Skip to main content
Microorganisms logoLink to Microorganisms
. 2024 Mar 6;12(3):529. doi: 10.3390/microorganisms12030529

Recombinant Production of Pseudomonas aeruginosa Rhamnolipids in P. putida KT2440 on Acetobacterium woodii Cultures Grown Chemo-Autotrophically with Carbon Dioxide and Hydrogen

Jonas Widberger 1,, Andreas Wittgens 1,2, Sebastian Klaunig 1, Markus Krämer 1, Ann-Kathrin Kissmann 1,2,, Franziska Höfele 3, Tina Baur 4, Tanja Weil 2, Marius Henkel 5, Rudolf Hausmann 6, Frank R Bengelsdorf 3, Bernhard J Eikmanns 3, Peter Dürre 4, Frank Rosenau 1,*
Editor: Laurent Dufossé
PMCID: PMC10972445  PMID: 38543580

Abstract

The establishment of sustainable processes for the production of commodity chemicals is one of today’s central challenges for biotechnological industries. The chemo-autotrophic fixation of CO2 and the subsequent production of acetate by acetogenic bacteria via anaerobic gas fermentation represents a promising platform for the ecologically sustainable production of high-value biocommodities via sequential fermentation processes. In this study, the applicability of acetate-containing cell-free spent medium of the gas-fermenting acetogenic bacterium A. woodii WP1 as the feeder strain for growth and the recombinant production of P. aeruginosa PAO1 mono-rhamnolipids in the well-established nonpathogenic producer strain P. putida KT2440 were investigated. Additionally, the potential possibility of a simplified production process without the necessary separation of feeder strain cells was elucidated via the cultivation of P. putida in cell-containing A. woodii culture broth. For these cultures, the content of both strains was investigated by examining the relative quantification of strain-exclusive genes via qPCR. The recombinant production of mono-rhamnolipids was successfully achieved with maximum titers of approximately 360–400 mg/L for both cell-free and cell-containing A. woodii spent medium. The reported processes therefore represent a successful proof of principle for gas fermentation-derived acetate as a potential sustainable carbon source for future recombinant rhamnolipid production processes by P. putida KT2440.

Keywords: rhamnolipid, Pseudomonas putida, biosurfactants, anaerobic gas fermentation, Acetobacterium woodii, sequential fermentation, heterologous production

1. Introduction

For almost every sector of modern industry, surfactants have become an indispensable component, which is evidenced by a worldwide production in the order of 18 million tons per year and the wide range of applications they are used in, including the food industry, agriculture, medicine, and healthcare, as well as textiles and bioremediation [1,2,3,4,5]. However, as most commercial surfactants are still produced from nonrenewable petrochemical precursors, a major focus in recent decades has been on the discovery and commercialization of biosurfactants, which are almost exclusively of microbiological origin and produced from renewable substrates [6]. Among the currently available classes of biosurfactants, rhamnolipids are of particularly high industrial potential [7]. Rhamnolipids show potential for many possible applications, as reviewed extensively by Lang and Wullbrandt [8] as well as Maier and Soberón Chávez and others [9,10]. A prominent example is the use of rhamnolipids as detergents in washing agents and the cleaning sector due to their potent tensidic properties [11]. Also possible is the utilization as emulsifiers in the cosmetic and food industry [12,13]. In comparison to conventional surfactants obtained through chemical synthesis, rhamnolipids show lower toxicity, are biodegradable, and possess novel properties, such as antimicrobial effects [14,15].

The molecular structure of rhamnolipids is composed of either one (mono-rhamnolipids) or two (di-rhamnolipids) L-rhamnose sugar residues linked to one or, more commonly, two 3-hydroxyfatty acids via a β-glycosidic bond, providing them with basic structural diversity [16,17,18]. Additionally, different bacterial producer strains are known to produce rhamnolipids with fatty acid residues of varying characteristic lengths, typically ranging from C8 to C16 and differing in their shares of unsaturated bonds, leading to over 60 reported congeners with considerable varying physicochemical properties [19]. This rich structural and physicochemical variety offers unique potential for the production and utilization of rhamnolipid mixes with distinct physicochemical properties via selective heterologous gene expression [6].

The production of rhamnolipids was first described nearly 70 years ago for the human pathogen Pseudomonas aeruginosa [20,21,22,23,24,25,26], which represents the best-known native producer strain until today. Apart from P. aeruginosa, several bacteria from the genus Burkholderia are known producers of rhamnolipids too. Among them are known human pathogens, such as Burkholderia pseudomallei [27,28], or plant pathogens, such as B. plantarii [29] and B. glumae [30,31]. A major bottleneck for industrial-scale rhamnolipid production in these native producer strains is the complex regulation mechanism controlling rhamnolipid biosynthesis at the transcriptional level through the quorum sensing regulatory network [32,33,34] and probably other signaling mechanisms in these strains. Furthermore, the pathogenic potential of the native producer strains is another considerable disadvantage for their use as production platforms, especially if the utilization of the rhamnolipids in food and cosmetics is envisaged [18,35]. As a result, the heterologous production of rhamnolipids in nonpathogenic host organisms has been given considerable attention, with the strain Pseudomonas putida KT2440 being one of the most noteworthy examples [7,36]. This well-characterized strain is known for its versatile metabolism, rapid growth, and high level of solvent tolerance [37,38]. Utilizing the strains’ natural metabolic versatility, several recent studies have focused on the establishment of unusual carbon sources derived from sustainable raw materials as substrates to support the more ecological production of rhamnolipids. P. putida KT2440 has, for example, been successfully engineered to utilize sugars such as xylose and arabinose as part of lignocellulose hydrolysates obtained from agricultural residues [39]. In another approach, acetate found within biooil obtained from the fast pyrolysis of lignocellulosic biomass was shown to be a promising sustainable carbon source for rhamnolipid production by Arnold et al. [40].

A noteworthy source of the sustainable biological production of acetate is acetogenic bacteria, which already provide approximately 10% of the global annual acetate output [41]. Acetogens are a phylogenetically diverse group of obligate anaerobic bacteria that use the reductive acetyl-CoA or the Wood-Ljungdahl pathway as the main means for energy conservation and synthesis of cell carbon. Within this pathway, two molecules of CO2 are reduced to the acetyl moiety of acetyl-CoA, which is subsequently converted to acetate [42,43,44]. Apart from energy conservation realized by the production of acetate, another significant part of energy conversion for the cell is achieved via ion-gradient-driven phosphorylation coupled to the reductive acetyl-CoA pathway. Depending on the species of acetogen, either protons or sodium ions are translocated for additional ATP generation [45,46]. Various acetogens are successfully used for the production of valuable natural and recombinant products, such as the biofuels ethanol, butanol, and hexanol [47,48,49], as well as bulk chemicals aside from acetic acid, such as acetone or lactate [50,51] via the fixation of CO2 from gaseous substrates (CO2 + H2 or synthesis (syn) gas fermentation). Syngas rich in CO2 can be obtained from different renewable and sustainable sources, e.g., from the pyrolysis/gasification of organic waste substances or from the utilization of certain industrial off-gases, for example those of the steel industry [52]. Among acetogenic species, Acetobacterium woodii is of particular interest, as it is a well-studied model strain for the metabolism of sodium-dependent acetogenic bacteria [46,53]. Furthermore, an established set of tools is available for genetic engineering [50,51,54].

The aim of this study was to utilize the acetate produced by A. woodii via chemo-autotrophic gas fermentation as the carbon source for the recombinant production of rhamnolipids by P. putida KT2440. Cell-free A. woodii spent medium was used as a base for P. putida growth and rhamnolipid production. To realize the production of mono-rhamnolipids, the rhlAB genes of P. aeruginosa PAO1 were introduced into P. putida KT2440 within the plasmid vector pVLT31. The expression of rhlAB genes was controlled using an IPTG-inducible tac promoter. The cultivation of P. putida was carried out in pure A. woodii spent medium as well as in a 1:1 mixture of spent medium and conventional minimal medium. To investigate the potential influences of the presence of A. woodii cells on the growth and final rhamnolipid concentrations, the cultivation of P. putida was also carried out in a cell-containing spent medium. To monitor the cell population development in the cultures containing both the A. woodii and P. putida cells, the relative quantification of strain-exclusive genes was carried out during the cultivation.

2. Materials and Methods

2.1. Media and Cultivation

Escherichia coli DH5α, which was used for the plasmid amplification, was cultivated in Luria-Bertani (LB) medium [55] containing 10 g/L tryptone, 10 g/L NaCl, and 5 g/L yeast extract while shaking (150× g) or on respective agar plates at 37 °C. After autoclaving, the medium was supplemented with glucose until a final concentration of 1% w/v. For plasmid maintenance, the medium was further supplemented with 10 µg/mL tetracycline prior to inoculation. A. woodii was cultivated in modified DSM 135 medium [50] containing 0.20 g/L NH4Cl, 1.76 g/L KH2PO4, 8.44 g/L K2HPO4, 10 g/L NaHCO3, 3 g/L yeast extract, 0.5 g/L L-cysteine-HCl, 2 mL/L SL-9 trace element solution (Table S1) [56], 2 mL/L vitamin solution (Table S2) [57], 1 mL/L selenite-tungstate solution (Table S3) [56], and 1 mL/L resazurin (1 g/L). The preparation of the medium was conducted anaerobically via the seven-fold exchange of the atmosphere with N2 + CO2 (80:20). After autoclaving, the medium was supplemented with 0.33 g/L MgSO4·7H2O. Autotrophic cultivation was carried out in 110 mL of medium in 500-mL rubber-sealed Müller Krempel bottles. The bottles’ atmosphere was exchanged seven-fold with H2 + CO2 (67:33) to a final overpressure of 110 kPa. When the overpressure fell under 50 kPa during cultivation, the bottles were gassed again to 110 kPa. The precultures were cultivated in 5 mL of medium in rubber-sealed hungate tubes supplemented with 8 g/L fructose. The cells from these precultures were used for the inoculation of 50 mL medium in Müller Krempel bottles with the aforementioned H2 + CO2 gas atmosphere for adaptation to autotrophic growth. Cultivation in 5 mL and 50 mL tubes took place with prior supplementation of 5 µg/mL clarithromycin for plasmid maintenance. The cells from the 50-mL cultures adapted to autotrophic growth were then used as the inoculum for 110-mL main cultures. The cultivation of A. woodii was always conducted at 30 °C while shaking (150× g). For the cultivation of P. putida strains in fresh medium, either modified Wilms Kpi medium, modified DSM 135 medium (as described above), or a 1:1 mixture of both was utilized. In the case of cultivation in fresh media, acetate was supplemented in different concentrations from 100 to 500 mM as the carbon source. Aside from the fresh medium, the cultivation of P. putida strains was also carried out in cell-free or cell-containing spent medium of A. woodii (pMTL83251) or in a 1:1 mixture of said spent medium with fresh modified Wilms KPi medium. The cell-free medium was obtained via centrifugation (4500× g, RT, 30 min). The modified Wilms KPi medium [58] contained 0.5 g/L NH4Cl, 1.64 KH2PO4, 6.58 g/L K2HPO4, 2 g/L Na2SO4, 5 g/L (NH4)2SO4, and 0.05 g/L thiamine-HCl. After autoclaving, the medium was supplemented with 0.5 g/L MgSO4·7H2O and 3 mL/L of a trace element solution (Table S4). If necessary for plasmid maintenance, the medium was supplemented with 25 µg/mL tetracycline. Precultures of all the P. putida strains were initially cultivated in a volume of 5 mL modified Wilms KPi medium supplied with 1% (w/v) of glucose in conventional glass culture tubes. The cells from these precultures were used for the inoculation of 20 mL modified Wilms KPi medium supplemented with 100 mM acetate for adaptation to the utilization of acetate as the carbon source in 100 mL conventional Erlenmeyer flasks. The cells from the 20-mL cultures adapted to the growth with acetate were subsequently used as the inoculum for the 100-mL main cultures in 500 mL conventional Erlenmeyer flasks in one of the respective medium variants mentioned above. The cultivation of the P. putida strains was always carried out at 30 °C while shaking (150× g). For the induction of gene expression from the tac promoter within the pVLT31 plasmid, 0.4 mM of isopropyl-β-D-thiogalactopyranoside (IPTG) was added to the medium prior to inoculation.

2.2. Bacterial Strains and Plasmids

Aside from the P. putida KT2440 strain, two other P. putida strains derived from this wild-type strain were constructed and used in this study. For the construction of these strains, the backbone plasmid pVLT31 as well as the plasmid pVLT31_rhlAB containing the rhlAB genes of the strain P. aeruginosa PAO1 were used. All the plasmids used in this study are listed in Table 1. The construction of the pVLT31_rhlAB plasmid was carried out by Wittgens et al. (2011) [7]. The aforementioned plasmids were transformed into E. coli DH5α and stored in glycerol cryo-stock cultures at −80 °C. To obtain the plasmids, the respective E. coli DH5α strains were grown from glycerol stock cultures overnight, and the plasmids were isolated using the QIAprep® Spin Miniprep Kit (Qiagen; Venlo, Netherlands). The plasmid identity was verified via restriction analysis using the enzymes SapI and XbaI. To obtain the P. putida KT2440 competent, the cells from a 50-mL overnight culture were sedimented a total of four times via centrifugation (3000× g, 4 °C, 30 min), being resuspended in different volumes of 300 mM saccharose (50, 25, and 12.5 mL) between each centrifugation step. After the last centrifugation step, the cells were resuspended in a final volume of 750 µL of saccharose, and 250 µL of glycerol (100%) was added. The competent cells were stored at −80 °C in aliquots of 150 µL. The transformation of the pVLT31 and pVLT31_rhlAB plasmids into P. putida KT2440 was carried out via electroporation. Therefore, the aliquots of the competent P. putida cells were thawed on ice, and 500 ng of the desired plasmid DNA was added. The mixtures were transferred to an electroporation cuvette. Electroporation was carried out at 12.5 kV/cm. After that, the cells were mixed with 800 µL of S.O.C. medium (Table S5), transferred into a sterile 15-mL falcon tube, and incubated for 2 h at 30 °C and 150× g orbital shaking for cell recovery. The selection of the successfully transformed cells was carried out on LB agar plates containing 25 µg/mL tetracycline. The resulting P. putida [pVLT31] and P. putida [pVLT31_rhlAB] strains were used for the subsequent growth experiments.

Table 1.

Plasmids used in this study and descriptions of their relevant features.

Plasmid Description Source
pVLT31 Expression vector with the IPTG-inducible tac promoter, TetR De Lorenzo et al., (1993) [59]
pVLT31_rhlAB Same as pVLT31, rhlAB genes of P. aeruginosa PAO1 under the control of the tac promoter Wittgens et al., (2011) [7]
pMTL83251 The backbone for homologous recombination vectors, CmR Heap et al., (2009) [60]

In order to avoid possible contaminations of the feeder strain, it was decided to utilize an A. woodii strain carrying the empty vector plasmid pMTL83251 with a clarithromycin-resistance gene. The A. woodii [pMTL83251] strain was provided by the Institute for Microbiology and Biotechnology of the University of Ulm.

2.3. Optical Density (OD600) Measurement

For determination of the OD600 during the growth experiments, samples of up to 1 mL were obtained from the respective cell cultures. The UV/Vis spectrophotometer UV-1600PC (VWR, Randor, PE, USA) was used to measure the OD600. If the resulting absorption values exceeded 0.3, the sample was diluted accordingly with the medium of the type that was used during the respective cultivation.

2.4. Quantification of Mono-Rhamnolipids

For the determination of mono-rhamnolipid production, samples of a 100-µL culture suspension were obtained. After centrifugation for 3 min at 14,000× g, the supernatants were used for the liquid/liquid extraction of the mono-rhamnolipids. For the rhamnolipid extraction, 500 µL of ethylacetate was added to the culture supernatants and thoroughly mixed. After centrifugation for 30 s at 21,500× g, the clear upper phase was obtained. For each sample, the process was repeated three times. In the next step, the solvent was evaporated under the application of a vacuum for 35 min at 60 °C and 1400× g using a CentriVap® Benchtop Centrifugal Vacuum Concentrator (Labconco Corporation, Kansas City, MO, USA). The total quantification of the mono-rhamnolipids was conducted with the orcinol assay. The rhamnolipids were resuspended in 100 µL of deionized water. Subsequently, 800 µL of sulfuric acid (60% v/v) and 100 µL of orcinol solution (1.6% w/v in deionized water) were added. The samples were then incubated for 30 min at 80 °C and 800× g orbital shaking in a thermomixer. After cooling to room temperature, the absorption of the samples at 421 nm was measured in comparison to the extracts of commercial pure mono-rhamnolipids (AGAE Technologies LLC, Corvallis, OR, USA) in different predefined concentrations from 10 mg/L to 1 g/L. If the resulting absorption values exceeded 0.3, the sample was diluted accordingly with a mixture of sulfuric acid and deionized water (4:1).

2.5. Gas Chromatography (GC)

The analysis of the acetate concentrations was conducted via gas chromatography (GC) utilizing the Clarus® 600 system (Perkin Elmer, Waltham, MA, USA). The cells present in the samples of all the culture supernatants were pelleted via centrifugation (30 min, 4 °C, 14,000× g). A total of 480 µL of supernatant was acidified by adding 20 µL of HCl (2 M). The Clarus® 600 system was equipped with an Elite-FFAP capillary column (Perkin Elmer, Waltham, MA, USA) with a length of 30 m, an inner diameter of 0.32 mm, and a density film of 0.25 µM. A total of 1 µL of the supernatant was injected via the preheated injector (200 °C) with a split ratio of 20 H2, which served as the carrier gas, and a flow rate of 45 mL/min. Detection occurred using a flame ionization detector (FID) at a temperature of 300 °C. The analysis of the samples was carried out using the following temperature profile: 2 min at 90 °C, from 90 °C to 250 °C in 40 °C/min, 1 min at 250 °C. External quantification standards were used for the calibration.

2.6. Primers and qPCR

During the growth experiments of P. putida KT2440 [pVLT31_rhlAB] in cell-containing spent medium of A. woodii, the investigation of P. putida growth and decay of A. woodii within the culture was not feasible via measuring the OD600. To gain information on the development of the two strains’ respective cell populations, the relative quantification of the selected strain-exclusive genes was carried out via qPCR. In the case of A. woodii, the gene acsA (Awo_10740), coding for the carbon monoxide dehydrogenase (CODH) catalytic subunit of the bifunctional CO dehydrogenase/acetyl-CoA synthase (ACS) complex was selected as a target. This enzyme plays a central role in CO2 fixation via the Wood-Ljungdahl pathway by catalyzing the reduction of one molecule of CO2 to CO via the CODH subunit, which is subsequently turned into the carbonyl group of acetyl-CoA via the ACS subunit [43,61,62]. Next, qPCR for the aforementioned gene was carried out using the SK_awo_Fwd1 and SK_awo_Rev1 primers, producing a PCR product of 163 base pairs (bp) in length. For P. putida, the gene lpxD (PP_RS08260) coding for the UDP-3-O-(3-hydroxymyristoyl) glucosamine N-acyltransferase enzyme was selected as a genetic target for qPCR. The enzyme plays an important role in the biosynthesis of lipid A and is therefore essential for the formation of lipopolysaccharides (LPSs), which form the external layer of the gram-negative bacterial outer cell membrane [63]. For the qPCR of this gene, the SK_ppu_Fwd1 and SK_ppu_Rev1 primers were used, producing a PCR product with a length of 412 bp. Primer synthesis was conducted using biomers.net GmbH (Ulm, Germany). The sequences of the primers utilized for the PCR processes are provided in Table 2.

Table 2.

Primers used for relative gene quantification via qPCR.

Primer Sequence (5′ → 3′)
SK_awo_Fwd1 GGTCCATGTCGAGTCAGTCC
SK_awo_Rev1 GCGCCATGCATCGCATGAAC
SK_ppu_Fwd1 GGCATCTGGCGCAAGATTGC
SK_ppu_Rev1 CCATGTCGTCCAGGTGGCGG

In all the PCR processes performed within this study, cycling was performed as follows: 2 min at 95 °C followed by 40 cycles of 15 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. The initial verification of the primer performance and specificity was conducted through a conventional PCR process using the isolated genomic DNA (gDNA) of A. woodii [pMTL83251] and P. putida [pVLT3_rhlAB] as templates. To investigate potential unspecific bindings, a PCR was carried out using both primer pairs on each of the bacterial gDNA samples separately. The isolation of bacterial genomic DNA was carried out from 5-mL overnight cultures using the DNeasy® Blood and Tissue Kit (Qiagen, Venlo, Netherlands) according to the handling guidelines provided in the user manual. The resulting PCR products were investigated via electrophoresis in a 1% (w/v) agarose gel.

For the preparation of the qPCR samples, the PowerTrack® SYBR® Green master mix (Thermo Fisher Scientific; Waltham, MA, USA) was used. For each sample, separate PCR reactions were prepared for each of the two used primer pairs. All reactions were carried out in triplicates. Each single reaction was prepared by adding 5 µL of PowerTrack® SYBR® Green Master Mix (Thermo Fisher Scientific Inc., Darmstadt, Germany), 0.5 µL primer working solution (8 µM) of the desired primer pair, and 3.4 µL of DNase-free water to the respective well. As a template material, 1 µL of the desired bacterial culture suspension was mixed with 0.25 µL of Yellow Sample Buffer (provided within the PowerTrack® master mix) and added into the desired well. The qPCR process was carried out using a qTOWER3® Real-time Thermocycler (Analytik Jena, Jena, Germany). A melting curve (60–95 °C at increments of 0.5 °C) was created for each experiment to verify the specificity of the primer amplification. The investigation of the population development of A. woodii [pMTL83251] and P. putida [pVLT31_rhlAB] was realized by comparing the species-specific Ct values of the culture samples to the ones obtained from the measurement of the samples from the pure single cultures of both species with predefined O.600 values from 0.01 to 2.0. From the measurement values of said single-culture samples, an OD600/Ct standard curve was created with Origin®Pro 2021b software (OriginLab Corporation; Northampton, MA, USA) via a nonlinear regression using the function “ExpDec1” with the following Equation (1):

y = A1 × exp(−x/t1) − y0 (1)

This standard curve was subsequently used for the determination of an “OD600 equivalence value” to investigate the OD600 development in the unknown samples indirectly.

2.7. Preservation of the Bacterial Strains

For the preservation of the empty vector strain P. putida [pVLT31] and the rhamnolipid producer strain P. putida [pVLT31_rhlAB], 500 µL of an overnight culture of the respective strain was mixed with a sterile glycerol solution (50% in deionized water (v/v)), transferred into a sterile cryo-tube, and subsequently stored at −80 °C.

