Binucleate Rhizoctonia induced tomato resistance against Rhizoctonia solani via affecting antioxidants and cell wall reinforcement

Abstract

Isolates of Rhizoctonia solani (AG-3 PT, AG-4 HG-I, AG-4 HG-II) and one binucleate Rhizoctonia sp. (BNR) belonging to AG-Bb were investigated for pathogenicity on tomato cultivar Mobil. The BNR isolate revealed the lowest virulence and it was used as biocontrol agent against R. solani AG-4 HG-II, which showed the highest virulence on tomato. Inoculation of tomato plants with the hypovirulent BNR isolate reduced the disease symptoms of R. solani and induced resistance. Resistance induction was observed not only on the plants simultaneously inoculated with BNR and R. solani, but also when the plants were inoculated by the BNR and R. solani with time intervals. The peroxidase (POX), superoxide dismutase (SOD) and catalase (CAT) activities and expression levels of the corresponding genes in tomato plants increased after R. solani or BNR inoculation. The highest level of antioxidant activities and expression of their genes, lignin and callose formation were observed in the plants inoculated with the BNR and R. solani, simultaneously. The BNR inoculation reduced H₂O₂ accumulation. The highest level of priming was observed for the POX among other antioxidants tested via application of the BNR. Treatment with potassium cyanide (as a POX inhibitor) reduced basal resistance and BNR-induced resistance (BNR-IR) via reduction of lignification and callose deposition in tomato plants. These findings demonstrated the role of antioxidant enzymes, mainly the POX, in both basal resistance and BNR-IR. Therefore, redox state and antioxidants are involved in cell wall strengthening via lignin and callose formation, as important defense components which decrease the pathogen progress in plant tissues.

1. Introduction

Tomato (Solanum lycopersicum) is one of the most important vegetables, which plays a crucial role in human nutrition and health. Rhizoctonia crown and root rot is an important disease of tomato, which causes high yield losses, worldwide. Rhizoctonia is a destructive plant pathogenic fungus with a wide host range, normally found in soils all over the world. The fungus causes diseases on both root and shoot systems of many monocots [1,2] and dicots [3,4]. Rhizoctonia solani is the most important species of the genus Rhizoctonia, which is widely recognized and studied [5,6]. To date, multinucleate isolates of R. solani are placed into 14 anastomosis groups (AGs) from AG1 to AG13 and AG BI. Whereas binucleate Rhizoctonia (BNR) isolates are classified into 16 AGs [7,8]. The most important AGs of R. solani, which infect tomato plants and cause crown, root, leaf or fruit rot include AG-2-1, AG-3 PT, AG-4 HG-I and AG-4 HG-II [[9], [10], [11]].

Hypovirulent and/or avirulent isolates of BNR species have been demonstrated to be mycorrhizal or biocontrol agents [12,13]. Several studies reported the ability of BNR isolates to protect many crop species, including tomato, against different phytopathogens, such as R. solani [14,15], Fusarium oxysporum f. sp. Lycopersici [16], Pythium ultimum [17,18], and Alternaria macrospora [15]. Several studies demonstrated the beneficial effects of various BNR isolates against different taxonomic groups of R. solani, indicating potential of these beneficial microorganisms in plant protection and growth promotion.

Management of Rhizoctonia disease is very difficult due to the high level of genetic diversity in the pathogen populations, long-term survival of the sclerotia of this soil-borne phytopathogen, and its wide host range [19,20]. Application of beneficial microorganisms [3] or their metabolites [21], with direct antifungal effect or indirect efficacy via resistance induction in the host plant against pathogen, can be considered as the most effective method for controlling the diseases caused by R. solani and other fungi [22,23]. During plant-pathogen interaction, a variety of defense mechanisms are activated in the host plant to decrease penetration, progress, and proliferation of various phytopathogens in the plant tissues [24,25]. A successful plant defense strategy depends on quick recognition of the pathogen and activation of various biochemical and structural defense mechanisms [26,27].

Plants have several successful resistance mechanisms against different pathogens. Plant immune system creates a complex network of protection strategies, including accumulation of reactive oxygen species (ROS), antioxidants, and cell wall reinforcement via lignin and callose production. These defense responses lead to reduction of disease progress in the host plant tissues [28]. Plant cell wall is the first line of defense against various pathogens. It is actively reinforced through lignification, also by creation and deposition of papillae (known as callose) in the interaction sites with pathogens. Strengthening the plant cell wall is one of the most important plant defense mechanisms against pathogens with different lifestyles [29,30]. Lignin and callose can be formed in the penetration sites, via the involvement of ROS (mainly H₂O₂) and antioxidants [28,31,32].

Various types of ROS, such as H₂O₂, are involved in cell wall reinforcement via functioning of peroxidase (POX) as an antioxidant [33,34]. Physiological function of POX is related to polymerization reactions, not only lignin formation via POX-based oxidative polymerization of monolignols, but also suberin production and cross linkage of proteins via H₂O₂ consumption, leading to cell wall reinforcement [28]. Also, H₂O₂ is involved in induction of callose deposition in plant cells via mediating transcriptome reprogramming and oxidizing thiol groups of cysteine residues [35,36]. Therefore, formation of cell wall defenses, such as lignin and callose, are suggested to be regulated by ROS and antioxidants.

