Skip to main content
IBRO Neuroscience Reports logoLink to IBRO Neuroscience Reports
. 2024 Mar 6;16:455–467. doi: 10.1016/j.ibneur.2024.02.008

Fas ligand regulate nerve injury and repair by affecting AKT, β-catenin, and NF-κB pathways

Yiyue Zhou a,1, Yi Yao b,1, Yumei Feng a, Zhiyuan Qiu a, Shixian Luo a, Xinyu Shi c, Dandan Gu a, Maorong Jiang a, Min Cai c,, Dengbing Yao a,⁎⁎
PMCID: PMC10966190  PMID: 38544794

Abstract

Objective

To investigate the regulatory effect of Fas-L on the repair and regeneration of peripheral extension injury in rats.

Methods

This study aimed to explore the effects of Fas-L on apoptosis and axonal regeneration of dorsal root ganglion (DRG) cells in rat peripheral nerve repair and regeneration by using several relevant experimental techniques from the injured nerve animal model, cell biology, and molecular biology.

Results

The expression level of Fas-L in DRG tissues was significantly down-regulated after sciatic nerve injury. Interference with Fas-L can significantly promote the regeneration of DRG neuronal axons and inhibit apoptosis, while the overexpression of Fas-L is contrary to it. Moreover, Fas-L may play a role in the regulation of DRG function and the repair and regeneration of peripheral nerves in Sprague Dawley (SD) rats by affecting several signaling pathways, such as p-AKT/AKT, β-catenin, and NF-κB.

Conclusion

Fas-L may have a certain effect on the repair and regeneration of peripheral nerve injury in SD rats, which may provide an experimental basis and a new theoretical basis for the functional reconstruction of peripheral nerves.

Significance statement

The expression level of Fas-L in DRG tissues was significantly down-regulated after sciatic nerve injury. Fas-L can significantly promote the regeneration of DRG neuronal axons and inhibit apoptosis. Fas-L may play a role in the regulation of DRG function and the repair and regeneration of peripheral nerves in SD rats by affecting several signaling pathways, such as p-AKT/AKT, β-catenin, and NF-κB. Fas-L may have a certain effect on the repair and regeneration of peripheral nerve injury in SD rats, which may provide an experimental basis and a new theoretical basis for the functional reconstruction of peripheral nerves.

Keywords: Fas-L, DRG neurons, Nerve injury, Nerve degeneration, Apoptosis, Nerve regeneration, Peripheral nerves

1. Introduction

Various enriching activities in our human body cannot be achieved without the proper regulation of nerves. When nerves are inhibited by external forces, polluted by chemical substances, or lost due to some congenital disorders or anomalies, the quality of life is greatly disturbed (Kouyoumdjian, 2006, Noble et al., 1998, Valls-Sole et al., 2011, Zochodne, 2012). Statistics show that every year, millions of people seek medical treatment for neurogenic injuries (Siemionow and Brzezicki, 2009). Relevant studies have shown that after peripheral nerve injury, axons and myelin sheaths at the site of injury gradually disintegrate, and after 1 week phagocytes begin to proliferate to phagocytose the debris, Schwann cells also begin to proliferate, and proximal nerve axons begin to regenerate distally, and by the 10th day the Schwann cells are aligned to form a Bungner's band, which guides and supports the axons in their growth (Kaiser and Haninec, 2012). Although injured peripheral nerves can recover and regenerate, their recovery process remains relatively slow, growing only 1–3 mm per day (Frostick et al., 1998, Scholz et al., 2009). In recent years, relevant repair techniques, such as neural stem cell transplantation, have been continuously developed, which contribute to providing a rich scientific research environment in this field. However, there is still much room to explore how nerves can be repaired faster and more efficiently, and this remains to be an active field of interest.

When the peripheral nervous system is damaged, it has serious impacts on bodily movement and sensory functions. It is mainly composed of somatic and autonomic nerves, which are responsible for connecting the central nervous system and peripheral tissues through electrical impulses (Cvetanovich et al., 2018). When some factors cause peripheral nerve injury, the distal nerve fibers are disconnected from the neuronal cell body, leading to local macrophage activation, circulating immune cell attraction, and subsequent processes involving necrosis, axonal degeneration, and atrophy (Berger et al., 2021). Wallerian degeneration (WD) refers to the disintegration of the myelin sheath where the injury signal is supposedly transmitted back to the neuron cell body in the form of a retrograde calcium wave and motor protein retrograde transport; loss of such function leads to neuronal gene reprogramming (Fawcett and Verhaagen, 2018, Gumy et al., 2017, Koley et al., 2019, Shimizu and Hisamoto, 2020).

Peripheral nerve injury is associated with altered excitability of sensory neurons in the dorsal root ganglion (DRG). These structures are technically only the size of peanuts, but each one can hold as many as 15,000 neurons. The nerve cells in the DRG play a significant role in regulating and transmitting peripheral nerve impulses (Esposito et al., 2019). Each axon accommodates fibers of varying sizes and excitability. For example, in comparison to type C fibers, type A fibers not only contain a myelin sheath but also have a larger fiber diameter and faster conduction speed. They jointly play a role in nerve regeneration (Esposito et al., 2019, Vancamp et al., 2017). At present, it is believed that the key factors that affect the regeneration of peripheral nerve after injury include the following: Regulation of axon regeneration and microenvironment after injury, reconstruction of axon structure, and so on. The regulation of axon regeneration is considered to be a key factor in stimulating its intrinsic regenerative ability (Cattin and Lloyd, 2016, Mar et al., 2014, Muramatsu and Yamashita, 2014, Scheib and Höke, 2013).

Fas-L (CD95L) is a transmembrane glycoprotein that belongs to the tumor necrosis factor (TNF) superfamily. It can bind Fas and induce the caspase signaling cascade, resulting in programmed cell death (Krzyzowska et al., 2021). Fas/Fas-L also plays a significant role in the immune system where it controls the expansion of T cells (Ju et al., 1995). Similarly, it has been widely implicated in tumor escape mechanisms in the reproductive and nervous systems. Previous studies have found that the inhibition of Fas/Fas-L alleviates inflammatory response and neurodegeneration after spinal cord injury (Yu and Fehlings, 2011). This suggests that Fas-L may play a significant role in nerve injury repair.In our group's previous research on this topic, we analyzed the expression changes of related genes and proteins in the WD process after sciatic nerve injury in rats by gene chip and protein chip techniques and found that the WD process is regulated by a variety of core factors, but the functions of most genes are still unclear, including Fas, Fas-L, BIRC3, TLR4 (Yao et al., 2013, Yao et al., 2012), etc., and found that Fas-L can affect the injury and repair of rat sciatic nerve by regulating the function of Schwann cells (SCs), suggesting that Fas-L plays a role in the repair and regeneration of peripheral nerve injury (Fei et al., 2018). However, the mechanism underlying this role in the early stages of peripheral nerve regeneration remains under investigation. Therefore, we discussed Fas-L in this experiment in order to study the effects of Fas-L on axonal elongation, regeneration-related gene expression, and some relevant protein pathways of DRG neurons both in vitro and in vivo. This paper is focused on the function of Fas-L in sciatic nerve repair and regeneration, specifically to provide new avenues for further study and to provide an experimental and theoretical basis for clinical functional reconstruction of injured nerves.

2. Materials and methods

2.1. Preparation of sciatic transection model in SD rats

The experimental animals and breeding sites used in this study are from the Experimental Animal Center of Nantong University. All Sprague Dawley (SD) rats used in the experiment were adult rats, weighing between 180 g and 220 g. To ensure the safety and research quality during the experiment, the rats were classified as non-specific pathogens (SPF). SD rats were weighed and injected with a compound anesthetic measuring 0.3 mL per 100 g. Anesthesia was injected into the abdomen. Once general anesthesia was achieved, the hair of the left hind limb was removed using a shaving machine, and the surface area was sterilized using alcohol and iodine before to the operation. The surgical instruments were strictly sterilized before to use. The skin of the rat was first held with tweezers along the lower edge of the hip joint and cut along the edge using surgical scissors. The muscle and fascia were then stripped by blunt dissection. Finally, the sciatic nerve was maximally exposed to the visual field using micro tweezers before the nerve was cut off with visualization at 0.5 cm of the lower edge of the transverse nerve of the piriformis muscle. After the operation, the wound was sutured and disinfected again with betadine. After the animals regained consciousness, they were transferred to a cage box and raised in a barrier environment with experimental hygiene conditions.

The surgical instruments were strictly sterilized before use. The skin was first held with tweezers along the lower edge of the hip joint and then cut along the edge with surgical scissors. The muscle and fascia were then stripped by blunt dissection. Finally, the sciatic nerve was maximally exposed to the visual field using micro tweezers, and the nerve was cut off with visualization at 0.5 cm of the lower edge of the transverse nerve piriformis muscle. After the operation, the wound was sutured, and the wound was disinfected again with betadine. After the animals recovered, they were transferred to a cage and placed in a barrier environment that complied with the experimental sanitary conditions for daily feeding.

2.2. Sampling and sample immobilization of rat L4 and L5 DRG tissues

Anesthesia was injected into the abdomen, and after general anesthesia was achieved, the hair of the hind limb was removed using a shaving machine and disinfected using alcohol and iodine. The surgical scissors cut the skin of the L4-L6 segment along the midline of the back to expose the muscles. The muscle along the edge of the bone of the bilateral lumbar vertebrae was cut, stretched, and then clamped at the hip bone along the incision with hemostatic forceps, break it and open the incision, expose the sciatic nerve and look for L4 and L5 intervertebral foramen along the nerve axon edge to peel off the excess tissue. After the intervertebral foramen was exposed, the DRG cell bodies of L4 and L5 were pulled out and placed inside the cryopreservation tube and the excess tissue was cut off. The obtained materials were sub-packed and managed, some of which were used to extract RNA and protein and stored in liquid nitrogen, while the rest were used for the tissue immunofluorescence histochemical experiment, which were fixed in 4% paraformaldehyde, and then stored in the refrigerator at 4 ℃ after a series of gradient dehydration steps.

2.3. Preparation of frozen sections

After the sample from the gradient dehydration was placed on the glass slide, residual sucrose solution with absorbent filter paper was added to absorb the excess fluids. Then, the excess connective tissue was quickly removed from the sample and laid flat on the freezing table before OCT was added. The sample was placed in a frozen slicer to determine the slice thickness according to the type of tissue. Generally, the thickness of each slice of DRG and the sciatic nerve is about 12 μ m, and the slices adhered to the slide marked in advance and dried in an oven at room temperature or 37℃. Afterward, the samples were placed orderly in a slicing box and stored at −80 ℃ Table 1.

Table 1.

Number of adult male SD mice with nerve damage. The test was repeated three times.

Methods Quantity
Real-time fluorescence quantitative polymerase chain reaction 40
Western blot 80
Immunohistochemical chemistry 40
Analysis of related genes (real-time PCR) 40
Total 200

2.4. Immunohistochemistry

The glass slides were placed at room temperature until there were no more obvious water droplets. Afterward, they were then placed into the oven to dry. A histochemical pen was used to encircle the well-formed tissue under the microscope and placed on the metal slide frame. The glass slides were placed in the washing tank, washed with PBS, removed for excess PBS, dripped into an appropriate amount of immunostaining sealing solution at room temperature, and sealed for 1 h. After that, the sealing solution was discarded. The pre-configured anti-diluent and incubate were stored in the refrigerator at 4℃ overnight. The next day, the sample was first reheated and then the first antibody was washed away using PBS. Afterward, the pre-configured second antibody diluent and incubate were added at room temperature for 2 h before the sample was washed with PBS four times and then sealed using DAPI (see Table 5). It was stored in a dry cartridge at 4℃ for no more than one week.

Table 5.

Antibodies used in immunofluorescence and western blotting.

Name Species Molecular size Company Article number
Fas-L Rabbit 40 kDa Santa-Cruz sc-19681
Fas-L Mouse 31 kDa SAB #38108
β-catenin Mouse 92 kDa Abcam ab22656
p-ERK Rabbit 40 kDa Abcam ab184699
ERK Rabbit 40 kDa Abcam ab201015
p-AKT Rabbit 60 kDa CST #4058
AKT Mouse 60 kDa CST #2920
NF-kB Rabbit 65 kDa CST #8214
GADPH Mouse 37 kDa Sigma G8795

2.5. Culture and transfection of primary neurons from adult SD rats

In this study, SD adult male rats were used to extract related stem cells (see Table 2). After shaving the back of anesthetized SD rats, the DRG tissue was removed from the intervertebral foramen with microscopic forceps, and the excess tissue was removed by microscopic scissors. The tissue was placed in the configured HA to avoid tissue dryness, and then the tissue was placed into a sterilized centrifuge tube and washed with PBS. After the tissue was cut up, 3 mg/mL of pre-warmed collagenase was added in advance, blown and mixed well, before it was transferred to a culture dish, placed in a 37℃ incubator for 90 min, and then digested with trypsin for 5–10 min. At the end of digestion, the supernatant was discarded by centrifugation through a sieve, and 15% BSA was added and centrifuged at 900 rpm for 5 min, then the supernatant was discarded. This step was repeated twice. Then, pre-warmed DRG neuronal culture solution, prepared in the ratio of 1% glutamine, 2% B27, and 97% Neurobasal®-A Mediu, was added to the purified cell sediment and gently blown into culture plates pre-coated with 5% CO2 polylysine at 37℃. When transfection of dorsal root ganglion neurons interfering with Fas-L is desired (see Table 3), the mixed reagents were prepared according to the instructions and the size of the orifice plate. The reagent mix was placed in static mode for 15 min and then dropped into the desired well plate. Then, cell suspension mixed with DRG neuron culture medium was added, and the specimens were placed in a cell culture incubator for 12 h and 16 h, and then the culture medium was replaced with DRG neuron culture medium containing PS, configured with a ratio of 1% PS, 1% glutamine, 2% B27, and 96% Neurobasal®-A Medium. For the overexpression of Fas-L group, DRG neuronal cells that had been well grown for 1 day were selected, and the control virus and adeno-associated virus encapsulated with Fas-L overexpression fragment were mixed with PS-free medium to replace the original medium, and the infection was incubated for 14–16 h and then replaced with PS-containing neuronal medium. The follow-up experiments based on the various experimental purposes were then carried out afterwards.

Table 2.

Number of SD adult male rats used. The test is repeated three times.

Methods Quantity
Transfection efficiency verification (real-time PCR) 24
Detection of axon growth 10
Detection of Tunel apoptosis 10
Related gene analysis (real-time PCR) 24
In vivo pathway analysis 80
Total 148

Table 3.

Fas-L small interfering RNA primer. Abbreviation: siRNA, small interfering RNA; NC, negative control. The siRNA used in this study was synthesized by Guangzhou Ruibo Biotechnology Co., LTD.

Methods Sequence
Control siRNA F:5’ UUCUCCGAACGUGUCACGUTT 3’
R:5’ACGUGACACGUUCGGAGAATT 3’
siRNA-02 F:5’ CUCUAAAGAAGAAGGACAACA 3’
R:5’ UUGUCCUUCUUCUUUAGAGGG 3’

2.6. RT-qPCR detection

To quantify the expression of Fas-L, we use the Trizol method to extract total RNA; and use Novizan's kit to reverse RNA (RNA is 1000 ng) to synthesize cDNA.

Then, according to the operating rules of the manufacturer, the real-time quantitative polymerase chain reaction experiment was carried out according to the manufacturer’s instructions. We used forward and reverse polymerase chain reactions (see Table 4). The reaction of each sample was performed in triplicate (see Table 1). Finally, the experimental data were normalized and the final data results were obtained and analyzed.

Table 4.

The main primers used in the real-time fluorescent quantitative polymerase chain reaction in this study. It is synthesized by Shanghai Sangong Biotechnology Co., LTD. Abbreviations: F, forward; R, reverse.

Genes Sequence
GAPDH F:5’ TGGAGTCTACTGGCGTCTT 3’
R:5’ TGTCATATTTCTCGTGGTTCA 3’
Fas-L F:5’ CACCAACCACAGCCTTAGAGTATCA 3’
R:5’ ACTCCAGAGATCAAAGCAGTTCCA 3’
Bax F:5’ TGCAGAGGATGATTGCTGAC 3’
R:5’ GATCAGCTCGGGCACTTTAG 3’
Wisp1 F:5’ CACATCAAGGCAGGGAAGAA 3’
R:5’ GGGTAAGATTCCAAGTCAGCAA 3’
NT3 F:5’ GACAAGTCCTCAGCCATTGACATTC 3’
R:5’ CTGGCTTCTTTACACCTCGTTTCAT 3’
Bcl2 F:5’ GCAGAGATGTCCAGTCAGC 3’
R:5’ CCCACCGAACTCAAAGAAGG 3’
PKCα F:5’ GAACACATGATGGACGGGGTCACGAC 3’
R:5’ CGCTTGGCAGGGTGTTTGGTCATA 3’
bFGF F:5’ CCCGCACCCTATCCCTTCACAGC 3’
R:5’ CACAACGACCAGCCTTCCACCCAAA 3’
Nf2 F:5’ CTGGGATTGGGTTCATGGGTGGAT 3’
R:5’AGGAAGCCCGAGAAGCAGAGCG 3’

2.7. Western blotting analysis

According to the amount of tissue and cells, the protein lysate was prepared in advance, and the DRG tissue protein and cell protein were extracted. All the steps were carried out on ice, and the protein concentration of the sample was detected according to the instructions of the BCA kit. The protein was stored at −80 ℃ after the protein was sub-packed. During the electrophoretic operation, the electrophoresis gel was first prepared according to the molecular weight of the target protein. After adding the electrophoresis solution, the protein marker and the target protein were sampled in an orderly manner, concentrated and then separated, and then cut off using glue and PVDF film. The membrane was turned around in the ice-water mixture and the target protein was transferred to the PVDF membrane, then the PVDF membrane was sealed using the shaker with 5% skimmed milk powder for 2 h. After the closure, an antibody was added at 4℃ to incubate overnight.

The next day, TBST was used to wash off the first antibody. Then, the pre-incubated second antibody was left for two hours at room temperature. Finally, after washing the secondary antibody with TBST, the developer was configured for development operation. GAPDH was used as a reference for the normalization of total protein levels (see Table 5). The experiment was repeated three times to enhance the credibility of the experimental data.

2.8. Tunel apoptosis detection

To verify the effect of Fas-L on DRG neuron cells, we used the Tunel apoptosis kit to detect neuronal cell migration in the experiment. The primary neuronal cells transfected with siRNA and AAV9 virus were selected for apoptosis detection. After 72 h of culture, the transfected DRG neuron cells were fixed with 4% paraformaldehyde, then the membrane was broken with 0.5% Triton X 100, and then 100 μ L 1 × Equilibration Buffer was added to balance at room temperature for 5 min according to the instructions of Tunel kit. After the balance, the follow-up operations were carried out under the condition of avoiding light. The appropriate amount of TdT incubation buffer was added, incubated at 37 ℃ for 1 h, and washed twice with PBS before the tablets were sealed with DAPI and stored in the dark at 4℃ for no more than three days.

2.9. In vivo experiment

In vivo, the model of Fas-L interference and overexpression was established, namely the rat model of intrathecal injection. All SD rats were weighed and injected with a compound anesthetic of about 0.3 mL per 100 g. Anesthesia was injected into the abdomen. After general anesthesia was achieved, the hair on the spine of the back half of the limb was removed using a shaving machine. Alcohol and iodine were used to disinfect the area. The surgical scissors were then used to cut the skin of the L4-L6 segment along the midline of the back. The skin was stretched and the muscles of the lumbar spinous process on both sides were cut using ophthalmic scissors at the L4-L6; the excess muscles and segmental spinous process were cut off using rongeur, which exposed the intervertebral space. Cotton balls soaked in normal saline were used to stop the wound. The virus was injected with a Micro4 microinjection pump, the glass electrode needle was firmly connected to the microinjector, and the needle was inserted obliquely behind the intervertebral foramen. At the end of the injection, the rats were placed for 1 min, and then the wound was sutured. After suturing the muscle, the wound was treated with an appropriate amount of antibiotics to prevent wound infection. After the skin suture was completed, an appropriate amount of iodophor was smeared to disinfect the area. When the animals regained consciousness, they were placed in their cages for daily feeding, in a barrier environment. Fourteen days after intrathecal injection, the sciatic nerves of SD rats were transected using the operation method described above, and each transected nerve was sutured using a silica gel tube with a length of 0.5 cm. The follow-up experiments were carried out according to different experimental purposes.

2.10. Statistical analysis

SPSS and GraphPad Prism software were used to process the experimental data. The non-paired t-test method was used for analysis and comparison between the control group and the experimental group. Single-factor ANOVA was used for comparison analysis between multiple groups. When p<0.05, the difference between the groups was considered statistically significant.

3. Results

3.1. Fas-L expression level in DRG after sciatic nerve injury

After transection of the sciatic nerve of SD rats, we selected six different time nodes (0 days, 4 days, 7 days, 14 days, 21 days, and 28 days) to take out the L4 and L5 DRG tissues of the injured side of SD rats. The sensory neurons in DRG tissue were labeled with Tuj1, and the expression of Fas-L in DRG was detected by tissue immunofluorescence staining. According to the experimental results we analyzed, after the sciatic nerve was injured, when compared to the expression levels on day 0, Fas-L in DRG neurons showed a significant down-regulation trend at the gene and protein levels (Fig. 1).

Fig. 1.

Fig. 1

Expression and distribution of Fas-L in DRG tissues. (A) Gene expression changes of Fas-L in DRG tissues using quantitative polymerase chain reaction. *p<0.05, **p<0.01, ***p<0.001. (B) Western Blot to detect the protein expression changes of Fas-L. (C) Gray scale statistics of protein bands in B graph with GADPH as internal reference and 0-day group as negative control. n=3, *p<0.05, **p<0.01. (D) The expression of Fas-L in DRG tissues was detected by immunofluorescence staining. The green fluorescence is the expression of Fas-L in DRG tissue, the red fluorescence is the neuron-specific marker Tuj1, the blue fluorescence is the DAPI-labeled nucleus, and the Merge is the multi-channel composite map. Bar=50 µm.

3.2. Research on the location of Fas-L in DRG

To determine the subcellular localization of Fas-L in DRG, an immunofluorescence staining technique was used to detect DRG neurons and DRG tissues with immunofluorescence double staining. The results of the fluorescence experiment showed that Fas-L and DRG neurons were co-located and expressed on the cell membrane (Fig. 2).

Fig. 2.

Fig. 2

Location of Fas-L in the DRG. (A) Subcellular localization of Fas-L in DRG neurons: the green fluorescence is Fas-L, the red fluorescence is neuron specific marker Tuj1, the blue fluorescence is DAPI labeled nucleus, and the Merge is multi-channel composite map. (B) Subcellular localization of Fas-L in DRG tissue: the green fluorescence is Fas-L, the red fluorescence is neuron specific marker Tuj1, the blue fluorescence is DAPI labeled nucleus, and the Merge is multi-channel composite map. Bar=50 µm.

3.3. Effects of in vitro interference and overexpression of Fas-L on axonal growth and apoptosis of DRG neurons

To interfere with Fas-L in vitro, DRG neuron cells were first cultured and purified, and transfected with siRNA-NC and siRNA-Fas-L, respectively. The fluid was changed 12–16 h after the cells were planted. After 48 h of continuous culture, total RNA was extracted for qPCR to screen the siRNA with the highest interference efficiency. Then, the cells were repeatedly cultured and introduced to the siRNA with the highest interference efficiency. After 72 h of culture, total proteins were extracted from the NC group and the interference group, and the interference effect of siRNA was verified by Western Blot. When Fas-L was overexpressed, DRG neurons with good growth status were also selected to infect control viruses and adeno-associated viruses coated with Fas-L overexpressed fragments. Total RNA was extracted from the cells after 5 days of culture, and total protein was extracted after 6 days of culture. The expression of Fas-L in vitro was verified by qPCR and Western Blot double experiments. According to the experimental results, the expression of Fas-L was significantly down-regulated after siRNA-Fas-L transfection, while the expression of Fas-L in cells infected with adeno-associated virus wrapped with Fas-L overexpression fragments was significantly up-regulated. Statistical analysis showed that the difference was significant (Fig. 3). To study the effect of Fas-L on axon growth and apoptosis in DRG neurons, we cultured DRG cells transfected with interfering Fas-L-siRNA for 3 d, and then resuspended them using 0.025% trypsin digestion to fracture their axons, while the overexpression of Fas-L group infected the cells with AAV for 1 d, and then resuspended them after a further 6 d of culture. After resuspension, the axons were grown for another 18 h and then removed and fixed, and the cell bodies and axons of sensory neurons were labeled with Tuj1, and the axons of interfering and overexpressing DRG neurons were statistically analyzed. Apoptosis of DRG neurons after interference and overexpression of Fas-L was detected by Tunel and TUNEL staining was performed on DRG neurons transfected with siRNA for 3 d and infected with AAV for 6 d. The results showed that after down-regulation of Fas-L expression, the longest axon length, average axon length, and total axon length of DRG neurons increased significantly, while the number of apoptotic DRG neurons decreased significantly. After up-regulation of Fas-L expression, the longest axon length, average axon length and total axon length of DRG neurons decreased significantly, while the apoptosis rate of DRG neurons showed an upward trend (Fig. 4). The experimental results show that the expression of Fas-L can affect the axonal growth and apoptosis of DRG neurons.

Fig. 3.

Fig. 3

Efficiency identification of Fas-L interference and overexpression. (A) The primary cultured DRG neurons were infected with Fas-L siRNA in vitro, and the RNA was extracted, and the interference efficiency was detected by qPCR. (B) Efficiency of interference detection by WB. (C) The quantitative statistical graph of B was normalized with NC as the negative control. Among them, fragments 1,2,3 are three interference sequences designed by the company, with GADPH as internal parameters. (D) Primary cultured DRG neurons were infected with Fas-L overexpression virus in vitro and RNA was extracted, and the overexpression efficiency was detected by qPCR. (E) The efficiency of the overexpression detected by WB. (F) The quantitative statistical graph of E was normalized with NC as the negative control. OE represents the Fas-L overexpressed virus group, and GADPH is used as the internal reference. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 4.

Fig. 4

Fig. 4

Effects of interference and overexpression of Fas-L on axon growth and apoptosis of DRG neurons. (A) Immunofluorescence staining of primary cultured DRG neurons infected with Fas-L siRNA in vitro. Bar=50 µm. (B) Total axon length statistics of DRG neurons after interference with Fas-L. (C) Statistics of the longest axon length of DRG neurons after interference with Fas-L. (D) Statistics of average axon length of DRG neurons after interference with Fas-L. (E) Immunofluorescence staining of primary cultured DRG neurons infected with Fas-L overexpression virus. Bar=50 µm. (F) Total axon length statistics of DRG neurons after Fas-L overexpression. (G) Statistics of the longest axon length of DRG neurons after Fas-L overexpression. (H) Average axon length statistics of DRG neurons after Fas-L overexpression. The length of NC axon was normalized as a negative control, and OE represented the Fas-L overexpressed virus group. ***p < 0.001. (I) The effect of in vitro interference of Fas-L on apoptosis of DRG neurons. The nucleus is labeled blue and apoptotic cells are labeled red. Bar=100 µm. (J) tunel apoptosis of Fas-L in vitro. **p < 0.01. (K) The effect of overexpression of Fas-L on apoptosis of DRG neurons in vitro. The nucleus is labeled blue and apoptotic cells are labeled red. Bar=100 µm. (L) Statistical diagram of tunel apoptosis with Fas-L overexpression in vitro. **p < 0.01.

3.4. Expression changes of genes affecting nerve regeneration after Fas-L knockout and overexpression

To further explore the potential functional regulation of Fas-L in DRG neurons, we selected some factors related to DRG neuron function and some useful nerve regeneration factors by referring to previous experimental research results. We used experiments to explore the expression changes of these factors after Fas-L is knocked out and overexpressed in DRG neurons. We analyze and discuss the results of this study. Through Real-time qPCR, we found that after interfering with Fas-L, Bcl-2, Bax, and PKC α were significantly down-regulated at the mRNA level, while NT3 was significantly up-regulated. After overexpression of Fas-L, Bcl-2, Bax, and PKC α were significantly up-regulated at the mRNA level, while NT3 was significantly down-regulated. These results indicate that Fas-L may affect the function of DRG neurons by regulating the expression level of these factors (Fig. 5).

Fig. 5.

Fig. 5

Effects of in vitro interference and overexpression of Fas-L on related factors. (A) After transfection of Fas-L siRNA and control siRNA, the expression changes of related genes were detected by RT-qPCR. (B) After transfection of Fas-L control virus and overexpressed virus, the expression changes of related genes were detected by RT-qPCR. NC was normalized as a negative control. **p < 0.01, ***p < 0.001.

3.5. Effects of interference and overexpression of Fas-L on the expression of related pathways in vitro

After verifying the expression changes of those related genes, we continue to select the related pathway proteins involved in the regulation of these related genes in the following experiments to further verify the changes in the role of related pathways. Western Blot analysis showed that β-catenin, p-AKT/AKT, and NF-κB were significantly down-regulated and p-ERK/ERK was significantly up-regulated after Fas-L interference compared with the control group. After Fas-L overexpression, β-catenin, p-AKT/AKT, and NF-κB were significantly up-regulated, while p-ERK/ERK was significantly down-regulated (Fig. 6). These results indicate that Fas-L may affect the function of DRG neurons by regulating the expression levels of these proteins.

Fig. 6.

Fig. 6

Influence of interference and overexpression of Fas-L on related pathways in vitro. (A) After in vitro transfection of Fas-L siRNA and control siRNA, WB was used to detect the expression changes of related pathway proteins; (B) Statistical plots of grayscale values of proteins in each pathway were normalized with siRNA-con as negative control, *p<0.05, **p < 0.01. (C) After transfection of control virus and Fas-L overexpressing virus in vitro, WB was used to detect the expression changes of proteins in each pathway. (D) Statistical plots of gray values of proteins in each pathway in the figure, normalized with NC as the negative control, *p<0.05.

3.6. Effects of interference and overexpression of Fas-L on the expression of related pathways in vivo

Through the experimental results in vitro, we verified these protein pathways in vivo. Bilateral L4 and L5 dorsal root nodal tissues were taken 7 and 14 days after intrathecal injection. Through Western Blot detection, we found that β-catenin, NF-κB, p-ERK/ERK, and p-AKT/AKT showed obvious relative changes at the protein level after interference and overexpression of Fas-L in vivo (Fig. 7). This indicates that Fas-L may affect the repair and regeneration of injured sciatic nerve by regulating these pathways.

Fig. 7.

Fig. 7

Influence of interference and overexpression of Fas-L on related pathways in vivo. (A) After transfection of Fas-L interference virus and control virus in vivo, WB was used to detect the expression of related pathway proteins; (B) Statistical diagram of grayscale values of pathway proteins in Figure C, and NC-sh was used as the negative control for normalization. *p<0.05, **p < 0.01, ***p < 0.001. (C) After transfection of Fas-L overexpressing virus and control virus in vivo, WB was used to detect the expression changes of related pathway proteins; (D) Statistical diagram of grayscale values of pathway proteins in Figure A, NC-p was used as the negative control for normalization.

3.7. Effects of interference and overexpression of Fas-L on nerve regeneration after nerve injury in vivo

To explore the effects of interference and overexpression of Fas-L on nerve regeneration after nerve injury, we established an intrathecal injection model in rats. After quantitative injection of interfering virus and overexpression virus, the rats were fed in a barrier environment for 14 days, and then the sciatic nerve of SD rats was transected, and the transected nerve was sutured with a 0.5 cm silicone tube. Fourteen days after suture, the samples were taken, and the axon regeneration in the silicone tube was examined by immunohistochemical fluorescence technique (Fig. 8). The fluorescence results showed that when Fas-L was interfered, the expression decreased, and the axon regeneration was significantly better than the control group, while when Fas-L was overexpressed, the expression increased, and the axon regeneration was inferior to the control group.

Fig. 8.

Fig. 8

In vivo axon regeneration with interference and overexpression of Fas-L. Red fluorescence is SCG10-specific labeled new axons, blue is DAPI labeled nucleus, Bar=100 µm.

4. Discussion

The nervous system is composed of the CNS and PNS, which both play an indispensable regulatory role in human body. According to previous studies, the peripheral nerve has a unique regenerative capacity that is absent in the central nerve, and much research is focused on its repair, especially for its implications in peripheral nerve injury treatment. When the peripheral nerve is injured due to force majeure factors, WD will occur at the distal end of the damaged nerve, which causes the myelin sheath to collapse and depolymerize. Then, the damage signal is transmitted back to the neuron cell body in the form of reverse calcium wave and reverse motor protein transport, thus causing the gene reprogramming of the neuron. WD is a transient and acute pathological response to peripheral nerve injury (Berger et al., 2021, Fawcett and Verhaagen, 2018, Gumy et al., 2017, Koley et al., 2019). With the continuous occurrence of clinical neurological diseases, patients are in urgent need of effective medical measures to alleviate pathological damage, which leads to the rapid development of related fields of neuroscience. Many scholars devote themselves to research, thus clarifying the molecular mechanism behind many important processes (Avraham et al., 2021).

Fas ligand is a type II protein with a molecular weight of about 40kD, which can bind to membranes. In addition, it can also specifically recognize the type I transmembrane glycoprotein Fas and trigger the apoptosis mechanism in vivo (Nagata and Golstein, 1995). Both Fas-L and Fas belong to the TNF superfamily (Suda et al., 1993).

The cytoplasmic domain of Fas-L contains the most extensive amino acid sequence (81 residues) of the 19 known members of the TNF family, which is highly conserved among species (Bodmer et al., 2002). Fas-L can also be expressed in some activated immune cells and resting cells, but compared with immune cells such as T cells and B cells, the expression of Fas-L in resting cells is not so widespread (Yamada et al., 2017). However, co-stimulation of IL-12 and IL-18 or IL-2 and IL-12 can significantly increase the level of Fas-L in lymphocytes (Refaeli et al., 1998). At the same time, some studies suggest that these cytokines may increase the expression of Fas-L by reducing the expression level of MMP3 and MMP7, causing the outer domain of Fas-L to divide from the cell surface (Gorelik et al., 2004). Fas-L expressing immune cells recognize Fas receptors on target cells, leading to the initiation of complex apoptosis pathways in target cells. Fas-L forms a homotrimer structure on the plasma membrane with a very long cytoplasmic tail, which can mediate apoptosis and death of target cells (Malarkannan, 2020, Shrestha and Diamond, 2007).

In the multidisciplinary field, the mutual recognition of Fas and Fas-L is the receptor-ligand pair that has been studied more. In the positive signaling events downstream of Fas, Caspase 3, Ask1 and other signals participate in cell apoptosis (Kreuz et al., 2004). Interestingly, Fas-L does not require any cytoplasmic tail component to mediate target cell death (Lückerath et al., 2011). It is known that Fas-L can use its cytoplasmic tail to achieve other non-apoptotic effector functions, including reverse signal-mediated T-cell costimulation (Sun et al., 2007, Suzuki et al., 2000). However, the biological correlation of Fas-L-mediated reverse signal transduction is not fully understood. Regardless of its ability to mediate costimulation, the function of Fas-L as an independent activating receptor has not been determined (Malarkannan, 2020).

Although Fas-L is often used as a research hotspot in the immune system, there are few studies in the neural field, and all of them take the Fas-Fas-L pathway as the research object. In 2014, relevant reports discussed the role of Fas-L in nerve regeneration and believed that Fas-L was involved in the core of regulating nerve repair and regeneration. This discovery confirms that Fas-L plays a role in the nervous system, but its specific mechanism remains to be deepened (Li et al., 2014). In this study, we explored the mechanism of Fas-L and discussed it from three directions. First, we verified the expression of Fas-L in vivo through experiments; Second, to explored the expression mechanism and function of Fas-L in vitro; Third, verify the effect of Fas-L on the repair and regeneration of sciatic nerve injury in vivo.

In the peripheral nervous system, sensory neurons send an axon, which forks in the ganglia. One axon extends to the center of the spinal cord along the dorsal root, and the other axon extends along the peripheral nerve. The difference is that regeneration and nerve function reconstruction can be achieved after peripheral nerve injury, but not after spinal cord injury (Attwell et al., 2018, He and Jin, 2016, Mahar and Cavalli, 2018, Tran et al., 2018). When peripheral sensory neurons are damaged due to some factors, relevant regeneration promotion programs are activated to accelerate functional recovery and promote axon regeneration. Therefore, the neurons with soma in the DRG provide a useful model for us to study axonal regeneration (Smith et al., 2012).

In this study, we choose DRG as the carrier of the study. First, we found that the expression of Fas-L in dorsal root ganglion neurons decreased significantly after sciatic nerve injury, and then slowly up-regulated, which may be due to the fact that the injury site generates a number of endogenous and exogenous stimulation signals and then triggers the body to respond to them (Martini and Willison, 2016), suggesting that Fas-L may be involved in the repair and regeneration process of the rat sciatic nerve after injury. It has been reported that Fas/Fas-L is involved in axonal growth and adult neurogenesis in CNS (Krzyzowska et al., 2021). Nerve repair is a very complex mechanism process, and the growth of proboscis is an important sign of axon regeneration. In the stage of injury recovery, neuronal processes begin to grow, develop into new axons, and eventually form synaptic structures and rebuild neural networks (De Siqueira-Santos et al., 2019).

Therefore, in vitro, the sensory fibers of DRGs may be re-extended after injury, which may be one of the regeneration characteristics of sciatic nerve injury and repair (Bucan et al., 2019).

We explored the effects of Fas-L on nerve repair and regeneration through in vitro and in vivo function gain and function loss experiments and found that Fas-L can inhibit the growth of DRG neurons' axons and promote the apoptosis of DRG neurons in vitro. The in vivo results were consistent with the in vitro results. The regeneration of peripheral nerve sensory axons is formed by the interaction of different cytokines, which is related to the underlying molecular mechanism, and does not belong to the autonomous behavior of cells. According to the experimental results in vitro, we selected some genes related to the growth and apoptosis of neuronal axons, and the results showed significant differences between Bcl-2, Bax, NT3, and PKCα. It has been reported that Bcl-2 belongs to the anti-apoptotic family, Bax can antagonize Bcl-2 (Wang and Li, 2021), NT3 can promote axon growth, and protein kinase C (PKC) also has a certain effect on neuronal hypoxia apoptosis. These related factors described above have also been reported in neuro-related literature. They interact with other related factors in the repair of sciatic nerve injury, and the experimental results are consistent with the functional expression.

Previous studies have shown that the survival protein AKT regulates the occurrence of apoptosis. β-catenin can not only promote proliferation but also induce mitochondrial apoptosis by activating Caspase 3. NF-κB induces Fas cascade death by directly activating Fas ligand to make it express. In addition, NF-κB transcription factor can also play a role in apoptosis, which can regulate the expression of bcl-2 anti-apoptotic factor and inhibit apoptosis (Liang et al., 2021). According to the functional effects of Fas-L in vitro, we selected some pathway proteins that may interact with Fas-L. The results show that Fas-L may regulate the function of DRG neurons through p-AKT/AKT, NF-κB, β-catenin and p-ERK/ERK. We then verified by in vivo experiments that Fas-L may be involved in the regulation of nerve repair and regeneration after sciatic nerve injury through β-catenin, NF-κB, p-AKT/AKT, and p-ERK/ERK pathways, among which the change of p-ERK/ERK pathway is the most significant.

In addition to some complex mechanism reactions, some related gene expression changes occur in the process of nerve regeneration and repair after nerve injury. However, little is known about the role of these up-regulated and down-regulated genes. The purpose of this study was to explore the mechanism of Fas-L in nerve injury, repair, and regeneration. According to the above experimental data, when sciatic nerve injury occurs in SD rats, Fas-L expression in DRG tissues is down-regulated, and related factors and signaling pathways related to nerve repair are also affected by its changes in expression. Meanwhile, Fas-L can also affect axon regeneration and apoptosis by changing its expression in DRG neurons.

The results of this study suggest the role and potential mechanism of Fas-L in peripheral neurodegeneration and regeneration and provide the experimental basis and basic data for further study of Fas-L in the nervous system.

However, in this study, the research on the mechanism of Fas-L regulating nerve regeneration is far from enough, and how Fas-L plays a regulatory role is not clear, which needs to be verified by further experiments. Similarly, the downstream factors affected by Fas-L in nerve repair and regeneration processes remain unclear, and a large number of experimental designs are needed for further study.

Ethical approval and consent to participate

The Institutional Animal Care and Use Committee of Nantong University approved all protocols used in this study. All animal tests were conducted according to the Key Laboratory of Neuroregeneration Guidelines for the Care and Use of Laboratory Animals and the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals.

Authors’ contributions

Y.Z. and Y.Y. performed the experiments and interpreted the data; M.C. and Y.F. were responsible for gene expression analysis; Z.Q. and X.S. conducted the animal studies; Y.Y. and D.G. performed the data analysis; S.L. and D.G. performed the immunohistochemical experiments; S.L. and M.J. analyzed the functional and biochemical data; D.Y. analyzed the data and planned the study; D.Y. and M.C. supervised the project and wrote the manuscript.

All authors read and approved the final manuscript.

Consent for publication

The authors of this manuscript have all approved the manuscript and provided consent for its publication.

Funding

The study was supported by the National Natural Science Foundation of China (Grant No. 31971277; 31950410551) (Dengbing Yao); Scientific Research Foundation for Returned Scholars, Ministry of Education of China (Dengbing Yao); a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) (Dengbing Yao); Jiangsu College Students' Innovation and Entrepreneurship Training Program (202213993005Y) (Yi Yao).

Conflict of Interest

The authors declare that there are no competing interests.

Acknowledgements

Not applicable.

Footnotes

Appendix A

Supplementary data associated with this article can be found in the online version at doi:10.1016/j.ibneur.2024.02.008.

Contributor Information

Yiyue Zhou, Email: zhouyiyue6254@163.com.

Yi Yao, Email: 2917649180@qq.com.

Yumei Feng, Email: 1005815068@qq.com.

Zhiyuan Qiu, Email: 1021326357@163.com.

Shixian Luo, Email: luoshixian99@163.com.

Xinyu Shi, Email: 1723017953@qq.com.

Dandan Gu, Email: protagonist0226@163.com.

Maorong Jiang, Email: jiangmr@ntu.edu.cn.

Min Cai, Email: caiminnt@ntu.edu.cn.

Dengbing Yao, Email: yaodb@ntu.edu.cn.

Appendix A. Supplementary material

Supplementary material.

mmc1.jpg (225.6KB, jpg)

References

  1. Attwell C.L., et al. The dorsal column lesion model of spinal cord injury and its use in deciphering the neuron-intrinsic injury response. Dev. Neurobiol. 2018;78(10):926–951. doi: 10.1002/dneu.22601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Avraham O., et al. Profiling sensory neuron microenvironment after peripheral and central axon injury reveals key pathways for neural repair. Elife. 2021;10 doi: 10.7554/eLife.68457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Berger A.A., et al. Dorsal root ganglion (DRG) and chronic pain. Anesth. Pain. Med. 2021;11(2) doi: 10.5812/aapm.113020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bodmer J.L., et al. The molecular architecture of the TNF superfamily. Trends Biochem Sci. 2002;27(1):19–26. doi: 10.1016/s0968-0004(01)01995-8. [DOI] [PubMed] [Google Scholar]
  5. Bucan V., et al. In vitro enhancement and functional characterization of neurite outgrowth by undifferentiated adipose-derived stem cells. Int. J. Mol. Med. 2019;43(1):593–602. doi: 10.3892/ijmm.2018.3979. [DOI] [PubMed] [Google Scholar]
  6. Cattin A.L., Lloyd A.C. The multicellular complexity of peripheral nerve regeneration. Curr. Opin. Neurobiol. 2016;39:38–46. doi: 10.1016/j.conb.2016.04.005. [DOI] [PubMed] [Google Scholar]
  7. Cvetanovich G.L., et al. Anatomy of the pudendal nerve and other neural structures around the proximal hamstring origin in males. Arthroscopy. 2018;34(7):2105–2110. doi: 10.1016/j.arthro.2018.02.029. [DOI] [PubMed] [Google Scholar]
  8. De Siqueira-Santos R., et al. Biological activity of laminin/polylaminin-coated poly-ℇ-caprolactone filaments on the regeneration and tissue replacement of the rat sciatic nerve. Mater. Today Bio. 2019;3 doi: 10.1016/j.mtbio.2019.100026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Esposito M.F., et al. Unique characteristics of the dorsal root ganglion as a target for neuromodulation. Pain. Med. 2019;20(Suppl 1):S23–S30. doi: 10.1093/pm/pnz012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fawcett J.W., Verhaagen J. Intrinsic determinants of axon regeneration. Dev. Neurobiol. 2018;78(10):890–897. doi: 10.1002/dneu.22637. [DOI] [PubMed] [Google Scholar]
  11. Fei X.U., et al. Analysis of Fas ligand(FasL) expression and relative function following rat sciatic nerve injury, 2018:
  12. Frostick S.P., et al. Schwann cells, neurotrophic factors, and peripheral nerve regeneration. Microsurgery. 1998;18(7):397–405. doi: 10.1002/(sici)1098-2752(1998)18:7&#x0003c;397::aid-micr2&#x0003e;3.0.co;2-f. [DOI] [PubMed] [Google Scholar]
  13. Gorelik E., et al. IL-12 receptor-mediated upregulation of FasL in human ovarian carcinoma cells. Int. J. Cancer. 2004;112(4):620–627. doi: 10.1002/ijc.20482. [DOI] [PubMed] [Google Scholar]
  14. Gumy L.F., et al. MAP2 defines a pre-axonal filtering zone to regulate KIF1- versus KIF5-dependent cargo transport in sensory neurons. Neuron. 2017;94(2):347–362.e7. doi: 10.1016/j.neuron.2017.03.046. [DOI] [PubMed] [Google Scholar]
  15. He Z., Jin Y. Intrinsic control of axon regeneration. Neuron. 2016;90(3):437–451. doi: 10.1016/j.neuron.2016.04.022. [DOI] [PubMed] [Google Scholar]
  16. Ju S.T., et al. Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature. 1995;373(6513):444–448. doi: 10.1038/373444a0. [DOI] [PubMed] [Google Scholar]
  17. Kaiser R., Haninec P. Degeneration and regeneration of the peripheral nerve. Cesk Fysiol. 2012;61(1):9–14. [PubMed] [Google Scholar]
  18. Koley S., et al. Translating regeneration: Local protein synthesis in the neuronal injury response. Neurosci. Res. 2019;139:26–36. doi: 10.1016/j.neures.2018.10.003. [DOI] [PubMed] [Google Scholar]
  19. Kouyoumdjian J.A. Peripheral nerve injuries: a retrospective survey of 456 cases. Muscle Nerve. 2006;34(6):785–788. doi: 10.1002/mus.20624. [DOI] [PubMed] [Google Scholar]
  20. Kreuz S., et al. NFkappaB activation by Fas is mediated through FADD, caspase-8, and RIP and is inhibited by FLIP. J. Cell Biol. 2004;166(3):369–380. doi: 10.1083/jcb.200401036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Krzyzowska M., et al. Fas/FasL contributes to HSV-1 brain infection and neuroinflammation. Front Immunol. 2021;12 doi: 10.3389/fimmu.2021.714821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li M., et al. Protein expression profiling during wallerian degeneration after rat sciatic nerve injury. Muscle Nerve. 2014;50(1):73–78. doi: 10.1002/mus.24082. [DOI] [PubMed] [Google Scholar]
  23. Liang S., et al. Neuroprotective effect of umbelliferone against cerebral ischemia/reperfusion induced neurological deficits: in-vivo and in-silico studies. J. Biomol. Struct. Dyn. 2021;39(13):4715–4725. doi: 10.1080/07391102.2020.1780153. [DOI] [PubMed] [Google Scholar]
  24. Lückerath K., et al. Immune modulation by Fas ligand reverse signaling: lymphocyte proliferation is attenuated by the intracellular Fas ligand domain. Blood. 2011;117(2):519–529. doi: 10.1182/blood-2010-07-292722. [DOI] [PubMed] [Google Scholar]
  25. Mahar M., Cavalli V. Intrinsic mechanisms of neuronal axon regeneration. Nat. Rev. Neurosci. 2018;19(6):323–337. doi: 10.1038/s41583-018-0001-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Malarkannan S. Molecular mechanisms of FasL-mediated 'reverse-signaling'. Mol. Immunol. 2020;127:31–37. doi: 10.1016/j.molimm.2020.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mar F.M., et al. Cell intrinsic control of axon regeneration. EMBO Rep. 2014;15(3):254–263. doi: 10.1002/embr.201337723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Martini R., Willison H. Neuroinflammation in the peripheral nerve: Cause, modulator, or bystander in peripheral neuropathies? Glia. 2016;64(4):475–486. doi: 10.1002/glia.22899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Muramatsu R., Yamashita T. Concept and molecular basis of axonal regeneration after central nervous system injury. Neurosci. Res. 2014;78:45–49. doi: 10.1016/j.neures.2013.07.002. [DOI] [PubMed] [Google Scholar]
  30. Nagata S., Golstein P. The Fas death factor. Science. 1995;267(5203):1449–1456. doi: 10.1126/science.7533326. [DOI] [PubMed] [Google Scholar]
  31. Noble J., et al. Analysis of upper and lower extremity peripheral nerve injuries in a population of patients with multiple injuries. J. Trauma. 1998;45(1):116–122. doi: 10.1097/00005373-199807000-00025. [DOI] [PubMed] [Google Scholar]
  32. Refaeli Y., et al. Biochemical mechanisms of IL-2-regulated Fas-mediated T cell apoptosis. Immunity. 1998;8(5):615–623. doi: 10.1016/s1074-7613(00)80566-x. [DOI] [PubMed] [Google Scholar]
  33. Scheib J., Höke A. Advances in peripheral nerve regeneration. Nat. Rev. Neurol. 2013;9(12):668–676. doi: 10.1038/nrneurol.2013.227. [DOI] [PubMed] [Google Scholar]
  34. Scholz T., et al. Peripheral nerve injuries: an international survey of current treatments and future perspectives. J. Reconstr. Microsurg. 2009;25(6):339–344. doi: 10.1055/s-0029-1215529. [DOI] [PubMed] [Google Scholar]
  35. Shimizu T., Hisamoto N. Factors regulating axon regeneration via JNK MAP kinase in Caenorhabditis elegans. J. Biochem. 2020;167(5):433–439. doi: 10.1093/jb/mvaa020. [DOI] [PubMed] [Google Scholar]
  36. Shrestha B., Diamond M.S. Fas ligand interactions contribute to CD8+ T-cell-mediated control of West Nile virus infection in the central nervous system. J. Virol. 2007;81(21):11749–11757. doi: 10.1128/jvi.01136-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Siemionow M., Brzezicki G. Chapter 8: Current techniques and concepts in peripheral nerve repair. Int. Rev. Neurobiol. 2009;87:141–172. doi: 10.1016/s0074-7742(09)87008-6. [DOI] [PubMed] [Google Scholar]
  38. Smith G.M., et al. Sensory axon regeneration: rebuilding functional connections in the spinal cord. Trends Neurosci. 2012;35(3):156–163. doi: 10.1016/j.tins.2011.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Suda T., et al. Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family. Cell. 1993;75(6):1169–1178. doi: 10.1016/0092-8674(93)90326-l. [DOI] [PubMed] [Google Scholar]
  40. Sun M., et al. Cutting edge: two distinct motifs within the Fas ligand tail regulate Fas ligand-mediated costimulation. J. Immunol. 2007;179(9):5639–5643. doi: 10.4049/jimmunol.179.9.5639. [DOI] [PubMed] [Google Scholar]
  41. Suzuki I., et al. Fas ligand costimulates the in vivo proliferation of CD8+ T cells. J. Immunol. 2000;165(10):5537–5543. doi: 10.4049/jimmunol.165.10.5537. [DOI] [PubMed] [Google Scholar]
  42. Tran A.P., et al. The biology of regeneration failure and success after spinal cord injury. Physiol. Rev. 2018;98(2):881–917. doi: 10.1152/physrev.00017.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Valls-Sole J., et al. Clinical consequences of reinnervation disorders after focal peripheral nerve lesions. Clin. Neurophysiol. 2011;122(2):219–228. doi: 10.1016/j.clinph.2010.06.024. [DOI] [PubMed] [Google Scholar]
  44. Vancamp T., et al. Relevant anatomy, morphology, and implantation techniques of the dorsal root ganglia at the lumbar levels. Neuromodulation. 2017;20(7):690–702. doi: 10.1111/ner.12651. [DOI] [PubMed] [Google Scholar]
  45. Wang J., Li X. Chamaejasmine induces apoptosis in human non-small-cell lung cancer A549 cells through increasing the Bax/Bcl-2 ratio, caspase-3 and activating the Fas/FasL. Minerva Med. 2021;112(3):413–414. doi: 10.23736/s0026-4806.19.06209-8. [DOI] [PubMed] [Google Scholar]
  46. Yamada A., et al. Dual role of Fas/FasL-mediated signal in peripheral immune tolerance. Front Immunol. 2017;8:403. doi: 10.3389/fimmu.2017.00403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Yao D., et al. Expression changes and bioinformatic analysis of Wallerian degeneration after sciatic nerve injury in rat. Neurosci. Bull. 2013;29(3):321–332. doi: 10.1007/s12264-013-1340-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yao D., et al. Gene expression profiling of the rat sciatic nerve in early Wallerian degeneration after injury. Neural Regen. Res. 2012;7(17):1285–1292. doi: 10.3969/j.issn.1673-5374.2012.17.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yu W.R., Fehlings M.G. Fas/FasL-mediated apoptosis and inflammation are key features of acute human spinal cord injury: implications for translational, clinical application. Acta Neuropathol. 2011;122(6):747–761. doi: 10.1007/s00401-011-0882-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zochodne D.W. The challenges and beauty of peripheral nerve regrowth. J. Peripher Nerv. Syst. 2012;17(1):1–18. doi: 10.1111/j.1529-8027.2012.00378.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material.

mmc1.jpg (225.6KB, jpg)

Articles from IBRO Neuroscience Reports are provided here courtesy of Elsevier

RESOURCES