3. Results

3.1. Cultivation of the P. putida Strains Using Acetate as a Substrate

Our concept was based on the use of A. woodii as a “feeder strain” and recombinant P. putida as the “producer strain” for the recombinant product of rhamnolipids. Both bacterial strains have well-established growth media, which, however, differ considerably in their composition [39,50,51,54,58]. The intention was to use acetate from A. woodii cell cultures as the source for the growth of P. putida and the production of rhamnolipids in the form of spent medium. Thus, in the first step, the growth behavior of the wild-type strain P. putida KT2440 and the recombinant strains P. putida [pVLT31] and P. putida [pVLT31_rhlAB] was investigated in modified Wilms KPi (the dedicated P. putida medium), modified DSM 135 (the dedicated A. woodii medium), and a 1:1 mixture of both, supplemented with different concentrations of acetate as the carbon source (100, 200, 300, 400, and 500 mM, respectively). Interestingly, the growth of P. putida was drastically reduced in pure, modified DSM 135 medium, with cell densities reaching not more than 50% compared to modified Wilms KPi (Figure 1). Up to a concentration of 200 mM of acetate, the consumption of acetate was complete within the first 30 h of cultivation in both the pure modified Wilms KPi medium and the 1:1 mixture medium, with comparable cell densities for the respective strains. Higher acetate concentrations appeared to inhibit P. putida growth in all the media (Figure 1). The cell densities of P. putida harboring the pVLT31_rhlAB plasmid for the recombinant production of rhamnolipids were, as expected, slightly lower compared to the wild-type and the empty-vector control strain. However, the 1:1 mixture medium had no negative effect on the growth of the cells (Figure 1). The highest rhamnolipid concentration of approximately 400 mg/L was reached within the 1:1 mixture medium after 40 h of cultivation, which is a considerable dimension for this strain in a shake flask experiment without prior optimization (Figure 2) [32,36]. The observed final rhamnolipid concentrations reached within the modified Wilms KPi medium, and the 1:1 mixture medium supplied with either 100 mM or 200 mM of acetate showed no significant difference, indicating that the latter medium also had no negative effect on the recombinant production (Figure 3).

Figure 1.

Figure 1

Growth (continuous lines) and acetate consumption (dashed lines) of the wild-type strain P. putida KT2440 (first row of the figures), the empty vector strain P. putida [pVLT31] (second row of the figures), and the mono-rhamnolipid producing strain P. putida [pVLT31_rhlAB] (third row of the figures). For each strain, cultivation was carried out in modified Wilms KPi medium (first column of the figures) in a 1:1 mixture of modified Wilms KPi medium and modified DSM 135 medium (second column of the figures) and in pure modified DSM 135 medium (third column of the figures). For each combination, cultivation was carried out separately with 100, 200, 300, 400, and 500 mM acetate as the carbon source. The error bars represent the deviations of the biological triplicates.

Figure 2.

Figure 2

Production of mono-rhamnolipids by P. putida [pVLT31_rhlAB] supplemented with 100 mM (red), 200 mM (brown), 300 mM (green), 400 mM (blue), or 500 mM (purple) acetate as the carbon source, respectively. Cultivation was carried out in modified Wilms KPi medium in a 1:1 mixture of modified Wilms KPi medium and modified DSM 135 medium and in pure modified DSM 135 medium. The error bars represent the standard deviation of the biological triplicates.

Figure 3.

Figure 3

Comparison of the mono-rhamnolipid production of P. putida [pVLT31_rhlAB] supplemented with 100 mM (red) and 200 mM (brown) acetate as the carbon source cultivated in pure modified Wilms KPi medium (black grid columns) and in a 1:1 mixture medium of modified Wilms KPi medium and modified DSM 135 medium (white grid columns). The statistical significance of the differences of the rhamnolipid concentrations reached with pure Wilms KPi medium and 1:1 mixture medium is illustrated. The error bars represent the deviations of the biological triplicates. *: p-value > 0.05; ** p-value > 0.01: n.s.: not significant.

3.2. Production of Mono-Rhamnolipids by P. putida [pVLT31_rhlAB] in Cell-Free A. woodii [pMTL83251] Spent Medium

The production of acetate in the “feeding cultures” of A. woodii [pMTL83251] with CO2 + H2 was carried out in a modified DSM 135 medium for 120 h and yielded a final concentration of approximately 150 mM and an OD600 of the cell cultures of typically 1.5–1.7, as expected (Figure S1) [47,50]. After A. woodii cell removal, both the pure spent medium and the spent medium diluted 1:1 with fresh Wilms KPi medium supported the growth of the P. putida [pVLT31_rhlAB] rhamnolipid producer strain (Figure 4a), reaching optical densities of the cell cultures of approximately 2.0 for the 1:1 mixture medium and approximately 2.5 for the pure spent medium containing 75 mM and 150 mM acetate for the 1:1 mixture medium and the pure spent medium, respectively. The acetate concentration after the dilution thus resulted in cell densities comparable to those obtained in the reference experiments with pure acetate as the carbon source in the respective basic media (compare with Figure 1). The same is true for the rhamnolipid production, delivering final concentrations between 300 and 400 mg/L, which are in the same range as in the former experiments (compare with Figure 2). Interestingly, in contrast to the initial experiments where pure DSM 135 medium was less suited for P. putida growth, the pure DSM 135-based spent medium appeared to result in a considerable surplus of cell density and rhamnolipid titer after cultivation for 32, 40, and 48 h (Figure 4b,c). The values of rhamnolipid productivity (mg/L per OD600) generally showed no significant difference between the pure modified DSM-based spent medium cultures and the ones prepared within the 1:1 mixture medium, indicating that dilution with fresh modified Wilms KPi medium does not benefit recombinant rhamnolipid production and can be omitted in this process (Figure 4c).

Figure 4.

Figure 4

Growth (continuous lines) and acetate consumption (dashed lines), (a) mono-rhamnolipid-production (b) and productivity values with the statistical analyses of the productivity differences (c) of P. putida [pVLT31_rhlAB] grown in different shares of cell-free A. woodii [pMTL83251] spent medium. Cultivation was either carried out in pure cell-free spent medium (dark green) obtained from the Awo2 culture (Figure S1) or in a 1:1 mixture of spent medium obtained from the Awo1 culture (Figure S1) and fresh modified Wilms KPi medium (light green) without additional acetate. The error bars represent the standard deviations of the technical triplicates, *: p-value > 0.05; n.s.: not significant.

3.3. Production of Mono-Rhamnolipids by P. putida [pVLT31_rhlAB] in Cell-Containing A. woodii [pMTL83251] Spent Medium (Culture Broth)

The next aim of our proof-of-concept-study presented here was to evaluate whether it was possible to avoid cell removal from the feeder cultures prior to the cultivation of the producer strain for possible future processes, which would represent a considerable simplification of the procedure and in turn an increase in the economical perspective of such sequential production processes [64]. Keeping A. woodii cells in the spent medium, however, poses an experimental difficulty, as the growth of P. putida in such cultures cannot be easily monitored by measuring the optical density. Thus, we decided to instead measure the relative amount of marker genes in the chromosomes of both P. putida and A. woodii referenced by the standard curves of the defined optical density values. P. putida KT2440 is a gram-negative bacterium, therefore it appeared reasonable to choose a gene encoding for a central enzyme of the lipid A biosynthesis as the marker gene, since lipid A is the essential component of lipopolysaccharides in the cell wall of gram-negative bacteria. In contrast, A. woodii is a gram-positive bacterium, thus not containing LPSs. Moreover, A. woodii harbors the Wood-Ljundahl pathway, leading us to choose one of its enzyme genes as the marker gene, allowing us to specifically distinguish A. woodii from P. putida KT2440. Primer pairs were designed resulting in sizes of the intended PCR products of 412 bp for P. putida KT2440 (Figure 5a) and 163 bp for A. woodii (Figure 5b). The specificity of the primer sets was verified after PCR in a traditional agarose gel (Figure S2). Next, standard curves were obtained from serial dilutions of cultures in triplicates, representing optical densities ranging from 0.01 to 2.0 for both strains (Figures S3 and S4). This monitoring principle was tested in a series of experiments with artificial mixtures of both cultures in different ratios from 15:1 to 1:1 (P. putida to A. woodii) and vice versa. Despite relatively high deviations from the calculated to predefined optical densities of up to 33% for a given OD600 of P. putida of 0.3 and a measured/calculated OD600 of 0.2 (i.e., in the range of extremely low cell densities), the measurements were precise enough to reflect the respective predefined amounts of cells and to allow the monitoring of the relative content of both strains along a growth curve of P. putida and a “decay curve” of A. woodii in the presence of P. putida (Figure S5, Table S6).

Figure 5.