These defense-related compounds are known as powerful physical barriers involved in resistance to different types of pathogens [37,38]. Papilla is a complex structure, that is formed between plasma membrane and the inner wall of plant cells. Papillae biochemical composition can vary in different plant species. Some common compositions found in the papilla are phenolics, ROS, cell wall proteins and polymers. Among these polymers, β-1,3-glucan or callose is one of the most abundant compounds. Improved performance of these defensive compositions is directly related to cell wall strengthening or an antimicrobial effect. Priming of defense strategies, such as lignification and papillae formation, are key factors for successful plant defense against pathogens [38].

Various types of ROS can play critical roles in changing the cell wall structure, defensive signals, and hypersensitivity reactions, or can directly kill different pathogens [39]. Rapid and unstable accumulation of ROS activate oxidative burst as a defense-related reaction. To protect the cells under stress conditions and maintain the level of ROS, plant tissues produce several enzymatic and non-enzymatic antioxidants, which regulate the amount of ROS. Hydrogen peroxide and superoxide anion are among the most important types of ROS, which are involved in cell wall strengthening via increasing the connections or cross-linking between proteins and phenolics in plant cell wall as an effective defense mechanism against biotrophs and necrotrophs [[40], [41], [42]].

This study was performed to investigate the interaction of tomato plants (cultivar Mobil) with three multinucleate R. solani isolates and one binucleate Rhizoctonia (BNR) isolate. The aims of this study were to investigate (i) virulence of the four Rhizoctonia isolates on tomato seedlings and leaf discs, (ii) possibility of using the hypovirulent BNR isolate for induction of resistance against highly virulent R. solani in tomato (iii) and demonstrate the involvement of ROS, antioxidant genes and enzymes, and cell wall strengthening via lignin and callose formation in BNR-induced resistance in tomato against R. solani.

2. Materials and methods

2.1. Plant growth conditions in greenhouse

Tomato cultivar Mobil, which has good growth and high yield in the climatic conditions of Iran, was used in this study. The seeds of this cultivar were obtained from Agricultural Research Center of Razavi Khorassan province. The seeds were surface sterilized with 1% sodium hypochlorite for 1 min, rinsed 3 times with sterile distilled water and incubated for 5 days on a wet sterile filter paper in Petri dishes at 28 °C. Germinated seeds were each sown in the 15 cm-diameter plastic pots filled with a commercial potting soil, which had been autoclaved at 121 °C for 60 min grown in greenhouse (with conditions of 28 ± 4 °C and 16/8 h light/dark photoperiod). Each tomato seedling was transferred to a pot containing autoclaved soil and kept in favorable greenhouse conditions (16 h of light and 8 h of darkness, temperature 26–28 °C). Four weeks after germination, the seedlings were used for inoculation with the fungal isolates.

2.2. Preparation of the fungal inoculum

In this study, the pathogenic R. solani isolates belonging to AG-3 PT, AG-4 HG-I and AG-4 HG-II [11], and an isolate of binucleate Rhizoctonia sp. (AG-Bb) were obtained from the culture collection of Department of Plant Protection, Faculty of Agriculture, Ferdowsi University of Mashhad in Iran. The BNR isolate used in this study was the same as the BNR (AG-Bb) isolate, which was used in our previous research for induction of resistance in bean-R. solani AG-4 HG-II pathosystem [12]. To prepare the inoculum, the wheat seeds were wetted with 500 mL distilled water and then sterilized in the autoclave 3 times with an interval of 24 h. Then, 12 g of sterilized seeds were distributed in each Petri dish containing PDA medium. Afterwards, they were colonized by adding a mycelial plug (5 mm diameter) to each Petri dish and incubated for 7 days at 28 °C [43]. The wheat seeds distributed on the PDA medium without the fungus were used as negative control in the pathogenicity tests. This is a well-known and simple method for production of uniform inoculum of Rhizoctonia spp [44,45].

2.3. Pathogenicity tests on the seedlings and leaf discs

For inoculating each seedling with the BNR and R. solani isolates, 3 g of the wheat seeds colonized by each fungal isolate were used as inoculum. This inoculum was placed next to the crown of tomato seedling at four weeks after germination. Then, the pots were covered with plastic bag to keep moisture and avoid evaporation. One week after fungal inoculation, the disease progress was graded into six groups based on development of the necrotic lesions (0 = no lesions on seedlings, 1 = lesions ≤2.5 cm long, 2 = lesions 2.5–5.0 cm long, 3 = lesions ≥5.0 cm long, 4 = lesions girdling the seedling, and 5 = seedling is damped-off). The disease index was calculated using the following formula [2]:

DI (%) = [sum (frequency × score)]/[(total number of plants) × (maximal score)] × 100.

