Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Jan 9;103(5):103420. doi: 10.1016/j.psj.2023.103420

Effects of puerarin as a feed additive on the laying performance, egg quality, endocrine hormones, antioxidant capacity, and intestinal morphology of aged laying hens

Xubin Du ⁎,†,1, Dong Zhao , Huifang Pian *, Yan Li *, Xinyue Wu *, Fei Liu †,2, Debing Yu ⁎,⁎⁎,1
PMCID: PMC10973177  PMID: 38518669

Abstract

The aim of this study was to investigate the effects of puerarin (Pue), a phytoestrogen, on the production performance, egg quality, endocrine hormones, antioxidant capacity, and intestinal morphology in aged laying hens. A total of 180 Hy-Line Brown hens aged 480 d were randomly divided into 4 groups (n = 45 per group) and fed 0, 200, 400, and 800 mg/kg of Pue (Con, L-Pue, M-Pue, and H-Pue, respectively) during a 42-d experiment. Compared with the Con treatment, supplementation with H-Pue improved laying performance and egg quality by significantly increasing egg production, average egg weight, albumen height, yolk weight, and Haugh unit (P < 0.05) while decreasing the feed conversion ratio (P < 0.05). A diet supplemented with H-Pue significantly decreasing serum total triglycerides, total cholesterol, and low-density lipoprotein cholesterol, alanine aminotransferase (P < 0.05), and significantly increasing serum levels of follicle-stimulating hormone, luteinizing hormone and progesterone (P < 0.05). Antioxidant activity was improved by significantly increasing the activity of total antioxidant capacity, glutathione peroxidase and catalase but decreasing malondialdehyde levels in serum, jejunum, and ileum (P < 0.05), and superoxide dismutase activity exhibited a significantly increase in the jejunum and ileum (P < 0.05). Villus height and the ratio of villus height to crypt depth (P < 0.05) were significantly increased in the jejunum and ileum. In the jejunal and ileal mucosa, the three treatment groups increased the mRNA expression levels of Claudin-1 and Claudin-2 compared with Con (P < 0.05), and no significant effect was observed on the expression of Occludin and ZO-1. The results showed that dietary supplementation with Pue could improve the laying performance, egg quality, antioxidant capacity, hormonal profile, and intestinal morphology of aged laying hens.

Key words: puerarin, aged laying hen, laying performance, antioxidant capacity, hormone level

INTRODUCTION

Recent research has demonstrated that age-related functional decline in biological systems (such as nutrient sensing, cellular senescence, gut microbiome and ageing phenotypes) can be slowed by nutritional interventions (Partridge et al., 2020). With increasing age, laying hens are prone to redox imbalances and chronic inflammation, which lead to a decline in production performance and egg quality (Liu et al., 2018c; Hasted et al., 2021). The main physiological problems of laying hens in the late laying period include deterioration of the reproductive system (Zhao et al., 2021), intestinal barrier dysfunction (Tang et al., 2019), and antioxidant and immune function decline (Liu et al., 2018b; Li et al., 2022). After the peak of egg production in hens, the number of follicles continues to decrease, and the atresia rate may increase, resulting in decreased ovarian function (Lillpers and Wilhelmson, 1993). Furthermore, intestinal function deteriorates and becomes dysfunctional in late-laying hens (Zhang et al., 2020). The calcium absorption capacity of the laying hens and the expression of intestinal calcium-binding proteins were substantially reduced, which led to insufficient calcium intake and poorer eggshell quality in the late laying period (Yosefi et al., 2003). The incomplete intestinal structure of aged laying hens increases their susceptibility to bacteria and viruses, and the decreased expression of micronutrient transporters in the intestine could affect the absorption and utilization of micronutrients (Jing et al., 2014; Soria et al., 2015).

Under normal conditions the redox balance of the animal is in equilibrium and homoeostasis is achieved, however under stress this can be upset resulting in oxidative stress (Uno and Nicholls, 2010). Normal metabolism produces reactive oxygen species (ROS), and the antioxidant defense system promptly removes and utilizes ROS to maintain the dynamic balance of redox reactions in the body (Xu et al., 2021). As the bird ages antioxidant enzyme levels fall, and as a result ROS may not be removed in a timely manner, increasing the risk of oxidative damage to lipids, DNA and proteins which can interfere with reproductive function (Liu et al., 2018a; Li et al., 2022).

Recent studies have revealed that flavonoids are a class of low molecular weight polyphenols. The core structure of flavonoids is the diphenylpropane (C6-C3-C6) skeleton, and their chemical properties depend on the degree of unsaturation and oxidation of the 3-carbon chain (Santos-Buelga and Feliciano, 2017; Shen et al., 2022). Flavonoids have been shown to have various biological activities that promote human health, including anti-inflammatory, antioxidant, antibacterial, anticancer, anti-diabetic, and hepatoprotective properties (Aroui et al., 2020; Marquez Campos et al., 2020; Wang et al., 2020). Puerarin (Pue) is a biologically active isoflavone glycoside that is structurally similar to estradiol, and thus exhibits estrogen-like effects while reducing oxidative stress in other animals (Qiu et al., 2017; Lee et al., 2018; Chen et al., 2021; Lyu et al., 2023). Considering the decreased physiological regulatory function of laying hens during the late laying period, antioxidants are receiving great interest. However, only a few studies have examined the effects of Pue as an avian antioxidant in older laying hens. In summary, this study investigated the effects of Pue on laying performance, egg quality, endocrine hormones, and intestinal health in aged laying hens.

MATERIALS AND METHODS

Preparation of Puerarin

Puerarin (98% purity) was purchased from Huatai Shaanxi Biotechnology Co., Ltd. (Xi'an, China).

Ethics Statement

All procedures were conducted under the guidelines of Nanjing Agricultural University Institutional Animal Care and Use Committee (Certification No.: SYXK(Su)2017-0007).

Animals, Diets, and Experimental Design

A total of 180 Hy-Line Brown laying hens aged 480 days old and having similar weights were obtained from a commercial laying hen farm (Taizhou, Jiangsu Province, China). All hens were housed in a fully enclosed lightweight steel structure with installed longitudinal ventilation system and wet curtain, and the floor is a cement floor. All the hens were randomly divided into four treatment groups with three replicates each, and each replicate contained 15 birds. The birds were kept in an individual wire cages (length: 50 cm, width: 45 cm, height: 42 cm), each cage was equipped with an individual nipple drinker. A continuous metal trough was partitioned by replicate to prevent hens from consuming feed designated for neighboring replicates. Environmental conditions were controlled at 20 to 25°C, humidity of 60 to 70% by a daily lighting schedule of 16 h light and 8 h dark per day, using incandescent lamp (light color is white) to give light intensity (30–40 LUX). Prior to the experiment, the laying hens were adaptively diets for 2 wk, and feed and fresh water were provided ad libitum before and during the experiment. The duration of the experiment was 42 d, and the hens were separately fed 4 different diets: basal diet (Con), basal diet + 200 mg/kg Pue (L-Pue), basal diet + 400 mg/kg Pue (M-Pue) and basal diet + 800 mg/kg Pue (H-Pue). The basal diet was formulated to meet or exceed the National Research Council recommendations, and details on the diet composition and nutrient content are presented in Table 1.

Table 1.

Composition and nutrient levels of basal diets (air dry basis, %).

Ingredients Content Calculated nutrient levels2 Content
Corn 62.00 Metabolizable energy (MJ/kg) 11.34
Soybean meal 25.00 Crude protein 15.52
Limestone 8.00 Lysine 0.71
Premix1 5.00 Methionine 0.36
Total 100.00 Methionine + Cysteine 0.53
Threonine 0.66
Calcium 3.40
Available Phosphorus 0.28
1

Premix provided the following per kg of the diet: VA 10,000 IU, VD3 3,000 IU, VE 30 IU, VK3 1 mg, VB1 1 mg, VB2 6 mg, VB6 3 mg, VB12 0.01 mg, biotin 0.1 mg, folic acid 0.3 mg, calcium pantothenate 10 mg, nicotinamide 40 mg, choline chloride 350 mg, NaCl 3 g, methionine 1 g, Cu (as copper sulfate) 8 mg, Fe (as ferrous sulfate)80 mg, Mn (as manganese sulfate) 100 mg, Zn (as zinc sulfate) 60 mg, I (as potassium iodide) l mg, Se (as sodium selenite) 0.3 mg.