Figure 5

Illustration of species-exclusive target genes selected for qPCR. For the detection of the gram-negative bacterium P. putida, the gene lpxD (PP_RS08260) was chosen as the target. The gene encodes UDP-3-O-(3-hydroxymyristoyl) glucosamine N-acyltransferase, which plays an important role in the biosynthesis of lipid A, a central component of lipopolysaccharides (LPSs) commonly found forming the outermost layer of a gram-negative cell wall. (a) The target gene chosen for the detection of A. woodii was acsA (Awo_c10740), which encodes the carbon monoxide dehydrogenase (CODH) subunit of the bifunctional CODH/acetyl-CoA synthase (ACS) enzyme complex. This subunit is responsible for the introduction of one of the two CO2 molecules into the Wood-Ljungdahl pathway (b).

The following key experiment proved the idea that the growth of P. putida and the production of rhamnolipids can be achieved using raw (cell-containing) culture broth of A. woodii cultures; rhamnolipid concentrations of 340 mg/L after 32 h and 366 mg/L after 40 h were obtained compared to 399 mg/L and 414 mg/L, respectively, after 32 and 40 h of cultivation in the cell-free spent medium (Figure 4b and Figure 6b). The number of A. woodii cells measured via qPCR decreased, indicating a disintegration of the cell structure exposing the chromosome to degradation (Figure 6a). Similar to the cultivations conducted in the cell-free spent medium, the productivity was not significantly different for the cultivations in the 1:1 mixture medium and pure cell-containing spent medium (culture broth) (Figure 6c), suggesting again that the dilution step with fresh modified Wilms KPi medium could be circumvented without a loss in the efficiency of recombinant rhamnolipid production. The comparison of the highest final concentrations reached after 32 and 40 h revealed a significant but small difference only after 32 h between the cell-free and cell-containing A. woodii spent medium (Figure 6d). Thus, careful consideration of the advantage of a slightly higher final concentration in cell-free spent medium and the necessity for additional technical efforts for cell separation appears to be reasonable for potential future implementation in real processes.

Figure 6.

Figure 6

Growth of P. putida [pVLT31_rhlAB], decay of A. woodii [pMTL83251], and acetate consumption (dashed lines) (a) as well as mono-rhamnolipid concentrations (b) and productivity values in concentration per OD600, with the statistical significance of the productivity differences (c) in the different shares of cell-containing spent medium of A. woodii [pMTL83251]. The OD600 equivalence (equ.) values were calculated from the data of qPCR for the genes exclusive to the respective bacterial species that were compared to the ones obtained from a standard curve. Cultivation was either carried out in pure cell-containing spent medium (dark blue) obtained from the Awo4 culture (Figure S1) or in a 1:1 mixture of spent medium obtained from the Awo3 culture (Figure S1) and fresh modified Wilms KPi medium (blue) without additional acetate. Further illustrated is a comparison of the overall highest reached concentrations of mono-rhamnolipids, obtained in pure cell-free and cell-containing A. woodii spent medium, with the statistical significance of the concentration differences. (d) The error bars represent the standard deviations of the technical triplicates, *: p-value > 0.05; n.s.: not significant.

4. Discussion

Recently, we introduced acetate as an attractive new and alternative substrate for the recombinant production of rhamnolipids in P. putida KT2440 [40]. In particular, acetate originating from fermentations based on renewable carbon sources, such as anaerobic gas fermentation, has been discussed as probably being the ideal alternative to allow the establishment of sustainable production processes for various biocommodities [45,53,64].

The aim of this project was to demonstrate the possible utilization of acetate-containing spent medium obtained from A. woodii anaerobic gas fermentation as the nutrient source for the growth of P. putida KT2440 and the production of rhamnolipids via a sequential fermentation approach. Although our initial experiments suggested a notably reduced growth of P. putida in the dedicated A. woodii medium DSM 135 supplemented with acetate compared to the modified Wilms KPi medium as the usual P. putida medium, this drawback did not occur in the 1:1 mixture of both media. As described by Hoffmeister et al. (2016) [50], the modified DSM 135 medium was supplemented with a selenite-tungstate solution, which is known to exhibit a beneficial effect on the autotrophic growth of A. woodii. Tungsten is already known to be present in the formate dehydrogenase of other acetogens, such as Moorella thermoacetica [65,66], which is a central enzyme of the Wood-Ljungdahl pathway in all acetogenic bacteria. It has, however, been shown to have toxic effects on different species of Pseudomonas [67,68,69]. The same medium, as the spent medium variant after cultivation of A. woodii, however, worked perfectly to cultivate P. putida, suggesting that the complexation of the heavy metal tungsten in cellular components of the feeder strain removed it from the accessible medium, thereby potentially omitting toxicity toward growing Pseudomonas cells. In light of this fact, our initial reasoning to dilute the spent media with fresh dedicated Pseudomonas medium became, in principle, obsolete. Rhamnolipid production using the recombinant P. putida KT2440 [pVLT31_rhlAB] was possible independent from whether spent medium with or without A. woodii cells was used and concentrations as well as productivities obtained were in a similar range. The total amounts of rhamnolipids of 366–414 mg/L produced after 40 h of cultivation were in the same range of rhamnolipid concentrations observed in previous studies in also unoptimized shake flask experiments with lignocellulose-derived sugars and acetate derived from pyrolysis oil [40].

The concept to use spent media still containing the biomass of the feeder strain A. woodii is accompanied by the difficulty to determine the correct cell densities using simple optical measurements. The qPCR strategy presented here, which was based on the use of primer pairs directed against the genes encoding for essential and exclusive metabolic functions of both A. woodii [pMTL83251] and P. putida [pVLT31_rhlAB], turned out to be suitable for a relatively precise estimation of the content of both cell types simultaneously in the rhamnolipid production cultures. The abundance of A. woodii DNA in the cultures was reduced with cultivation time, suggesting that the cell integrity was compromised and thus the DNA was exposed to degradation. This, however, does not necessarily indicate that A. woodii biomass is consumed in the process as an additional source of nutrients by P. putida for the growth and recombinant production of rhamnolipids. In-depth studies of the consumption of further A. woodii cell components, such as proteins, polysaccharides, and lipids, are urgently required to describe and understand the role of A. woodii biomass in this process.

In summary, our initial experiments presented here represent an important proof of concept that the production of rhamnolipids based on acetate/biomass from anaerobic gas fermentation of the A. woodii feeder strain is possible and reaches reasonable productivities and final concentrations. Nevertheless, there is an enormous space for optimization by bioengineers to set up a real biotechnological process. We thus have added recombinant rhamnolipids to the constantly growing portfolio of value-added commodity chemicals either directly or indirectly produced in cultivations based on gas-fermenting acetogens. We conclude that sequential fermentation processes of this type represent a yet inconceivably high potential for future truly sustainable bioprocesses and will open new avenues towards a successful transformation of human technology into the direction of a decarbonized global industry.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms12030529/s1, Figure S1: Growth (a) and final acetate concentrations (b) of four cultures of A. woodii [pMTL83251] (Awo1–4) after 120 h of cultivation. The red horizontal line represents the average final acetate concentration (153.84 mM) of the four cultures. Figure S2: Visualization of the PCR products obtained using the primer pairs SK_awo_Fwd1+Rev1 (163 bp) and SK_ppu_Fwd1+Rev1 (412 bp) respectively in a 1 % (w/v) agarose gel. To investigate the primers specificity, genomic DNA of both A. woodii and P. putida were used as template material for each of the primer pairs separately. To detect potential contaminations of the used diluent with foreign genomic material, PCR for both primer pairs was additionally carried out with PCR water. *NTC: Non-template control. Figure S3: Results of qPCR with culture suspension of P. putida [pVLT31_rhlAB] with different OD600 values from 0.01 to 2.0 used as template material. The shown data were obtained using the primer pair SK_ppu_Fwd1+Rev1 for specific detection of the lpxD (PP_08260) gene of P. putida KT2440. Curves of matching colour represent technical triplicates (a). The mean Ct values obtained from qPCR were plotted against the corresponding OD600 values to obtain a standard curve via nonlinear regression, using a function corresponding to Equation (1) (b). Figure S4: Results of qPCR with culture suspension of A. woodii [pMTL83251] with different OD600 values from 0.01 to 2.0 used as template material. The shown data were obtained using the primer pair SK_awo_Fwd1+Rev1 for specific detection of the acsA (Awo_c10740) gene of A. woodii. Curves of matching colour represent technical triplicates (a). The mean Ct values obtained from qPCR were plotted against the corresponding OD600 values to obtain a standard curve via nonlinear regression, using a function corresponding to Equation (1) (b). Figure S5: Results of qPCR with mixed cell suspensions of A. woodii [pMTL83251] and P. putida [pVLT31_rhlAB] of different predefined OD600 ratios used as template material (see Table S6). The values were obtained using the primer pairs SK_awo_Fwd1+Rev1 (a) and SK_ppu_Fwd1+Rev1 (b), respectively. Curves of matching colour represent technical triplicates. Table S1: Composition of SL-9 trace element solution (Tschech and Pfennig, 1984) [52] for preparation of the modified DSM 135 medium. Table S2: Composition of vitamin solution (Wolin et al., 1963, modified) [53] for preparation of the modified DSM 135 medium. Table S3: Composition of selenite-tungstate solution (Tschech and Pfennig, 1984) [53] for preparation of the modified DSM 135 medium. Table S4: Composition of the trace element solution (Wilms et al., 2001) [54] for preparation of modified Wilms KPi medium. Table S5: Composition of S.O.C. medium used for cell regeneration of P. putida KT2440 after transformation with plasmids pVLT31 and pVLT31_rhlAB. Table S6: Results of OD600 calculation from Ct values obtained from qPCR with predefined A.woodii/P. putida mixtures of different OD600 ratios used as template material. Also shown are the respective percental deviations of the calculated OD600 values from the actual ones. Values of standard deviation refer to technical triplicates.