For investigating the possibility of inducing resistance in tomato seedlings against R. solani via pre-treatment with the BNR isolate, 3 g of the wheat seeds colonized by the BNR were placed near the stem base of each 3 weeks old tomato seedling and inoculation of the pathogen was performed at 0, 1, 3, 5, and 7 days after the BNR inoculation [13]. In the control treatment, the seedlings were inoculated with sterile wheat seeds, instead of the seeds colonized by the BNR.

To perform the leaf disc assay, circular discs (2 cm diameter) were cut out from apical leaflet of the first true leaves of 4-week-old tomato plants (which appeared after cotyledon leaves) using a cork borer [41]. Each of these discs were placed on a glass slide inside a Petri dish containing two wet filter papers. One mycelial plug of R. solani (5 mm diameter) was placed on each leaf disc. Pre-treatment with the BNR isolate was performed at 0, 1, and 3 days before R. solani inoculation on the leaf discs. The Petri dishes containing the inoculated leaf discs were kept in laboratory conditions (25 °C; 12/12 h of light/dark photoperiod). The symptoms were assessed 5 days after the pathogen inoculation and the disease index (DI) was calculated on each leaf disc as described before.

2.4. Investigating colonization of tomato roots by the BNR isolate

Evaluation of tomato root colonization by the BNR was performed at 0, 1, 3 and 5 days post inoculation (dpi). The root samples were washed under running tap water for 1 min. Then, the tomato roots were blotted dry and 1 g of the root tissues per plant were dissected 1 cm long. The root fragments were divided and placed on the plates containing alkaline water agar containing an antibiotic (15 g of agar per liter of water and 0.15 mg mL⁻¹ streptomycin sulfate) [13,46]. The plates were incubated at 28 °C for 3 days. Root colonization was investigated by counting single colonies of the BNR originating from the root pieces, using an optical microscope [47].

2.5. Protein extraction and enzyme activity assays

Total protein was extracted from the plant samples with different treatments at 0, 12, 24, 36, and 48 h post-inoculation (hpi) with R. solani. The first true leaves of tomato plants (500 mg) were ground in liquid nitrogen and homogenized in 3 mL of 100 mM potassium phosphate buffer (pH 6.8). The homogenate was centrifuged at 14,000 g for 20 min at 4 °C and the supernatant was used for the enzyme assays [48]. Protein content in the extract was estimated using bovine serum albumin, as a standard [49].

The activity of catalase (CAT) enzyme was calculated spectrophotometrically (Biowave II vrw company USA) by measuring H₂O₂ consumption at 240 nm for 3 min [50]. The reaction mixture (1.51 mL) contained potassium phosphate buffer (100 mM, pH 6.8), H₂O₂ (70 mM) and the enzyme extract (10 μL).

Superoxide dismutase (SOD) activity was determined by measuring reduction of NBT at 560 nm [13]. The reaction mixture (3 mL) contained potassium phosphate buffer (50 mM, pH 7.8), methionine (13 mM), riboflavin (2 μM), EDTA (0.1 mM), NBT (75 μM) and the enzyme extract (100 μL).

For determining peroxidase (POX) activity, the protein extracts (containing 30 mg of total protein) were added to 30 mL of 200 mM guaiacol (as an electron donor substrate) and 25 mM citrate phosphate (pH 5.4). For each sample, 30 mL of 30% H₂O₂ was added and the absorbance was measured at 470 nm using spectrophotometer. The POX activity was calculated using the extinction coefficient of 26.6 mM⁻¹ cm⁻¹ for guaiacol [51].

Finally, activities of the POX and CAT were expressed as μmol min⁻¹ mg⁻¹ protein and the SOD activity was expressed as U SOD mg⁻¹ protein.

2.6. RNA extraction and gene expression analyses

Transcription analyses of the antioxidant genes, including the CAT, POX, and SOD in tomato plants were performed using quantitative reverse transcription-polymerase chain reaction (qRT-PCR) method. Simultaneous inoculation of the plants with both BNR and R. solani (Rs) was performed in this assay, which showed the best effect in resistance induction (the BNR0Rs treatment). The plants only inoculated with the BNR or infected with the pathogen (Rs) were used as controls in this experiment.

Total RNA was extracted from tomato leaves using TRIzol reagent according to the instructions of manufacturer (Invitrogen GmbH, Karlsruhe, Germany). Then, each RNA sample was treated with RNase-free DNase (TURBO DNase, Ambion, USA) to remove DNA. Quantity of each RNA sample was determined via spectrophotometry. First-strand cDNAs were synthesized using oligodT-(18) primer and SuperScript reverse transcriptase (Invitrogen) following the manufacturer's instruction. Primer sequences specific for amplifying the cDNA fragment of POX (designed in this study using Primer 3 software), CAT [52], SOD [53], and Actin [54] were used in qRT-PCR (Table 1). The qRT-PCR amplifications were performed using Quantitect SYBR green PCR kit (Qiagen), according to descriptions of the manufacturer using the ABI7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The PCR conditions consisted of an initial denaturation step at 95 °C for 15 min, followed by 35–40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 60 s, and extension at 72 °C for 60 s. The PCR efficiency for each target cDNA was checked by the slope of a standard curve. Expression levels of the antioxidant genes were showed as fold increase in transcript level compared to the expression level of Actin gene in each sample as a calibrator and presented using the means (±SE) of three replicates in an experiment with three independent repetitions.

Table 1.

Primer sequences of peroxidase, catalase, superoxide dismutase and Actin in tomato, used in this study.

Gene name	Primer sequence (5′ to 3′)	Reference
peroxidase	Forward: AGTGGTAGCCCTGATCCAAC Reverse: GGCTCTGACTACTCGCGTAA	This study
Catalase	Forward: TGGAAGCCAACTTGTGGTGT Reverse:ACTGGGATCAACGGCAAGAG	Zhang et al., 2015
Superoxide dismutase	Forward: GGCTTGCATACAAACCTGAA Reverse: CTGACTGCTTCCCATGACAC	Rai et al., 2018
Actin	Forward: GCTCCACCAGAGAGGAAATACAGT Reverse:CATACTCTGCCTTTGCAATCCA	Zheng et al., 2013

2.7. Evaluation of callose deposition

For determining the role of callose in BNR-IR, the leaf discs were inoculated by the fungal isolates, as described before. Then, callose deposition was estimated at several time points after the inoculation. Chlorophyll was removed from the leaf tissues using ethanol and the samples were immersed in 1% aniline blue for 1 h. Then, the samples were placed in 60% glycerin to make them more softened and improve the microscopic analysis. Callose deposition was investigated using Olympus BX41 microscope and Olympus BX51 Fluorescence microscope. Callose intensity was quantified using the image J software.

2.8. Thioglycolic acid assay for lignin measurement

Lignin was measured using thioglycoli acid (TGA) assay, in which the lignin was bound to TGA to form lignin thioglycolic acid (LTGA) derivatives, which can be extracted from the plant tissues using sodium hydroxide and measured spectrophotometrically. In this assay, the first leaves of tomato plants (500 mg) with different treatments were sampled at various time points and ground in liquid nitrogen. The LTGA derivatives were purified as described by Suzuki et al. [55]. The purified LTGA derivatives were dissolved in 1 M NaOH, and absorbance of the samples at 280 nm was recorded using a spectrophotometer (Biowave II vrw company, USA).

2.9. Oxidative burst investigation

The levels of H₂O₂ in tomato leaves were quantified spectrophotometrically using the method described by Mukherjee and Choudhuri [56]. The supernatant of homogenized fresh leaves (0.05 g) in cold acetone was mixed with titanium dioxide-H₂SO₄ reagent (20%), and the mixture was centrifuged at 6000 rpm for 15 min. Intensity of the yellow color of the obtained supernatant was measured at 415 nm using a Spectrophotometer (Biowave II vrw company USA).

2.10. Manipulating the POX levels and its role in disease development and defense responses

To investigate the function of POX, as a main antioxidant with highest level of priming in BNR-IR in tomato-R. solani pathosystem, the levels of POX were lowered via treating the leaf discs with 8 mM potassium cyanide (KCN), as a POX inhibitor [57]. The leaf discs were treated with the inhibitor for 2 h at room temperature and sterile distilled water was used as control. Afterwards, fungal inoculation on the treated leaf discs was done as mentioned before. Disease symptoms were evaluated at 5 dpi and the DI was calculated [2]. Quantification of lignin and callose deposition were investigated for these leaf discs as previously described.

2.11. Statistical analysis

The SPSS 21 software was used for analyzing the data obtained from different experiments, and the mean values were compared with each other using the Kruskall-Wallis multiple comparison tests completed by a Mann-Whitney comparison test (P ≤ 0.05). Each experiment was done using completely randomized design with at least three repetitions and three replications.

3. Results

3.1. Pathogenicity tests on tomato seedlings and leaf discs

Pathogenicity levels of the fungal isolates on tomato seedlings and leaf discs were evaluated (Fig. 1). Based on the obtained results, the highest and lowest disease index values were observed for the isolates of AG-4 HG-II and the BNR isolates respectively (Fig. 1), on both leaf discs (Fig. 2A) and seedlings (Fig. 2B). Among multinucleate R. solani isolates, the lowest virulence level was observed for the isolate of AG 3 (Fig. 1, Fig. 2). Inoculating tomato plants with the BNR isolate with different time intervals before inoculation of R. solani AG-4 HG-II significantly reduced the disease index on the seedlings compared to the control plants (only inoculated with the pathogen). The highest level of plant protection against the pathogen was observed in the plants simultaneously inoculated with the BNR and R. solani (Table 2).

Fig. 1.

Disease index caused by various isolates of Rhizoctonia solani (AG-3, AG-4 HG-I, and AG-4 HG-II) and a binucleate Rhizoctonia isolate (AG-Bb) on tomato leaf discs and seedlings at 5 days after inoculation. Lines on the columns represent standards error (±SE) of three replicates of a representative experiment. Different letters indicate significant differences according to Kruskale Wallis followed by the Manne Whitney comparison test at p ≤ 0.05. Data are means (± standard error) of three replicates of a representative experiment. The experiment was repeated three times with similar results.