2

Nutrient levels were calculated values.

Laying Performance Measurement

Eggs were collected daily throughout the study period. Egg production, egg weight, and feed intake were recorded to calculate laying rate (total egg production/total hens), average egg weight (AEW), average daily feed intake (ADFI) and feed conversion ratio (FCR). At the end of the experiment, six chickens were randomly selected from each group and killed by jugular vein exsanguination. Blood serum was centrifuged (3,000 rpm, 10 min) and stored at −20°C for later examination of serum biochemical parameters, hormone levels, and enzyme activity.

Egg Quality Assay

At the end of the study, 18 eggs from each group were collected and stored at 4°C until analysis (within 24 h). The longitudinal and transverse diameters of the egg were measured using a vernier caliper, and the egg shape index was computed as the ratio of the longitudinal diameter to the transverse diameter. Eggshell thickness were measured using a spiral micrometer, and eggshell strength was measured using an eggshell strength tester (KQ-1A type) (Beijing Tianxiang Feiyu Technology Co., Ltd., Beijing Shi, Chaoyang Qu, China.). An egg quality tester (Toukyo Rhythm Co., Ltd., Chuo Ward, Tokyo, Japan) was used to measure albumin height, haugh units (HU), yolk color, and yolk weight.

Serum Biochemical Parameters

Serum was collected from 6 chickens in each group, and the test was repeated 3 times for each serum. The levels of total protein (TP), total triglyceride (TG), total cholesterol (TC), glucose (GLU), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) were analyzed and determined using an automatic biochemical analyzer (NVAS6805, NOVATECH, Jinan, China). These kits were purchased from Nanjing Angle Gene Biotechnology Co., Ltd. (Nanjing, China).

Enzyme Activities

The test was repeated 3 times for each serum collected from 6 chickens in each group. Serum total antioxidant capacity (T-AOC), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and malondialdehyde (MDA) levels were determined using the appropriate kits according to the manufacturer's instructions. All kits were purchased from Nanjing Angle Gene Biotechnology Co., Ltd.

Hormone Determination

Serum samples were obtained from 6 chickens within each experimental group, and the assay was conducted thrice for every serum sample. The levels of estradiol (E2), follicle stimulating hormone (FSH), luteinizing hormone (LH), and progesterone (P4) were determined using ELISA. The assay kit was purchased from Angle Gene Biotechnology Co. Ltd. The reagent preparation and procedures were performed according to the manufacturer's instructions.

Intestinal Morphometry

The middle sections of the jejunum and ileum from 3 hens per group were harvested and rinsed several times with ice-cold phosphate-buffered saline (pH 7.4). Then, they were fixed with 4% paraformaldehyde and maintained at 4°C. Mucosas of jejunum and ileum were quickly scraped and washed thoroughly with ice-cold phosphate-buffered saline before being frozen in liquid nitrogen and stored at −80°C for intestinal antioxidant capacity as well as mRNA expression analysis. Nine complete, well-oriented villus and crypt units were selected for each intestinal cross section. Villus height (VH) was measured from the tip of the villi to the junction of the villus crypt, and crypt depth (CD) was defined as the depth of invagination between adjacent villus. The morphological indicators were determined using an image processing and analysis system (Leica Imaging Systems Ltd., Cambridge, UK).

Real-Time Quantitative (RT-PCR)

For total RNA extraction, a sample of 50.0 to 60.0 mg of intestinal mucosa was homogenized in 1.00 mL of TRIzol reagent (Invitrogen), and total RNA was extracted according to the manufacturer's instructions. RNA was reverse transcribed into cDNA using Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc., Santa Clara, CA). Each reaction was performed in triplicate on a LightCycler 96 Real-Time PCR System (Roche, Basel, Switzerland). All samples were repeated 3 times, and the mean and standard error values were calculated. Relative expression levels of all genes were calculated using the 2− ΔΔCT method (Livak and Schmittgen, 2001). The primer sequences, including Occludin, Claudin-1, Claudin-2, ZO-1, and β-actin and their gene bank ID numbers are presented in Table 2.

Table 2.

Sequences for real-time PCR primers.

Genes Gene Bank ID Primer Sequence (5′ -3′) Product length (bp)
Occludin NM_205128.1 F: CCGTAACCCCGAGTTGGAT
R: ATTGAGGCGGTCGTTGATG
214
Claudin-1 NM_001013611.2 F: AGGTGTACGACTCGCTGCTT
R: AGCCACTCTGTTGCCATACC
242
Claudin-2 NM_001277622.1 F: CCTGCTCACCCTCATTGGAG
R: GCTGAACTCACTCTTGGGCT
144
ZO-1 XM_015278975.2 F: TTTACATGATGACCGCCTGT
R: GAATCCTCCCTAACGGGTTC
213
β-actin NM_205518 F: TGCTGTGTTCCCATCTATCG
R: TTGGTGACAATACCGTGTTCA
150

Abbreviations: F, forward primer; R, reversed primer.

Statistical Analysis

All data were normalized using SPSS software (version 19.0) and subjected to statistical analysis using one-way analysis of variance (ANOVA). Duncan (D) multiple comparison test was used to compare differences among the different groups. Data are expressed as the mean ± standard error of the mean (SE). Differences were considered significant at P < 0.05, P < 0.01, or P < 0.001.

RESULTS

Effects of Pue on Laying Performances

As shown in Table 3, compared to the Con group, the laying rate of the group treated with Pue increased by 7.95, 14.34, and 11.99%, respectively (P < 0.05). No significant difference was observed in the ADFI (P > 0.05); however, the AEW of the treatment groups supplemented with Pue was enhanced by 0.36%, 4.86%, and 3.77%, respectively. In addition, the FCRs for L-Pue, M-Pue, and H-Pue were 0.92, 4.61, and 4.15 lower than those of Con, respectively. These results indicated that adding Pue to the diet could effectively improve the production performance of laying hens.

Table 3.

Effects of Pue on production performance in laying hens.

Item Con L - Pue M - Pue H - Pue P-value
Linear Quadratic
laying rate (%) 73.71 ± 0.011c 79.57 ± 0.006b 84.28 ± 0.007a 82.55 ± 0.010a <0.001 <0.001 <0.001
AEW (g) 60.51 ± 0.729b 60.73 ± 0.739b 63.45 ± 0.67a 62.79 ± 0.717a 0.007 0.008 0.144
ADFI (g) 130.94 ± 0.267 130.13 ± 0.277 131.03 ± 0.353 130.23 ± 0.445 0.184 0.710 0.016
FCR 2.17 ± 0.026a 2.15 ± 0.026a 2.07 ± 0.022b 2.08 ± 0.024b 0.003 0.160 0.198

Abbreviations: AEW, average egg weight. ADFI, average daily feed intake. FCR, feed conversion ratio.

Con, the control group, fed with the basal diet. L - Pue, fed with the basal diet supplemented with 200 mg /kg puerarin. M - Pue, fed with the basal diet supplemented with 400 mg/kg puerarin. H - Pue, fed with the basal diet supplemented with 800 mg/kg puerarin.

Values are mean ± SE of 45 hens.

a,b

Means within a row with different superscripts differ significantly (P < 0.05).

Effects of Pue on Egg Quality in Laying Hens

As shown in Table 4, the shape index, eggshell thickness and eggshell strength were not significantly different among the groups (P > 0.05); Compared to the Con group, albumen height, yolk weight, and HU were increased in the dietary groups supplemented with Pue (P < 0.05). In addition, no significant differences were observed in yolk color (P > 0.05). These results indicate that the addition of Pue to the diet enhanced egg quality.

Table 4.

Effects of Pue on egg quality in laying hens.

