Abstract
There is growing interest in telomere length as an indicator of current and future health. Although early childhood is a period of rapid telomere attrition, little is known about the factors that influence telomere biology during this time. Adult research suggests that telomere length is influenced by psychological characteristics. This study’s goal was to test associations among repeated measures of temperament and telomere length in a community sample of children (N = 602; 52% male, 73% non-Hispanic White, middle to high socioeconomic status) from infancy to age 3 years. Relative telomere length was assessed from DNA in saliva samples collected at infancy (M = 8.4 months), 2 years (M = 24.9 months), and 3 years (M = 37.8 months). Temperament was assessed via maternal-report questionnaires administered at infancy (Infant Behavior Report Questionnaire-Revised) and ages 2 and 3 years (Early Childhood Behavior Questionnaire). Temperament was operationalized two ways: using the established domains of negative affectivity, surgency/extraversion, and regulation/effortful control; and utilizing person-centered scores that identified three groups of children with similar profiles across domains (emotionally and behaviorally regulated, emotionally and behaviorally dysregulated, introverted and overcontrolled). Analyses revealed that greater regulation/effortful control was associated with longer telomere length across timepoints. Additionally, higher surgency/extraversion, beginning in infancy, was associated with decreased rate of telomere attrition. There were no sex differences in the relations between temperament and telomere measures. These findings suggest that, as early as infancy, temperament may influence telomere biology, with a potential protective effect of positive temperament characteristics on telomere erosion.
Keywords: telomere, temperament, early childhood, longitudinal, development
Psychological characteristics have been associated with differential risk for a number of disease states and earlier mortality. A state of “accelerated aging” has been proposed as a mechanism that may be responsible for associations of psychological functioning with adverse health outcomes (Lindqvist et al., 2015). Cellular aging is measurable in telomeres, repeating nucleotide sequences of variable number that protect against chromosome deterioration and regulate cellular and tissue function (Blackburn & Gall, 1978). Shorter telomere length has been associated with chromosomal instability and is predictive of the development of chronic physical diseases and mental health disorders throughout life, abnormalities in brain structure and functioning, and earlier mortality (Geronimus et al., 2015; Hochstrasser et al., 2012; Rode et al., 2015). Moreover, the biological pathways hypothesized to link psychological characteristics and poor physical and mental health outcomes—particularly dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis, metabolic stress, and increased oxidative stress and inflammation—have been implicated in decreased production of telomerase, a cellular holoenzyme responsible for the maintenance of telomeric integrity, and in accelerated telomere erosion (Epel, 2009; Van den Bergh et al., 2017; Verhoeven et al., 2014). Thus, there is increasing interest in explicating the influence of psychological factors on telomere biology.
Psychological Traits and Telomere Length: Developmental Considerations
Elucidating the role of psychological factors on telomere biology in the first years of life may be particularly important given the uneven nature of telomere attrition processes across the lifespan, the impact of telomere shortening in early development on lifelong telomere biology, and the heightened vulnerability of telomeres to erosion processes during this developmental window. More specifically, data suggest that telomere erosion occurs most rapidly in the first years of life and that telomere biology may be particularly vulnerable to the effects of emotional dysregulation in early development (Bosquet Enlow et al., 2020; Frenck et al., 1998; Rufer et al., 1999; Sidorov et al., 2009; Zeichner et al., 1999). Further, telomere length at any given timepoint is determined by initial telomere length and subsequent attrition. Consequently, telomere loss in early childhood may have impact on physical and mental health outcomes across the lifespan (Bosquet Enlow et al., 2018), with accelerated telomere attrition in the first years mechanistically contributing to diseases of aging hypothesized to originate in early development (Wadhwa et al., 2009). Thus, elucidating early childhood psychological characteristics that influence telomere biology may have significant implications for developmentally informed models of disease and wellness. Moreover, given the unique nature of telomere length dynamics in early life, the manner in which psychological factors relate to telomere length during this specific developmental period may differ from that in later childhood and adulthood, further emphasizing the need for research in this area during the first three years.
Early Life Psychological Traits: Temperament
Presently, relations between psychological traits and telomere biology in childhood are largely unknown. Exploring relations between temperament and telomere biology in the first years of life may prove to be a fruitful line of inquiry for understanding potential effects of psychological characteristics in early childhood on telomere attrition. Temperament has been defined as constitutionally based individual differences in reactivity (e.g., arousability of emotional, motor, and attentional responses) and self-regulation (processes that modulate reactivity) that emerge in infancy, are relatively stable, and underlie expressions of stress reactivity, emotionality, and sociability (Gartstein & Rothbart, 2003; Stifter & Dollar, 2016). Researchers have identified three main temperament domains, observable across cultural contexts: negative affectivity, surgency/extraversion, and regulation/effortful control (Ahadi et al., 1993; Rothbart et al., 2000). Negative affectivity reflects the tendency to express negative emotions (anger, fear, sadness); surgency/extraversion encompasses approach behaviors, activity level, and impulsivity; and regulation/effortful control includes the ability to control attention and behavior (Rothbart & Bates, 2007).
Importantly, these domains do not exist in isolation and likely act jointly to influence developmental outcomes. Recent work has identified three distinct combinations of these temperament domains that categorize young children into the following profiles: emotionally and behaviorally regulated (high surgency/extraversion and regulation/effortful control, low negative affectivity); emotionally and behaviorally dysregulated (high negative affectivity, moderate surgency/extraversion, low regulation/effortful control); and introverted and overcontrolled (moderate to high negative affectivity, low surgency/extraversion, moderate to high regulation/effortful control) (Xie et al., 2022). Research examining associations between child temperament and telomere biology may benefit from considering both a domain approach and a profile approach to operationalizing temperament.
Temperament and Telomere Length: Supportive Evidence
Although studies have not explored associations between child temperament and telomere measures, research in other domains suggest possible relations.
Personality and Telomere Length
Early measures of temperament may represent precursors of later personality characteristics (Wright & Jackson, 2022), and adult studies suggest that different domains of personality are associated with telomere length and attrition. More specifically, personality traits characterized by elevated negative affectivity (e.g., higher neuroticism, negative affectivity, social inhibition, interpersonal sensitivity, defensiveness, pessimism; lower agreeableness) have been associated with shorter telomere length or greater telomere erosion over time (O’Donovan et al., 2009; Schoormans et al., 2018; Starnino et al., 2016; Suzuki et al., 2017; van Ockenburg et al., 2014). Conversely, positive psychological dispositional traits (e.g., greater optimism, conscientiousness, hardiness, harm avoidance) have been associated with longer telomere length (Sadahiro et al., 2015; Schutte et al., 2016; Zerach et al., 2020). Moreover, one study showed that conscientiousness in childhood predicted longer telomere length 40 years later (Edmonds et al., 2015).
Physiological Reactivity and Telomere Length
There is evidence that temperament domains are differentially associated with physiological measures of stress reactivity that have been implicated in telomere erosion processes. For example, in early infancy, negative affectivity has been associated with poorer cortisol recovery, and surgency/extraversion and regulation with better cortisol recovery following a stressor (Bajgarova & Bajgar, 2020). Greater surgency/extraversion has been linked to greater physiological reactivity to the environment in the toddler period, as reflected in higher diurnal cortisol output (Tervahartiala et al., 2021). Associations between greater surgency/extraversion and cortisol output may be particularly robust in children also low in effortful control (Donzella et al., 2000). A number of studies have demonstrated concurrent and longitudinal associations between parasympathetic reactivity and measures of emotional, attentional, and behavioral regulation across early childhood, beginning in the newborn period (Calkins & Fox, 2002; Huffman et al., 1998; Jones et al., 2018). Additionally, greater baseline parasympathetic activity has been associated with higher levels of negative affectivity in infancy and surgency/extraversion in the preschool period (Lee & Doan, 2020; Perry et al., 2018).
Further, limited evidence in children suggests that physiological stress reactivity may be associated with telomere length. For example, in a sample of 5- to 6-year-old children, those with a profile of heightened stress reactivity, as reflected by high sympathetic reactivity and parasympathetic withdrawal and high cortisol reactivity in response to a laboratory challenge, had shorter telomere length than children without this profile (Kroenke et al., 2011). These findings are supported by research in adults that suggests that disruptions in physiological stress reactivity may be responsible for associations of psychological characteristics with telomere length (Dolbier et al., 2001; Huzen et al., 2010; Sandvik et al., 2013; Wolkowitz et al., 2011; Zerach et al., 2020). For example, negative personality characteristics have been associated with higher levels of systemic inflammation and increased oxidative stress, and positive characteristics have been associated with more optimal functioning of stress-related biological systems (Dolbier et al., 2001; Huzen et al., 2010; Sandvik et al., 2013; Zerach et al., 2020). Some have posited that positive personality characteristics dampen activation of the sympathetic nervous system and the HPA axis, having downstream effects on telomere attrition rate (Zerach et al., 2020). Together, these data suggest that psychological characteristics, beginning in childhood, may influence telomere biology via individual differences in physiological stress reactivity.
Mental Health and Telomere Length
There is a growing literature linking other psychological characteristics, particularly various forms of psychopathology (e.g., depression, anxiety, PTSD, bipolar disorder, schizophrenia, ADHD), to shortened telomere length (Corfdir et al., 2021; Costa et al., 2015; Humphreys et al., 2020; Révész et al., 2016; Ridout et al., 2016; Shalev et al., 2014; Squassina et al., 2017). Although such studies have been primarily in adults, there is a limited literature in young children. For example, a study examining associations among prenatal exposure to tobacco, infant telomere attrition, and ADHD symptoms found that, among infants of mothers who reported prenatal smoking, higher ADHD scores at 18 months were associated with less telomere erosion from ages 4 to 18 months (Howell et al., 2022). Another analysis using this same sample found that, among infants whose mothers reported higher childhood adversity scores, higher levels of child externalizing problems at 18 months were associated with greater telomere attrition between 4 and 18 months (Esteves et al., 2020). In a study of preschool aged children, oppositional defiant behavior at ages 3, 4, or 5 years was associated with shorter telomere length at ages 4 and 5 years (Wojcicki et al., 2015). Finally, in a study of 3- to 5-year-old children, half of whom had experienced recent maltreatment, there was a positive association between internalizing symptoms and telomere length measured concurrently and again 6 months later (Ridout et al., 2019), whereas another study of 5- to 6-year-old children found a negative association between internalizing symptoms and telomere length (Kroenke et al., 2011).
Relatedly, child temperament measures have been associated with risk for mental health difficulties. For example, higher negative affectivity increases risk for internalizing and externalizing problems, whereas higher regulation/effortful control is protective against these outcomes (Eisenberg et al., 2010; Gartstein et al., 2012; Xie et al., 2022). Surgency/extraversion has shown a mixed pattern: Heightened levels have been associated with both greater self-regulation and externalizing problems/ADHD, with evidence that the nature of associations may vary by age at temperament assessment (Casalin et al., 2012; Foss, So, et al., 2022; Komsi et al., 2006; Putnam et al., 2008). When temperament is defined by profile group, group membership is differentially associated with risk for later internalizing and externalizing problems, with children in the emotionally and behaviorally regulated group at lowest risk (Xie et al., 2022). Given the strands of research linking temperament, personality, mental health, stress physiology, and telomere biology across the lifespan, associations between temperament and psychopathology risk may indicate a shared underlying diathesis that influences telomere biology in early life. Notably, temperament characteristics may demonstrate varying degrees of stability across time and predictive ability of later outcomes, depending on the specific temperament domain and age of assessment (Xie et al., 2022). Thus, examinations of associations between temperament and telomere length in early life should include assessments at multiple ages (infancy, toddlerhood, preschool period).
Sex-specific Effects
Sex assigned at birth may be an important moderator of associations between psychological functioning and telomere biology. Sex differences in telomere length and attrition rate have been documented throughout the lifespan, beginning at birth, with females consistently showing longer telomere length than males (Bosquet Enlow et al., 2020; Lansdorp, 2022; Ly et al., 2019). Further, telomeres may be differentially susceptible to the effects of psychosocial exposures in males versus females beginning in utero, with males frequently showing greater vulnerability to exposure effects on accelerated telomere erosion (Bosquet Enlow et al., 2018; Zalli et al., 2014). Additionally, in adults, some studies find associations of psychological characteristics with telomere length among males only, others among females only, and yet others in opposite directions by gender (Needham et al., 2015; Savolainen et al., 2015; Shalev et al., 2014; Whisman & Richardson, 2017). Studies examining the role of sex as a moderator of associations between psychological factors and telomere length in children are lacking. Sex-specificity in relations between psychological functioning and telomere biology may contribute to documented sex disparities in mental and physical health outcomes across the lifespan and thus should be explored in studies of children.
The Current Study
The primary goal of the current study was to examine associations of temperament with telomere length and attrition rate in a community sample of children during the first 3 years of life. Specifically, we tested (a) whether the established temperament domain traits of negative affectivity, surgency/extraversion, and regulation/effortful control in infancy and at ages 2 and 3 years were associated with measures of telomere length or telomere attrition rate from infancy to age 3 years; (b) whether more newly developed temperament profiles (Xie et al., 2022) were associated with measures of telomere length or telomere attrition rate from infancy to age 3 years; and (c) whether associations of temperament and telomere measures showed sex-specific effects. We hypothesized that the following temperament characteristics would be associated with shorter telomere length and increased rate of telomere attrition in early childhood: higher levels of negative affectivity; belonging to the temperament profile group of emotionally and behaviorally dysregulated or introverted and over-controlled. We further hypothesized that the following temperament characteristics would be associated with longer telomere length and decreased rate of telomere attrition in early childhood: higher levels of surgency/extraversion and regulation/effortful control; belonging to the temperament profile group of emotionally and behaviorally regulated. Finally, we hypothesized that temperament variables would show more robust associations with telomere measures among males than females.
Method
Participants
Participants were recruited from a registry of local births comprising families who had indicated willingness to participate in developmental research. Families in the current analyses participated in a prospective study to examine the early development of emotion processing. Exclusion criteria included known prenatal or perinatal complications, maternal use of medications during pregnancy that may have significant impact on fetal brain development (i.e., anticonvulsants, antipsychotics, opioids), pre- or post-term birth (±3 weeks from due date), developmental delay, uncorrected vision difficulties, and neurological disorder or trauma. After enrollment, families were no longer followed and their data were excluded from analyses if the child was diagnosed with an autism spectrum disorder or a genetic or other condition known to influence neurodevelopment. By design, families were enrolled in the parent study when the children were 5, 7, or 12 months old (T1), with a smaller subsample to be followed when the children were 2 years (T2) and 3 years (T3) of age. Supplemental funding obtained after the start of the parent project allowed for the collection of saliva samples at T1, T2, and/or T3 from families who were age eligible and interested in participating. To be included in the current analyses, participants needed to provide, at minimum, telomere length data and concurrent temperament data from at least one of these timepoints, which provided an analytic sample of N = 602.
Procedures
In-person study visits were administered at the T1 and T3 timepoints. Staff collected saliva samples for telomere length assaying during these visits. At T2, there were two options for saliva collection: Parents collected and returned the saliva sample via a mailer, or a research assistant collected the saliva sample during a home visit. Parents were instructed as to how to collect the sample during the T1 laboratory visit and provided links to online video instructions prior to the T2 collection. Sociodemographic data were obtained at T1 and child temperament data at T1, T2, and T3 via online questionnaires completed by the child’s parent, primarily the child’s mother (98.0% at T1, 97.1% at T2, 96.7% at T3). Study procedures complied with APA ethical standards and were approved by the Institutional Review Board of Boston Children’s Hospital. Parents provided written informed consent prior to the initiation of study activities. Participants were provided monetary compensation for their time.
Measures
Sociodemographics
At T1, the child’s parent completed online questionnaires that inquired about the child’s age, sex assigned at birth (hereafter “sex”), and race/ethnicity, maternal and paternal age and educational attainment, and annual household income. Child and parental age were considered as continuous variables. Child race was categorized as American Indian or Alaska Native, Asian, Black/African American, White, or more than one race. Child ethnicity was categorized as Hispanic/Latino or not Hispanic/Latino. Parental educational attainment was categorized as high school degree/GED or less, Associate’s degree, Bachelor’s degree, Master’s degree, or graduate degree (M.D., Ph.D., J.D., or equivalent). Annual household income was scored into one of five categories, ranging from less than $35,000 per year to $100,000 per year or greater.
Temperament
At T1, parents completed the Infant Behavior Questionnaire-Revised (IBQ-R; Gartstein & Rothbart, 2003). At T2 and T3, parents completed the Early Childhood Behavior Questionnaire (ECBQ; Putnam et al., 2006), an age-upward extension of the IBQ-R. For both the IBQ-R and ECBQ, parents rated the frequency that their child engaged in specific day-to-day behaviors in the prior 1–2 weeks using a 7-point scale, with responses ranging from 1 (never) to 7 (always). Item scores were summed and averaged according to measure scoring rules to create subscale scores, with higher scores indicating greater levels of that temperament dimension. Cronbach alpha scores reported below were derived from the current sample.
The IBQ-R comprises 14 subscales, which factor analyses have previously shown contribute to composite measures for three domains of child temperament: negative affectivity (α = .798), consisting of the subscales Sadness, Distress to Limitations, Fear, and Falling Reactivity/Rate of Recovery from Distress (reverse-scored); surgency/extraversion (α = .814), consisting of the subscales Approach, Vocal Reactivity, High Intensity Pleasure, Smiling and Laughter, Activity Level, and Perceptual Sensitivity; and orienting/regulation (α = .695), consisting of the subscales Low Intensity Pleasure, Cuddliness, Duration of Orienting, and Soothability (Gartstein & Rothbart, 2003).
The ECBQ, comprising 18 subscales, also provides three composite measures: negative affectivity (T2 α = .797, T3 α = .766), consisting of the subscales Discomfort, Fear, Sadness, Perceptual Sensitivity, Shyness, Soothability, Frustration, and Motor Activation; surgency/extraversion (T2 α = .698, T3 α = .708), consisting of the subscales Impulsivity, Activity Level/Energy, High-intensity Pleasure, Sociability, and Positive Anticipation; and effortful control (T2 α = .767, T3 α = .798), an age-upward extension of the IBQ-R orienting/regulation factor (Putnam et al., 2006), consisting of the subscales Inhibitory Control, Attentional Shifting, Attentional Focusing, Low-intensity Pleasure, and Cuddliness.
In addition to analyzing the three domain scores of negative affectivity, surgency/extraversion, and regulation/effortful control at each age, we also considered temperament profile groups previously developed in this sample using a person-centered data-driven approach (Xie et al., 2022). These analyses revealed three distinct groups of children with different temperament profiles: emotionally and behaviorally regulated (EBR; high surgency/extraversion and regulation/effortful control, low negative affectivity); emotionally and behaviorally dysregulated (EBD; high negative affectivity, moderate surgency/extraversion, low regulation/effortful control); and introverted and overcontrolled (IOC; moderate to high negative affectivity, low surgency/extraversion, moderate to high regulation/effortful control). Group membership was moderately stable across T1 to T3, particularly from T2 to T3. External validation testing showed that the temperament groups differed on laboratory-based prosocial and behavioral inhibition tasks at age 3 years and on an eye-tracking measure of dwell time in response to emotional faces at age 5 years. In addition, the groups demonstrated different levels of risk for internalizing and externalizing problems by age 5 years. For more details, see (Xie et al., 2022).
Telomere Length
As previously described (Bosquet Enlow et al., 2020), telomere length was assessed from DNA extracted from saliva collected at T1, T2, and T3. Saliva samples were collected using the Oragene (DNA Genotek) kit and then stored at room temperature until DNA extraction. DNA was extracted from samples at the Psychiatric and Neurodevelopmental Genetics Unit (Massachusetts General Hospital) using the Oragene DNA extraction protocol. Relative telomere length was determined using a modified, high throughput (384-well format) version of the quantitative real-time polymerase chain reaction (PCR) (Cawthon, 2002; Wang et al., 2008). A recent meta-analysis determined that the PCR method is a valid technique for quantifying telomere length (Ridout et al., 2018). Laboratory personnel were blinded to participants’ characteristics.
The average relative telomere length was calculated as the ratio of telomere repeat copy number to a single gene (36B4) copy number. Telomere length is reported as the exponentiated ratio of telomere repeat copy number to a single gene copy number corrected for a reference sample. Ratios of telomere repeat copy number to a single gene copy number highly correlate with absolute telomere lengths determined by Southern blot (Cawthon, 2002). The T/S ratio value for all samples at all timepoints was compared to that of a reference DNA quality control standard sample to normalize for experimental variations and allow comparison among sample sets. The T/S ratio has been shown to be linearly proportional to average telomere length. When an unknown sample is identical to the reference DNA in its T/S ratio, the T/S ratio value is 1. The T/S ratio of one individual relative to the T/S ratio of another should thus correspond to the relative telomere lengths of their DNA.
All of the samples were run at the same time within one batch across 15 plates. Five nanograms of genomic DNA were dried down in each 384-well plate and resuspended in 10 μL of either the telomere or 36B4 PCR reaction mixture and then stored at 4°C for up to 6h. The telomere reaction mixture consisted of 1x Thermo Fisher PowerUP SYBR Master Mix, 2.0 mM of DTT, 270 nM of Tel-1b primer, and 900 nM of Tel-2b primer. The reaction proceeded for one cycle hold at 50°C for 2m and at 95°C for 2m, followed by 35 cycles at 95°C for 15s and 54°C for 2m. The 36B4 reaction consisted of 1x Thermo Fisher PowerUP SYBR Master Mix, 300 nM of 36B4U primer, and 500 nM of 36B4D primer. The 36B4 reaction proceeded for one cycle hold at 50°C for 2m and at 95°C for 2m, followed by 40 cycles at 95°C for 15s and 58°C for 70s. All samples for both the telomere and single-copy gene (36B4) reactions were performed in triplicate on different plates. Each 384-well plate also contained a 6-point standard curve from 0.625 ng to 20 ng using pooled saliva derived genomic DNA.
The standard curve assessed and compensated for inter-plate variations in PCR efficiency. The PCR efficiency was overall ~90%, and the linear correlation coefficient (R2) values for both reactions were overall > 0.99. The T/S ratio (-dCt) for each sample was calculated by subtracting the average 36B4 Ct value from the average telomere Ct value. The relative T/S ratio (-ddCt) was determined by subtracting the T/S ratio value of the 5 ng standard curve point from the T/S ratio of each unknown sample. Quality control samples were interspersed throughout the test samples in order to assess inter-plate and intra-plate variability of threshold cycle (Ct) values. A combined inter- and intra-assay coefficient of variation (CV) calculated from the relative T/S ratio (-ddCt) of quality control samples was 10.43%.
Telomere PCR Primers:
Tel 1 GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT
Tel 2 TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA
36B4 (Single copy gene) PCR Primers:
36B4u CAGCAAGTGGGAAGGTGTAATCC
36B4d CCCATTCTATCATCAACGGGTACAA
Covariates
Given prior evidence that age and sex are consistently associated with telomere length and telomere attrition, they were considered as covariates and/or moderator variables in analyses, as specified below. Age at saliva sample collection for deriving telomere length and age at completion of the temperament measure were very highly correlated within timepoint (rs = .95−.99); thus, age at saliva sample collection was used for all analyses that included age as a covariate or moderator. Previously published analyses indicated that the following variables were not associated with telomere length or telomere attrition in this cohort (see Bosquet Enlow et al., 2020 for details) and therefore were not considered as covariates in the current analyses: child race/ethnicity, maternal and paternal age, maternal and paternal education level, annual household income, child birthweight, presence of any serious illnesses or difficulties in child development since birth (T1) or since last assessment (T2, T3), and number of days saliva sample was in storage prior to DNA extraction.
Data Analysis Plan
We first performed descriptive analyses to demonstrate the sample characteristics. We then analyzed associations among the temperament variables and the telomere length variables at infancy, 2 years, and 3 years. For our “association analysis” between temperament characteristics and telomere length, we fit a linear mixed model with fixed effects for age at assessment (in months), sex, and the three continuous temperament domain scores (negative affectivity, surgency/extraversion, regulation/effortful control). Participant level random effects included an intercept and random slope for age (unstructured covariance structure). Participants provided one to three observations of temperament and relative telomere length measured at the same timepoint. That is, this analysis is testing the contemporaneous association between temperament and relative telomere length, where participants can provide as many as three repeated measures. We included tests of sex as moderators of temperament effects on telomere length via interaction terms; we removed interaction terms from the final model if p > .05. We then fit the same model using the temperament profile group score in lieu of the continuous temperament domain scores.
For our “trajectory analysis,” we fit a linear mixed effects model with random effects as above, and fixed effects for age, sex, the three continuous temperament domain scores in infancy, and age by temperament domain score interaction terms. That is, this analysis is testing the hypothesis that temperament in infancy moderates the slope of relative telomere length over time (i.e., attrition rate). Age by temperament domain interaction terms were removed if p > .05. Additionally, we tested sex interactions with three-way interaction terms, again excluding them if p > .05. The model was then repeated using the temperament profile group score in infancy in place of the continuous temperament domain scores. Temperament measures in infancy were used as the main temperament variables in this trajectory analysis given that the temperament measures in infancy have the advantage of being measured at the beginning of the telomere trajectory. To address the fact that temperament scores may not be highly stable over this development period (i.e., infancy to age 3 years), secondary analyses examined whether using time-varying temperament scores or mean temperament scores across ages influenced findings.
For all analyses, alpha was set at .05, and all tests were two-tailed. The main findings are presented below. The full regression tables for the final models are presented in Supplemental Materials Table S1.
Power Analysis
We calculated a post-hoc effect size estimate given 80% power for our hypothesis that we would observe differences in telomere attrition rate in relation to IBQ-R domain scores. Given our sample size of 602, and assuming the same missing data patterns, we had at least 80% power to detect an interaction effect of a one-unit change in any IBQ-R score associated with a 0.0016 telomere length change per month of age (α = .05, intraclass correlation of telomere length = .40). Thus, we were powered to detect small changes in telomere length across time in relation to infant temperament scores.
Transparency and Openness
We report power calculations that justify our sample size, all inclusion and exclusion criteria, and all relevant measures. Statistical analyses were performed with IBM SPSS Statistics (Version 28) and STATA (Version 16.1). Deidentified data sets and syntax required to reproduce analyses are available by request from the first author. This study was not preregistered.
Results
Sample Characteristics
Table 1 displays the sample sociodemographic characteristics. Children were predominantly non-Hispanic White (73.3%) and of middle to high socioeconomic status as reflected in parental education and annual household income. As previously described (Bosquet Enlow et al., 2020), available health indicators suggest that the sample was healthy overall and free from illness at the time of data collection. Due to study exclusionary criteria, all children were born full term. Children were also of normal birthweight (M = 3501g, SD = 490g, 98% > 2500g). As noted above, children were excluded from the study if there were any known developmental delays, neurological disorder or trauma, or maternal use of certain medications during pregnancy.
Table 1.
Sample Characteristics (N = 602)
| M | SD | n | % | |
|---|---|---|---|---|
|
| ||||
| Child age, infant (T1) assessment (months) | 8.42 | 3.03 | ||
| Child age, 2-year (T2) assessment (months) | 24.86 | 1.48 | ||
| Child age, 3-year (T3) assessment (months) | 37.75 | 2.07 | ||
| Child sex assigned at birth (male) | 312 | 51.8 | ||
| Maternal age (years) | 34.04 | 3.86 | ||
| Paternal age (years) | 35.74 | 4.82 | ||
| Child race | ||||
| White | 477 | 79.2 | ||
| Asian | 21 | 3.5 | ||
| Black/African American | 8 | 1.3 | ||
| American Indian or Alaska Native | 1 | 0.2 | ||
| Multi-racial | 85 | 14.1 | ||
| Did not report | 10 | 1.7 | ||
| Child ethnicity | ||||
| Not Hispanic or Latino | 542 | 90.0 | ||
| Hispanic or Latino | 53 | 8.8 | ||
| Did not report | 7 | 1.2 | ||
| Maternal education | ||||
| High school degree/GED or less | 26 | 4.3 | ||
| Associate’s degree | 5 | 0.8 | ||
| Bachelor’s degree | 179 | 29.7 | ||
| Master’s degree | 274 | 45.5 | ||
| Graduate degree | 116 | 19.3 | ||
| Paternal education | ||||
| High school degree/GED or less | 49 | 8.1 | ||
| Associate’s degree | 24 | 4.0 | ||
| Bachelor’s degree | 182 | 30.2 | ||
| Master’s degree | 189 | 31.4 | ||
| Graduate degree | 153 | 25.4 | ||
| Annual household income | ||||
| < $35,000 | 18 | 3.0 | ||
| $35,000-$49,999 | 15 | 2.5 | ||
| $50,000-$74,999 | 52 | 8.6 | ||
| $75,000-$99,999 | 81 | 13.5 | ||
| $100,000+ | 390 | 64.8 | ||
| Did not respond | 46 | 7.7 | ||
Data during at least one timepoint were available for 602 participants, with 545 providing data at T1, 254 at T2, and 313 at T3; 221 provided data at one timepoint, 252 at two timepoints, and 129 at three timepoints, with 370 providing data during T1 and at least one follow-up timepoint. Participants who did not provide T2 and/or T3 data did not differ from those with these data on parental demographics (age, education, income), infant age, temperament, or telomere length at T1 (all ps > .05, separate tests for participants missing T2 and those missing T3 data). Table 2 presents the descriptive data for the telomere and temperament variables.
Table 2.
Descriptive Data for Telomere and Temperament Variables
| M | SD | Range | n | % | |
|---|---|---|---|---|---|
|
| |||||
| Relative telomere length | |||||
| T1 (N = 545) | 1.27 | 0.21 | 0.24–1.96 | ||
| T2 (N = 254) | 1.15 | 0.21 | 0.70–1.96 | ||
| T3 (N = 313) | 1.12 | 0.18 | 0.70–1.84 | ||
| Temperament domain scores | |||||
| T1 (N = 545) | |||||
| Negative affectivity | 3.18 | 0.73 | 1.35–5.63 | ||
| Surgency/extraversion | 4.72 | 0.71 | 2.44–6.64 | ||
| Regulation/effortful control | 5.09 | 0.56 | 2.63–6.68 | ||
| T2 (N = 254) | |||||
| Negative affectivity | 2.83 | 0.49 | 1.76–4.43 | ||
| Surgency/extraversion | 4.93 | 0.55 | 3.62–6.54 | ||
| Regulation/effortful control | 4.83 | 0.53 | 2.94–6.15 | ||
| T3 (N = 313) | |||||
| Negative affectivity | 2.94 | 0.55 | 1.54–4.87 | ||
| Surgency/extraversion | 4.96 | 0.54 | 3.38–6.64 | ||
| Regulation/effortful control | 4.96 | 0.54 | 3.12–6.18 | ||
| Temperament profile groups | |||||
| EBR, T1 | 222 | 40.7 | |||
| EBD, T1 | 236 | 43.3 | |||
| IOC, T1 | 87 | 16.0 | |||
| EBR, T2 | 113 | 44.5 | |||
| EBD, T2 | 90 | 35.4 | |||
| IOC, T2 | 51 | 20.1 | |||
| EBR, T3 | 114 | 36.8 | |||
| EBD, T3 | 117 | 37.7 | |||
| IOC, T3 | 79 | 25.5 | |||
Note. T1 = Time 1 (infancy); T2 = Time 2 (age 2 years); T3 = Time 3 (age 3 years); EBR = emotionally and behaviorally regulated; EBD = emotionally and behaviorally dysregulated; IOC = introverted and overcontrolled. % = percent of sample with a given temperament profile among those with available temperament profile group data at the given time point.
Telomere Length in Relation to Temperament: Association Analysis
Table 3 presents the bivariate correlations among the telomere length measures at each timepoint and the temperament domain scores (negative affectivity, surgency/extraversion, regulation/effortful control) at each timepoint. The telomere length measures were moderately correlated across timepoints. The scores for the same temperament domain were moderately correlated between T1 and later timepoints and strongly correlated between T2 and T3. Table 4 presents the relative telomere length scores by temperament profile group at each timepoint.
Table 3.
Correlations among Telomere Length and Temperament Domain Scores
| TL_T1 | TL_T2 | TL_T3 | NA_T1 | S/E_T1 | R/EC_T1 | NA_T2 | S/E_T2 | R/EC_T2 | NA_T3 | S/E_T3 | |
|---|---|---|---|---|---|---|---|---|---|---|---|
|
| |||||||||||
| TL_T2 | .39*** | ||||||||||
| TL_T3 | .39*** | .32*** | |||||||||
| NA_T1 | .00 | .01 | −.04 | ||||||||
| S/E_T1 | −.10* | .10 | .06 | .00 | |||||||
| R/EC_T1 | .06 | .08 | .04 | −.38*** | .15*** | ||||||
| NA_T2 | .03 | .02 | .01 | .31*** | .06 | −.09 | |||||
| S/E_T2 | −.03 | .00 | .16+ | −.06 | .29*** | .15* | .05 | ||||
| R/EC_T2 | .00 | .04 | .07 | −.22*** | .31*** | .42*** | −.22*** | .22*** | |||
| NA_T3 | −.05 | −.06 | −.03 | .33*** | .00 | −.15* | .68*** | .01 | −.33*** | ||
| S/E_T3 | .03 | −.02 | .02 | −.01 | .20** | .11+ | .07 | .60*** | .16+ | .05 | |
| R/EC_T3 | .05 | .13 | .09+ | −.15* | .20** | .29*** | −.16+ | .13 | .67*** | −.30*** | −.11+ |
Note. TL = Relative Telomere Length; T1 = Time 1 (infancy); T2 = Time 2 (age 2 years); T3 = Time 3 (age 3 years); NA = Negative Affectivity; S/E = Surgency/Extraversion; R/EC = Regulation/Effortful Control.
p <.10.
p <.05.
p <.01.
p <.001.
Table 4.
Relative Telomere Length by Temperament Profile Group at Each Timepoint
| M | SD | Range | |
|---|---|---|---|
|
| |||
| T1 | |||
| EBR | 1.26 | 0.21 | 0.24–1.79 |
| EBD | 1.27 | 0.19 | 0.81–1.94 |
| IOC | 1.27 | 0.24 | 0.33–1.96 |
| T2 | |||
| EBR | 1.14 | 0.20 | 0.70–1.92 |
| EBD | 1.14 | 0.20 | 0.70–1.70 |
| IOC | 1.18 | 0.24 | 0.84–1.96 |
| T3 | |||
| EBR | 1.14 | 0.18 | 0.77–1.68 |
| EBD | 1.11 | 0.18 | 0.73–1.69 |
| IOC | 1.11 | 0.21 | 0.70–1.84 |
Note. T1 = Time 1 (infancy); T2 = Time 2 (age 2 years); T3 = Time 3 (age 3 years); EBR = emotionally and behaviorally regulated; EBD = emotionally and behaviorally dysregulated; IOC = introverted and overcontrolled.
Our association analysis examining temperament domain scores across timepoints in relation to telomere length across timepoints (602 participants, 1109 observations) showed that regulation/effortful control was positively associated with relative telomere length (B = 0.025, 95% CI [0.002, 0.047], p = .03). Neither negative affectivity nor surgency/extraversion was associated with relative telomere length, ps = .44 and .09, respectively. There was a main effect for age (B = −0.005, 95% CI [−0.006, −0.004], p < .001), with relative telomere length declining with age. There was also a main effect for sex, with females exhibiting longer relative telomere length than males (B = 0.067, 95% CI [0.040, 0.094], p < .001).
In our mixed model analysis examining temperament profile group scores across timepoints in relation to telomere length across timepoints, relative telomere length was not associated with temperament profile group, p = .73.
Sex did not modify associations between any of the temperament measures (domain scores or profile group) and relative telomere length, ps > .40.
Telomere Attrition in Relation to Temperament: Trajectory Analysis
Our trajectory analysis examining continuous temperament domain scores in relation to telomere attrition from infancy to age 3 years (574 participants, 1084 observations) showed that greater surgency/extraversion in infancy was associated with a less steep decline in relative telomere length from infancy to age 3 years (B = 0.0014, 95% CI [0.0003, 0.0025], p = .01]). For example, an infant with a surgency/extraversion score of 4 in infancy exhibited an estimated decline of 0.0063 [−0.0072, −0.0052] in relative telomere length each month, compared to a decline of 0.0049 [−0.0057, −0.0040] for an infant with a score of 5. Over a 3-year period, this difference in slope would culminate in a 0.05 lower relative telomere length (or 0.25 standard deviations) in those with a surgency/extraversion score of 4 compared to 5. As this mixed model simultaneously included all continuous infant temperament domain scores and sex, this observed effect for infant surgency/extraversion is adjusted for infant regulation and negative affectivity and for sex. The rate of telomere attrition did not vary by infant regulation or negative affectivity. Secondary analyses showed similar results when utilizing time-varying temperament scores or mean temperament scores across ages (results not presented for sake of parsimony).
In the mixed model including temperament profile groups, the rate of telomere attrition did not vary by temperament profile group, p = .49.
Sex did not modify associations between any of the temperament measures (domain scores or profile group) and telomere attrition rate, ps > .50.
Sex-specific Effects
T-test analyses following up on the observed main effect, described above in the association analysis, for sex on relative telomere length demonstrated that females exhibited longer relative mean telomere length than males at all timepoints: T1 t(543) = 3.42, p < .001, Mf = 1.30, SDf = 0.20, Mm = 1.24, SDm = 0.21; T2 t(252) = 3.19, p = .002, Mf = 1.19, SDf = 0.22, Mm = 1.11, SDm = 0.19; and T3 t(311) = 3.47, p < .001, Mf = 1.16, SDf = 0.19, Mm = 1.09, SDm = 0.17. For the temperament measures, males were rated as higher on surgency/extraversion than females at T3, t(310) = −1.99, p = .047, Mf = 4.89, SDf = 0.46, Mm = 5.01, SDm = 0.59. Additionally, at T3, females were more likely than males to be in the EBD profile group (43.0% vs. 33.3%) and less likely to be in the IOC profile group (18.3% vs. 31.6%), χ2(2, N = 310) = 7.45, p = .02. As noted above in the association analysis and in the trajectory analysis, there was no evidence of moderation by sex of the associations between temperament (domain scores or profile group) and telomere length or telomere attrition rate.
Discussion
The overall goal of the current study was to examine associations between temperament and telomere length over the first three years of life in a community sample of children. Temperament was operationalized as distinct characteristics/domains (negative affectivity, surgency/extraversion, and regulation/effortful control) and as profile groups that considered multiple domains simultaneously (emotionally and behaviorally regulated, emotionally and behaviorally dysregulated, and introverted and overcontrolled). Analyses examined relations of temperament to measures of telomere length and to rate of telomere attrition from infancy to age 3 years. Sex-specific effects were explored given prior evidence of differential sex effects of psychosocial factors on telomere biology. The findings from the current study suggest that temperament domains that reflect more positive characteristics (i.e., surgency/extraversion as an indicator of positive emotionality, regulation/effortful control as an indicator of self-regulatory abilities) were associated with longer telomere length and a decreased rate of telomere attrition. More specifically, greater regulation/effortful control was associated with longer telomere length across timepoints assessed (infancy, 2 years, 3 years), and higher surgency/extraversion was associated with a decreased rate of telomere attrition from infancy to age 3 years. Notably, contemporaneous measures of temperament were not better at predicting telomere length than temperament measures in infancy, despite within-subject variability in temperament across time. Although there were observed sex differences in relative telomere length and some temperament characteristics, there were no sex-specific effects on the associations between temperament and telomere variables, suggesting that the associations between temperament and telomere measures were similar among males and females. Overall, the findings suggest that temperament characteristics observable as early as infancy may be associated with telomere biology in early childhood, with a potential protective effect of positive temperament characteristics on telomere erosion.
Temperament was associated with telomere measures when distinct domains of temperament characteristics were considered (i.e., surgency/extraversion, regulation/effortful control), but not when temperament profiles were examined. There may be a few explanations for this pattern of findings. The temperament domains were continuous scale measures, whereas the temperament profile score was an ordinal group variable; the greater variability in the continuous measures may have allowed for greater power to detect effects. The findings also may indicate that, at least in early development, the characteristics of surgency/extraversion and regulation/effortful control are more relevant than that of negative affectivity in influencing telomere biology. We had hypothesized that negative affectivity would be associated with shorter telomere length/increased rate of telomere attrition, but we did not observe any relation between this temperament domain and the telomere measures. Thus, the lack of relation between the temperament profile score and telomere variables may be attributable to the fact that information not useful in predicting telomere variables (i.e., negative affectivity scores) were central in the derivation of the temperament profile score.
The current analyses did not consider how temperament may interact with the environment to predict telomere length or attrition rate. Research in adults suggests that personality traits may influence the impact of environmental exposures on telomere biology. For example, among individuals who participated in a meditation retreat, those highest in neuroticism and lowest in agreeableness demonstrated greater increases in telomere length (Conklin et al., 2018). Moreover, a decrease in neuroticism partially mediated the effects of a meditation retreat on increased telomerase activity (Jacobs et al., 2011). Some hypothesize that temperament characteristics reflect a child’s biological sensitivity to the environment, such that the same traits may be associated with optimal outcomes if the child is exposed to an enriched, positive environment but maladaptive outcomes if exposed to a stressful environment (Foss, So, et al., 2022). Thus, certain temperament characteristics may interact with environmental conditions to influence telomere biology, with more “reactive” children (e.g., high on surgency/extraversion) demonstrating longer telomere length/decreased rate of attrition under supportive conditions and shorter telomere length/increased rate of attrition under stressful conditions. The current sample was highly resourced and consequently may have been positioned to provide more environmental supports, such that surgency/extraversion was associated with decreased rate of telomere attrition. Relatedly, the fact that negative affectivity was not associated with shorter telomere length/more rapid telomere attrition as hypothesized may have been due to the buffering effects of more supportive environments in this sample. Future research should consider the joint effects of temperament and environmental characteristics on telomere biology in samples that represent a range of supportive and stressful environments.
When designing studies that consider the joint role of the environment and temperament on telomere outcomes, particularly in early development, researchers should consider characteristics specifically of the caregiving environment. A large literature has demonstrated the critical role of aspects of caregiving (e.g., parental involvement, sensitivity, quality of the caregiver-child relationship), particularly during the first years of life, on a range of developmental outcomes (Sroufe et al., 2005). Moreover, studies suggests that caregiving quality may influence dimensions of child temperament (Bosquet Enlow, Petty, et al., 2019; Dindo et al., 2017; Foss, So, et al., 2022) as well as telomere length attrition (Asok et al., 2013; Dagan et al., 2018). Research further suggests that caregiving characteristics may interact with child psychological traits to influence telomere length (Esteves et al., 2020) and stress physiology relevant for telomere erosion processes (Foss, Petty, et al., 2022). Thus, the caregiving environment may exert measurable influence on the association between child psychological characteristics and telomere length dynamics and should be considered in future work.
This study also did not consider the role of hypothesized underlying biological mechanisms that may link psychological characteristics, such as temperament, personality, and psychopathology, to telomere length/attrition rate. For example, some have hypothesized that exposure to elevated levels of glucocorticoids may affect oxidative balance via genomic or non-genomic mechanisms and that exposure to increased oxidative stress is a primary cause of telomere shortening (Angelier et al., 2018; Nelson et al., 2018). Glucocorticoids may also influence telomere length by modulating telomerase activity (Angelier et al., 2018; Choi et al., 2008). Other physiological systems involved in oxidative stress and/or telomere biology have been implicated, including immune activation and metabolic processes that result in increased production of reactive oxygen species (e.g., glucose and lipid mobilization) (Angelier et al., 2018). Measures of such potential biological mechanisms (i.e., HPA axis functioning/cortisol output, oxidative stress, inflammation) were not available in this cohort. This study was a first step in showing associations between temperament and telomere measures in early development. Our findings support future research efforts that explore whether physiological stress reactivity mediates associations between psychological characteristics, such as temperament, and telomere attrition processes.
We observed sex differences in telomere length, with females consistently showing longer telomere length than males across timepoints, and in some temperament measures specifically at age 3 years. However, the nature and magnitude of the associations of temperament characteristics with telomere measures did not differ by sex. These results suggest that the associations between temperament and telomere length in early life are similar among males and females. Future research that considers the joint roles of temperament and environmental exposures on telomere biology should include testing for potential sex modification effects despite the lack of sex effects observed here. A large body of research suggests sex differences in reactivity to stress exposures, beginning in fetal development, including in relation to telomere attrition (Bosquet Enlow et al., 2018; Bosquet Enlow, Sideridis et al., 2019; Van den Bergh et al., 2017). Environmental exposures may interact differently with temperament characteristics in males versus females, with consequences for telomere biology.
Developmental considerations are important to note. First, although temperament scores were only moderately stable from infancy to later ages, temperament assessed in infancy, specifically surgency/extraversion, was predictive of telomere attrition rate from infancy to age 3 years, and later measures of temperament were not better at predicting telomere attrition rate. Additionally, the positive association between regulation/effortful control and telomere length was consistent across timepoints assessed. These findings suggest that, despite changes in temperament ratings, particularly from infancy to ages 2 and 3 years, temperament assessed at any of these timepoints was relevant for measures of telomere length. Moreover, temperament assessed as early as infancy had predictive value in relation to telomere attrition. Thus, the emotional, physiological, and behavioral traits underlying these observable temperament characteristics may influence telomere biology as early as the first months of life. Of particular interest is the positive (i.e., protective) association of surgency/extraversion on telomere erosion given the inconsistent associations between this temperament characteristic and developmental outcomes in prior literature. As noted above, this characteristic has been associated with both better self-regulation and with externalizing problems/ADHD. There is some evidence that surgency/extraversion may represent more “positive” behaviors (e.g., positive emotionality) when assessed in early childhood and more “negative” characteristics (e.g., impulsivity, hyperactivity) when assessed in later childhood (Foss, So, et al., 2022). That surgency/extraversion was associated with decreased rate of telomere erosion across the first three years is consistent with the view that this temperament characteristic may be a positive/adaptive trait in early childhood, at least in relation to telomere biology. Relatedly, as noted above, this characteristic may be more likely to be associated with better developmental outcomes when combined with a supportive environment. Finally, associations between temperament/personality and telomere biology may intensify with age. Given that temperament/personality are relatively stable traits, they are expected to result in consistent physiological effects that accumulate over time to influence cell aging processes, such as telomere shortening (Lin et al., 2012). At the same time, temperament/psychological characteristics may have particular impact on telomere attrition processes in early life due to the noted unevenness of telomere length dynamics across the lifespan, with exceptionally more rapid erosion and potential susceptibility to environmental influences in the first years (Bosquet Enlow et al., 2020). More longitudinal research is needed to understand how temperament and personality, in conjunction with the environment, influence telomere biology over time, including whether there are sensitive developmental periods for such effects to emerge.
Strengths and limitations of the current study deserve consideration. The relatively large sample consisted of healthy children recruited in infancy and followed to age 3 years. The majority of studies in this area have been cross-sectional, which only allows comparison of telomere length among participants who vary on a covariate of interest, such as temperament. Longitudinal studies of telomere attrition in childhood are sorely lacking. Longitudinal data are necessary to be able to determine the psychological characteristics that influence telomere attrition rate over time. Further, telomere erosion does not occur at a constant rate, rather proceeding relatively rapidly over the first two years of life and then slowing considerably (Bosquet Enlow et al., 2020). This coincides with a period of major developmental changes across biological systems and heightened plasticity to environmental exposure effects on these systems. This differing pattern of attrition rate over early childhood is further evidence for the need for longitudinal studies in this area.
Another strength of the study includes the use of saliva samples for assaying telomere length. As described in more detail elsewhere (Bosquet Enlow et al., 2020), use of saliva over blood, particularly in studies of young children, offers numerous advantages, including lower risk and greater ease and acceptability to both caregivers and children. Previous work has validated the methods used here for extracting DNA from saliva and assessing telomere length (Goldman et al., 2018; Montpetit et al., 2014; Ridout et al., 2018). However, because the method produces relative telomere length rather than absolute kilobase length estimates, it does limit comparability with findings from other studies (Montpetit et al., 2014).
The sample was primarily non-Hispanic White and of middle to high socioeconomic status. These sample characteristics are both a strength and a limitation. Some previous studies have found differences in telomere length by race and socioeconomic status. The reasons for such associations are not established but may be related to racial/ethnic differences in polygenetic adaptation (Hansen et al., 2016) and to higher rates of stress exposures, systemic racism, and other health risk factors among both minority racial groups and low socioeconomic status groups (Geronimus et al., 2015). Moreover, race/ethnicity and socioeconomic status are often confounded in research studies (Geronimus et al., 2015), further complicating efforts to understand the impact of specific sociodemographic characteristics on telomere parameters. Using a sample of relatively high socioeconomic status reduces the potential variability in telomere length due to exposure to stressors associated with economic adversity. However, the limited representation of individuals of minority racial/ethnic backgrounds and varied socioeconomic status restricts the generalizability of the findings. Changes in telomere length in relation to child temperament should be explored in samples representing a range of sociodemographic characteristics. Finally, the current study did not consider the role of genetic factors/heritability in analyses (Broer et al., 2013).
Conclusion
The current findings suggest that temperament characteristics observable as early as infancy are associated with telomere measures in the first years of life. Specifically, in a community sample of healthy children, we found that effortful control was positively associated with measures of relative telomere length across timepoints assessed (infancy, 2 years, 3 years). Additionally, greater surgency/extraversion in infancy was associated with a less steep decline in relative telomere length from infancy to age 3 years. Despite sex differences in relative telomere length and some temperament characteristics, there were no sex-specific effects on the associations between the temperament and telomere variables. Overall, these findings suggest that certain temperament characteristics may serve as protective factors against telomere erosion in early life, when telomere attrition rate is relatively accelerated. The findings should be confirmed and extended to samples of varying sociodemographic characteristics in future developmental studies. Identifying early life psychological factors that influence telomere biology may further our understanding of the developmental origins of health and disease and enhance our ability to identify at-risk individuals and develop more targeted, effective interventions to maximize health outcomes across the lifespan.
Supplementary Material
Public Significance Statement:
This study suggests that positive temperament characteristics may buffer telomere erosion in early childhood. Telomere erosion is a measure of cellular aging that may contribute to many diseases across the lifespan. Identifying factors in early life that influence telomeres may enhance our understanding of the origins of health and disease and our ability to identify at-risk individuals and to develop targeted, effective interventions that maximize health outcomes across the lifespan.
Footnotes
Paul A. Harris, Robert Taylor, Robert Thielke, Jonathon Payne, Nathaniel Gonzalez, Jose G. Conde, Research electronic data capture (REDCap) - A metadata-driven methodology and workflow process for providing translational research informatics support, J Biomed Inform. 2009 Apr;42(2):377–81.
References
- Ahadi SA, Rothbart MK, & Ye R (1993). Children’s temperament in the US and China: Similarities and differences. European Journal of Personality, 7(5), 359–378. [Google Scholar]
- Angelier F, Costantini D, Blevin P, Chastel O (2018). Do glucocorticoids mediate the link between environmental conditions and telomere dynamics in wild vertebrates? A review. General and Comparative Endocrinology, 256, 99–111. 10.1016/j.ygcen.2017.07.007 [DOI] [PubMed] [Google Scholar]
- Asok A, Bernard K, Roth TL, Rosen JB, Dozier M (2013). Parental responsiveness moderates the association between early-life stress and reduced telomere length. Developmental Psychopathology, 25(03), 577–585. 10.1017/s0954579413000011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bajgarova Z, & Bajgar A (2020). The relationships among MAOA, COMT Val158Met, and 5-HTTLPR polymorphisms, newborn stress reactivity, and infant temperament. Brain and Behavior, 10(2), Article e01511. 10.1002/brb3.1511 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Blackburn EH, & Gall JG (1978). A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena. Journal of Molecular Biololgy, 120(1), 33–53. [DOI] [PubMed] [Google Scholar]
- Bosquet Enlow M, Bollati V, Sideridis G, Flom JD, Hoxha M, Hacker MR, & Wright RJ (2018). Sex differences in effects of maternal risk and protective factors in childhood and pregnancy on newborn telomere length. Psychoneuroendocrinology, 95, 74–85. 10.1016/j.psyneuen.2018.05.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bosquet Enlow M, Kane-Grade F, De Vivo I, Petty CR, & Nelson CA (2020). Patterns of change in telomere length over the first three years of life in healthy children. Psychoneuroendocrinology, 115, Article 104602. 10.1016/j.psyneuen.2020.104602 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bosquet Enlow M, Petty CR, Svelnys C, Gusman M, Huezo M, Malin A, & Wright RJ (2019). Differential effects of stress exposures, caregiving quality, and temperament in early life on working memory versus inhibitory control in preschool-aged children. Dev Neuropsychol, 44(4), 339–356. 10.1080/87565641.2019.1611833 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bosquet Enlow M, Sideridis G, Bollati V, Hoxha M, Hacker MR, & Wright RJ (2019). Maternal cortisol output in pregnancy and newborn telomere length: Evidence for sex-specific effects. Psychoneuroendocrinology, 102, 225–235. 10.1016/j.psyneuen.2018.12.222 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Broer L, Codd V, Nyholt DR, Deelen J, Mangino M, Willemsen G, Albrecht E, Amin N, Beekman M, de Geus EJC, Henders A, Nelson CP, Steves CJ, Wright MJ, de Craen AJM, Isaacs A, Matthews M, Moayyeri A, Montgomery GW, …Boomsma DI. (2013). Meta-analysis of telomere length in 19,713 subjects reveals high heritability, stronger maternal inheritance and a paternal age effect. European Journal of Human Genetics, 21(10), 1163–1168. 10.1038/ejhg.2012.303 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Calkins SD, & Fox NA (2002). Self-regulatory processes in early personality development: a multilevel approach to the study of childhood social withdrawal and aggression. Dev Psychopathol, 14(3), 477–498. 10.1017/s095457940200305x [DOI] [PubMed] [Google Scholar]
- Casalin S, Luyten P, Vliegen N, & Meurs P (2012). The structure and stability of temperament from infancy to toddlerhood: a one-year prospective study. Infant Behavior & Development, 35(1), 94–108. 10.1016/j.infbeh.2011.08.004 [DOI] [PubMed] [Google Scholar]
- Cawthon RM (2002). Telomere measurement by quantitative PCR. Nucleic Acids Research, 30(10), Article e47. 10.1093/nar/30.10.e47 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choi J, Fauce SR, Effros RB (2008). Reduced telomerase activity in human T lymphocytes exposed to cortisol. Brain, Behavior, and Immunity, 22(4), 600–605. 10.1016/j.bbi.2007.12.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Conklin QA, King BG, Zanesco AP, Lin J, Hamidi AB, Pokorny JJ, Álvarez-López MJ, Cosín-Tomás M, Huang C, Kaliman P, Epel ES, Saron CD (2018). Insight meditation and telomere biology: The effects of intensive retreat and the moderating role of personality. Brain, Behavior, and Immunity, 70, 233–245. 10.1016/j.bbi.2018.03.003 [DOI] [PubMed] [Google Scholar]
- Corfdir C, Pignon B, Szöke A, & Schürhoff F (2021). [Accelerated telomere erosion in schizophrenia: A literature review]. Encephale, 47(4), 369–375. 10.1016/j.encep.2020.12.001 [DOI] [PubMed] [Google Scholar]
- Costa DD, Rosa DV, Barros AG, Romano-Silva MA, Malloy-Diniz LF, Mattos P, & de Miranda DM (2015). Telomere length is highly inherited and associated with hyperactivity-impulsivity in children with attention deficit/hyperactivity disorder. Frontiers in Molecular Neuroscience, 8, 28. 10.3389/fnmol.2015.00028 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dagan O, Asok A, Steele H, Steele M, & Bernard K (2018). Attachment security moderates the link between adverse childhood experiences and cellular aging. Dev Psychopathol, 30(4), 1211–1223. 10.1017/s0954579417001705 [DOI] [PubMed] [Google Scholar]
- Dindo L, Brock RL, Aksan N, Gamez W, Kochanska G, & Clark LA (2017). Attachment and effortful control in toddlerhood predict academic achievement over a decade later. Psychol Sci, 28(12), 1786–1795. 10.1177/0956797617721271 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dolbier CL, Cocke RR, Leiferman JA, Steinhardt MA, Schapiro SJ, Nehete PN, Perlman JE, Sastry J (2001). Differences in functional immune responses of high vs. low hardy healthy individuals. Journal of Behavioral Medicine, 24(3), 219–229. 10.1023/a:1010762606006 [DOI] [PubMed] [Google Scholar]
- Donzella B, Gunnar MR, Krueger WK, & Alwin J (2000). Cortisol and vagal tone responses to competitive challenge in preschoolers: associations with temperament. Developmental Psychobiology, 37(4), 209–220. 10.1002/1098-2302(2000)37:4<209::aid-dev1>3.0.co;2-s [DOI] [PubMed] [Google Scholar]
- Edmonds GW, Côté HC, & Hampson SE (2015). Childhood conscientiousness and leukocyte telomere length 40 years later in adult women--preliminary findings of a prospective association. PLoS One, 10(7), Article e0134077. 10.1371/journal.pone.0134077 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eisenberg N, Spinrad TL, & Eggum ND (2010). Emotion-related self-regulation and its relation to children’s maladjustment. Annual Review of Clinical Psychology, 6, 495–525. 10.1146/annurev.clinpsy.121208.131208 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Epel ES (2009). Psychological and metabolic stress: a recipe for accelerated cellular aging? Hormones, 8(1), 7–22. 10.14310/horm.2002.1217 [DOI] [PubMed] [Google Scholar]
- Esteves KC, Jones CW, Wade M, Callerame K, Smith AK, Theall KP, & Drury SS (2020). Adverse Childhood Experiences: Implications for offspring telomere length and psychopathology. Am J Psychiatry, 177(1), 47–57. 10.1176/appi.ajp.2019.18030335 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Foss S, Petty CR, Howell C, Mendonca J, Bosse A, Waber DP, Wright RJ, & Bosquet Enlow M (2022). Associations among maternal lifetime trauma, psychological symptoms in pregnancy, and infant stress reactivity and regulation. Dev Psychopathol, 1–18. 10.1017/s0954579422000402 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Foss S, So RP, Petty CR, Waber DP, Wright RJ, & Bosquet Enlow M (2022). Effects of maternal and child lifetime traumatic stress exposures, infant temperament, and caregiving quality on preschoolers’ executive functioning. Developmental Neuropsychology, 47(7), 327–352. 10.1080/87565641.2022.2147180 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Frenck RW Jr., Blackburn EH, & Shannon KM (1998). The rate of telomere sequence loss in human leukocytes varies with age. Proceedings of the National Academy of Sciences of the United States of America, 95(10), 5607–5610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gartstein MA, Putnam SP, & Rothbart MK (2012). Etiology of preschool behavior problems: Contributions of temperament attributes in early childhood. Infant Ment Health Journal, 33(2), 197–211. 10.1002/imhj.21312 [DOI] [PubMed] [Google Scholar]
- Gartstein MA, & Rothbart MK (2003). Studying infant temperament via a revision of the Infant Behavior Questionnaire. Infant Behavior & Development, 7, 517–522. [Google Scholar]
- Geronimus AT, Pearson JA, Linnenbringer E, Schulz AJ, Reyes AG, Epel ES, Lin J, Blackburn EH (2015). Race-ethnicity, poverty, urban stressors, and telomere length in a Detroit community-based sample. Journal of Health and Socical Behavior, 56(2), 199–224. 10.1177/0022146515582100 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goldman EA, Eick GN, Compton D, Kowal P, Snodgrass JJ, Eisenberg DTA, & Sterner KN (2018). Evaluating minimally invasive sample collection methods for telomere length measurement. American Journal of Human Biology, 30(1). 10.1002/ajhb.23062 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hansen ME, Hunt SC, Stone RC, Horvath K, Herbig U, Ranciaro A, Hirbo J, Beggs W, Reiner AP, Wilson JG, Kimura M, De Vivo I, Chen MM, Kark JD, Levy D, Nyambo T, Tishkoff SA, Aviv A (2016). Shorter telomere length in Europeans than in Africans due to polygenetic adaptation. Human Molecular Genetics, 25(11), 2234–2330. 10.1093/hmg/ddw070 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hochstrasser T, Marksteiner J, & Humpel C (2012). Telomere length is age-dependent and reduced in monocytes of Alzheimer patients. Experimental Gerontology, 47(2), 160–163. 10.1016/j.exger.2011.11.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Howell MP, Jones CW, Herman CA, Mayne CV, Fernandez C, Theall KP, Esteves KC, & Drury SS (2022). Impact of prenatal tobacco smoking on infant telomere length trajectory and ADHD symptoms at 18 months: a longitudinal cohort study. BMC Med, 20(1), 153. 10.1186/s12916-022-02340-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huffman LC, Bryan YE, del Carmen R, Pedersen FA, Doussard-Roosevelt JA, & Porges SW (1998). Infant temperament and cardiac vagal tone: assessments at twelve weeks of age. Child Dev, 69(3), 624–635. [PubMed] [Google Scholar]
- Humphreys KL, Sisk LM, Manczak EM, Lin J, & Gotlib IH (2020). Depressive symptoms predict change in telomere length and mitochondrial DNA copy number across adolescence. Journal of the American Academy of Child and Adolescent Psychiatry, 59(12), 1364–1370. 10.1016/j.jaac.2019.09.031 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huzen J, van der Harst P, de Boer RA, Lesman-Leegte I, Voors AA, van Gilst WH, Samani NJ, Jaarsma T, van Veldhuisen DJ (2010). Telomere length and psychological well-being in patients with chronic heart failure. Age and Ageing, 39(2), 223–227. 10.1093/ageing/afp256 [DOI] [PubMed] [Google Scholar]
- Jacobs TL, Epel ES, Lin J, Blackburn EH, Wolkowitz OM, Bridwell DA, Zanesco AP, Aichele SR, Sahdra BK, MacLean KA, King BG, Shaver PR, Rosenberg EL, Ferrer E, Wallace BA, Saron CD (2011). Intensive meditation training, immune cell telomerase activity, and psychological mediators. Psychoneuroendocrinology, 36(5), 664–681. 10.1016/j.psyneuen.2010.09.010 [DOI] [PubMed] [Google Scholar]
- Jones CW, Gray SAO, Theall KP, & Drury SS (2018). Polymorphic variation in the SLC5A7 gene influences infant autonomic reactivity and self-regulation: A neurobiological model for ANS stress responsivity and infant temperament. Psychoneuroendocrinology, 97, 28–36. 10.1016/j.psyneuen.2018.06.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Komsi N, Räikkönen K, Pesonen AK, Heinonen K, Keskivaara P, Järvenpää AL, & Strandberg TE (2006). Continuity of temperament from infancy to middle childhood. Infant Behavior & Development, 29(4), 494–508. 10.1016/j.infbeh.2006.05.002 [DOI] [PubMed] [Google Scholar]
- Kroenke CH, Epel E, Adler N, Bush NR, Obradovic J, Lin J, Blackburn E, Stamperdahl JL, & Boyce WT (2011). Autonomic and adrenocortical reactivity and buccal cell telomere length in Kindergarten children. Psychosom Med, 73(7), 533–540. 10.1097/PSY.0b013e318229acfc [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lansdorp PM (2022). Sex differences in telomere length, lifespan, and embryonic dyskerin levels. Aging Cell, 21(5), Article e13614. 10.1111/acel.13614 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee HY, & Doan SN (2020). Ethnicity moderates the association between autonomic functioning and temperament in preschool children. Journal of Genetic Psychology, 181(2–3), 181–190. 10.1080/00221325.2020.1751044 [DOI] [PubMed] [Google Scholar]
- Lin J, Epel E, Blackburn E (2012). Telomeres and lifestyle factors: roles in cellular aging. Mutation Research, 730(1–2), 85–89. 10.1016/j.mrfmmm.2011.08.003 [DOI] [PubMed] [Google Scholar]
- Lindqvist D, Epel ES, Mellon SH, Penninx BW, Révész D, Verhoeven JE, Reus VI, Lin J, Mahan L, Hough CM, Rosser R, Bersani FS, Blackburn EH, Wolkowitz OM (2015). Psychiatric disorders and leukocyte telomere length: Underlying mechanisms linking mental illness with cellular aging. Neuroscience and Biobehavioral Reviews, 55, 333–364. 10.1016/j.neubiorev.2015.05.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ly K, Walker C, Berry S, Snell R, Marks E, Thayer Z, Atatoa-Carr P, Morton S (2019). Telomere length in early childhood is associated with sex and ethnicity. Scientific Reports, 9(1), Article 10359. 10.1038/s41598-019-46338-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- Montpetit AJ, Alhareeri AA, Montpetit M, Starkweather AR, Elmore LW, Filler K, Mohanraj L, Burton CW, Menzies VS, Lyon DE, Jackson-Cook CK (2014). Telomere length: a review of methods for measurement. Nursing Research, 63(4), 289–299. 10.1097/nnr.0000000000000037 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Needham BL, Mezuk B, Bareis N, Lin J, Blackburn EH, & Epel ES (2015). Depression, anxiety and telomere length in young adults: evidence from the National Health and Nutrition Examination Survey. Molecular Psychiatry, 20(4), 520–528. 10.1038/mp.2014.89 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nelson BW, Allen NB, Laurent H (2018). Infant HPA axis as a potential mechanism linking maternal mental health and infant telomere length. Psychoneuroendocrinology, 88, 38–46. 10.1016/j.psyneuen.2017.11.008 [DOI] [PubMed] [Google Scholar]
- O’Donovan A, Lin J, Tillie J, Dhabhar FS, Wolkowitz OM, Blackburn EH, & Epel ES (2009). Pessimism correlates with leukocyte telomere shortness and elevated interleukin-6 in post-menopausal women. Brain, Behavior, and Immunity, 23(4), 446–449. 10.1016/j.bbi.2008.11.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perry NB, Dollar JM, Calkins SD, & Bell MA (2018). Developmental cascade and transactional associations among biological and behavioral indicators of temperament and maternal behavior. Child Development, 89(5), 1735–1751. 10.1111/cdev.12842 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Putnam SP, Gartstein MA, & Rothbart MK (2006). Measurement of fine-grained aspects of toddler temperament: The Early Childhood Behavior Questionnaire. Infant Behavior & Development, 29(3), 386–401. 10.1016/j.infbeh.2006.01.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Putnam SP, Rothbart MK, & Gartstein MA (2008). Homotypic and heterotypic continuity of fine-grained temperament during infancy, toddlerhood, and early childhood. Infant and Child Development, 17(4), 387–405. [Google Scholar]
- Révész D, Verhoeven JE, Milaneschi Y, & Penninx BW (2016). Depressive and anxiety disorders and short leukocyte telomere length: mediating effects of metabolic stress and lifestyle factors. Psychological Medicine, 46(11), 2337–2349. 10.1017/s0033291716000891 [DOI] [PubMed] [Google Scholar]
- Ridout KK, Levandowski M, Ridout SJ, Gantz L, Goonan K, Palermo D, Price LH, Tyrka AR (2018). Early life adversity and telomere length: a meta-analysis. Molecular Psychiatry, 23(4), 858–871. 10.1038/mp.2017.26 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ridout KK, Parade SH, Kao HT, Magnan S, Seifer R, Porton B, Price LH, & Tyrka AR (2019). Childhood maltreatment, behavioral adjustment, and molecular markers of cellular aging in preschool-aged children: A cohort study. Psychoneuroendocrinology, 107, 261–269. 10.1016/j.psyneuen.2019.05.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ridout KK, Ridout SJ, Price LH, Sen S, & Tyrka AR (2016). Depression and telomere length: A meta-analysis. Journal of Affective Disorders, 191, 237–247. 10.1016/j.jad.2015.11.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rode L, Nordestgaard BG, & Bojesen SE (2015). Peripheral blood leukocyte telomere length and mortality among 64,637 individuals from the general population. Journal of the National Cancer Institute, 107(6), Article djv074. 10.1093/jnci/djv074 [DOI] [PubMed] [Google Scholar]
- Rothbart MK, Ahadi SA, & Evans DE (2000). Temperament and personality: origins and outcomes. Journal of Personality and Social Psychology, 78(1), 122–135. 10.1037//0022-3514.78.1.122 [DOI] [PubMed] [Google Scholar]
- Rothbart MK, & Bates JE (2007). Temperament. In Handbook of child psychology: John Wiley & Sons, Inc. [Google Scholar]
- Rufer N, Brummendorf TH, Kolvraa S, Bischoff C, Christensen K, Wadsworth L, Schulzer M, Lansdorp PM (1999). Telomere fluorescence measurements in granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem cells and memory T cells in early childhood. Journal of Experimental Medicine, 190(2), 157–167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sadahiro R, Suzuki A, Enokido M, Matsumoto Y, Shibuya N, Kamata M, Goto K, Otani K (2015). Relationship between leukocyte telomere length and personality traits in healthy subjects. European Psychiatry, 30(2), 291–295. 10.1016/j.eurpsy.2014.03.003 [DOI] [PubMed] [Google Scholar]
- Sandvik AM, Bartone PT, Hystad SW, Phillips TM, Thayer JF, & Johnsen BH (2013). Psychological hardiness predicts neuroimmunological responses to stress. Psychology, Health, and Medicine, 18(6), 705–713. 10.1080/13548506.2013.772304 [DOI] [PubMed] [Google Scholar]
- Savolainen K, Eriksson JG, Kajantie E, Pesonen AK, & Raikkonen K (2015). Associations between the five-factor model of personality and leukocyte telomere length in elderly men and women: The Helsinki Birth Cohort Study (HBCS). Journal of Psychosomatic Research, 79(3), 233–238. 10.1016/j.jpsychores.2015.04.011 [DOI] [PubMed] [Google Scholar]
- Schoormans D, Verhoeven JE, Denollet J, van de Poll-Franse L, & Penninx B (2018). Leukocyte telomere length and personality: associations with the Big Five and Type D personality traits. Psychological Medicine, 48(6), 1008–1019. 10.1017/s0033291717002471 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schutte N, Palanisamy S, & McFarlane J (2016). The relationship between positive psychological characteristics and longer telomeres. Psychology & Health, 31(12), 1466–1480. 10.1080/08870446.2016.1226308 [DOI] [PubMed] [Google Scholar]
- Shalev I, Moffitt TE, Braithwaite AW, Danese A, Fleming NI, Goldman-Mellor S, Harrington JL, Houts RM, Israel S, Poulton R, Robertson SP, Sugden K, Williams B, Caspi A (2014). Internalizing disorders and leukocyte telomere erosion: a prospective study of depression, generalized anxiety disorder and post-traumatic stress disorder. Molecular Psychiatry, 19(11), 1163–1170. 10.1038/mp.2013.183 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sidorov I, Kimura M, Yashin A, & Aviv A (2009). Leukocyte telomere dynamics and human hematopoietic stem cell kinetics during somatic growth. Experimental Hematology, 37(4), 514–524. 10.1016/j.exphem.2008.11.009 [DOI] [PubMed] [Google Scholar]
- Squassina A, Pisanu C, Corbett N, & Alda M (2017). Telomere length in bipolar disorder and lithium response. European Neuropsychopharmacology, 27(6), 560–567. 10.1016/j.euroneuro.2015.10.008 [DOI] [PubMed] [Google Scholar]
- Sroufe LA, Egeland B, Carlson EA, & Collins WA (2005). The development of the person. New York: Guilford Press. [Google Scholar]
- Starnino L, Busque L, Tardif JC, & D’Antono B (2016). Psychological profiles in the prediction of leukocyte telomere length in healthy individuals. PLoS One, 11(10), Article e0165482. 10.1371/journal.pone.0165482 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stifter C, & Dollar J (2016). Temperament and developmental psychopathology: John Wiley & Sons Inc. [Google Scholar]
- Suzuki A, Matsumoto Y, Enokido M, Shirata T, Goto K, & Otani K (2017). Relationship between interpersonal sensitivity and leukocyte telomere length. BMC Medical Genetics, 18(1), 112. 10.1186/s12881-017-0473-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tervahartiala K, Kortesluoma S, Pelto J, Ahtola A, Karlsson H, Nolvi S, & Karlsson L (2021). Children’s diurnal cortisol output and temperament in two different childcare settings at 2 and 3.5 years of age. Developmental Psychobiology, 63 Suppl 1, Article e22223. 10.1002/dev.22223 [DOI] [PubMed] [Google Scholar]
- Van den Bergh BRH, van den Heuvel MI, Lahti M, Braeken M, de Rooij SR, Entringer S, Hoyer D, Roseboom T, Räikkönen K, King S, Schwab M (2017). Prenatal developmental origins of behavior and mental health: The influence of maternal stress in pregnancy. Neuroscience and Biobehavioral Reviews. 10.1016/j.neubiorev.2017.07.003 [DOI] [PubMed] [Google Scholar]
- van Ockenburg SL, de Jonge P, van der Harst P, Ormel J, & Rosmalen JG (2014). Does neuroticism make you old? Prospective associations between neuroticism and leukocyte telomere length. Psychological Medicine, 44(4), 723–729. 10.1017/s0033291713001657 [DOI] [PubMed] [Google Scholar]
- Verhoeven JE, Révész D, Wolkowitz OM, & Penninx BW (2014). Cellular aging in depression: Permanent imprint or reversible process?: An overview of the current evidence, mechanistic pathways, and targets for interventions. Bioessays, 36(10), 968–978. 10.1002/bies.201400068 [DOI] [PubMed] [Google Scholar]
- Wadhwa PD, Buss C, Entringer S, & Swanson JM (2009). Developmental origins of health and disease: brief history of the approach and current focus on epigenetic mechanisms. Seminars in Reproductive Medicine, 27(5), 358–368. 10.1055/s-0029-1237424 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H, Chen H, Gao X, McGrath M, Deer D, De Vivo I, Schwarzschild MA, Ascherio A (2008). Telomere length and risk of Parkinson’s disease. Movement Disorders, 23(2), 302–305. 10.1002/mds.21867 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Whisman MA, & Richardson ED (2017). Depressive symptoms and salivary telomere length in a probability sample of middle-aged and older adults. Psychosomatic Medicine, 79(2), 234–242. 10.1097/psy.0000000000000383 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wojcicki J, Heyman M, Elwan D, Shiboski S, Lin J, Blackburn E, & Epel E (2015). Telomere length is associated with oppositional defiant behavior and maternal clinical depression in Latino preschool children. Translational psychiatry, 5(6), e581. 10.1038/tp.2015.71 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wolkowitz OM, Mellon SH, Epel ES, Lin J, Dhabhar FS, Su Y, Reus VI, Rosser R, Burker HM, Kupferman E, Compagnone M, Nelson JC, Blackburn EH (2011). Leukocyte telomere length in major depression: correlations with chronicity, inflammation and oxidative stress--preliminary findings. PLoS One, 6(3), Article e17837. 10.1371/journal.pone.0017837 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wright AJ, & Jackson JJ (2022). Childhood temperament and adulthood personality differentially predict life outcomes. Scientific Reports, 12(1), Article 10286. 10.1038/s41598-022-14666-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xie W, Bathelt J, Fasman A, Nelson CA, & Bosquet Enlow M (2022). Temperament and psychopathology: The “community” to which you belong matters. Child Development. 10.1111/cdev.13742 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zalli A, Carvalho LA, Lin J, Hamer M, Erusalimsky JD, Blackburn EH, & Steptoe A (2014). Shorter telomeres with high telomerase activity are associated with raised allostatic load and impoverished psychosocial resources. Proceedings of the National Academy of Sciences of the United States of America, 111(12), 4519–4524. 10.1073/pnas.1322145111 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zeichner SL, Palumbo P, Feng Y, Xiao X, Gee D, Sleasman J, Goodenow M, Biggar R, Dimitrov D (1999). Rapid telomere shortening in children. Blood, 93(9), 2824–2830. [PubMed] [Google Scholar]
- Zerach G, Shevlin M, & Solomon Z (2020). Associations between hardiness, C-reactive protein, and telomere length among former prisoners of war. Health Psychology, 39(11), 1007–1012. 10.1037/hea0001030 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