Fig. 2.

Disease symptoms caused by different isolates of Rhizoctonia solani and binucleate Rhizoctonia sp. (BNR) AG-Bb on the leaf discs (A) and seedlings (B) of tomato cultivar Mobil.

Table 2.

Disease progress on tomato plants inoculated with the binucleate Rhizoctonia sp. AG-Bb (BNR) at different days before inoculation with Rhizoctonia solani AG-4 HG-II (Rs). Disease evaluation was done at 7 days after the pathogen inoculation.

Treatment	Disease index
Plants only inoculated with BNR	2.1 ± 0.3 a
Plants only inoculated with Rs	68.2 ± 0.1 f
Simultaneous inoculation with BNR & Rs	24.3 ± 0.2 b
Inoculation of BNR at 1 day before Rs	39.5 ± 0.7 c
Inoculation of BNR at 3 days before Rs	40.6 ± 0.2 cd
Inoculation of BNR at 5 days before Rs	46.8 ± 0.5 d
Inoculation of BNR at 7 days before Rs	52.8 ± 0.6 e

Results are mean ± SD of three separate experiments done in triplicate. Different letters indicate significant differences according to Duncan's multiple range test (P < 0.05).

3.2. Colonization of tomato roots by the BNR isolate

Root colonization by the BNR was microscopically investigated and the fungal hyphae were detected at 3 dpi (Fig. 3A). Tomato root colonization by the BNR at 0, 1, 3 and 5 dpi revealed the range of 0–44 colony forming units (CFUs) in the investigated roots (Fig. 3B).

Fig. 3.

Microscopic analysis of tomato root colonization by the binucleate Rhizoctonia AG-Bb at 3 days post inoculation (dpi; A) and determining colony forming units at 0, 1, 3 and 5 days dpi (B).

3.3. Assessment of antioxidative enzymes activities

Effects of the BNR treatment on the activity of antioxidant enzymes, including the CAT, POX and SOD were investigated in tomato plants at 0, 12, 24, 36 and 48 hpi (Fig. 4). For the CAT activity, in the plants only inoculated with the pathogen (Rs treatment), an increasing trend was observed until 12 hpi, then decreased until 48 hpi. In the plants only infected with the BNR, an increasing trend of the CAT activity was recorded until 12 hpi, which slightly decreased until 24 hpi and then decreased until 48 hpi. The CAT activity in tomato plants simultaneously inoculated with BNR and Rs (BNR0Rs treatment) increased until 12 hpi, then slightly decreased until 24 hpi and afterwards showed sharp decrease until 48 hpi. In the plants with 1 day time interval between inoculation of the BNR and pathogen (BNR1Rs treatment), the CAT activity increased until 24 hpi, followed by a stationary state until 48 hpi with a slight decrease. In the BNR3Rs and BNR5Rs treatments, the CAT activities were similar to those observed for the BNR1Rs treatment. In the BNR7Rs treatment, the CAT activity increased until 36 hpi, followed by a decreasing trend until 48 hpi (Fig. 4A). In the healthy control plants without fungal inoculation, stationary state of the CAT activity was observed at all time points tested (data not shown).

Fig. 4.

Catalase (CAT; A), peroxidase (POX; B) and Superoxide dismutase (SOD; C) activity in tomato plants with various treatments at different time points after inoculation with Rhizoctonia solani AG-4 HG-II. Rs: R. solani; BNR: Binucleate Rhizoctonia AG-Bb; BNR0Rs: simultaneous inoculation with BNR & Rs; BNR1Rs: inoculation of BNR at 1 day before Rs, BNR3Rs: inoculation of BNR at 3 days before Rs; BNR5Rs: inoculation of BNR at 5 days before Rs; BNR7Rs: inoculation of BNR at 7 days before Rs. Data are means (± standard error) of three replicates of a representative experiment. Each replicate consisted of one sample pooled from six individual plants. The experiment was repeated three times with similar results.

Maximum POX activity was observed in the BNR0Rs treatment at most of the time points investigated. In the plants with this treatment, the POX activity increased until 12 hpi and then decreased. Also, in all other treatments tested, the highest level of POX activity was observed at 12 hpi followed by decreasing trend until 48 hpi (Fig. 4B). In the healthy control plants without fungal inoculation, stationary state of the CAT activity was observed at all time points tested (data not shown).

For the SOD activity, the highest level of enzyme activity was observed at 12 hpi in the plants with BNR0Rs treatment. This treatment showed a decreasing trend of the SOD activity from 12 to 48 hpi. In the BNR treatment, the SOD activity had an increasing trend from 0 to 12 hpi, followed by a decreasing trend until 24 hpi. Then, the SOD activity displayed a stationary state until 36 hpi and then decreased until 48 hpi. The SOD activity in the plants with the Rs treatment showed an increasing trend until 12 hpi and then decreased from 12 to 48 hpi. In tomato plants with the BNR1Rs treatment, the SOD activity increased from 0 to 12 hpi, then decreased until 36 hpi, followed by a slight increase at 48 hpi. In three other treatments tested (including BNR3Rs, BNR5Rs and BNR7Rs), the SOD activity increased until 12 hpi, followed by a decreasing trend until 48 hpi (Fig. 4C). In the healthy control plants without fungal inoculation, stationary state of the CAT activity was observed at all time points tested (data not shown).

3.4. Transcription analysis of the antioxidant genes

Previous assays revealed priming the activities of CAT, POX and SOD enzymes in tomato plants with the BNR treatment. Therefore, it was interesting to investigate the correlation between activity of these antioxidant enzymes and transcript levels of the corresponding genes. The data obtained via qRT-PCR revealed that priming the CAT (Fig. 5A) gene expression was occurred in tomato plants with the BNR treatment and maximum level of the CAT upregulation was observed at 12 hpi. The highest levels of POX transcript accumulation were observed in plants with the BNR0Rs treatment at most of the time points tested (Fig. 5B). Also, maximum level of the SOD expression was observed in plants with the BNR0Rs treatment at 12 hpi (Fig. 5C).

Fig. 5.

Transcript accumulation of CAT (A), POX (B) and SOD (C) genes at various time points after inoculation of tomato plants with Rhizoctonia isolates. Expression levels of the gene transcripts were determined using qRT-PCR and expressed as fold upregulation compared to the transcript levels of the Actin gene as an internal control. Values are the means ± standard error (SE) of three replicates of an experiment with three independent repetitions. Means with different letters at each time point statistically significant difference according to the Kruskall-Wallis tests completed by Mann-Whitney analysis at P ≤ 0.05 in the SPSS software.

3.5. Callose deposition

Investigating callose deposition in tomato plants with different treatments revealed that the highest amount of callose was deposited in plants with the BNR0Rs treatment. Whereas the lowest levels of callose at all of the time points tested were observed in plants only inoculated with the pathogen (Rs treatment). The levels of callose production in the other treatments were between the values observed for the BNR0Rs and Rs treatments. Callose accumulation showed increasing trend until 24 hpi, followed by a decreasing trend until 48 hpi in all treatments investigated (Fig. 6A).

Fig. 6.

Measurement of callose (A) and lignin (B) contents in tomato plants with various treatments at different time points after inoculation with Rhizoctonia solani AG-4 HG-II. Rs: R. solani; BNR: Binucleate Rhizoctonia AG-Bb; BNR0Rs: simultaneous inoculation with BNR & Rs; BNR1Rs: inoculation of BNR at 1 day before Rs, BNR3Rs: inoculation of BNR at 3 days before Rs; BNR5Rs: inoculation of BNR at 5 days before Rs; BNR7Rs: inoculation of BNR at 7 days before Rs. Data are means (± standard error) of three replicates of a representative experiment. Each replicate consisted of one sample pooled from six individual plants. The experiment was repeated three times with similar results.

3.6. Quantification of lignin

To investigate effect of the BNR isolate in inducing cell wall-related defense responses, changes of lignin formation were analyzed in the present study. As shown in Fig. 5B, tomato plants with the BNR0Rs treatment showed the highest level of lignification at all time points tested. While the lowest levels of lignin were detected in the Rs treatment. In the BNR0Rs treatment, an increasing trend of the lignin accumulation was observed from 0 to 24 hpi, followed by a slight decrease until 36 hpi and then increased until 48 hpi. Lignin accumulation slightly increased until 48 hpi in tomato plants with other treatments, but their lignin levels were lower than those of the BNR0RS treatment (Fig. 6B).

3.7. Quantification of H₂O₂ accumulation in the plants and its effect in BNR-IR

Accumulation of H₂O₂ at different time points after inoculating tomato plants with R. solani AG-4 HG-II was investigated. Quantification of H₂O₂ revealed that its highest level was observed in the plants only inoculated with the pathogen, whereas the lowest levels of H₂O₂ were detected in the interaction of tomato with the BNR isolate at various time points tested (Fig. 7). Accumulation of H₂O₂ increased until 24 hpi and decreased afterwards in the plants only inoculated with R. solani (Rs treatment). Whereas, in the plants only inoculated with the BNR isolate or inoculated by both BNR and Rs, the H₂O₂ levels increased until 12 hpi followed by a decreasing trend until 48 hpi (Fig. 7).

Fig. 7.

Investigation of H₂O₂ accumulation in tomato plants with various treatments at different time points after inoculation with Rhizoctonia solani AG-4 HG-II. Rs: R. solani; BNR: Binucleate Rhizoctonia AG-Bb; BNR0Rs: simultaneous inoculation with BNR and Rs; BNR1Rs: inoculation of BNR at 1 day before Rs, BNR3Rs: inoculation of BNR at 3 days before Rs; BNR5Rs: inoculation of BNR at 5 days before Rs; BNR7Rs: inoculation of BNR at 7 days before Rs. Data are means (± standard error) of three replicates of a representative experiment. Each replicate consisted of one sample pooled from six individual plants. The experiment was repeated three times with similar results.

3.8. The role of POX in BNR-IR

The POX inhibitor (KCN) treatment inhibited BNR-IR and increased the disease index (DI) significantly in both KCNRs and KCNBNR0Rs treatments (Fig. 8A), indicating enhanced susceptibility of KCN-treated plants to the pathogen. Culturing R. solani on PDA amended with 8 mM KCN did not affect the fungal growth, representing that the applied POX inhibitor had not any direct effect on the pathogen (data not shown). Treating tomato leaf discs with KCN prior to the pathogen inoculation or before simultaneous inoculation by the BNR and R. solani (Rs) considerably reduced lignin formation (Fig. 8B) and callose deposition (Fig. 7C), which are related to increased disease progress due to application of KCN.

Fig. 8.

Investigating effect of KCN treatment (as a peroxidase inhibitor) on tomato induced resistance against Rhizoctonia solani AG-4 HG-II via application of Binucleate Rhizoctonia sp. AG-Bb. Effect of KCN (8 mM) treatment on the disease progress (A), lignification (B) and callose deposition (C) in tomato plants. Different letters indicate significant differences according to Kruskale-Wallis followed by the Manne-Whitney comparison test at p ≤ 0.05. Data are means (± standard error) of three replicates of a representative experiment. The experiment was repeated three times with similar results. KCNRs: plants pretreated with KCN and inoculated with the pathogen; Rs: R. solani; BNR: Binucleate Rhizoctonia sp. AG-Bb; BNR0Rs: simultaneous inoculation with BNR and Rs; KCNBNR0Rs: plants pretreated with KCN and simultaneously inoculated with BNR and Rs.

4. Discussion

This study is the first report on the effect of Binucleate Rhizoctonia sp. AG-Bb in reducing the disease caused by R. solani on tomato via induction of plant defense responses, including antioxidant enzymes, H₂O_2, and cell wall related defense mechanisms. In this study, virulence analyses using three taxonomic groups of R. solani (including AG-3 PT, AG-4 HG-I, AG-4 HG-II) and one isolate of Binucleate Rhizoctonia sp. AG-Bb revealed that the highest level of disease progress belonged to the tomato seedlings and leaf discs infected with R. solani AG-4 HG-II. Infection caused by the binucleate isolate (BNR) was significantly less than all multinucleate R. solani isolates tested. Generally, binucleate isolates of Rhizoctonia are reported as avirulent or hypovirulent fungi on various host plants [58], which in some cases have potential capability of controlling highly virulent multinucleate isolates of R. solani [12,15,59], binucleate isolates of Rhizoctonia cerealis [59] and other fungal pathogens [16,60,61] via resistance induction. Therefore, it was interesting to find out if the hypovirulent BNR isolate used in this study was capable of inducing defense responses and protecting tomato plants against the highly virulent isolate of R. solani AG-4 HG-II.

Investigating effect of different time intervals between pre-treatment of tomato plants with the BNR isolate and inoculation of R. solani AG-4 HG-II revealed that simultaneous inoculation of the BNR and R. solani had the best effect in decreasing the disease progress. This finding is in accordance with a previous report on application of an isolate of BNR belonging to AG-Bb for induction of resistance in bean-R. solani AG-4 HG-II pathosystem [12]. Therefore, similar defense mechanisms might be activated in various dicots against R. solani via application of BNR as an effective biocontrol agent.

Antioxidant systems, including enzymatic and non-enzymatic antioxidants and ROS are amongst the main defense components involved in plant immunity against pathogens with various lifestyles [28]. One of the most important types of ROS is H₂O₂, which is known to be involved in tomato resistance against biotrophic fungal pathogens, including Cladosporium fulvum [62], Oidium neolycopersici [63], and hemibiotrophics such as Colletotrichum coccodes [63]. In addition, several studies reported the importance of H₂O₂ as a main defense component and second messenger in tomato immunity against several necrotrophic fungi, such as Botrytis cinerea [39], Fusarium oxysporum f.sp. lycopersici [64], and R. solani [41]. However, due to the necrotrophic lifestyle of R. solani, accumulation of H₂O₂ at high levels might be helpful for establishing the infection and progress of the disease. So, biocontrol agents and beneficial microorganisms are reported to protect various host plants against R. solani and decrease the disease severity via increasing activity of various antioxidants [13].

The results of this study revealed that the highest amounts of H₂O₂ were produced in the plant tissues infected with R. solani. While the lowest levels of these signaling molecules were produced in the plants only inoculated with the hypovirulent BNR isolate. Inoculation of tomato plants with the BNR and R. solani simultaneously and/or BNR inoculation prior to R. solani inoculation reduced H₂O₂ accumulation in plant cells compared to the plants only inoculated with the pathogen. Therefore, it can be concluded that oxidative burst enhanced progress of R. solani in the host tissues and modulation of H₂O₂ levels via activating antioxidants in plants by the BNR treatment reduced the disease progress, as previously observed in bean-R. solani interaction [13,65].

Plant cell wall is a main physical barrier, which limits pathogen invasion in the host tissues via callose and lignin accumulation. Components of the plant cell can be associated with ROS and antioxidative enzymes [28,41]. Investigating plant defense mechanisms related to cell wall reinforcement might be useful in developing integrative strategies to decrease destructive effects of various environmental stimuli, especially pathogenic fungi on various plants. Callose is a 1,3- β glucan polymer found in plant cell walls, which is produced in response to both biotic and abiotic stresses. In the present research, a correlation was observed between BNR-IR and callose deposition in tomato plants. The highest level of callose formation was detected in the plants with BNR0Rs treatment, which showed the best resistance induction against R. solani. These findings suggest that callose deposition can be considered as a resistance marker in tomato-R. solani AG-4 HG-II interaction, as previously demonstrated in tomato-R. solani AG-3 pathosystem [66]. This finding is in agreement with the report of Gindro et al. [67] in grape-Plasmopara viticola interaction, which demonstrated that the levels of callose deposition can be used as a marker to examine resistance of various grape varieties to downy mildew. Researchers found that callose is deposited with more delay in mesophyll of susceptible grape varieties compared to the resistant ones. These findings are in accordance with the data obtained in the present study about faster accumulation of callose in the plants with BNR0Rs treatment, which induced the highest level of resistance compared to the other treatments tested in tomato-R. solani pathosystem. By forming papillae, callose deposition prevents penetration of haustoria formed by phytopathogenic fungi into the epidermal cells of the host plants. Therefore, it can be a powerful physical barrier for penetration of pathogens into the plant cells.

Lignin is amongst complex cell wall phenolics, which is produced via oxidative polymerization of monolignols by involvement of H₂O₂ and peroxidases [28,68]. The present research revealed effect of the BNR pre-inoculation before the pathogen infection in priming lignin formation, as a main plant defense response against R. solani. Similar to these findings, involvement of lignification in basal resistance and SNP-activated defense responses in tomato-R. solani AG-3 interaction have been previously demonstrated [66]. Lignification has been shown to be primed by riboflavin-IR in rice against R. solani AG-1 IA [2] and in Piriformospora indica-IR in bean against R. solani AG-4 HG-II [13]. Romero et al. [69] demonstrated the involvement of oxidative burst and plant cell wall reinforcement via callose and lignin formation in melon resistance to powdery mildew (caused by Podosphaera fusca), which is in accordance with our findings. These data suggest critical role of callose and lignin formation as major defense components involved in cell wall strengthening, leading to decreased level of disease progress in the plant tissues.

In this study, priming the activities and transcript accumulations of the antioxidants in tomato plants with the BNR treatment was correlated with resistance induction against the pathogen. Application of KNC (as a POX inhibitor) significantly reduced both basal resistance and BNR-IR in our pathosystem, which could be related to lower level of lignin and callose formation in the KCN treated leaves. These findings suggested major role of the POX in lignin and callose production, as the main defense components involved in tomato resistance against R. solani. Similar to these data, application of the POX inhibitor reduced basal resistance of sugar beet and tomato plants to R. solani, which was associated with decreased phenolics and lignin [2,41]. The main role of POX in phenolics accumulation, that leads to tomato resistance against wounding and necrotrophics, such as Alternaria tenuissima [40], A. alternata and Fusarium solani [70], were also reported in accordance with the findings of this study. Therefor, activity of the POX as a type of pathogenesis-related proteins can be considered among the main defense components of the host plants against R. solani, which are previously demonstrated in different plant species [[71], [72], [73]].

In overall, these findings suggest the critical role of ROS homeostasis via activation of antioxidant enzymes, and cell wall strengthening via callose and lignin production as defense mechanisms involved in BNR-IR in our pathosystem (Fig. 9). Several reports similarly demonstrated the correlation between priming antioxidant activities such as peroxidases, callose and lignin mediated resistance against various taxonomic groups of R. solani on different monocot and dicot plants [41,66]. So far, no detailed analyses on the involvement of ROS, antioxidant genes and enzymes, callose and lignin in BNR-IR of tomato to R. solani AG-4 HG-II had been conducted. Our knowledge on defense mechanisms involved in biologically induced defense responses could be useful in designing novel and effective disease management strategies and breeding programs leading to obtain plant cultivars with elevated immunity to destructive pathogens.

Fig. 9.

Schematic presentation of the findings of present study about mechanisms of induced resistance against Rhizoctonia solani AG-4 HG-II via application of binucleate Rhizoctonia sp. AG-Bb in tomato plants.

Statement of human and animal Rights

This article does not contain any studies with human or animal subjects performed by any of the authors.

Data availability statement

The data associated with our study was not deposited into a publicly available repository. Data will be made available on request.

CRediT authorship contribution statement

Parissa Taheri: Writing – review & editing, Writing – original draft, Supervision, Resources, Project administration, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Fatemeh Hosseini-Zahani: Writing – original draft, Software, Methodology, Data curation. Saeed Tarighi: Writing – review & editing, Visualization, Resources, Formal analysis, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.