Item Con L - Pue M - Pue H - Pue P-value
Linear Quadratic
Shape index 1.31 ± 0.012 1.30 ± 0.008 1.32 ± 0.108 1.32 ± 0.011 0.487 0.376 0.893
Eggshell thickness (mm) 0.33 ± 0.008 0.36 ± 0.007 0.36 ± 0.008 0.36 ± 0.009 0.104 0.126 0.068
Eggshell strength (kgf/m2) 33.72 ± 2.068 34.31 ± 1.545 38.16 ± 2.682 35.38 ± 1.682 0.431 0.468 0.246
Albumen height (mm) 5.47 ± 0.291b 7.20 ± 0.299a 6.79 ± 0.292a 6.79 ± 0.227a <0.001 0.018 0.002
Yolk color 5.32 ± 0.276 5.94 ± 0.311 5.23 ± 0.218 5.47 ± 0.219 0.224 0.843 0.753
Yolk weight (g) 16.29 ± 0.413b 17.43 ± 0.303a 17.74 ± 0.335a 17.35 ± 0.326a 0.025 0.070 0.014
HU 68.70 ± 2.192b 82.88 ± 1.737a 80.74 ± 1.761a 81.03 ± 1.470a <0.001 <0.001 <0.001

Abbreviation: HU, Haugh units.

Con, the control group, fed with the basal diet. L - Pue, fed with the basal diet supplemented with 200 mg /kg puerarin. M - Pue, fed with the basal diet supplemented with 400 mg/kg puerarin. H - Pue, fed with the basal diet supplemented with 800 mg/kg puerarin.

Values are mean ± SE of 18 eggs.

a,b

Means within a row with different superscripts differ significantly (P < 0.05).

Effects of Pue on Parameters of Serum in Laying Hens

As shown in Table 5, compared with the Con group, the dietary addition of Pue significantly reduced the levels of TG, TC, and LDL-C in the serum of laying hens (P < 0.05). In addition, the serum ALT levels of M-Pue and H-Pue were significantly lower than those of Con (P < 0.05), and H-Pue significantly decreased by 28.42%. However, the serum levels of TP, GLU, HDL-C, and AST were not significantly different between the groups (P > 0.05). These results suggest that Pue can improve dyslipidemia in laying hens during the late laying period.

Table 5.

Effects of Pue on parameters of serum in laying hens.

Item Con L - Pue M - Pue H - Pue P-value
Linear Quadratic
TP (g/L)_ 58.75 ± 1.678 61.77 ± 1.561 58.58 ± 1.787 60.33 ± 1.738 0.518 0.804 0.895
TG (mmol/L) 19.58 ± 0.434a 16.55 ± 1.283bc 17.72 ± 0.694ab 14.45 ± 1.176c 0.010 0.003 0.908
TC (mmol/L) 5.31 ± 0.464a 4.58 ± 0.372ab 3.82 ± 0.237bc 3.29 ± 0.195c 0.002 <0.001 0.268
GLU (mmol/L) 12.59 ± 0.492 11.65 ± 0.221 12.23 ± 0.259 13.18 ± 0.512 0.076 0.112 0.063
HDL-C (mmol/L) 0.49 ± 0.033 0.50 ± 0.012 0.52 ± 0.094 0.54 ± 0.047 0.916 0.496 0.920
LDL-C (mmol/L) 2.64 ± 0.208a 2.31 ± 0.123ab 1.95 ± 0.070b 1.90 ± 0.076b 0.002 0.001 0.064
AST (U/L) 269.13 ± 13.447 268.28 ± 19.082 257.92 ± 14.393 251.82 ± 11.437 0.812 0.360 0.972
ALT (U/L) 23.82 ± 2.131a 23.05 ± 1.254a 20.10 ± 1.747ab 17.05 ± 1.044b 0.032 0.004 0.654

Abbreviations: TP, total protein. TG, total triglyceride. TC, total cholesterol. GLU, glucose. HDL-C, high-density lipoprotein cholesterol. LDL-C, low-density lipoprotein cholesterol. AST, aspartate aminotransferase. ALT, alanine aminotransferase.

Con, the control group, fed with the basal diet. L - Pue, fed with the basal diet supplemented with 200 mg /kg puerarin. M - Pue, fed with the basal diet supplemented with 400 mg/kg puerarin. H - Pue, fed with the basal diet supplemented with 800 mg/kg puerarin.

Values are mean ± SE of 6 hens.

a,b

Means within a row with different superscripts differ significantly (P < 0.05).

Effects of Pue on Antioxidative Capability of Laying Hens

As shown in Table 6, the levels of GSH-Px and CAT in the serum of M-Pue and H-Pue were significantly higher than those in the Con group (P < 0.05), the levels of T-AOC in both groups were also significantly higher than those in the Con group (P < 0.05). Although the serum SOD content in the Pue group was higher than that in the Con group, the difference was not significant (P > 0.05). In addition, serum MDA levels in the M-Pue and H-Pue groups were significantly lower than those in the Con group (P < 0.05). These results imply that Pue regulates the serum antioxidant activity in laying hens.

Table 6.

Effects of Pue on antioxidative capability of laying hens.

Item Con L - Pue M - Pue H - Pue P-value
Linear Quadratic
T-AOC(U/mL) 43.15 ± 1.726b 41.02 ± 2.344b 46.77 ± 1.861b 53.52 ± 2.820a 0.004 0.001 0.270
SOD (U/mL) 20.26 ± 1.349 21.10 ± 1.373 23.65 ± 1.351 26.05 ± 3.256 0.198 0.037 0.952
GSH-Px (U/mL) 150.52 ± 6.387c 149.95 ± 2.621c 165.43 ± 3.115b 180.44 ± 5.294a <0.001 <0.001 0.558
CAT (U/mL) 21.37 ± 0.899c 19.86 ± 0.874c 24.21 ± 1.047b 28.99 ± 0.632a <0.001 <0.001 0.062
MDA (nmol/mL) 5.04 ± 0.188a 4.92 ± 0.069a 4.45 ± 0.114b 3.82 ± 0.169c <0.001 <0.001 0.551

Abbreviations: T-AOC, total antioxidant capacity. SOD, superoxide dismutase. GSH-Px, glutathione peroxidase. CAT, catalase. MDA, malondialdehyde.

Con, the control group, fed with the basal diet. L - Pue, fed with the basal diet supplemented with 200 mg /kg puerarin. M - Pue, fed with the basal diet supplemented with 400 mg/kg puerarin. H - Pue, fed with the basal diet supplemented with 800 mg/kg puerarin.

Values are mean ± SE of 6 hens.

a,b

Means within a row with different superscripts differ significantly (P < 0.05).

Effects of Pue on Hormone Levels of Laying Hens

As shown in Table 7, serum E2 content was higher in the Pue group than in the Con group; however, the difference was not statistically significant (P > 0.05). Except for L-Pue, the serum FSH levels in M-Pue and H-Pue were significantly higher than those in the Con group (P < 0.05). Meanwhile, compared to the LH of the Con group, dietary supplementation with M-Pue and H-Pue significantly increased LH by 33.88% and 54.68%, respectively (P < 0.05). The P4 content of the L-Pue group was lower than that of the Con group, and that of the other 2 Pue groups was significantly higher than that of the Con group (P < 0.05). In addition, dietary supplementation with H-Pue significantly improved serum P4 levels by 27.05% (P < 0.05). These results suggest that Pue promotes estrogen secretion in aged laying hens.

Table 7.

Effects of Pue on serum hormone levels of laying hens.

Item Con L - Pue M - Pue H - Pue P-value
Linear Quadratic
E2 (pg/mL) 383.78 ± 12.902 390.40 ± 14.772 402.06 ± 17.360 425.06 ± 12.841 0.233 0.045 0.854
FSH (IU/L) 2.28 ± 0.147c 2.11 ± 0.104c 2.91 ± 0.115b 4.01 ± 0.131a <0.001 <0.001 0.011
LH (ng/L) 7.26 ± 0.555b 8.01 ± 0.620b 9.72 ± 0.527a 11.23 ± 0.448a <0.001 <0.001 0.680
P4 (ng/mL) 22.92 ± 1.217b 22.08 ± 0.987b 25.10 ± 1.482ab 29.12 ± 1.752a 0.009 0.001 0.338

Abbreviations: E2, estradiol. FSH, folliclestimulating hormone. LH, luteinizing hormone. P4, progesterone.

Con, the control group, fed with the basal diet. L - Pue, fed with the basal diet supplemented with 200 mg /kg puerarin. M - Pue, fed with the basal diet supplemented with 400 mg/kg puerarin. H - Pue, fed with the basal diet supplemented with 800 mg/kg puerarin.

Values are mean ± SE of 6 hens.

a,b

Means within a row with different superscripts differ significantly (P < 0.05).

Effects of Pue on Antioxidant Capacity of Jejunum and Ileum of Laying Hens

Similar to the detection results of serum antioxidant levels, the levels of T-AOC, SOD, GSH-Px, and CAT in the jejunum and ileum of the Pue treatment groups were higher than those in the Con group. The antioxidant indices (T-AOC, SOD, GSH-Px, and CAT) of H-Pue were significantly higher than those of the other 3 groups (P < 0.05). In addition, the MDA content of H-Pue was significantly lower than that of the Con in the jejunum and ileum (P < 0.05). These results indicated that Pue not only improved serum antioxidant levels, but also effectively increased antioxidant levels in intestinal tissues, as shown in Table 8.

Table 8.

Effects of Pue on antioxidant capacity of jejunum and ileum of laying hens.

P-value
Item Con L - Pue M - Pue H - Pue Linear Quadratic
Jejunum
T-AOC (U/mg) 15.05 ± 0.453c 18.11 ± 0.821b 19.05 ± 0.835b 23.18 ± 0.741a <0.001 <0.001 0.699
SOD (U/mg) 10.05 ± 0.473c 10.51 ± 0.455c 12.50 ± 0.585b 16.08 ± 0.676a <0.001 <0.001 0.221
GSH-Px (U/mg) 64.21 ± 2.173c 67.10 ± 2.669c 74.27 ± 2.234b 81.71 ± 2.282a <0.001 <0.001 0.879
CAT (U/mg) 7.54 ± 0.292c 8.56 ± 0.255c 10.09 ± 0.271b 12.15 ± 0.520a <0.001 <0.001 0.847
MDA (nmol/mg) 0.86 ± 0.027a 0.89 ± 0.044a 0.81 ± 0.032ab 0.74 ± 0.018b 0.014 0.003 0.389
Ileum
T-AOC (U/mg) 13.34 ± 0.510d 15.32 ± 0.610c 18.02 ± 0.928b 22.15 ± 0.525a <0.001 <0.001 0.869
SOD (U/mg) 12.11 ± 0.587b 13.04 ± 1.585b 14.56 ± 0.687b 17.58 ± 0.538a 0.003 <0.001 0.739
GSH-Px (U/mg) 58.26 ± 2.395b 62.52 ± 2.388b 65.10 ± 2.013b 72.79 ± 2.295a 0.002 <0.001 0.980
CAT (U/mg) 6.00 ± 0.160d 7.43 ± 0.213c 8.60 ± 0.303b 9.90 ± 0.264a <0.001 <0.001 0.030
MDA (nmol/mg) 0.79 ± 0.028a 0.76 ± 0.028a 0.71 ± 0.031ab 0.63 ± 0.025b 0.004 <0.001 0.947

Abbreviations: T-AOC, total antioxidant capacity. SOD, superoxide dismutase. GSH-Px, glutathione peroxidase. CAT, catalase. MDA, malondialdehyde.

Con, the control group, fed with the basal diet. L - Pue, fed with the basal diet supplemented with 200 mg /kg puerarin. M - Pue, fed with the basal diet supplemented with 400 mg/kg puerarin. H - Pue, fed with the basal diet supplemented with 800 mg/kg puerarin.

Values are mean ± SE of 6 hens.

a,b,c,d

Means within a row with different superscripts differ significantly (P < 0.05).

Effect of Pue on the Intestinal Morphology

In the jejunum and ileum, the VH was significantly higher in M-Pue and H-Pue than in Con group (P < 0.05), and there was no discernible change in the CD among the three additive groups in comparison to the Con group (P > 0.05). The VH/CD ratio of the three groups supplemented with Pue were higher than that of Con group, but only M-Pue and H-Pue showed significant differences (P < 0.05), as shown in Table 9. Meanwhile, as shown in Figure 1, the jejunal vilius of the Con group were swollen and broken, whereas the ileal vilius were broken, atrophied, and disordered. When laying hens were fed the Pue diet in the late laying period, the villi of the jejunum and ileum showed only slight cleavage and were partially oedematous but neatly arranged. Based on the above results, dietary addition of Pue prevented intestinal villus degeneration in aged laying hens and maintained normal intestinal morphology.

Table 9.

Effect of Pue on the intestinal morphology.

P-value
Item Con L - Pue M - Pue H - Pue Linear Quadratic
Jejunum
VH (μm) 783.08 ± 24.474b 788.72 ± 19.95b 1042.29 ± 28.11a 1077.03 ± 24.56a <0.001 <0.001 0.041
CD (μm) 156.12 ± 9.932 145.61 ± 7.692 143.71 ± 6.907 140.19 ± 6.672 0.524 0.187 0.531
VH/CD ratio 5.42 ± 0.290b 5.78 ± 0.297b 7.64 ± 0.379a 8.10 ± 0.385a <0.001 <0.001 0.174
Ileum
VH (μm) 805.05 ± 30.228c 817.84 ± 7.230c 960.18 ± 24.228a 877.81 ± 12.853b <0.001 0.002 <0.001
CD (μm) 143.09 ± 9.106 130.31 ± 7.036 132.65 ± 7.042 131.47 ± 6.932 0.615 0.395 0.418
VH/CD ratio 6.20 ± 0.447b 6.79 ± 0.382ab 7.75 ± 0.426a 7.16 ± 0.391ab 0.064 0.087 0.054

Abbreviations: VH, villus height. CD, crypt depth. VH/CD ratio, villus height/ crypt depth ratio.

Con, the control group, fed with the basal diet. L - Pue, fed with the basal diet supplemented with 200 mg /kg puerarin. M - Pue, fed with the basal diet supplemented with 400 mg/kg puerarin. H - Pue, fed with the basal diet supplemented with 800 mg/kg puerarin.

Values are mean ± SE of 6 hens.

a,b,c

Means within a row with different superscripts differ significantly (P < 0.05).

Figure 1.

Figure 1

Effects of Pue supplementation on the intestinal morphology of jejunum and ileum in the aged laying hens. Con, the control group, fed with the basal diet. L - Pue, fed with the basal diet supplemented with 200 mg /kg puerarin. M - Pue, fed with the basal diet supplemented with 400 mg/kg puerarin. H - Pue, fed with the basal diet supplemented with 800 mg/kg puerarin. The following groups were the same.

Intestinal Barrier-Associated Gene Expression

As shown in Figure 2A, in the jejunal mucosa, the mRNA expression levels of Claudin-1 and Claudin-2 were increased in the other three groups (P < 0.05), and the expression level in M-Pue was the highest (P < 0.001). However, the mRNA expression levels of Occludin and ZO-1 did not differ among the four groups (P > 0.05). Similar results were observed for the ileal mucosa (Figure 2B). For example, the mRNA expression levels of Claudin-2 and Claudin-1 were higher in the Pue group than in the control group (P < 0.05), but Claudin-2 was highest in the H-Pue group. These results suggest that Pue could regulate the expression of some genes related to intestinal tight junctions in the jejunal and ileal mucosa.

Figure 2.

Figure 2

Effects of Pue supplementation on the relative mRNA abundances of tight junction in the mucosas of jejunum (A) and ileum (B) from aged laying hens. Values are mean ± SE of 3 hens.

*: P < 0.05, **: P < 0.01, ***: P < 0.001.

DISSCUSSION

Puerarin is the major bioactive ingredient isolated from the root of the Pueraria lobata (Willd.) Ohwi, which is well known as Gegen (Chinese name) in traditional Chinese medicine (Zhou et al., 2014; Jeon et al., 2020; Kulczynski et al., 2021; Zhou et al., 2022). Previous studies have revealed that Pue is a natural antioxidant with high health value and has various biological activities, such as anti-inflammatory, anti-oxidation, anti-tumor, immunity enhancement, and protection of the cardiovascular and cerebrovascular systems (Zhou et al., 2014; Wang et al., 2020). Guo et al., 2023 observed that dietary supplementation with Pue did not increase the average daily gain but improved the antioxidant capacity and intestinal integrity of broilers. Research has elucidated Pue's potential to ameliorate intestinal function in PEDV-infected piglets (Wu et al., 2021) and mitigate inflammation and apoptosis induced by Mycoplasma gallisepticum by suppressing the chicken TLR6/MyD88/NF-κB signaling pathway (Niu et al., 2020). Additionally, daidzein, an isoflavone inherent in soybeans, has been noted for its positive impact on the laying performance and egg quality in post-peak laying hens (Zhang et al., 2021). Nevertheless, investigations focusing on the performance, serum biochemical indices, antioxidant levels, estrogen secretion, and intestinal integrity of laying hens, especially during the late laying period, are scarce. Consequently, the primary aim of this study was to assess the impact of varied dietary levels of Pue on the performance and internal homeostasis of aging laying hens.

From the perspective of breeding production, studying the effects of Pue on laying performance of laying hens after the peak laying period is of great economic value. Within the scope of our investigation, administering moderate (400 mg/kg) to elevated (800 mg/kg) concentrations of Pue in the diet elicited a notable augmentation in laying rate coupled with a noteworthy reduction in the feed conversion ratio among aged laying hens. Egg quality is a core factor in the development of the laying hen industry (Wang et al., 2018). Albumen quality is the standard for measuring egg quality and is usually measured using albumen height and HU. Nonetheless, both albumen height and HU exhibit a diminishing trajectory as hens age (Silversides and Scott, 2001; Wang et al., 2018). Previous investigations have consistently demonstrated a noteworthy enhancement in egg quality when laying hens were nourished with diets enriched with vitamins (C and E), tea powder, or tea polyphenol (Biswas et al., 2000; Franchini et al., 2002; Yuan et al., 2016; Wang et al., 2018). In the present investigation, supplementing the diet with over 200 mg/kg of Pue markedly heightened albumen height, yolk weight, and HU among hens in the latter stages of laying. To summarize, our findings unequivocally advocate for Pue as a superior feed additive, effectively extending production performance and enhancing egg quality in aging laying hens.

Blood biochemical indices serve as crucial biomarkers, indicative of the health status and normal metabolic functioning of organisms (Hu et al., 2021; Yao et al., 2023). Earlier investigations have demonstrated that Radix Puerariae flavones effectively impede the accumulation of TG and TC in the livers of ovariectomized rats (Wang et al., 2004). Likewise, Bao et al. (2015) found that Pue significantly reduced the levels of TC, TG, and LDL-C and elevated the HDL-C levels in the serum from induced-atherosclerosis of rabbits. In this study, dietary Pue supplementation significantly decreased the levels of TG, TC, and LDL-C in the serum of aging laying hens compared with the Con group. However, no significant variance was observed in the levels of HDL-C. Furthermore, serum levels of AST and ALT have been substantiated as valuable surrogate indicators for assessing hepatic function (Ma et al., 2021). In general, serum ALT and AST levels are extremely low under normal circumstances and are released into the blood unless the liver is subjected to stress damage or liver cell permeability is increased (Mani et al., 2013). In the present study, the activities of ALT in the serum were reduced by dietary Pue supplementation (P < 0.05), implying that age-related decline in hepatic function in laying hens might be prevented by the use of Pue.

Oxidative damage plays a key role in the pathological processes involved in aging and age-related disorders (Sekhar, 2021). The onset of aging is attributed to the assault of oxygen free radicals on cellular constituents. Augmenting appropriate levels of antioxidants and free radical scavengers has the potential to decelerate the aging process (Martemucci et al., 2022). SOD, GSH-Px, and CAT are the main endogenous antioxidant enzymes that exist in the body and their function is to cooperate with each other to clear superoxide and lipid peroxide, forming a line of defense against ROS damage (Akbarian et al., 2016; Guo et al., 2023). Malondialdehyde is a product of lipid peroxidation produced during oxidative stress and can be used as an index to measure the degree of oxidative stress in the cell (Tas Cengiz et al., 2023). Previous studies have confirmed that Pue treatment significantly increases SOD, CAT, and GSH-Px levels in the serum of STZ-induced diabetic rats (She et al., 2014). In addition, Zhu et al. (2021) found that dietary supplementation with neohesperidin increased the antioxidant capacity by enhancing T-AOC of the serum in laying hens. In the current investigation, a notable augmentation in serum antioxidant activity (T-AOC, GSH-Px, and CAT) was discerned, accompanied by a consequential reduction in serum MDA levels upon supplementation with 400 and 800 mg/kg Pue in the diets administered to laying hens. Consequently, our findings posit that Pue supplementation has the potential to enhance serum antioxidant capacity in post-peak laying hens.

Estrogen serves as a pivotal regulator in the orchestration of female reproductive development. Notably, the age-related downregulation of estrogen secretion emerges as a crucial determinant contributing to the decline in egg production among post-peak laying hens (Liu and Zhang, 2008; Lim et al., 2015; Hao et al., 2020; Colella et al., 2021; Zhang et al., 2021). Broadly, FSH and LH assume pivotal roles in the intricate processes of folliculogenesis and ovulation (Tarumi et al., 2014). Within the follicles, the E2 undergoes synergistic regulation orchestrated by FSH and LH (Liu et al., 2023). A dose-dependent relationship between plasma E2 and oviduct growth exists, hence, E2 reflects ovarian follicular development, which in turn predicts future egg production (Zhang et al., 2021). Analogously, P4 is co-regulated by FSH and LH, which are involved in regulating gonadal development and reproduction (Li et al., 2023). Recent evidence has shown that dietary supplementation with 150 mg/kg curcumin increases FSH and LH concentrations in heat-stressed laying hens (Liu et al., 2020). Furthermore, researchers found that quercetin-supplemented diets increased serum E2, LH, FSH, or P4 in laying hens compared to control (Yang et al., 2018; Liu et al., 2023). Nevertheless, the effect of Pue on estrogen secretion in aged laying hens remains unclear. Here, we found that a diet supplemented with Pue increased the levels of LH, FSH, and P4 in the serum of laying hens to varying degrees. Notably, high doses of Pue were more effective than low doses.

Numerous studies have suggested that plant-derived bioactive compounds (including Pue, curcumin, quercetin, and baicalein) can inhibit fundamental processes involved in the pathogenesis of endometriosis, such as proliferation, inflammation, ROS formation, and angiogenesis (Cheng et al., 2012; Li et al., 2021; Meresman et al., 2021; Yen et al., 2023). In addition, investigations have demonstrated that Pue has the capability to bind to estrogen receptors (ERs), thereby exhibiting a mild estrogenic effect. Cheng et al. (2012) showed that Pue could inhibit endometriotic stromal cell proliferation through MAPK signaling pathway induced by 17β-estradiol-BSA. Hwang et al. (2006) found that soy isoflavone exerted some of the activity of ER agonists and antagonists depending on the concentration of estrogen in the body, it might function as an estrogen antagonist in a high-estrogen environment and vice versa. Consequently, we hypothesize that the concentration of estrogen in post-peak laying hens is comparatively low, and Pue may act as an agonist, binding with ER to facilitate folliculogenesis and estrogen secretion. Further research will be conducted on the signaling pathways through which Pue stimulates the recovery of normal estrogen secretion and ovarian function in older laying hens.

When the growth of the intestinal villi is healthy and orderly, devoid of evident tissue damage or pathological alterations, it serves not only to enhance nutrient absorption but also to withstand pathogenic microorganisms (Heo et al., 2013; Patra et al., 2019). Therefore, the integrity of the intestinal mucosal barrier is necessary for intestinal epithelial cells to perform normal functions and resist pathogenic bacteria (Wijtten et al., 2011). Prior investigations have indicated that Pue induces mucin secretion, fosters goblet cell differentiation, and facilitates the restoration of intestinal mucosal integrity (Li et al., 2020; Wu et al., 2020; Guo et al., 2023). An increase in VH indicates an increase in surface area for nutrient absorption, whereas an increase in CD indicates a rapid high demand for tissue renewal, which is often associated with a decline in the capacity of the host to digest and absorb nutrients (Shi et al., 2020). Here, HE staining showed that supplementation with 400 or 800 mg/kg of Pue increased the VH and VH/CD ratio in the jejunum and ileum. Concurrently, it was observed that the incorporation of 800 mg/kg of Pue into the diet resulted in a significant elevation in the levels of T-AOC, SOD, GSH-Px, and CAT, accompanied by a notable reduction in MDA content in both the jejunum and ileum. Moreover, Pue has been reported to alleviate sleep disorders in aged mice by increasing intestinal barrier protein levels (ZO-1, Occludin, Claudin 1, and E-cadherin) (Tao et al., 2023). Barrier proteins are known to act as critical intestinal mucosal barriers, preventing the transfer of pathogens, antigens, and intraluminal toxins into the systemic blood circulation (Ulluwishewa et al., 2011). In our study, dietary Pue supplementation affected mRNA expression of claudin-1 and claudin-2 in the mucosa of the jejunum and ileum. The above results indicate that the addition of Pue could ameliorate age-induced damage to the intestinal morphology of laying hens by increasing the VH/CD ratio and the antioxidant index, regulating the expression of tight junction protein-related genes, thereby facilitating the digestion and absorption of nutrients accordingly.

CONCLUSIONS

In conclusion, dietary supplementation with Pue increased the laying performance and egg quality by improving the antioxidant state, promoting the secretion of hormones, preserving intestinal morphology, and regulating the expression of intestinal barrier-associated genes in aged laying hens. Our results demonstrate that Pue can be used as a functional feed additive to prolong the economic benefits for aged laying hens.

ACKNOWLEDGMENTS

This study was financially supported by the Jiangsu Provincial Agricultural Science and Technology Independent Innovation Fund (JASTIF, CX(22)3196).

DISCLOSURES

The authors have declared that there are no competing interests related to this work.

REFERENCES

  1. Akbarian A., Michiels J., Degroote J., Majdeddin M., Golian A., De Smet S. Association between heat stress and oxidative stress in poultry; mitochondrial dysfunction and dietary interventions with phytochemicals. J. Anim. Sci. Biotechnol. 2016;7:37. doi: 10.1186/s40104-016-0097-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aroui S., Fetoui H., Kenani A. Natural dietary compound naringin inhibits glioblastoma cancer neoangiogenesis. BMC Pharmacol. Toxicol. 2020;21:46. doi: 10.1186/s40360-020-00426-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bao L., Zhang Y., Wei G., Wang Y., Ma R., Cheng R., Ren X., Agula B. The anti-atherosclerotic effects of puerarin on induced-atherosclerosis in rabbits. Biomed. Pap. Med. Fac. Univ. Palacky Olomouc Czech Repub. 2015;159:53–59. doi: 10.5507/bp.2013.096. [DOI] [PubMed] [Google Scholar]
  4. Biswas A.H., Miyazaki Y., Nomura K., Wakita M. Influences of long-term feeding of Japanese green tea powder on laying performance and egg quality in hens. Asian-Australasian J. Anim. Sci. 2000;13:980–985. [Google Scholar]
  5. Chen C., Li S., Hu C., Cao W., Fu Q., Li J., Zheng L., Huang J. protective effects of puerarin on premature ovarian failure via regulation of Wnt/β-catenin signaling pathway and oxidative stress. Reprod. Sci. 2021;28:982–990. doi: 10.1007/s43032-020-00325-0. [DOI] [PubMed] [Google Scholar]
  6. Cheng W., Chen L., Yang S., Han J., Zhai D., Ni J., Yu C., Cai Z. Puerarin suppresses proliferation of endometriotic stromal cells partly via the MAPK signaling pathway induced by 17ss-estradiol-BSA. PLoS One. 2012;7:e45529. doi: 10.1371/journal.pone.0045529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Colella M., Cuomo D., Peluso T., Falanga I., Mallardo M., De Felice M., Ambrosino C. Ovarian aging: role of pituitary-ovarian axis hormones and ncRNAs in regulating ovarian mitochondrial activity. Front. Endocrinol. (Lausanne) 2021;12 doi: 10.3389/fendo.2021.791071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Franchini A., Sirri F., Tallarico N., Minelli G., Iaffaldano N., Meluzzi A. Oxidative stability and sensory and functional properties of eggs from laying hens fed supranutritional doses of vitamins E and C. Poult. Sci. 2002;81:1744–1750. doi: 10.1093/ps/81.11.1744. [DOI] [PubMed] [Google Scholar]
  9. Guo S., Hu J., Ai S., Li L., Ding B., Zhao D., Wang L., Hou Y. Effects of Pueraria extract and curcumin on growth performance, antioxidant status and intestinal integrity of broiler chickens. Animals (Basel) 2023;13 doi: 10.3390/ani13081276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hao E.Y., Chen H., Wang D.H., Huang C.X., Tong Y.G., Chen Y.F., Zhou R.Y., Huang R.L. Melatonin regulates the ovarian function and enhances follicle growth in aging laying hens via activating the mammalian target of rapamycin pathway. Poult. Sci. 2020;99:2185–2195. doi: 10.1016/j.psj.2019.11.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hasted T.L., Sharif S., Boerlin P., Diarra M.S. Immunostimulatory potential of fruits and their extracts in poultry. Front. Immunol. 2021;12 doi: 10.3389/fimmu.2021.641696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Heo J.M., Opapeju F.O., Pluske J.R., Kim J.C., Hampson D.J., Nyachoti C.M. Gastrointestinal health and function in weaned pigs: a review of feeding strategies to control post-weaning diarrhoea without using in-feed antimicrobial compounds. J. Anim. Physiol. Anim. Nutr. (Berl) 2013;97:207–237. doi: 10.1111/j.1439-0396.2012.01284.x. [DOI] [PubMed] [Google Scholar]
  13. Hu H., Bai X., Xu K., Zhang C., Chen L. Effect of phloretin on growth performance, serum biochemical parameters and antioxidant profile in heat-stressed broilers. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hwang C.S., Kwak H.S., Lim H.J., Lee S.H., Kang Y.S., Choe T.B., Hur H.G., Han K.O. Isoflavone metabolites and their in vitro dual functions: they can act as an estrogenic agonist or antagonist depending on the estrogen concentration. J. Steroid Biochem. Mol. Biol. 2006;101:246–253. doi: 10.1016/j.jsbmb.2006.06.020. [DOI] [PubMed] [Google Scholar]
  15. Jeon Y.D., Lee J.H., Lee Y.M., Kim D.K. Puerarin inhibits inflammation and oxidative stress in dextran sulfate sodium-induced colitis mice model. Biomed. Pharmacother. 2020;124 doi: 10.1016/j.biopha.2020.109847. [DOI] [PubMed] [Google Scholar]
  16. Jing M., Munyaka P.M., Tactacan G.B., Rodriguez-Lecompte J.C., O K, House J.D. Performance, serum biochemical responses, and gene expression of intestinal folate transporters of young and older laying hens in response to dietary folic acid supplementation and challenge with Escherichia coli lipopolysaccharide. Poult. Sci. 2014;93:122–131. doi: 10.3382/ps.2013-03384. [DOI] [PubMed] [Google Scholar]
  17. Kulczynski B., Gramza-Michalowska A., Suliburska J., Sidor A. Puerarin-an isoflavone with beneficial effects on bone health. Front. Biosci. (Landmark Ed) 2021;26:1653–1667. doi: 10.52586/5058. [DOI] [PubMed] [Google Scholar]
  18. Lee J.H., Jeon Y.D., Lee Y.M., Kim D.K. The suppressive effect of puerarin on atopic dermatitis-like skin lesions through regulation of inflammatory mediators in vitro and in vivo. Biochem. Biophys. Res. Commun. 2018;498:707–714. doi: 10.1016/j.bbrc.2018.03.018. [DOI] [PubMed] [Google Scholar]
  19. Li B., Liu M., Wang Y., Gong S., Yao W., Li W., Gao H., Wei M. Puerarin improves the bone micro-environment to inhibit OVX-induced osteoporosis via modulating SCFAs released by the gut microbiota and repairing intestinal mucosal integrity. Biomed. Pharmacother. 2020;132 doi: 10.1016/j.biopha.2020.110923. [DOI] [PubMed] [Google Scholar]
  20. Li C., Cao Y., Ren Y., Zhao Y., Wu X., Si S., Li J., Li Q., Zhang N., Li D., Li G., Liu X., Kang X., Jiang R., Tian Y. The adiponectin receptor agonist, AdipoRon, promotes reproductive hormone secretion and gonadal development via the hypothalamic-pituitary-gonadal axis in chickens. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li H., Gu Y., Jin R., He Q., Zhou Y. Effects of dietary rutin supplementation on the intestinal morphology, antioxidant capacity, immunity, and microbiota of aged laying hens. Antioxidants (Basel) 2022;11 doi: 10.3390/antiox11091843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li W., Hu H., Zou G., Ma Z., Liu J., Li F. Therapeutic effects of puerarin on polycystic ovary syndrome: a randomized trial in Chinese women. Medicine (Baltimore) 2021;100:e26049. doi: 10.1097/MD.0000000000026049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lillpers K., Wilhelmson M. Age-dependent changes in oviposition pattern and egg production traits in the domestic hen. Poult. Sci. 1993;72:2005–2011. doi: 10.3382/ps.0722005. [DOI] [PubMed] [Google Scholar]
  24. Lim J., Nakamura B.N., Mohar I., Kavanagh T.J., Luderer U. Glutamate cysteine ligase modifier subunit (Gclm) null mice have increased ovarian oxidative stress and accelerated age-related ovarian failure. Endocrinology. 2015;156:3329–3343. doi: 10.1210/en.2015-1206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Liu H.Y., Zhang C.Q. Effects of daidzein on messenger ribonucleic acid expression of gonadotropin receptors in chicken ovarian follicles. Poult. Sci. 2008;87:541–545. doi: 10.3382/ps.2007-00274. [DOI] [PubMed] [Google Scholar]
  26. Liu J., Fu Y., Zhou S., Zhao P., Zhao J., Yang Q., Wu H., Ding M., Li Y. Comparison of the effect of quercetin and daidzein on production performance, anti-oxidation, hormones, and cecal microflora in laying hens during the late laying period. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liu M., Lu Y., Gao P., Xie X., Li D., Yu D., Yu M. Effect of curcumin on laying performance, egg quality, endocrine hormones, and immune activity in heat-stressed hens. Poult. Sci. 2020;99:2196–2202. doi: 10.1016/j.psj.2019.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Liu X., Lin X., Zhang S., Guo C., Li J., Mi Y., Zhang C. Lycopene ameliorates oxidative stress in the aging chicken ovary via activation of Nrf2/HO-1 pathway. Aging (Albany NY) 2018;10:2016–2036. doi: 10.18632/aging.101526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Liu X.T., Lin X., Mi Y.L., Zeng W.D., Zhang C.Q. Age-related changes of yolk precursor formation in the liver of laying hens. J. Zhejiang Univ. Sci. B. 2018;19:390–399. doi: 10.1631/jzus.B1700054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Liu Z., Sun C., Yan Y., Li G., Shi F., Wu G., Liu A., Yang N. Genetic variations for egg quality of chickens at late laying period revealed by genome-wide association study. Sci. Rep. 2018;8:10832. doi: 10.1038/s41598-018-29162-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  32. Lyu C., Yuan B., Meng Y., Cong S., Che H., Ji X., Wang H., Chen C., Li X., Jiang H., Zhang J. Puerarin alleviates H2O2-induced oxidative stress and blood-milk barrier impairment in dairy cows. Int. J. Mol. Sci. 2023;24 doi: 10.3390/ijms24097742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Ma Y., Shi Y., Wu Q., Ma W. Epigallocatechin-3-gallate alleviates vanadium-induced reduction of antioxidant capacity via Keap1-Nrf2-sMaf pathway in the liver, kidney, and ovary of laying hens. Biol. Trace Elem. Res. 2021;199:2707–2716. doi: 10.1007/s12011-020-02398-z. [DOI] [PubMed] [Google Scholar]
  34. Mani V., Ramasamy K., Ahmad A., Wahab S.N., Jaafar S.M., Kek T.L., Salleh M.Z., Majeed A.B. Effects of the total alkaloidal extract of Murraya koenigii leaf on oxidative stress and cholinergic transmission in aged mice. Phytother. Res. 2013;27:46–53. doi: 10.1002/ptr.4676. [DOI] [PubMed] [Google Scholar]
  35. Marquez Campos E., Jakobs L., Simon M.C. Antidiabetic effects of Flavan-3-ols and their microbial metabolites. Nutrients. 2020;12 doi: 10.3390/nu12061592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Martemucci G., Portincasa P., Di Ciaula A., Mariano M., Centonze V., D'Alessandro A.G. Oxidative stress, aging, antioxidant supplementation and their impact on human health: an overview. Mech. Ageing Dev. 2022;206 doi: 10.1016/j.mad.2022.111707. [DOI] [PubMed] [Google Scholar]
  37. Meresman G.F., Gotte M., Laschke M.W. Plants as source of new therapies for endometriosis: a review of preclinical and clinical studies. Hum. Reprod. Update. 2021;27:367–392. doi: 10.1093/humupd/dmaa039. [DOI] [PubMed] [Google Scholar]
  38. Niu L., Luo R., Zou M., Sun Y., Fu Y., Wang Y., Peng X. Puerarin inhibits mycoplasma gallisepticum (MG-HS)-induced inflammation and apoptosis via suppressing the TLR6/MyD88/NF-kappaB signal pathway in chicken. Int. Immunopharmacol. 2020;88 doi: 10.1016/j.intimp.2020.106993. [DOI] [PubMed] [Google Scholar]
  39. Partridge L., Fuentealba M., Kennedy B.K. The quest to slow ageing through drug discovery. Nat. Rev. Drug Discov. 2020;19:513–532. doi: 10.1038/s41573-020-0067-7. [DOI] [PubMed] [Google Scholar]
  40. Patra A.K., Amasheh S., Aschenbach J.R. Modulation of gastrointestinal barrier and nutrient transport function in farm animals by natural plant bioactive compounds - a comprehensive review. Crit. Rev. Food Sci. Nutr. 2019;59:3237–3266. doi: 10.1080/10408398.2018.1486284. [DOI] [PubMed] [Google Scholar]
  41. Qiu Z.K., Zhang G.H., Zhong D.S., He J.L., Liu X., Chen J.S., Wei D.N. Puerarin ameliorated the behavioral deficits induced by chronic stress in rats. Sci. Rep. 2017;7:6266. doi: 10.1038/s41598-017-06552-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Santos-Buelga C., Feliciano A.S. Flavonoids: from structure to health issues. Molecules. 2017;22 doi: 10.3390/molecules22030477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Sekhar R.V. GlyNAC supplementation improves glutathione deficiency, oxidative stress, mitochondrial dysfunction, inflammation, aging hallmarks, metabolic defects, muscle strength, cognitive decline, and body composition: implications for healthy aging. J. Nutr. 2021;151:3606–3616. doi: 10.1093/jn/nxab309. [DOI] [PubMed] [Google Scholar]
  44. She S., Liu W., Li T., Hong Y. Effects of puerarin in STZ-induced diabetic rats by oxidative stress and the TGF-beta1/Smad2 pathway. Food Funct. 2014;5:944–950. doi: 10.1039/c3fo60565e. [DOI] [PubMed] [Google Scholar]
  45. Shen N., Wang T., Gan Q., Liu S., Wang L., Jin B. Plant flavonoids: classification, distribution, biosynthesis, and antioxidant activity. Food Chem. 2022;383 doi: 10.1016/j.foodchem.2022.132531. [DOI] [PubMed] [Google Scholar]
  46. Shi L., Xun W., Peng W., Hu H., Cao T., Hou G. Effect of the single and combined use of curcumin and piperine on growth performance, intestinal barrier function, and antioxidant capacity of weaned Wuzhishan piglets. Front. Vet. Sci. 2020;7:418. doi: 10.3389/fvets.2020.00418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Silversides F.G., Scott T.A. Effect of storage and layer age on quality of eggs from two lines of hens. Poult. Sci. 2001;80:1240–1245. doi: 10.1093/ps/80.8.1240. [DOI] [PubMed] [Google Scholar]
  48. Soria M.A., Bonnet M.A., Bueno D.J. Relationship of Salmonella infection and inflammatory intestinal response with hematological and serum biochemical values in laying hens. Vet. Immunol. Immunopathol. 2015;165:145–153. doi: 10.1016/j.vetimm.2015.03.008. [DOI] [PubMed] [Google Scholar]
  49. Tang D., Wu J., Jiao H., Wang X., Zhao J., Lin H. The development of antioxidant system in the intestinal tract of broiler chickens. Poult. Sci. 2019;98:664–678. doi: 10.3382/ps/pey415. [DOI] [PubMed] [Google Scholar]
  50. Tao Q., Zhang J., Liang Q., Song S., Wang S., Yao X., Gao Q., Wang L. Puerarin alleviates sleep disorders in aged mice related to repairing intestinal mucosal barrier. Nat. Prod. Bioprospect. 2023;13:29. doi: 10.1007/s13659-023-00390-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Tarumi W., Itoh M.T., Suzuki N. Effects of 5alpha-dihydrotestosterone and 17beta-estradiol on the mouse ovarian follicle development and oocyte maturation. PLoS One. 2014;9:e99423. doi: 10.1371/journal.pone.0099423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Tas Cengiz Z., Yilmaz H., Beyhan Y.E., Ekici A., Cicek M., Aydemir S. The importance of antioxidant enzymes and oxidative stress in human fascioliasis. Turk. Parazitol. Derg. 2023;47:38–41. doi: 10.4274/tpd.galenos.2022.07088. [DOI] [PubMed] [Google Scholar]
  53. Ulluwishewa D., Anderson R.C., McNabb W.C., Moughan P.J., Wells J.M., Roy N.C. Regulation of tight junction permeability by intestinal bacteria and dietary components. J. Nutr. 2011;141:769–776. doi: 10.3945/jn.110.135657. [DOI] [PubMed] [Google Scholar]
  54. Uno K., Nicholls S.J. Biomarkers of inflammation and oxidative stress in atherosclerosis. Biomark. Med. 2010;4:361–373. doi: 10.2217/bmm.10.57. [DOI] [PubMed] [Google Scholar]
  55. Wang J., Chi Z., Zhao K., Wang H., Zhang X., Xu F., Shao X., Wei Y. A transcriptome analysis of the antibacterial mechanism of flavonoids from Sedum aizoon L. against Shewanella putrefaciens. World J. Microbiol. Biotechnol. 2020;36:94. doi: 10.1007/s11274-020-02871-w. [DOI] [PubMed] [Google Scholar]
  56. Wang J.F., Guo Y.X., Niu J.Z., Liu J., Wang L.Q., Li P.H. Effects of radix Puerariae flavones on liver lipid metabolism in ovariectomized rats. World J. Gastroenterol. 2004;10:1967–1970. doi: 10.3748/wjg.v10.i13.1967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Wang X.C., Wang X.H., Wang J., Wang H., Zhang H.J., Wu S.G., Qi G.H. Dietary tea polyphenol supplementation improved egg production performance, albumen quality, and magnum morphology of Hy-Line Brown hens during the late laying period. J. Anim. Sci. 2018;96:225–235. doi: 10.1093/jas/skx007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Wijtten P.J., van der Meulen J., Verstegen M.W. Intestinal barrier function and absorption in pigs after weaning: a review. Br. J. Nutr. 2011;105:967–981. doi: 10.1017/S0007114510005660. [DOI] [PubMed] [Google Scholar]
  59. Wu M., Yi D., Zhang Q., Wu T., Yu K., Peng M., Wang L., Zhao D., Hou Y., Wu G. Puerarin enhances intestinal function in piglets infected with porcine epidemic diarrhea virus. Sci. Rep. 2021;11:6552. doi: 10.1038/s41598-021-85880-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Wu Y., Li Y., Ruan Z., Li J., Zhang L., Lu H., Xu Z. Puerarin rebuilding the mucus layer and regulating mucin-utilizing bacteria to relieve ulcerative colitis. J. Agric. Food Chem. 2020;68:11402–11411. doi: 10.1021/acs.jafc.0c04119. [DOI] [PubMed] [Google Scholar]
  61. Xu Y., Yu Y., Shen Y., Li Q., Lan J., Wu Y., Zhang R., Cao G., Yang C. Effects of Bacillus subtilis and Bacillus licheniformis on growth performance, immunity, short chain fatty acid production, antioxidant capacity, and cecal microflora in broilers. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Yang J.X., Chaudhry M.T., Yao J.Y., Wang S.N., Zhou B., Wang M., Han C.Y., You Y., Li Y. Effects of phyto-oestrogen quercetin on productive performance, hormones, reproductive organs and apoptotic genes in laying hens. J. Anim. Physiol. Anim. Nutr. (Berl) 2018;102:505–513. doi: 10.1111/jpn.12778. [DOI] [PubMed] [Google Scholar]
  63. Yao Y., Liu Y., Li C., Huang X., Zhang X., Deng P., Jiang G., Dai Q. Effects of rosemary extract supplementation in feed on growth performance, meat quality, serum biochemistry, antioxidant capacity, and immune function of meat ducks. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Yen P.T., Huang S.E., Hsu J.H., Kuo C.H., Chao Y.Y., Wang L.S., Yeh J.L. Anti-inflammatory and anti-oxidative effects of puerarin in postmenopausal cardioprotection: roles of Akt and heme oxygenase-1. Am. J. Chin. Med. 2023;51:149–168. doi: 10.1142/S0192415X2350009X. [DOI] [PubMed] [Google Scholar]
  65. Yosefi S., Braw-Tal R., Bar A. Intestinal and eggshell calbindin, and bone ash of laying hens as influenced by age and molting. Comp. Biochem. Physiol. Mol. Integr. Physiol. 2003;136:673–682. doi: 10.1016/s1095-6433(03)00244-7. [DOI] [PubMed] [Google Scholar]
  66. Yuan Z.H., Zhang K.Y., Ding X.M., Luo Y.H., Bai S.P., Zeng Q.F., Wang J.P. Effect of tea polyphenols on production performance, egg quality, and hepatic antioxidant status of laying hens in vanadium-containing diets. Poult. Sci. 2016;95:1709–1717. doi: 10.3382/ps/pew097. [DOI] [PubMed] [Google Scholar]
  67. Zhang J.C., Chen P., Zhang C., Khalil M.M., Zhang N.Y., Qi D.S., Wang Y.W., Sun L.H. Yeast culture promotes the production of aged laying hens by improving intestinal digestive enzyme activities and the intestinal health status. Poult. Sci. 2020;99:2026–2032. doi: 10.1016/j.psj.2019.11.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zhang L., Zhong G., Gu W., Yin N., Chen L., Shi S. Dietary supplementation with daidzein and Chinese herbs, independently and combined, improves laying performance, egg quality and plasma hormone levels of post-peak laying hens. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Zhao M., Sun Q., Khogali M.K., Liu L., Geng T., Yu L., Gong D. Dietary selenized glucose increases selenium concentration and antioxidant capacity of the liver, oviduct, and spleen in laying hens. Biol. Trace Elem. Res. 2021;199:4746–4752. doi: 10.1007/s12011-021-02603-7. [DOI] [PubMed] [Google Scholar]
  70. Zhou B., Zhang J., Chen Y., Liu Y., Tang X., Xia P., Yu P., Yu S. Puerarin protects against sepsis-induced myocardial injury through AMPK-mediated ferroptosis signaling. Aging (Albany NY) 2022;14:3617–3632. doi: 10.18632/aging.204033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Zhou Y.X., Zhang H., Peng C. Puerarin: a review of pharmacological effects. Phytother. Res. 2014;28:961–975. doi: 10.1002/ptr.5083. [DOI] [PubMed] [Google Scholar]
  72. Zhu A.N., Zhang K.Y., Wang J.P., Bai S.P., Zeng Q.F., Peng H.W., Ding X.M. Effect of different concentrations of neohesperidin dihydrochalcone on performance, egg quality, serum biochemistry and intestinal morphology in laying hens. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101387. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES