except the control group. After 10 μL of CCK-8 was added to each well, and the plates were incubated at 37 °C for 0.5 h. Thermo Fisher Scientific's Microplate Reader (1510) was used to measure the optical density at 450 nm.
2.5. Measurement of ROS
The SH-SY5Y cells were grown overnight in 6-well plates, then each group was given the corresponding drugs treatment as mentioned. According to the manufacturer's instructions, 1 ml 2,7-Dichlorodi-hydrofluorescein diacetate (DCFH-DA) solution was applied at a concentration of 10 μmol/mL. The cells were incubated at 37 °C for 30 min. Fluorescence microscopy was used to observe the cell morphology, and ImageJ was used to evaluate the results.
2.6. Detection of MMP
The mitochondrial membrane potential (MMP) was detected using the JC-1 fluorescent probe. The SH-SY5Y cells were grown overnight in 6-well plates, then each group was given the corresponding drugs treatment as mentioned. And the cells were collected. The cells were stained with JC-1 probe and identified by flow cytometry after being washed once with phosphate buffered saline (PBS).
2.7. Cell apoptosis analysis
Annexin V-FITC Apoptosis Detection Kit was used to assess cell apoptosis. The SH-SY5Y cells were grown overnight in 6-well plates, then each group was given the corresponding drugs treatment as mentioned. Cultures were harvested, stained with Annexin V-FITC and PI, and identified by flow cytometry.
2.8. Measurement of SOD, MDA, GSH, CAT, NO, and LDH
The SH-SY5Y cells were cultured overnight in 6-well plates, then each group was given the corresponding drugs treatment as mentioned. Post-treatment, the activity of superoxide dismutase (SOD), malondialdehyde (MDA), glutathione (GSH), catalase (CAT), nitric oxide (NO), and lactate dehydrogenase (LDH) in media were analyzed respectively, using SOD kit, MDA kit, GSH kit, CAT kit, NO kit and LDH kit according to manufacturer's instructions. The absorbance was recorded by Microplate Reader (Thermo Fisher Scientific, 1510).
2.9. Measurement of inflammatory factor
The SH-SY5Y cells were cultured overnight in 6-well plates, then each group was given the corresponding drugs treatment as mentioned. The expression levels of Interleukin-1β (IL-1β), Interleukin-6 (IL-6), Tumor necrosis factor-α (TNF-α), and Nitric oxide synthase (iNOS) in SH-SY5Y cells were determined. RNA was extracted and transcribed into cDNA using PrimeScript RT reagent Kit. Then cDNAs were quantified by SYBR Premix Ex Taq using ABI 7500 fast real-time PCR System (Applied Biosystems, USA). β-actin mRNA was used as internal control for normalization. The specific primer pairs used were listed in Table 1.
Table 1.
The mRNA Primer Sequences used for PCR.
| Gene | Upstream primer | Downstream primer |
|---|---|---|
| IL-1β | AGTGGTGTTCTCCATGTCCTTTGTA | AGCTTGTTATTGATTTCTATCTTGT |
| IL-6 | AGACAGCCACTCACCTCTTCA | AGTGCCTCTTTGCTGCTTTC |
| TNF-α | AAGCCTGTAGCCCATGTTGTAGCA | CCTTGAAGAGGACCTGGGAGTAGAT |
| iNOS | TCGTGGAGACGGGAAAGAAG | ATCTGGAGGGGTAGGCTTGT |
| β-actin | GGGAAATCGTGCGTGACAT | GGAAGGAAGGCTGGAAGAGT |
2.10. Western blot analysis
The SH-SY5Y cells were cultured overnight in 6-well plates, then each group was given the corresponding drugs treatment as mentioned. Protein was denatured by boiling 10 min with loading buffer. Same amounts of proteins were added on 10–12% sodium dodecyl sulfate-polyacrylamide gels for electrophoresis (SDS-PAGE), which were then transferred to membranes. Then, the membranes were blocked for 2 h at room temperature with 5% non-fat milk in Tris-Buffered Saline and Tween20 (TBST). After TBST wash, membranes were incubated after primary antibodies were added at 4 °C overnight. Membranes were incubated for 2 h with goat anti-rabbit IgG-HRP. The listed antibodies were applied in accordance with the instructions provided by the manufacturers (Table 2). Finally, the images were obtained by Image Lab (Bio-Rad Laboratories, USA).
Table 2.
Antibodies were used in this study.
| Antibody | Host | Manufacturer | Cat. No. | Dilution |
|---|---|---|---|---|
| Bcl-2 | Rabbit | Solarbio, China | K107929P | 1:1000 |
| Bax | Rabbit | Solarbio, China | K110973P | 1:500 |
| Nrf2 | Rabbit | Solarbio, China | K106685P | 1:1000 |
| HO-1 | Rabbit | Solarbio, China | K002131P | 1:1000 |
| Keap1 | Rabbit | Solarbio, China | K106685P | 1:1000 |
| Caspase 3 | Rabbit | Cell Signaling Technology, USA | 9662S | 1:1000 |
| Caspase 9 | Rabbit | Cell Signaling Technology, USA | 9502S | 1:1000 |
| β-actin | Rabbit | Solarbio, China | 4970 | 1:1000 |
2.11. Statistical analysis
All data were expressed as mean ± standard error of the mean (SEM). One-way analysis of variance (ANOVA) was used in Prism 8.4.3 (GraphPad Software Inc., San Diego, CA, USA) to compare groups. Statistical significance was defined as p < 0.05. *p < 0.05, **p < 0.01, ***p < 0.001 compared to the H2O2 group; #p < 0.05, ##p < 0.01, ###p < 0.001 compared to the control group. And “n” denoted the number of independent experiments.
3. Results
3.1. Identification of CM-YJ44 and D-HT207 by LC-MS
72 metabolites components of D-HT207 and 50 metabolites components of CM-YJ44 were detected, and the neuroprotective activities have been confirmed in present studies (Fig. S1, Table S4). Besides, 31 metabolites components were both detected from D-HT207 and CM-YJ44. The 19 compounds both detected from D-HT207 and CM-YJ44 that possess neuroprotective activities through the regulating Nrf2 pathway were listed in Table 3.
Table 3.
Metabolites of CM-YJ44 and D-HT207.
| NO. | Formula | Name | mz | RT | Mode | D-HT207 | CM-YJ44 |
|---|---|---|---|---|---|---|---|
| 1 | C12H14N2O2 | N-Acetylserotonin | 219.1115 | 470 | pos | + | + |
| 2 | C13H12N2O | Harmine | 211.0871 | 651.3 | neg | + | + |
| 3 | C15H18O8 | Bilobalide A | 309.095 | 406.5 | pos | + | + |
| 4 | C7H6O4 | Protocatechuic acid | 153.0197 | 150.5 | neg | + | + |
| 5 | C15H16O3 | Osthol | 244.1107 | 233.3 | pos | + | + |
| 6 | C8H14N2O5S | gamma-Glutamylcysteine | 248.9603 | 84.9 | neg | + | + |
| 7 | C2H7NO3S | Taurine | 125.9861 | 72 | pos | + | + |
| 8 | C21H20O10 | Isovitexin | 433.1101 | 495.6 | pos | + | + |
| 9 | C10H12O2 | Eugenol | 147.0806 | 847.6 | pos | + | + |
| 10 | C15H10O6 | Luteolin | 285.2422 | 848 | neg | + | + |
| 11 | C17H26O4 | Gingerol | 293.1747 | 787.1 | neg | + | + |
| 12 | C11H12O5 | Sinapic acid | 223.0612 | 760.1 | neg | + | + |
| 13 | C10H10O4 | trans-Ferulic acid | 177.0544 | 751.8 | pos | + | + |
| 14 | C18H29NO3 | Dihydrocapsaicin | 308.2142 | 625.5 | pos | + | + |
| 15 | C12H16O7 | Arbutin | 272.0923 | 587.8 | neg | + | + |
| 16 | C15H10O7 | Tricetin | 301.0409 | 498.5 | neg | + | + |
| 17 | C16H12O7 | Isorhamnetin | 315.0523 | 515.5 | neg | + | + |
| 18 | C16H12O5 | Biochanin A | 283.0603 | 807 | neg | + | + |
| 19 | C27H30O16 | Rutin | 593.133 | 984.4 | pos | + | + |
Note: (+) detected, (−) not detected.
3.2. Cell viability assay
CM-YJ44 and D-HT207 (5–1000 ng/mL) had no toxicity to SH-SY5Y cells, and the dendrobine (50–400 μM) group showed the same result (Fig. S2). 50% lethal concentration (LC50) was 200 μM H2O2, and viability was decreased with increasing H2O2 concentration (Fig. 1A). Therefore, 200 μM H2O2 was used to stimulate cells. According to the results of the CCK8 (Fig. 1B), the concentration of the positive control group was set at 250 μM. H2O2 treatment decreased significantly cell viability, while pretreatment with CM-YJ44 at 10–1000 ng/mL or dendrobine decreased dramatically the H2O2-induced cytotoxicity (Fig. 1C). Pretreatment with D-HT207 at 5–500 ng/mL or dendrobine decreased significantly the H2O2-induced cytotoxicity (Fig. 1D). Based on the above results, the concentrations of the CM-YJ44 group at 50, 100 and 500 ng/mL and the D-HT207 group at 5, 10 and 50 ng/mL were chosen for further experiments.
Fig. 1.
(A) SH-SY5Y cells were exposed to various concentrations of H2O2 for 24 h (n = 3). (B) SH-SY5Y cells were pre-cultured with different concentrations of dendrobine for 12h before exposed to 200 μM H2O2 (n = 5). (C) (D) Cells were pre-cultured with different concentrations of drugs group for 12 h before exposed to 200 μM H2O2 (n = 3). **p < 0.01, ***p < 0.001 compared to the H2O2 group; ###p < 0.001 compared to the control group.
3.3. Measurement of ROS
As Fig. 2A and C have shown, the control group produced ROS fluorescence response rarely, and the ROS generation was higher in the H2O2 group (11.13 ± 1.57%) than that in the control group (3.54 ± 1.05%) after H2O2 treatment, while the CM-YJ44 group (50, 100, 500 ng/mL) inhibited the H2O2-induced increase in ROS generation (5.05 ± 1.00%, 4.84 ± 1.18%, 3.87 ± 0.49%), which were more effective than the positive control group (6.15 ± 1.25%).
Fig. 2.
CM-YJ44 and D-HT207 reduced H2O2-induced ROS generation. (A)(B) SH-SY5Y cells were pretreatment with CM-YJ44 or D-HT207, dendrobine for 12 h before H2O2 stimulated, pictures were taken by fluorescence microscopy (n = 5). (C)(D) Bar chart of ROS generation was obtained by Image J software. ***p < 0.001 compared to the H2O2 group; ###p < 0.001 compared to the control group.
In Fig. 2B and D, The ROS generation was higher in the H2O2 group (3.48 ± 0.80%) than that in the control group (1.27 ± 0.32%), while the D-HT207 group (5, 10, 50 ng/mL) inhibited the H2O2-induced increase in ROS generation (1.66 ± 0.38%, 1.31 ± 0.30%, 1.28 ± 0.23%), which were more effective than the positive control group (1.75 ± 0.48%).
3.4. Detection of MMP
The flow cytometry analysis indicated that the amounts of cells at the low potential were higher in the H2O2 group than that in the control group (p < 0.001). After pretreatment with CM-YJ44, the amounts of cells at the low potential were reduced significantly compared to the H2O2 group (Fig. 3A–C). Similar results were also confirmed after pretreatment with D-HT207 (Fig. 3B–D).
Fig. 3.
Effects of CM-YJ44 and D-HT207 on MMP using JC-1 fluorescent probe. (A)(B) Detection of MMP by flow cytometry (n = 3). (C)(D) Bar chart presentation of JC-1 ratio. ***p < 0.001 compared to the H2O2 group; ###p < 0.001 compared to the control group.
3.5. Cell apoptosis analysis
The inhibitory effect of CM-YJ44 or D-HT207 on H2O2-induced apoptosis was tested (Fig. 4A–D). The apoptosis rate was the sum of Q2 and Q3. Compared to the control group, the rate of apoptosis was increased significantly in the H2O2 group. However, after pretreatment with CM-YJ44 or D-HT207, the rate of apoptosis was decreased significantly, respectively.
Fig. 4.
Effects of CM-YJ44 and D-HT207 on the apoptotic ratio. (A)(B) the rate of cell apoptosis analyzed by Flow cytometry (n = 3). (C)(D) Bar chart presentation of apoptotic rate. ***p < 0.001 compared to the H2O2 group; ###p < 0.001 compared to the control group.
3.6. Measurement of NO, LDH, MDA, GSH, SOD, and CAT
3.6.1. Effects of CM-YJ44 on SH-SY5Y cells
In Fig. 5A–F, compared to the control group, the NO, LDH and MDA content of the H2O2 group were increased significantly, respectively, and they were decreased significantly after treatment with CM-YJ44. Meanwhile, compared to the control group, the GSH, SOD, and the CAT levels of the H2O2 group, were decreased significantly, respectively. Pre-cultured with CM-YJ44 resulted in a significant improvement in these values.
Fig. 5.
Effects of CM-YJ44 on NO, LDH, MDA and GSH levels, as well as on CAT activity and SOD inhibition in SH-SY5Y cells (n = 3). (A) NO content. (B) released of LDH. (C) MDA content. (D) GSH content. (E) SOD inhibition rate. (F) CAT activity. *p < 0.05, **p < 0.01, ***p < 0.001 compared to the H2O2 group; #p < 0.05, ##p < 0.01, ###p < 0.001 compared to the control group.
3.6.2. Effects of D-HT207 on SH-SY5Y cells
In Fig. 6A–F, compared to the control group, the NO, LDH and MDA content of the H2O2 group were increased significantly, respectively, and they were decreased significantly after pretreatment with D-HT207. Meanwhile, compared to the control group, the SOD, GSH, and CAT levels of the H2O2 group, were decreased significantly, respectively. Pre-cultured with D-HT207 resulted in a significant improvement in these values.
Fig. 6.
Effects of D-HT207 on NO, LDH, MDA, GSH, CAT, and SOD inhibition in SH-SY5Y cells (n = 3). (A) NO content. (B) released of LDH. (C) MDA content. (D) SOD inhibition rate. (E) GSH content. (F) CAT activity. *p < 0.05, **p < 0.01, ***p < 0.001 compared to the H2O2 group; #p < 0.05, ##p < 0.01, ###p < 0.001 compared to the control group.
3.7. Measurement of inflammatory factor
Compare to the control group, the content of IL-6, IL-1β, TNF-α and iNOS were increased after H2O2 exposure, respectively. However, IL-6, IL-1β, TNF-α and iNOS levels were significantly lower after treatment with CM-YJ44 than they were in the H2O2 group (Table 4). In the same situation, IL-6, IL-1β, TNF-α and iNOS levels were significantly lower after treatment with D-HT207 (10, 50 ng/mL) than they were in the H2O2 group (Table 5).
Table 4.
Effects of CM-YJ44 on the content of inflammatory factors (n = 3).
| Group | IL-6 | IL-1β | TNF-α | iNOS |
|---|---|---|---|---|
| con | 1 | 1 | 1 | 1 |
| H2O2 | 2.14 ± 0.27### | 2.06 ± 0.26### | 0.55 ± 0.38### | 1.11 ± 0.08### |
| Dendrobine | 0.59 ± 0.07*** | 0.28 ± 0.05*** | 0.16 ± 0.01*** | 0.11 ± 0.01*** |
| 50 ng/mL | 0.55 ± 0.02*** | 1.79 ± 0.13 | 0.41 ± 0.04*** | 0.40 ± 0.04*** |
| 100 ng/mL | 0.63 ± 0.06*** | 0.62 ± 0.09*** | 0.27 ± 0.02*** | 0.45 ± 0.03*** |
| 500 ng/mL | 0.33 ± 0.05*** | 0.40 ± 0.07*** | 0.18 ± 0.02*** | 0.21 ± 0.02*** |
Note:*p < 0.05, **p < 0.01, ***p < 0.001 compared to the H2O2 group; #p < 0.05, ##p < 0.01, ###p < 0.001 compared to the control group.
Table 5.
Effects of D-HT207 on the content of inflammatory factors (n = 3).
| Group | IL-6 | IL-1β | TNF-α | iNOS |
|---|---|---|---|---|
| con | 1 | 1 | 1 | 1 |
| H2O2 | 2.31 ± 0.51### | 1.05 ± 0.07### | 2.52 ± 0.23### | 0.73 ± 0.05### |
| Dendrobine | 0.88 ± 0.14*** | 0.30 ± 0.01*** | 0.45 ± 0.05*** | 0.30 ± 0.04*** |
| 5 ng/mL | 1.73 ± 0.18 | 0.76 ± 0.1** | 1.24 ± 0.13*** | 0.63 ± 0.08 |
| 10 ng/mL | 1.46 ± 0.10* | 0.77 ± 0.11** | 0.78 ± 0.14*** | 0.49 ± 0.01*** |
| 50 ng/mL | 1.21 ± 0.18** | 0.51 ± 0.08*** | 0.54 ± 0.12*** | 0.47 ± 0.04*** |
Note:*p < 0.05, **p < 0.01, ***p < 0.001 compared to the H2O2 group; #p < 0.05, ##p < 0.01, ###p < 0.001 compared to the control group.
3.8. Western blot analysis
3.8.1. Effects of CM-YJ44 on Nrf2/Keap1 pathway, expression of Bax/Bcl-2, Caspase3 and Caspase9
In Fig. 7A–G, the protein expression of Keap1 of the H2O2 group were increased significantly compared to the control group. After treatment with CM-YJ44, the expression of keap1 was decreased significantly compared to the H2O2 group. Meanwhile, the expression of Nrf2 and HO-1 of the H2O2 group were decreased significantly compared to the control group. However, after treatment with CM-YJ44, the expression of Nrf2 and HO-1 were higher significantly than that of the H2O2 group. The protein expression of caspase3, caspase9 and the Bax/Bcl-2 ratio of the H2O2 group were increased significantly compared to the control group. After treatment with CM-YJ44, the protein expressions of Caspase3, Caspase9 and the Bax/Bcl-2 ratio were decreased significantly compared to the H2O2 group.
Fig. 7.
Effects of CM-YJ44 on Nrf2, HO-1, Keap1, Bax, Bcl-2, Caspase3 and Caspase9 protein expression (n = 3) (refer to Figs. S2 and S3). (A) Bands correspond to Nrf2, HO-1, keap1, Bax, Bcl-2, Caspase3, Caspase9 and GADPH. (B–G) Nrf2, HO-1, keap1, Caspase3, Caspase9and ratio of Bax/Bcl-2 were quantified using densitometric analysis. *p < 0.05, **p < 0.01, ***p < 0.001 compared to the H2O2 group; #p < 0.05, ##p < 0.01, ###p < 0.001 compared to the control group.
3.8.2. Effects of D-HT207 on Nrf2/Keap1 pathway, expression of Bax/Bcl-2, Caspase3 and Caspase9
In Fig. 8A–G, after treatment with D-HT207, the expression of keap1 was decreased significantly compared to the H2O2 group. Meanwhile, the expression of Nrf2 and HO-1 of the H2O2 group were decreased significantly compared with the control group. However, after treatment with D-HT207, the expression of Nrf2, HO-1 were higher significantly than that of the H2O2 group. The expression of caspase3, caspase9 and the Bax/Bcl-2 ratio of the H2O2 group were increased significantly compared to the control group. After treatment with D-HT207, the protein expressions of Caspase3, Caspase9 and the Bax/Bcl-2 ratio were decreased significantly compared to the H2O2 group.
Fig. 8.
Effects of D-HT207 on Nrf2, HO-1, Keap1, Bax, Bcl-2, Caspase3 and Caspase9 protein expression (n = 3) (refer to Figs. S4 and S5). (A) Bands correspond to Nrf2, HO-1, keap1, Bax, Bcl-2, Caspase3, Caspase9 and GADPH. (B–G) Nrf2, HO-1, keap1, Caspase3, Caspase9and ratio of Bax/Bcl-2 were quantified using densitometric analysis. *p < 0.05, **p < 0.01, ***p < 0.001 compared to the H2O2 group; #p < 0.05, ##p < 0.01, ###p < 0.001 compared to the control group.
4. Discussion
The metabolites of two endophytes isolated from dendrobium were both identified and examined in this study. It was discovered that 31 components of CM-YJ44 and D-HT207 were the same, proving that strains from different species that were isolated from the same host can produce similar metabolites. A search of reported researches revealed that there were 50 neuroprotective compounds in CM-YJ44, with 35 compounds such as isorhamnetin, and eugenol acting via the Nrf2 pathway. Besides, there were 72 neuroprotective compounds in D-HT207, with 44 compounds such as berberine, and trans-ferulic acid acting via the Nrf2 pathway. But D-HT207 contained more numbers of active compounds than CM-YJ44, which may result in a smaller active concentration of D-HT207 than CM-YJ44.
Any imbalance between cellular ROS production and antioxidant systems can lead to oxidative stress, which can result in cellular dysfunction and death [15]. The primary causes of oxidative stress are thought to be the excessive production of ROS and decrease of antioxidant enzyme activity [16,17]. It can result in cell death in the central nervous system by lipid peroxidation and other types of cellular damage [18]. The experiment results showed that CM-YJ44 and D-HT207 enhanced significantly the viability of oxidative stress-injured cells, reduced LDH production and had an inhibitory effect on oxidative stress injury. CM-YJ44 and D-HT207 not only reduced the levels of ROS and MDA but also raised the content of antioxidant indicators SOD, CAT and GSH.
Among the concentration groups of CM-YJ44 and D-HT207, the antioxidant damage effects of 500 ng/mL CM-YJ44 and 50 ng/mL D-HT207 were relatively better. In terms of inhibiting ROS production, the effects of each concentration group of CM-YJ44 and D-HT207 were stronger than dendrobine, with the 500 ng/mL CM-YJ44 and 50 ng/mL D-HT207 showing the best effects. CM-YJ44 and D-HT207 were potential to be explored as ROS inhibitors for further research.
The major damage to cells caused by oxidative stress is through mitochondrial-mediated apoptosis signals leading to cell death [19,20]. As membrane potential decreases, leading to the release of caspase3 in mitochondria, triggering a cascade of amplification effects leading to cell death [21,22]. Overexpression of Bcl-2 can activate nerve growth factor, inhibit Bax-mediated release of Caspase3, and reduce cell apoptosis [[23], [24], [25]]. Results showed that CM-YJ44 and D-HT207 inhibited the decrease of MMP. Meanwhile, the results of flow cytometry showed that CM-YJ44 and D-HT207 inhibited significantly the cells’ transition from normal to apoptosis in a concentration-dependent manner. Therefore, it was speculated that CM-YJ44 and D-HT207 can cause changes in the protein expression of Bcl-2, Caspase3, and other related proteins. CM-YJ44 and D-HT207 can protect cells from oxidative stress by regulation of Bcl-2 and Bax protein expression, according to Western blot results. In addition, they can also inhibit cell apoptosis by down-regulating the expression of Caspase3 and Caspase9.
Numerous studies have suggested that both inflammation and oxidative stress may contribute to NDDs. These two processes are interrelated and mutually reinforcing [26,27]. In this study, CM-YJ44 and D-HT207 reduced the inflammatory response of H2O2-stimulated SH-SY5Y cells in this process.
Based on the above experiment results, we decide to investigate whether the Nrf2/Keap1 signaling pathway was engaged in this process. Nrf2/Keap1 signaling pathway regulated and induced the expression of many antioxidant enzymes and proteasomes, thereby inhibiting oxidative stress and neuroinflammation [22]. When oxidative stress injury increases, oxidative molecules modify cysteine residues of Keap1, and the conformation of Keap1 changes to release Nrf2, which is rapidly translocated into the nucleus [[28], [29], [30], [31]]. In this study, it was found that Nrf2 and HO-1 expressions were upregulated significantly and Keap1 expressions were downregulated significantly in H2O2-injured SH-SY5Y cells after CM-YJ44 and D-HT207 pre-protection compared with the H2O2 group. It was confirmed that CM-YJ44 and D-HT207 may play an antioxidant role by regulating Nrf2/Keap1 signaling pathway.
SH-SY5Y cells was used in the study of distinct NDDs as in vitro models. With the technological advances in cell biology, in vitro NDDs models have been extensively developed and provided a rapid and direct way to reveal the pathological changes that occur in NDDs at the molecular and cellular level [31].In vitro models allow accurate and reproducible control of extracellular environments, providing additional information for animal models. But in terms of neurological impairments, neuroanatomy and endocrine systems, animal models are superior to in vitro models. Animal models revealed on NDDs conditions and facilitate the exploration of the pathological, physiological, and behavioral changes occurring in NDDs [32,33]. Using a combination of multiple models can accelerate the understanding of the mechanisms of NDDs and drug development process in NDDs. In this study, only the in vitro experiments were done in order to quickly assess the activity of metabolites of two dendrobium endophytes. The active components in the metabolites would be isolated before doing the animal experiments in next step.
It is known that oxidative stress, inflammation, and proteostasis are largely involved in the pathogenesis of NDDs, and the Nrf2/Keap1 system appears to be a promising therapeutic target [34]. Previous studies showed that phytochemical ingredients could act as an Nrf2 activator in the treatment of NDDs through the antioxidant defense mechanism. The metabolites of Pseudomonas protegens CM-YJ44 and Priestia megaterium D-HT207, such as osthol, taurine, and luteolin, had the potential to improve Nrf2 signaling, thereby combatting NDDs [[35], [36], [37]]. However, the use of plant-derived Nrf2 activators for NDDs is still under preclinical investigation. Therefore, understanding the mode and mechanism of action of Nrf2 is of great significance. Results of our study indicated the potential of the metabolites of dendrobium endophytes as natural sources of bioactive compounds to be developed into novel antioxidants and Nrf2 activators. At present, the compound analysis and activity evaluation are done with the whole fermentation broth. However, the different components in the fermentation broth should be separated and collected in next step to clarify the mechanism of action and signaling pathway for each component.
5. Conclusion
In summary, this study showed that Pseudomonas protegens CM-YJ44 and Priestia megaterium D-HT207 extracted from dendrobium could inhibit oxidative stress by activating the Nrf2/Keap1 signaling pathway, and regulating the expression of Caspase3 and Caspase9 to inhibit apoptosis, thereby attenuating H2O2-stimulated damage in SH-SY5Y cells.
6. Ethics statement
Approval by an ethics committee was not needed for this study because this study didn't involve the use of animal or human subjects.
Data availability statement
Data associated with our study were included in article, supplemental material and referenced in article and there has not been deposited into a publicly available repository.
CRediT authorship contribution statement
Yan tian Liang: Writing – original draft. Jia meng Liu: Methodology. Lu qi Qin: Validation. Cong Lu: Software. Jing Sun: Resources. Qiong Wang: Data curation. Yong Yang: Formal analysis. Bei Fan: Writing – review & editing. Feng zhong Wang: Project administration, Conceptualization.
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgments
The study was supported by the National Key R&D Program of China (2022YFD1600303), Agricultural Science and Technology Innovation Program of Institute of Food Science and Technology, Chinese Academy of Agricultural Sciences (CAAS-ASTIP-G2022-IFST-06).
Abbrevation
- ANOVA
One-way analysis of variance
- ARE
antioxidant response element
- BAX
BCL-2-associated X
- Bcl-2
B-cell lymphoma-2
- CAT
catalase
- DCFH-DA
2,7-Dichlorodi-hydrofluorescein diacetate
- DMEM
Dulbecco's modified Eagle's minimum
- DMSO
Dimethyl Sulfoxide; GSH, glutathione
- H2O2
hydrogen peroxide
- HO-1
Heme oxygenase-1
- IL-1β
Interleukin-1β
- IL-6
Interleukin-6
- iNOS
Nitric oxide synthase
- JC-1
5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-benzimidazolyl-carbocyanine iodide
- Keap1
Kelch-like ECH-associated protein 1
- LC50
50% lethal concentration
- LDH
Lactate dehydrogenase
- MDA
Malondialdehyde
- NCBI
National Center for Biotechnology Information
- NDDs
Neurodegenerative diseases
- Nrf2
Nuclear Factor erythroid 2-Related
- PBS
phosphate buffered saline
- ROS
reactive oxygen species
- RT
retention time
- RT-PCR
Reverse Transcription-Polymerase Chain Reaction
- SDS-PAGE
sodium dodecyl sulfate-polyacrylamide gels for electrophoresis
- SEM
standard error of the mean
- SOD
superoxide dismutase
- TBST
Tris-Buffered Saline and Tween20
- TNF-α
Tumor necrosis factor-α.
Footnotes
Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e28222.
Contributor Information
Bei Fan, Email: caasBFan@163.com.
Feng zhong Wang, Email: caasFZWang@163.com.
Appendix A. Supplementary data
The following is the Supplementary data to this article.
References
- 1.Merelli A., Repetto M., Lazarowski A., Auzmendi J. Hypoxia, oxidative stress, and inflammation: three faces of neurodegenerative diseases. J Alzheimers Dis. 2021;82(s1):S109–S126. doi: 10.3233/JAD-201074. [DOI] [PubMed] [Google Scholar]
- 2.Ryter S.W., Kim H.P., Hoetzel A., Park J.W., Nakahira K., Wang X., Choi A.M. Mechanisms of cell death in oxidative stress. Antioxid Redox Signal. 2007;9(1):49–89. doi: 10.1089/ars.2007.9.49. [DOI] [PubMed] [Google Scholar]
- 3.Li J., Jia B., Cheng Y., Song Y., Li Q., Luo C. Targeting molecular mediators of ferroptosis and oxidative stress for neurological disorders. Oxid. Med. Cell. Longev. 2022;2022 doi: 10.1155/2022/3999083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Jayaram S., Krishnamurthy P.T. Role of microgliosis, oxidative stress and associated neuroinflammation in the pathogenesis of Parkinson's disease: the therapeutic role of Nrf2 activators. Neurochem. Int. 2021;145 doi: 10.1016/j.neuint.2021.105014. [DOI] [PubMed] [Google Scholar]
- 5.Yang S., Gong Q., Wu Q., Li F., Lu Y., Shi J. Alkaloids enriched extract from Dendrobium nobile Lindl. attenuates tau protein hyperphosphorylation and apoptosis induced by lipopolysaccharide in rat brain. Phytomedicine. 2014;21(5):712–716. doi: 10.1016/j.phymed.2013.10.026. [DOI] [PubMed] [Google Scholar]
- 6.Nie J., Jiang L.S., Zhang Y., Tian Y., Li L.S., Lu Y.L., Yang W.J., Shi J.S. Dendrobium nobile lindl. Alkaloids decreases the level of intracellular β-amyloid by improving impaired autolysosomal proteolysis in APP/PS1 mice. Front. Pharmacol. 2018;9:1479. doi: 10.3389/fphar.2018.01479. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hui A., Chen J., Deng S., Chen Y., He X., Yang L., Zhang W., Wu Z. Phytochemical profile of alkaloid extract from dendrobium huoshanense and inhibitory effects against oxidative stress in H2 O2-induced PC12 cells. Chem. Biodivers. 2023 doi: 10.1002/cbdv.202301332. [DOI] [PubMed] [Google Scholar]
- 8.Li L.S., Lu Y.L., Nie J., Xu Y.Y., Zhang W., Yang W.J., Gong Q.H., Lu Y.F., Lu Y., Shi J.S. Dendrobium nobile Lindl alkaloid, a novel autophagy inducer, protects against axonal degeneration induced by Aβ25-35 in hippocampus neurons in vitro. CNS Neurosci. Ther. 2017;23(4):329–340. doi: 10.1111/cns.12678. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ancheeva E., Daletos G., Proksch P. Bioactive secondary metabolites from endophytic fungi. Curr. Med. Chem. 2020;27(11):1836–1854. doi: 10.2174/0929867326666190916144709. [DOI] [PubMed] [Google Scholar]
- 10.Yue J.Y., Yu Y. Isolation and identification of endophytic fungi from Dendrobium huoshanense with their antibacterial and anti-inflammatory activities. Pak J Pharm Sci. Jul. 2022;35(4):1143–1151. [PubMed] [Google Scholar]
- 11.Zhao H., Chen X., Chen X., Zhu Y., Kong Y., Zhang S., Deng X., Ouyang P., Zhang W., Hou S., Wang X., Xie T. New peptidendrocins and anticancer chartreusin from an endophytic bacterium of Dendrobium officinale. Ann. Transl. Med. 2020;8(7):455. doi: 10.21037/atm.2020.03.227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Chua R.W., Song K.P., Ting A.S.Y. Antioxidant and L-asparaginase activities of culturable endophytic fungi from ornamental Dendrobium orchids. Lett. Appl. Microbiol. 2023:ovad096. doi: 10.1093/lambio/ovad096. [DOI] [PubMed] [Google Scholar]
- 13.Wang S.S., Liu J.M., Sun J., Huang Y.T., Jin N., Li M.M., Liang Y.T., Fan B., Wang F.Z. Analysis of endophytic bacterial diversity from different dendrobium stems and discovery of an endophyte produced dendrobine-type sesquiterpenoid alkaloids. Front. Microbiol. 2022;12 doi: 10.3389/fmicb.2021.775665. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Liu J.M., Liang Y.T., Wang S.S., Jin N., Sun J., Lu C., Sun Y.F., Li S.Y., Fan B., Wang F.Z. Antimicrobial activity and comparative metabolomic analysis of Priestia megaterium strains derived from potato and dendrobium. Sci. Rep. 2023;13(1):5272. doi: 10.1038/s41598-023-32337-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Guan P., Liang Y., Wang N. Fasudil alleviates pressure overload-induced heart failure by activating Nrf2-mediated antioxidant responses. J. Cell. Biochem. 2018;119(8):6452–6460. doi: 10.1002/jcb.26662. [DOI] [PubMed] [Google Scholar]
- 16.Nandi A., Yan L.J., Jana C.K., Das N. Role of catalase in oxidative stress- and age-associated degenerative diseases. Oxid. Med. Cell. Longev. 2019;2019 doi: 10.1155/2019/9613090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Sies H. Hydrogen peroxide as a central redox signaling molecule in physiological oxidative stress: oxidative eustress. Redox Biol. 2017;11:613–619. doi: 10.1016/j.redox.2016.12.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Aksenova M.V., Aksenov M.Y., Mactutus C.F., Booze R.M. Cell culture models of oxidative stress and injury in the central nervous system. Curr Neurovasc Res. 2005;2(1):73–89. doi: 10.2174/1567202052773463. [DOI] [PubMed] [Google Scholar]
- 19.Modanloo M., Shokrzadeh M. Analyzing mitochondrial dysfunction, oxidative stress, and apoptosis: potential role of L-carnitine. Iran J Kidney Dis. 2019;13(2):74–86. [PubMed] [Google Scholar]
- 20.Zhao F., Guo L., Wang X., Zhang Y. Correlation of oxidative stress-related biomarkers with postmenopausal osteoporosis: a systematic review and meta-analysis. Arch Osteoporos. 2021;16(1):4. doi: 10.1007/s11657-020-00854-w. [DOI] [PubMed] [Google Scholar]
- 21.Radi E., Formichi P., Battisti C., Federico A. Apoptosis and oxidative stress in neurodegenerative diseases. J Alzheimers Dis. 2014;42(Suppl 3):S125–S152. doi: 10.3233/JAD-132738. [DOI] [PubMed] [Google Scholar]
- 22.Zhang H., Davies K.J.A., Forman H.J. Oxidative stress response and Nrf2 signaling in aging. Free Radic. Biol. Med. 2015;88(Pt B):314–336. doi: 10.1016/j.freeradbiomed.2015.05.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Lin M.T., Beal M.F. Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases. Nature. 2006;443(7113):787–795. doi: 10.1038/nature05292. [DOI] [PubMed] [Google Scholar]
- 24.Méndez-Armenta M., Nava-Ruíz C., Juárez-Rebollar D., Rodríguez-Martínez E., Gómez P.Y. Oxidative stress associated with neuronal apoptosis in experimental models of epilepsy. Oxid. Med. Cell. Longev. 2014 doi: 10.1155/2014/293689. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Singh A., Kukreti R., Saso L., Kukreti S. Oxidative stress: a key modulator in neurodegenerative diseases. Molecules. 2019;24(8):1583. doi: 10.3390/molecules24081583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.McGarry T., Biniecka M., Veale D.J., Fearon U. Hypoxia, oxidative stress and inflammation. Free Radic. Biol. Med. 2018;125:15–24. doi: 10.1016/j.freeradbiomed.2018.03.042. [DOI] [PubMed] [Google Scholar]
- 27.Das M., Devi K.P. Dihydroactinidiolide regulates Nrf2/HO-1 expression and inhibits caspase-3/Bax pathway to protect SH-SY5Y human neuroblastoma cells from oxidative stress induced neuronal apoptosis. Neurotoxicology. 2021;84:53–63. doi: 10.1016/j.neuro.2021.02.006. [DOI] [PubMed] [Google Scholar]
- 28.Bellezza I., Giambanco I., Minelli A., Donato R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Biophys. Acta Mol. Cell Res. 2018;1865(5):721–733. doi: 10.1016/j.bbamcr.2018.02.010. [DOI] [PubMed] [Google Scholar]
- 29.Zhang W., Feng C., Jiang H. Novel target for treating Alzheimer's Diseases: crosstalk between the Nrf2 pathway and autophagy. Ageing Res. Rev. 2021;65 doi: 10.1016/j.arr.2020.101207. [DOI] [PubMed] [Google Scholar]
- 30.Fu X., Chen S., Xian S., Wu Q., Shi J., Zhou S. Dendrobium and its active ingredients: emerging role in liver protection. Biomed. Pharmacother. 2023;157 doi: 10.1016/j.biopha.2022.114043. [DOI] [PubMed] [Google Scholar]
- 31.Li X., Bao X., Wang R. Experimental models of Alzheimer's disease for deciphering the pathogenesis and therapeutic screening. Int. J. Mol. Med. 2016;37(2):271–283. doi: 10.3892/ijmm.2015.2428. (Review) [DOI] [PubMed] [Google Scholar]
- 32.Ioghen O.C., Ceafalan L.C., Popescu B.O. SH-SY5Y cell line in vitro models for Parkinson disease research-old practice for new trends. J. Integr. Neurosci. 2023;22(1):20. doi: 10.31083/j.jin2201020. [DOI] [PubMed] [Google Scholar]
- 33.Pandey M., Karmakar V., Majie A., Dwivedi M., Md S., Gorain B. The SH-SY5Y cell line: a valuable tool for Parkinson's disease drug discovery. Expert Opin Drug Discov. 2023;2023(Dec 19):1–14. doi: 10.1080/17460441.2023.2293158. [DOI] [PubMed] [Google Scholar]
- 34.Uruno A., Yamamoto M. The KEAP1-NRF2 system and neurodegenerative diseases. Antioxid Redox Signal. 2023;38(13–15):974–988. doi: 10.1089/ars.2023.0234. [DOI] [PubMed] [Google Scholar]
- 35.Agca C.A., Tuzcu M., Hayirli A., Sahin K. Taurine ameliorates neuropathy via regulating NF-κB and Nrf2/HO-1 signaling cascades in diabetic rats. Food Chem. Toxicol. 2014;71:116–121. doi: 10.1016/j.fct.2014.05.023. [DOI] [PubMed] [Google Scholar]
- 36.Zhang J., Xu H.X., Zhu J.Q., Dou Y.X., Xian Y.F., Lin Z.X. Natural Nrf2 inhibitors: a review of their potential for cancer treatment. Int. J. Biol. Sci. 2023;19(10):3029–3041. doi: 10.7150/ijbs.82401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Singh L., Bhatti R. Signaling pathways involved in the neuroprotective effect of osthole: evidence and mechanisms. Mol. Neurobiol. 2024 Feb;61(2):1100–1118. doi: 10.1007/s12035-023-03580-9. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data associated with our study were included in article, supplemental material and referenced in article and there has not been deposited into a publicly available repository.