Author Contributions

Conceptualization, P.D. and F.R.; Methodology, J.W. and S.K.; Validation, S.K. and A.-K.K.; Formal analysis, J.W.; Investigation, J.W., A.W., S.K., M.K., F.H., M.H., R.H., F.R.B. and B.J.E.; Resources, F.R.; Data curation, J.W. and S.K.; Writing—original draft, J.W., S.K., A.-K.K. and F.R.; Writing—review & editing, A.W., A.-K.K., F.H., T.B., T.W., M.H., R.H., F.R.B., B.J.E., P.D. and F.R.; Visualization, A.-K.K.; Supervision, F.R.; Project administration, F.R.; Funding acquisition, F.R. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data can be requested from the authors for valid reasons.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This work was supported by grants from the Ministry of Science, Research, and the Arts of Baden-Württemberg (MWK; Förderkennzeichen: 7533-10-5-186A and 7533-10-5-190).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Nikolova C., Gutierrez T. Biosurfactants and Their Applications in the Oil and Gas Industry: Current State of Knowledge and Future Perspectives. Front. Bioeng. Biotechnol. 2021;9:626639. doi: 10.3389/fbioe.2021.626639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Nagtode V.S., Cardoza C., Yasin H.K.A., Mali S.N., Tambe S.M., Roy P., Singh K., Goel A., Amin P.D., Thorat B.R., et al. Green Surfactants (Biosurfactants): A Petroleum-Free Substitute for Sustainability—Comparison, Applications, Market, and Future Prospects. ACS Omega. 2023;8:11674–11699. doi: 10.1021/acsomega.3c00591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ceresa C., Fracchia L., Sansotera A.C., De Rienzo M.A.D., Banat I.M. Harnessing the Potential of Biosurfactants for Biomedical and Pharmaceutical Applications. Pharmaceutics. 2023;15:2156. doi: 10.3390/pharmaceutics15082156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.da Silva A.F., Banat I.M., Giachini A.J., Robl D. Fungal Biosurfactants, from Nature to Biotechnological Product: Bioprospection, Production and Potential Applications. Bioprocess Biosyst. Eng. 2021;44:2003–2034. doi: 10.1007/s00449-021-02597-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Eras-Muñoz E., Farré A., Sánchez A., Font X., Gea T. Microbial Biosurfactants: A Review of Recent Environmental Applications. Bioengineered. 2022;13:12365–12391. doi: 10.1080/21655979.2022.2074621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Nitschke M., Costa S.G.V.A.O., Contiero J. Rhamnolipid Surfactants: An Update on the General Aspects of These Remarkable Biomolecules. Biotechnol. Prog. 2005;21:1593–1600. doi: 10.1021/bp050239p. [DOI] [PubMed] [Google Scholar]
  • 7.Wittgens A., Tiso T., Arndt T.T., Wenk P., Hemmerich J., Müller C., Wichmann R., Küpper B., Zwick M., Wilhelm S., et al. Growth Independent Rhamnolipid Production from Glucose Using the Non-Pathogenic Pseudomonas putida KT2440. Microb. Cell Fact. 2011;10:80. doi: 10.1186/1475-2859-10-80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Lang S., Wullbrandt D. Rhamnose Lipids—Biosynthesis, Microbial Production and Application Potential. Appl. Microbiol. Biotechnol. 1999;51:22–32. doi: 10.1007/s002530051358. [DOI] [PubMed] [Google Scholar]
  • 9.Maier R.M., Soberón-Chávez G. Pseudomonas aeruginosa Rhamnolipids: Biosynthesis and Potential Applications. Appl. Microbiol. Biotechnol. 2000;54:625–633. doi: 10.1007/s002530000443. [DOI] [PubMed] [Google Scholar]
  • 10.Irorere V.U., Tripathi L., Marchant R., McClean S., Banat I.M. Microbial Rhamnolipid Production: A Critical Re-Evaluation of Published Data and Suggested Future Publication Criteria. Appl. Microbiol. Biotechnol. 2017;101:3941–3951. doi: 10.1007/s00253-017-8262-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Fracchia L., Ceresa C., Franzetti A., Cavallo M., Gandolfi I., Van Hamme J., Gkorezis P., Marchant R., Banat I.M. Biosurfactants. CRC Press; Boca Raton, FL, USA: 2014. Biological Applications of Biosurfactants and Strategies to Potentiate Commercial Production; pp. 280–305. [Google Scholar]
  • 12.Gautam K.K., Tyagi V.K. Microbial Surfactants: A Review. J. Oleo Sci. 2006;55:155–166. doi: 10.5650/jos.55.155. [DOI] [Google Scholar]
  • 13.Rahman P.K.S.M., Gakpe E. Production, Characterisation and Applications of Biosurfactants—Review. Biotechnology. 2008;7:360–370. doi: 10.3923/biotech.2008.360.370. [DOI] [Google Scholar]
  • 14.Desai J.D., Banat I.M. Microbial Production of Surfactants and Their Commercial Potential. Microbiol. Mol. Biol. Rev. 1997;61:47–64. doi: 10.1128/mmbr.61.1.47-64.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Abalos A., Pinazo A., Infante M.R., Casals M., García F., Manresa A. Physicochemical and Antimicrobial Properties of New Rhamnolipids Produced by Pseudomonas aeruginosa AT10 from Soybean Oil Refinery Wastes. Langmuir. 2001;17:1367–1371. doi: 10.1021/la0011735. [DOI] [Google Scholar]
  • 16.Soberón-Chávez G., Lépine F., Déziel E. Production of Rhamnolipids by Pseudomonas aeruginosa. Appl. Microbiol. Biotechnol. 2005;68:718–725. doi: 10.1007/s00253-005-0150-3. [DOI] [PubMed] [Google Scholar]
  • 17.Déziel E., Lépine F., Dennie D., Boismenu D., Mamer O.A., Villemur R. Liquid Chromatography/Mass Spectrometry Analysis of Mixtures of Rhamnolipids Produced by Pseudomonas aeruginosa Strain 57RP Grown on Mannitol or Naphthalene. Biochim. Biophys. Acta (BBA)—Mol. Cell Biol. Lipids. 1999;1440:244–252. doi: 10.1016/S1388-1981(99)00129-8. [DOI] [PubMed] [Google Scholar]
  • 18.Toribio J., Escalante A.E., Soberón-Chávez G. Rhamnolipids: Production in Bacteria Other than Pseudomonas aeruginosa. Eur. J. Lipid Sci. Technol. 2010;112:1082–1087. doi: 10.1002/ejlt.200900256. [DOI] [Google Scholar]
  • 19.Abdel-Mawgoud A.M., Lépine F., Déziel E. Rhamnolipids: Diversity of Structures, Microbial Origins and Roles. Appl. Microbiol. Biotechnol. 2010;86:1323–1336. doi: 10.1007/s00253-010-2498-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Jarvis F.G., Johnson M.J. A Glycolipide Produced by Pseudomonas aeruginosa. J. Am. Chem. Soc. 1949;71:4124–4126. doi: 10.1021/ja01180a073. [DOI] [Google Scholar]
  • 21.Shreve G.S., Makula R. Characterization of a New Rhamnolipid Biosurfactant Complex from Pseudomonas Isolate DYNA270. Biomolecules. 2019;9:885. doi: 10.3390/biom9120885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shi S., Teng Z., Liu J., Li T. Conversion of Waste Cooking Oil to Rhamnolipid by a Newly Oleophylic Pseudomonas aeruginosa WO2. Int. J. Environ. Res. Public Health. 2022;19:1700. doi: 10.3390/ijerph19031700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chong H., Li Q. Microbial Production of Rhamnolipids: Opportunities, Challenges and Strategies. Microb. Cell Fact. 2017;16:137. doi: 10.1186/s12934-017-0753-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li Z., Zhang Y., Lin J., Wang W., Li S. High-Yield Di-Rhamnolipid Production by Pseudomonas aeruginosa YM4 and Its Potential Application in MEOR. Molecules. 2019;24:1433. doi: 10.3390/molecules24071433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Soberón-Chávez G., González-Valdez A., Soto-Aceves M.P., Cocotl-Yañez M. Rhamnolipids Produced by Pseudomonas: From Molecular Genetics to the Market. Microb. Biotechnol. 2021;14:136–146. doi: 10.1111/1751-7915.13700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Dulcey C.E., López de los Santos Y., Létourneau M., Déziel E., Doucet N. Semi-rational Evolution of the 3-(3-hydroxyalkanoyloxy)Alkanoate (HAA) Synthase RhlA to Improve Rhamnolipid Production in Pseudomonas aeruginosa and Burkholderia glumae. FEBS J. 2019;286:4036–4059. doi: 10.1111/febs.14954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Häuβler S., Rohde M., von Neuhoff N., Nimtz M., Steinmetz I. Structural and Functional Cellular Changes Induced by Burkholderia Pseudomallei Rhamnolipid. Infect. Immun. 2003;71:2970–2975. doi: 10.1128/IAI.71.5.2970-2975.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Bzdyl N.M., Moran C.L., Bendo J., Sarkar-Tyson M. Pathogenicity and Virulence of Burkholderia Pseudomallei. Virulence. 2022;13:1945–1965. doi: 10.1080/21505594.2022.2139063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kim N., Mannaa M., Kim J., Ra J.-E., Kim S.-M., Lee C., Lee H.-H., Seo Y.-S. The In Vitro and in Planta Interspecies Interactions among Rice-Pathogenic Burkholderia Species. Plant Dis. 2021;105:134–143. doi: 10.1094/PDIS-06-20-1252-RE. [DOI] [PubMed] [Google Scholar]
  • 30.Costa S.G.V.A.O., Déziel E., Lépine F. Characterization of Rhamnolipid Production by Burkholderia glumae. Lett. Appl. Microbiol. 2011;53:620–627. doi: 10.1111/j.1472-765X.2011.03154.x. [DOI] [PubMed] [Google Scholar]
  • 31.Ortega L., Rojas C.M. Bacterial Panicle Blight and Burkholderia glumae: From Pathogen Biology to Disease Control. Phytopathology. 2021;111:772–778. doi: 10.1094/PHYTO-09-20-0401-RVW. [DOI] [PubMed] [Google Scholar]
  • 32.Ochsner U.A., Fiechter A., Reiser J. Isolation, Characterization, and Expression in Escherichia coli of the Pseudomonas aeruginosa RhlAB Genes Encoding a Rhamnosyltransferase Involved in Rhamnolipid Biosurfactant Synthesis. J. Biol. Chem. 1994;269:19787–19795. doi: 10.1016/S0021-9258(17)32089-6. [DOI] [PubMed] [Google Scholar]
  • 33.Pearson J.P., Pesci E.C., Iglewski B.H. Roles of Pseudomonas aeruginosa Las and Rhl Quorum-Sensing Systems in Control of Elastase and Rhamnolipid Biosynthesis Genes. J. Bacteriol. 1997;179:5756–5767. doi: 10.1128/jb.179.18.5756-5767.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Nickzad A., Lépine F., Déziel E. Quorum Sensing Controls Swarming Motility of Burkholderia glumae through Regulation of Rhamnolipids. PLoS ONE. 2015;10:e0128509. doi: 10.1371/journal.pone.0128509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Müller M.M., Hausmann R. Regulatory and Metabolic Network of Rhamnolipid Biosynthesis: Traditional and Advanced Engineering towards Biotechnological Production. Appl. Microbiol. Biotechnol. 2011;91:251–264. doi: 10.1007/s00253-011-3368-2. [DOI] [PubMed] [Google Scholar]
  • 36.Ochsner U.A., Reiser J., Fiechter A., Witholt B. Production of Pseudomonas aeruginosa Rhamnolipid Biosurfactants in Heterologous Hosts. Appl. Environ. Microbiol. 1995;61:3503–3506. doi: 10.1128/aem.61.9.3503-3506.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Nelson K.E., Weinel C., Paulsen I.T., Dodson R.J., Hilbert H., Martins dos Santos V.A.P., Fouts D.E., Gill S.R., Pop M., Holmes M., et al. Complete Genome Sequence and Comparative Analysis of the Metabolically Versatile Pseudomonas putida KT2440. Environ. Microbiol. 2002;4:799–808. doi: 10.1046/j.1462-2920.2002.00366.x. [DOI] [PubMed] [Google Scholar]
  • 38.Tiso T., Wierckx N., Blank L.M. In: Non-Pathogenic Pseudomonas as Platform for Industrial Biocatalysts. Grunwald P., editor. Jenny Stanford Publishing; Dubai, United Arab Emirates: 2014. [Google Scholar]
  • 39.Wang Y., Horlamus F., Henkel M., Kovacic F., Schläfle S., Hausmann R., Wittgens A., Rosenau F. Growth of Engineered Pseudomonas putida KT2440 on Glucose, Xylose, and Arabinose: Hemicellulose Hydrolysates and Their Major Sugars as Sustainable Carbon Sources. GCB Bioenergy. 2019;11:249–259. doi: 10.1111/gcbb.12590. [DOI] [Google Scholar]
  • 40.Arnold S., Henkel M., Wanger J., Wittgens A., Rosenau F., Hausmann R. Heterologous Rhamnolipid Biosynthesis by P. putida KT2440 on Bio-Oil Derived Small Organic Acids and Fractions. AMB Express. 2019;9:80. doi: 10.1186/s13568-019-0804-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Drake H.L., Daniel S.L., Matthies C., Küsel K. Acetogenesis. Springer; Boston, MA, USA: 1994. Acetogenesis, Acetogenic Bacteria, and the Acetyl-CoA “Wood/Ljungdahl” Pathway: Past and Current Perspectives; pp. 3–60. [Google Scholar]
  • 42.Drake H.L., Gößner A.S., Daniel S.L. Old Acetogens, New Light. Ann. N. Y. Acad. Sci. 2008;1125:100–128. doi: 10.1196/annals.1419.016. [DOI] [PubMed] [Google Scholar]
  • 43.Ragsdale S.W., Pierce E. Acetogenesis and the Wood–Ljungdahl Pathway of CO2 Fixation. Biochim. Biophys. Acta (BBA)—Proteins Proteom. 2008;1784:1873–1898. doi: 10.1016/j.bbapap.2008.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Bengelsdorf F.R., Dürre P. Gas Fermentation for Commodity Chemicals and Fuels. Microb. Biotechnol. 2017;10:1167–1170. doi: 10.1111/1751-7915.12763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Müller V. Energy Conservation in Acetogenic Bacteria. Appl. Environ. Microbiol. 2003;69:6345–6353. doi: 10.1128/AEM.69.11.6345-6353.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Poehlein A., Schmidt S., Kaster A.-K., Goenrich M., Vollmers J., Thürmer A., Bertsch J., Schuchmann K., Voigt B., Hecker M., et al. An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis. PLoS ONE. 2012;7:e33439. doi: 10.1371/journal.pone.0033439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Abubackar H.N., Bengelsdorf F.R., Dürre P., Veiga M.C., Kennes C. Improved Operating Strategy for Continuous Fermentation of Carbon Monoxide to Fuel-Ethanol by Clostridia. Appl. Energy. 2016;169:210–217. doi: 10.1016/j.apenergy.2016.02.021. [DOI] [Google Scholar]
  • 48.Phillips J.R., Atiyeh H.K., Tanner R.S., Torres J.R., Saxena J., Wilkins M.R., Huhnke R.L. Butanol and Hexanol Production in Clostridium Carboxidivorans Syngas Fermentation: Medium Development and Culture Techniques. Bioresour. Technol. 2015;190:114–121. doi: 10.1016/j.biortech.2015.04.043. [DOI] [PubMed] [Google Scholar]
  • 49.Ramió-Pujol S., Ganigué R., Bañeras L., Colprim J. Incubation at 25 °C Prevents Acid Crash and Enhances Alcohol Production in Clostridium Carboxidivorans P7. Bioresour. Technol. 2015;192:296–303. doi: 10.1016/j.biortech.2015.05.077. [DOI] [PubMed] [Google Scholar]
  • 50.Hoffmeister S., Gerdom M., Bengelsdorf F.R., Linder S., Flüchter S., Öztürk H., Blümke W., May A., Fischer R.-J., Bahl H., et al. Acetone Production with Metabolically Engineered Strains of Acetobacterium woodii. Metab. Eng. 2016;36:37–47. doi: 10.1016/j.ymben.2016.03.001. [DOI] [PubMed] [Google Scholar]
  • 51.Mook A., Beck M.H., Baker J.P., Minton N.P., Dürre P., Bengelsdorf F.R. Autotrophic Lactate Production from H2 + CO2 Using Recombinant and Fluorescent FAST-Tagged Acetobacterium woodii Strains. Appl. Microbiol. Biotechnol. 2022;106:1447–1458. doi: 10.1007/s00253-022-11770-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Geinitz B., Hüser A., Mann M., Büchs J. Gas Fermentation Expands the Scope of a Process Network for Material Conversion. Chem. Ing. Tech. 2020;92:1665–1679. doi: 10.1002/cite.202000086. [DOI] [Google Scholar]
  • 53.Schuchmann K., Müller V. Autotrophy at the Thermodynamic Limit of Life: A Model for Energy Conservation in Acetogenic Bacteria. Nat. Rev. Microbiol. 2014;12:809–821. doi: 10.1038/nrmicro3365. [DOI] [PubMed] [Google Scholar]
  • 54.Arslan K., Schoch T., Höfele F., Herrschaft S., Oberlies C., Bengelsdorf F., Veiga M.C., Dürre P., Kennes C. Engineering Acetobacterium woodii for the Production of Isopropanol and Acetone from Carbon Dioxide and Hydrogen. Biotechnol. J. 2022;17:2100515. doi: 10.1002/biot.202100515. [DOI] [PubMed] [Google Scholar]
  • 55.Bertani G. Studies on Lysogenesis. I. The Mode of Phage Liberation by Lysogenic Escherichia coli. J. Bacteriol. 1951;62:293–300. doi: 10.1128/jb.62.3.293-300.1951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Tschech A., Pfennig N. Growth Yield Increase Linked to Caffeate Reduction in Acetobacterium woodii. Arch. Microbiol. 1984;137:163–167. doi: 10.1007/BF00414460. [DOI] [Google Scholar]
  • 57.Wolin E.A., Wolin M.J., Wolfe R.S. Formation of Methane by Bacterial Extracts. J. Biol. Chem. 1963;238:2882–2886. doi: 10.1016/S0021-9258(18)67912-8. [DOI] [PubMed] [Google Scholar]
  • 58.Wilms B., Hauck A., Reuss M., Syldatk C., Mattes R., Siemann M., Altenbuchner J. High-cell-density Fermentation for Production of L-carbamoylase Using an Expression System Based on the Escherichia coli RhaBAD Promoter. Biotechnol. Bioeng. 2001;73:95–103. doi: 10.1002/bit.1041. [DOI] [PubMed] [Google Scholar]
  • 59.de Lorenzo V., Eltis L., Kessler B., Timmis K.N. Analysis of Pseudomonas Gene Products Using LacIq/Ptrp-Lac Plasmids and Transposons That Confer Conditional Phenotypes. Gene. 1993;123:17–24. doi: 10.1016/0378-1119(93)90533-9. [DOI] [PubMed] [Google Scholar]
  • 60.Heap J.T., Pennington O.J., Cartman S.T., Minton N.P. A Modular System for Clostridium Shuttle Plasmids. J. Microbiol. Methods. 2009;78:79–85. doi: 10.1016/j.mimet.2009.05.004. [DOI] [PubMed] [Google Scholar]
  • 61.Shin J., Song Y., Jeong Y., Cho B.-K. Analysis of the Core Genome and Pan-Genome of Autotrophic Acetogenic Bacteria. Front. Microbiol. 2016;7:1531. doi: 10.3389/fmicb.2016.01531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Ragsdale S.W. Nickel and the Carbon Cycle. J. Inorg. Biochem. 2007;101:1657–1666. doi: 10.1016/j.jinorgbio.2007.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Buetow L., Smith T.K., Dawson A., Fyffe S., Hunter W.N. Structure and Reactivity of LpxD, the N-Acyltransferase of Lipid A Biosynthesis. Proc. Natl. Acad. Sci. USA. 2007;104:4321–4326. doi: 10.1073/pnas.0606356104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Stark C., Münßinger S., Rosenau F., Eikmanns B.J., Schwentner A. The Potential of Sequential Fermentations in Converting C1 Substrates to Higher-Value Products. Front. Microbiol. 2022;13:907577. doi: 10.3389/fmicb.2022.907577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Ljungdahl L.G., Andreesen J.R. Formate Dehydrogenase, a Selenium-Tungsten Enzyme from Clostridium thermoaceticum. Methods Enzymol. 1978;53:360–372. doi: 10.1016/s0076-6879(78)53042-5. [DOI] [PubMed] [Google Scholar]
  • 66.Martin W., Russell M.J. On the Origin of Biochemistry at an Alkaline Hydrothermal Vent. Philos. Trans. R. Soc. B Biol. Sci. 2007;362:1887–1926. doi: 10.1098/rstb.2006.1881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Popov A.L., Zholobak N.M., Balko O.I., Balko O.B., Shcherbakov A.B., Popova N.R., Ivanova O.S., Baranchikov A.E., Ivanov V.K. Photo-Induced Toxicity of Tungsten Oxide Photochromic Nanoparticles. J. Photochem. Photobiol. B. 2018;178:395–403. doi: 10.1016/j.jphotobiol.2017.11.021. [DOI] [PubMed] [Google Scholar]
  • 68.Matharu R.K., Ciric L., Ren G., Edirisinghe M. Comparative Study of the Antimicrobial Effects of Tungsten Nanoparticles and Tungsten Nanocomposite Fibres on Hospital Acquired Bacterial and Viral Pathogens. Nanomaterials. 2020;10:1017. doi: 10.3390/nano10061017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Strigul N., Koutsospyros A., Arienti P., Christodoulatos C., Dermatas D., Braida W. Effects of Tungsten on Environmental Systems. Chemosphere. 2005;61:248–258. doi: 10.1016/j.chemosphere.2005.01.083. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The data can be requested from the authors for valid reasons.


Articles from Microorganisms are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES