Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Jan 24;103(5):103489. doi: 10.1016/j.psj.2024.103489

Effects of 28 h ahemeral light cycle on production performance, egg quality, blood parameters, and uterine characteristics of hens during the late laying period

Xuelu Liu *,1, Lei Shi *,1, Erying Hao *, Xiangyu Chen , Ziwen Liu , Yifan Chen *, Dehe Wang *, Chenxuan Huang *, Jiawei Ai *, Min Wu *, Yanyan Sun , Yunlei Li , Lijun Xu , Erdong Sun §, Jilan Chen , Hui Chen *,2
PMCID: PMC10973186  PMID: 38518666

Abstract

This study aimed to systematically determined the effect of 28 h ahemeral light cycle on production performance, egg quality, blood parameters, uterine morphological characteristics, and gene expression of hens during the late laying period. At 74 wk, 260 Hy-Line Brown layers were randomly divided into 2 groups of 130 birds each and in duplicates. Both a regular (16L:8D) and an ahemeral light cycle (16L:12D) were provided to the hens. The oviposition pattern in an ahemeral cycle shifted into darkness, with oviposition mostly occurring 3 to 5 h after light out. Production performance was unaffected by light cycle (P > 0.05). Nonetheless, compared to the normal group, the ahemeral group exhibited increased egg weight, eggshell weight, eggshell percentage, yolk percentage, eggshell thickness, and eggshell strength (P < 0.05). There were rhythmic changes in the uterine morphological structure in both cycles, however, the ahemeral group maintained a longer duration and had more uterine folds than the normal group. In the ahemeral cycle, the phases of the CLOCK and PER2 genes were phase-advanced for 3.96 h and 4.54 h compared to the normal cycle. The PHLPP1 gene, which controls clock resetting, exhibited a substantial oscillated rhythm in the ahemeral group (P < 0.05), while the expression of genes presenting biological rhythm, such as CRY2 and FBXL3, was rhythmically oscillated in normal cycle (P < 0.05). The ITPR2 gene, which regulates intracellular Ca2+ transport, displayed a significant oscillated rhythm in ahemeral alone (P < 0.05), while the CA2 gene, which presents biomineralization, rhythmically oscillated in both cycles (P < 0.05). The ahemeral cycle caused 2.5 h phase delays in the CA2 gene compared to the normal cycle. In conclusion, the 28 h ahemeral light cycle preserved the high condition of the uterine folds and changed the uterine rhythms of CLOCK, PER2, ITPR2, and CA2 gene expression to improve ion transport and uterine biomineralization.

Key words: chicken, ahemeral light, late laying period, production performance, egg quality

INTRODUCTION

The primary trend in high-production layers is to lengthen the laying period, which has the potential to lower hatching costs and improve resource utilization efficiency. The poultry industry has been promoting the “100-500” plan—that is, producing 500 eggs at 100 wk of age by 2020—since 2011 (www.poultryworld.net). Many commercial layers that have progressively moved closer to this target, such as ISA Brown and ISA White layers with 470 and 490 eggs at 100 wk (www.isa-poultry.com), HY-LINE W-80 plus layers with 455.6 to 473.1 eggs at 100 wk (Li et al., 2020), and Jing Tint 6 layers produce 380 eggs at 80 wk (Li et al., 2020). However, many researchers have observed that both eggshell thickness and strength decreased sharply after 50 wk of age (Wistedt et al., 2019; Cristina et al., 2021; Feng, 2021), and the rate of egg breakage was 3-fold higher (60 vs. 20–29 wk) in the late laying stage compared with the peak period (Bell and Weaver, 2002). Moreover, the breakage rate during egg transportation was found to increase from 5.5% at 32 to 50 wk to 8.3% at 62 to 80 wk, thus challenging the strategy of late laying period (Oh et al., 2008). Therefore, improvement of the eggshell quality over late laying periods is a long-term goal in the industry.

Light plays an important role in many activities of birds, such as feeding, sleeping, sexual maturity, reproduction and so on (Helle et al., 2007; Nishiwaki-Ohkawa and Yoshimura, 2016). Furthermore, as a timing factor of biological rhythm, light involves the eggshell formation by circadian regulation of clock genes in the uterus, including SCNN1G, CA2, SPP1, and ATP1B1 (Zhang et al., 2022; Sun et al., 2016). According to a previous study (Xin et al., 2021), chickens' eggshell quality may be improved by extending their scotophase from 8 to 15 h. Adequate light is also necessary for hens to produce eggs. For the hens to lengthen their laying time, an appropriate light cycle must be created.

Birds' ovulation interval lengthened from 24 to 27 h with increase in their age (Boersma et al., 2002). Furthermore, using an ahemeral cycle could enhance the eggshell quality (Nordstrom and Ousterhout, 1983; Ibaraki et al., 1985). According to Shanawany (1982), the egg weight increased linearly during cycles lasting between 24 and 30 h. The eggshell thickness increased linearly from 24 to 28 h, but it significantly decreased from 28.5 h onward (Siopes and Neely, 1997). The results of these investigations add together to show that the ahemeral cycle improves the quality of eggshells. On the other hand, not much is known about the ahemeral cycle of hens' longer laying periods.

With the goal of offering new insights into the light management of the hens in prolonging laying period, this study methodically examined the impact of a 28-h ahemeral light cycle on production performance, eggshell quality, blood hormone level, and morphological characteristics of hens from 74 to 92 wk.

MATERIALS AND METHODS

Ethics Statement

Practices regarding the care and use of animals for research purposes were in accordance with the institutional and national guidelines, and was approved by the Animal Care and Use Committee of the Hebei Agriculture University.

Experimental Design and Birds

A one-factor experiment was carried out using 2 treatments with 2 rooms (replicates) in our study, and all the rooms (replicates) were completely independent of each other. At 73 wk, 260 Hy-Line brown layers were chosen and divided into 2 groups at random. Following a week of prefeeding with a 16L:8D cycle, 130 birds from 1 group were exposed to 16L:8D (normal, 24-h light cycle), whereas the other 130 birds were subjected to 16L:12D (ahemeral, 28-h light cycle).

We added the Figure 1 to clarify the lighting program designed for the 28 h ahemeral light cycle group. The control group turns on the light at 7 am and turns off the light at 11 pm every day. Rooms had independent temperature controls and were held at 21C for the duration of the study. The instrument and the actual temperature were examined at regular intervals to make sure that the temperatures were within normal limits and there was no significant difference between replicates (rooms).

Figure 1.

Figure 1

The distribution map of light and dark time of 28 h ahemeral light cycle group in a week. The white and black boxes above the figure correspond to light illumination and dark periods, respectively.

Using a lightmeter's photoreceptor sensor at bird's eye level, the light intensity was set at 25 lx. Throughout the trial, water was available for free use, and the birds were fed commercial diets consisting of corn and soybeans that included 4.20% calcium and 14.0 % crude protein.

Oviposition Patterns and Production Performance

From 75 to 77 wk, the oviposition timing was manually recorded every hour on Mondays. As a result, 2 groups' oviposition time distributions were computed.

From 74 to 92 wk, the feeding consumption, egg number, and weight were recorded every day (6 times a week for the ahemeral cycle). Defective eggs, calculated as the percentages of total egg number, were classed as broken, soft-shelled, and other abnormal eggs. Calculate the feed-to-egg ratios (FER) at the end of the experiment.

Egg Quality

Total 50 eggs from each replicate were gathered at 85 wk and had their egg quality assessed. The egg shape determinator (FHK, Fujihira Industry Co., Ltd., Tokyo, Japan) was used to measure the egg shape. We measured the weight of the egg, eggshell, yolk, and albumen using a digital scale (Huachaoice Electrical Appliances, Shanghai, China). An echo-meter (ESTG-1; ORKA, Israel) was used to measure the thickness of the eggshell. The Egg Force Reader (ESTG-01, ORKA, Israel) was used to test the eggshell strength.

A total of 10 eggs were taken from every group and their eggshell ultrastructure was examined using a 3.0 kV SEM (Prisma E, EI Segundo, CA, Thermo Fisher, Waltham, MA) set at 400 ×.

Blood Parameters

Zeitgeber time (ZT) is the nomenclature of time in the light-dark cycle. ZT0 (07 am Beijing Time) was the time at which the lamps were turned on. At 88 wk, twelve hens with consistent oviposition pattern were chosen from each group. At time points ZT0, ZT4, ZT8, ZT12, ZT16, ZT20, ZT24, and ZT28 (ZT4 in the normal group), the same birds took blood samples. Commercial ELISA kits (Horabio Biotechnology Co., Ltd., Shanghai, China) and the Shenzhen Mindray BS-420 automatic biochemical analyzer was used to measure the levels of estradiol (E2) and calcium (Ca) in the serum.

At 93 wk, 12 hens from each group with similar oviposition times were sacrificed at ZT2, ZT7, ZT12, ZT17, ZT22, and ZT27 (ZT3 in the normal group). The serum levels of malondialdehyde (MDA), total antioxidant capacity (T-AOC), follicle-stimulating hormone (FSH), and luteotropic hormone (LH) were measured using commercial ELISA kits (Horabio Biotechnology Co., Ltd., Shanghai, China).

Ovarian Characteristics

At 93 wk, 12 hens from each group with a consistent oviposition pattern were chosen. To measure ovarian weight and count the number of ovarian follicles, including large yellow follicles (LYF, >10 mm), small yellow follicles (SYF, 8–10 mm), large white follicles (LWF, 6–8 mm), and medium white follicles (SWF, 4–6 mm, Robinson and Etches, 1986), the ovarian were collected at ZT2, ZT7, ZT12, ZT17, ZT22, and ZT27 (ZT3 in the normal group).

Morphological and Histological Observations of Uterine Tissues

At 93 wk, sagittal sections of the uterine tissues of birds with similar ovipositional rhythmicity were fixed in 4% buffered formalin. The sections were then stained with hematoxylin and eosin (HE) and evaluated under a fluorescence microscope (DP80; Olympus, Japan).

Tibial Characteristics

Tibial weight, bone mineral density (BMD), bone mineral content (BMC, iNSiGHT VET DXA, Osteosys Co., Ltd., Korea), and tibial strength (TA. XTPlus, Stable Micro System Corp., Surrey, UK) were measured in similar birds at 93 wk. The apex of the curve was determined to be the relative strength of the tibia, and BW adjusted it.

Gene Expression Analysis by qRT-PCR

Using the PrimeScript RT Reagent Kit (TaKaRa, Dalian, China) and the manufacturer's instructions, total RNA from the uterine tissues of birds at ZT2, ZT7, ZT12, ZT17, ZT22, and ZT27 (ZT3 in the normal group) was reverse transcribed into cDNA. qRT-PCR was carried out on the ABI QuantStudio 7 Flex Real-Time Detection System (Life Technologies, Carlsbad, CA) using the KAPA SYBR Fast universal qRT-PCR kit (TaKaRa, Dalian, China). Eight genes' relative expression levels were measured using the 2−ΔΔCt method, with GAPDH serving as a reference (Kenneth and Thomas, 2001). Table 1 lists the primer sequences.

Table 1.

List of primers used.

Gene Product size (bp) Primer Sequence (5′-3′)
CLOCK 121 F GCTTCCAGGTAATGCTCGGAAG
R CCAGTCCTGTCGAATCTCACTGG
PER2 115 F CCAACTTTGTTGTGTGCTCCTTGC
R CTGGAACAAACAGGTTGGTGTGTG
CA2 151 F
R
CCCATCGCCATCAGCACCAAAG
GCAGCACTGACTTGTCGGAGGA
CRY2 141 F GCACGGCTGGATAAACACT
R AAATAAGCGGCAGGACAAA
FBXL3 137 F ATGTGTGGCGGTCGTCTCTCA
R GTGGGCATCATGTCTGGGAACC
ATP2B1 198 F CTCTTGCCTTGGCGACAGAACC
R GCAGAGGTGCGTTTCTTCCACT
ITPR2 154 F AACAGCACCAGCCTCCAGACA
R TCCCACGGTTCTTCGCCACTT
PHLPP1 171 F GCGGCATGGCTTCAGAGATCA
R GGAAGGAGTTGGACAGGCAGAC
GAPDH 153 F AGGACCAGGTTGTCTCCTGT
R CCATCAAGTCCACAACACGG

Data Analysis

One-way ANOVA was used to analyze the data (SPSS 20.0, Inc., Chicago, IL). Duncan was utilized to compare mean value differences at the 5% significance level. GraphPad Prism (Version 8.0.2) was used to evaluate the genetic rhythm. Indicating a statistically significant difference is a P value less than 0.05.

RESULTS

Production Performance

In general, the oviposition pattern mostly happened 3 to 5 h after the illumination started. However, when the light cycle changed from 24 to 28 h, the oviposition pattern shifted significantly into the dark phase, with oviposition occurring largely 3 to 5 h after the start of darkness in the third cycle (Figure 2). Table 2 illustrates that the light cycle had no effect on the laying rate, egg number, FER, and abnormal egg percentage (P > 0.05).

Figure 2.

Figure 2

Oviposition frequencies in hens between 75 and 77 wk. The red and blue boxes represent the oviposition frequency in the ahemeral and normal groups, respectively. The white and black boxes under the figure correspond to light illumination and dark periods, respectively.

Table 2.

Effect of light cycles on egg production of laying hens from 74 to 92 wk.

Item/Group 16L:12D 16L:8D SEM Pa,b
Laying rate, % 63.32 66.24 1.42 0.16
Hen-day quality eggs, n 79.05 82.38 1.54 0.11
Hen-day eggs, n 84.78 88.22 1.62 0.13
FER 3.22 3.32 0.09 0.57
Broken egg, % 5.51 6.17 0.76 0.64
Abnormal egg, % 0.83 0.92 0.18 0.78
Soft-shelled egg, % 0.43 0.63 0.10 0.23
a,b

Mean values in the same row without a common superscript differ significantly (P < 0.05). FER: Feed-to-egg ratios.

Egg Quality

Table 3 shows the impact of the light cycle on egg quality of laying hens. The egg weight, eggshell weight, yolk weight, eggshell percentage, yolk percentage, eggshell thickness, and eggshell strength were all considerably raised by the ahemeral cycle (P < 0.05). Furthermore, the ahemeral cycle considerably boosted the eggshell weight, yolk weight, eggshell thickness, and eggshell strength by 0.68 g, 1.67 g, 0.03 mm, and 4.17 N, respectively. On the other hand, the albumen weight and shape index did not differ (P > 0.05).

Table 3.

Effect of light cycles on egg quality of laying hens at 85 wk.

Item/Group 16L:12D 16L:8D SEM P
Shape index 1.33 1.30 0.01 0.17
Egg weight, g 62.58a 59.44b 1.34 0.04
Eggshell weight, g 5.80a 5.12b 0.29 0.03
Yolk weight, g 18.01a 16.34b 0.69 0.01
Albumen weight, g 38.77 37.98 0.40 0.21
Eggshell percentage, % 9.28a 8.62b 0.27 0.03
Yolk percentage, % 28.89a 27.62b 0.54 0.04
Albumen percentage, % 61.84a 63.76b 0.79 0.01
Eggshell thickness, mm 0.35a 0.32b 0.02 0.03
Eggshell strength, N 34.16a 29.99b 1.74 0.02
a,b

Mean values in the same row without a common superscript differ significantly (P < 0.05).

The eggshell effective thickness in the ahemeral group was more than normal, as Figure 3 illustrates. In addition, the palisade layer has a thick structure and fewer pores in ahemeral group.

Figure 3.

Figure 3

Effect of light cycle on eggshell ultrastructure from hens at 85 wk. (A) and (B) electron micrographs of cross-sections of eggshells from the ahemeral and normal groups, respectively; (C) and (D) eggshell palisade layers in the ahemeral and normal groups, respectively. White arrows indicate the palisade layer pores. ET, Effective thickness; MT, Mammillary thickness.

Blood Parameters

Indicators of antioxidant and reproductive function

The serum MDA content was lower in the ahemeral group than in the normal group while the T-AOC was higher (P > 0.05, Table 4). Furthermore, the light cycle had no effect on the serum FSH and LH contents in hens (P > 0.05).

Table 4.

Effect of light cycles on serum indicators of antioxidant and reproductive function in hens at 93 wk.

Item/Group 16L:12D 16L:8D SEM P
MDA, mmol/L 5.97 7.03 0.51 0.15
T-AOC, U/mL 6.16 5.39 0.47 0.33
FSH, IU/L 10.13 9.64 0.35 0.65
LH, ng/L 28.04 27.46 0.41 0.84

Mean values in the same row without a common superscript differ significantly (P < 0.05).

Estradiol and Calcium

Serum E2 and Ca concentrations varied rhythmically in both the ahemeral and normal groups (Figure 4), and the content in the oviposition time was lower than the eggshell production stage. Furthermore, the 2 groups' E2 alterations revealed the opposite pattern, while Ca revealed a comparable trend. When compared to the normal group, the ahemeral group's serum Ca concentration was greater and caused a 4 h phase delay.

Figure 4.

Figure 4

Effects of light cycle on the serum estradiol and calcium levels at 88 wk. ZT, zeitgeber time.

Ovarian Characteristics

The ovary weight, ovary index, and the number of ovarian follicles were not affected by the light cycle (P > 0.05, Table 5), although the ahemeral group had a higher BW than normal (P < 0.05).

Table 5.

Effects of light cycles on ovarian characteristics of laying hens at 93 wk.

Item/Group 16L:12D 16L:8D SEM P
BW, kg 2.09a 1.97b 0.05 0.04
Ovary weight, g 55.27 57.14 3.14 0.76
Ovary index 2.66 2.91 0.20 0.48
LYF, n 5.59 6.25 0.31 0.13
SYF, n 0.42 0.67 0.20 0.50
LWF, n 0.67 0.58 0.18 0.80
SWF, n 0.00 0.09 0.06 0.42
a,b

Mean values in the same row without a common superscript differ significantly (P < 0.05).

Morphological and Histological Observations

Figure 5 displayed the findings of the morphology and histology of uteri. Zeitgeber time (ZT) is the nomenclature of time in the light-dark cycle. ZT0 (07 am Beijing Time) was the time at which the lamps were turned on. While we also discovered that eggs were present in the oviduct isthmus at ZT7, the eggs in the normal group were located in the uterus at ZT2, ZT12, ZT217, ZT22, and ZT27 (Figure 5). From ZT2 to ZT27, there was a progressive increase in the number of uterine folds and tubular gland cells. There was a sudden decline from ZT17 to ZT22, followed by a gradual increase from ZT22 to ZT27.

Figure 5.

Figure 5

Morphology and histology of uteri. Hematoxylin-eosin (HE) staining of uteri from different light cycles and time points (40 × and 200 × magnification). E: endometrium; M: myometrium. Black arrows indicate T cells. The white box represents the sampling site of uterus tissue, and the black box represents the 200-fold magnification site. ZT, zeitgeber time.

In the ahemeral group, the uterus contained eggs at ZT2, ZT7, ZT12, ZT17, and ZT27. Additionally, we discovered that the expanded portion of the oviduct contained eggs at ZT22. The number of tubular gland cells and uterine folds peaked at ZT2, after which the tubular gland cells steadily reduced from ZT7 to ZT17 but the uterine folds remained in the same state. The number of tubular gland cells and uterine folds steadily increased from ZT22 to ZT27. In any case, the ahemeral group continued to have greater uterine fold values over a longer period of time.

Tibial Characteristics

The tibial weight, BMC, and relative tibial strength were not affected by the light cycle (P > 0.05, Table 6), although the ahemeral group had higher BMD values than the normal group (P = 0.05).

Table 6.

Effects of light cycles on tibial characteristics of hens at 93 wk.

Item/Group 16L:12D 16L:8D SEM Pa,b
Tibia weight, g 12.46 11.58 0.56 0.35
BMC, g 3.88 3.36 0.25 0.15
BMD, g/cm2 0.30 0.27 0.01 0.05
Relative strength of tibia, kg/kg 10.46 9.47 0.69 0.41
a,b

Mean values in the same row without a common superscript differ significantly (P < 0.05). 1The relative tibial strength was determined at the peak of the curve produced and was corrected by the body weight of each hen.

Quantitative Real-time PCR

Figure 6 depicts the examined genes' patterns of expression in response to various light cycles. In both groups, there was a rhythmic oscillation of the CLOCK, PER2, and CA2 genes (P < 0.05). In the ahemeral group, the CLOCK and PER2 gene phases were phase-advanced for 3.96 and 4.54 h, respectively, compared to normal. The CA2 gene showed 2.5-h phase delays when the light cycle was changed to 28 h. In contrast to the normal group, the CLOCK gene's expression trend was opposite. The genes ITPR2 and PHLPP1 were rhythmically oscillating in the ahemeral group exclusively (P < 0.05), while the CRY2, FBXL3, and ATP2B1 genes showed significant oscillated rhythm in the normal group (P < 0.05).

Figure 6.

Figure 6

Effects of light cycle on relative gene expression in hens at 93 wk. The curve shows the best fit to the points determined by nonlinear regression. The solid line represents rhythmical gene expression, and the absence of a solid line represents arrhythmical gene expression. P-values indicate the significance of the regression analysis. P-values of < 0.05 were considered significant. ZT, zeitgeber time.

DISCUSSION

While extending the laying time of hens is a popular research topic these days, one inevitable issue is the deterioration of eggshell quality over this late laying period. Ahemeral light cycles have been shown in earlier research to enhance egg quality during the peak laying period; however, it is unknown if this effect may be extended. Consequently, the impact of a 28-h ahemeral light cycle on eggshell quality was methodically examined in this study.

Extend the laying time from 24 to 28 h of birds, which would raise the feed conversation ratio but decrease the egg number. These outcomes matched those of earlier research (Shanawany, 1982; Nordstrom and Ousterhout, 1983; Spies et al., 2000), which investigated the application of ahemeral cycle from 26 to 28 h in early, peak, and late stage of laying. According to Morris (1973), the ahemeral group saw a reduction in egg number due to a restriction on the maximum frequency of ovulation to 1 cycle and an increase in oviducal transit time of 1.5 h when compared to the normal group. The lack of impacts on the levels of FSH and LH in the serum further suggested that the prolongation of the oviducal transit time was the reason of the drop in egg number. Long-term exposure to darkness causes oxidative stress in animals, which impairs their ability to reproduce by causing granulosa cell apoptosis and oocyte damage, according to a previous study (Zhang et al., 2014). Prolonged scotophase in this investigation did not alter the levels of T-AOC and MDA in the serum. As a result, altering the light cycle throughout the extending period had no effect on the birds' ability to produce. This contradicts other findings, most likely because the goal of this study is to lengthen the laying time in late laying period while the focus of other studies was on the peak laying period.

Furthermore, adjusting the light cycle to 28 h, the oviposition also shifted from daylight to darkness, especially 3 to 5 h after onset of darkness, suggesting that the laying behavior altered. Similar finding had been obtained in other species (Wu et al., 2008; Wu et al., 2009; Dong et al., 2010).

The eggshell quality was greatly enhanced by the ahemeral cycle, as seen by increases in eggshell weight, thickness, and strength of 13.28%, 9.38%, and 13.90%, respectively. Additionally, it enhanced the ultrastructure of avian eggshells. These findings supported earlier research that shown that eggs laid during the 27 and 28 h light cycles at various stages of hen development had eggshells that were 6 to 10% thicker than those laid during the usual cycle (Leeson et al., 1979). Meanwhile, previous studies have shown that the improvement of eggshell quality is due to the prolonged oviducal transit time (Morris, 1973). In this experiment, the oviposition time was changed from daytime to darkness, which more nearly coincides with the period of active absorption of calcium from the gut (Melek et al., 1973; Xin et al., 2021). The increase of eggshell quality is a combined result of increased oviducal transit time and the changed oviposition time.

Apart from the quality of the eggshell, the yolk weight was also markedly boosted by the shift in the light cycle. This outcome could have 2 causes. Ahemeral cycles lengthen the time that yolks are deposited, but they do not change the average rate of deposition, which results in a rise in yolk weight. However, Ibaraki et al. (1985) found that the rate of yolk deposition increases during darkness as compared to daylight, increasing the weight of the yolk. As a result, both the altered oviposition time and the prolonged yolk deposition period contribute to the rise in yolk weight.

High-yield layers can produce 1 egg almost every day. At this time, the organic matrix in the uterine fluid secreted by the uterus changes in a sequential manner and forms a specific microstructure through interaction with inorganic minerals (Jonchère et al., 2012; Rodríguez-Navarro et al., 2015). In the present study, the histological characteristics of the uterus in the normal group showed that the number of the uterine folds and tubular gland cells increased gradually from ZT12 to ZT17. This has been reported as the time when uterine fluid, together with various ions needed for eggshell calcification, are secreted (Marie et al., 2014). It also represents the active stage of eggshell formation. A previous study has shown that the uterine folds increased within 12 h after turning on the light (Cui et al., 2021). These results are consistent with those of our study. Greater numbers of uterine folds promote full contact between the uterine fluid and the eggs, which is conducive to the full development of the eggshell. The number of the uterine folds was higher for longer periods of time in the ahemeral group. We speculate that the light cycle alters the microstructure of the uterus, thus improving the eggshell quality.

By enabling the ovary to regulate the daily release of calcium in the uterus, estrogen contributes to the creation of eggshells (Nys et al., 2011). The physical alterations of the uterus and the results of our study regarding estrogen were in agreement with each other, with oviposition being lower than the production of eggshells. More research has to be done on the mechanism underlying the effects of variations in the estrogen cycle on the quality of eggshells.

The expression of circadian clock genes in almost all tissues results in circadian rhythms that are synchronized with the environment throughout the light-dark cycle of the day (Buijs et al., 2003). In our study, expression of the CLOCK, PER2, and CA2 genes showed rhythmic oscillation in both groups (Keleher et al., 2014; Herzog et al., 2017). The expression of the CLOCK gene showed an opposite trend between the 2 groups, which was consistent with the estrogen results. Compared with the normal group, the CLOCK and PER2 genes responsible for the biological rhythm were phase-advanced for 3.96 h and 4.54 h in ahemeral group, respectively. The ahemeral group showed 2.5 h phase delays in the expression of the CA2 gene. CA2 is reported to catalyze the formation of HCO3 (Dorcas et al., 2019), which is one of the main constituents of calcium carbonate (CaCO3). The expression of genes regulating the biological rhythm, including CRY2 and FBXL3, showed rhythmic oscillation during the normal cycle. Deletion of FBXL3 has been shown to lead to reduced CRY2 protein degradation and the abnormal accumulation of clock genes, resulting in the prolongation of the biological cycle. Moreover, FBXL3-deficient mice show a rhythm of 27 h (Godinho et al., 2007), which is consistent with the findings of our study. The ATP2B1 gene is active in the uterus which the eggshell weight was high, which is consistent with the eggshell quality. The total calcium required for laying in the normal group was higher than that in the ahemeral group, leading to activation of ATP2B1 in the uterus. Both the ITPR2 and PHLPP1 genes showed rhythmic oscillation in expression in the ahemeral group only. Evidence has shown that ITPR2 is expressed in the uterine epithelial cells of chickens where it is involved in the regulation of intracellular Ca2+ transportation in uterus, as well as contributing to the process of eggshell calcification (Sun et al., 2015; Daria, 2017). PHLPP1 plays a critical role in the consolidation of circadian periodicity following resetting in mice (Masubuchi et al., 2010), therefore, we speculate that PHLPP1 plays an important role in the control of clock resetting when the light cycle changes from 24 h to 28 h.

Increasing age is associated with reduced ability for calcium absorption, causing an increased incidence of osteoporosis and bone fragility in laying hens (Fleming et al., 2004; Simon et al., 2020; Song et al., 2022). The ahemeral group showed higher BMC, BMD, and relative strength values, indicating a higher level of bone mineralization. Since only 6 eggs were produced in a week, the amount of calcium required for the eggshell was reduced, and less medullary bone was used from the bone to form the eggshell. Secondly, the ahemeral group showed good tibial quality, contributing to the animal welfare (Casey-Trott et al., 2017; Li et al., 2023). In the normal group, the values of BMC, BMD, and relative strength were low, indicating active transfer of calcium from the bones to the blood during oviposition, which is not conducive to the maintenance of bone health.

With the popularization of automatic environmental control technology, what we need to solve is the technical problems of automatic feeding and egg collection. On the other hand, the study of 28 h ahemeral light cycle could promote the study of poultry circadian genes in the future, so as to improve the egg quality which decreased seriously in the late laying period.

CONCLUSION

This study systematically examined how the 28-h ahemeral light cycle improved the eggshell quality in late laying period. The findings show that: 1) the 28-h ahemeral light cycle changed the oviposition pattern into darkness, maintaining consistent feeding and eggshell formation times, which improved the function of intestinal active absorption of ions; 2) the ahemeral cycle preserved the high uterus folds state, meaning that the eggs were fully contacted with the uterine fluid, improving the quality of the eggshell; and 3) the cycle changed the phase of the CLOCK and PER2 genes in the uterus, promoted the specific expression of ITPR2 and CA2, and improved the ion transport and biomineralization function of the uterus.

ACKNOWLEDGMENTS

The current research was Supported by the General Program of National Natural Foundation of China (32202731), the Hebei Agricultural University talent introduction research project (YJ2021042), China Agriculture Research System of MOF and MARA (CARS-40), the Modern Agricultural Industry Technology System Construction Project of Hebei Province (HBCT2023210201).

DISCLOSURES

No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication.

REFERENCES

  1. Bell D.D., Weaver W.D. Commercial chicken meat and egg production. J. App. Poultry Res. 2002;11:224–225. 5th ed. [Google Scholar]
  2. Boersma S.I., Robinson F.E., Renema R.A. The effect of twenty-eight-hour ahemeral day lengths on carcass and reproductive characteristics of broiler breeder hens late in lay. Poult. Sci. 2002;81:760–766. doi: 10.1093/ps/81.6.760. [DOI] [PubMed] [Google Scholar]
  3. Buijs R.M., Eden C.G., Goncharuk V.D., Kalabeek A. The biological clock tunes the organs of the body: timing by hormones and the autonomic nervous system. J Endocrinol. 2003;177:17–26. doi: 10.1677/joe.0.1770017. [DOI] [PubMed] [Google Scholar]
  4. Casey-Trott T.M., Korver D.R., Guerin M.T., Sandilands V., Torrey S., Widowski T.M. Opportunities for exercise during pullet rearing, part I: effect on the musculoskeletal characteristics of pullets. Poult. Sci. 2017;96:2509–2517. doi: 10.3382/ps/pex059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cristina B.R., Elisa F., Nazaret D.G., Gilberto L., Estefania S.R., Alejandro B., Murtala U.F. Research note: changes in eggshell quality and microstructure related to hen age during a production cycle. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cui Z.F., Zhang Z.C., Kwame A.F., Du X.X., Li L., Tian Y.F., Kang X.C., Shu G., Zhu Q., Wang Y., Li D.Y., Zhang Y., Zhao X.L. Circadian miR-449c-5p regulates uterine Ca2+ transport during eggshell calcification in chickens. BMC Genom. 2021;22:764. doi: 10.1186/s12864-021-08074-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Daria N. Protein fragmentation as a regulatory mechanism: insights from two different Ca2+ channels, RyR1 and IP3R. Front. Physiol. 2017;7:655. doi: 10.3389/fphys.2016.00655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dong Y., Wu T., Ni Y.H., Kato H., Fu Z.W. Effect of fasting on the peripheral circadian gene expression in rats. Biol. Rhythm Res. 2010;41:41–47. [Google Scholar]
  9. Dorcas A.A., Nako M., Tomoyoshi S., Randa D., Li C., Hiroshi K., Takayuki H., Masahiro M., Tetsuya K., Mohammad T.A., Kazuyuki M., Nobuo S., Jin-Min N., Yasuhiro H., Kyoko H. Carbonic anhydrase 2 (CAII) supports tumor blood endothelial cell survival under lactic acidosis in the tumor microenvironment. Cell Commun Signal. 2019;17:169. doi: 10.1186/s12964-019-0478-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Feng J. 2021. Mechanism of eggshell ultrastructure formation and nutritional modulation in the late phase production of laying hens. Ph.D. Chinese Academy of Agricultural Sciences Thesis. (in Chinese)
  11. Fleming R.H., Korver D., McCormack H.A., Whitehead C.C. Assessing bone mineral density in vivo: digitized fluoroscopy and ultrasound. Poult. Sci. 2004;83:207–214. doi: 10.1093/ps/83.2.207. [DOI] [PubMed] [Google Scholar]
  12. Godinho S.I., Maywood E.S., Shaw L., Tucci V., Barnard A.R., Busino L., Pagano M., Kendall R., Quwailid M.M., Romero M.R., O'neill J., Chesham J.E., Brooker D., Lalanne Z., Hastings M.H., Nolan P.M. The after-hours mutant reveals a role for Fbxl3 in determining mammalian circadian period. Science. 2007;316:897–900. doi: 10.1126/science.1141138. [DOI] [PubMed] [Google Scholar]
  13. Helle H.K., Neville B.P., Graham C.P., Jan L., Annette K.E., Katja C.O., Christopher M.W. The behaviour of broiler chickens in different light sources and illuminances. Appl. Anim. Behav. Sci. 2007;103:75–89. [Google Scholar]
  14. Herzog E.D., Hermanstyne T., Smyllie N.J., Hastings M.H. Regulating the suprachiasmatic nucleus (SCN) circadian clockwork: interplay between cell-autonomous and circuit-level mechanisms. Cold. Spring Harb. Perspect. Biol. 2017;9 doi: 10.1101/cshperspect.a027706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ibaraki K., Yoshida S., Kunimatsu Y., Kojima Y. Effect of 28-h ahemeral light-dark cycle on egg production and egg shell qualities of laying hens. Jpns. Poult. Sci. 1985;22:181–189. [Google Scholar]
  16. Jonchère V., Brionne A., Gautron J., Nys Y. Identification of uterine ion transporters for mineralisation precursors of the avian eggshell. BMC Physiol. 2012;12:10. doi: 10.1186/1472-6793-12-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Keleher F.C., Rao A., Maguire A. Circadian molecular clocks and cancer. Cancer Lett. 2014;342:9–18. doi: 10.1016/j.canlet.2013.09.040. [DOI] [PubMed] [Google Scholar]
  18. Kenneth J.L., Thomas D.S. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  19. Leeson S., Summers J.D., Etches R.J. Effect of a 28 hour light: dark cycle on egg shell quality of end-of-lay birds. Poult. Sci. 1979;58:285–287. [Google Scholar]
  20. Li G.Q., Yang N., Sun H., Shi F.Y., Sun C.J., Li H.N., Zhao L.H., Han W.P., Wang Z.Q., Wu G.Q. Cultivation of pink eggshell layers “Jing Tint 6”. Chin. J. Anim. Sci. 2020;56:61–64. (in Chinese) [Google Scholar]
  21. Li B., Wang Y., Rong L., Zheng W. Research progresson animal environment and welfare. Anim. Rese One Health. 2023;1:56–77. [Google Scholar]
  22. Masubuchi S., Gao T.Y., O'neill A., Eckel-Mahan K., Newton A.C., Sassone-Corsi P. Protein phosphatase PHLPP1 controls the light-induced resetting of the circadian clock. Proc Natl Acad Sci USA. 2010;107:1642–1647. doi: 10.1073/pnas.0910292107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Marie P., Labas V., Brionne A., Harichaux G., Hennequet-Antier C., Nys Y., Gautron J. Data set for the proteomic inventory and quantitative analysis of chicken uterine fluid during eggshell biomineralization. Data Brief. 2014;1:65–69. doi: 10.1016/j.dib.2014.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Melek O., Morris T.R., Jennings R.C. The time factor in egg formation for hens exposed to ahemeral light-dark cycles. Br. Poult. Sci. 1973;14:493–498. doi: 10.1080/00071667308416056. [DOI] [PubMed] [Google Scholar]
  25. Morris T.R. The effects of ahemeral light and dark cycles on egg production in the fowl. Poult. Sci. 1973;52:423–445. doi: 10.3382/ps.0520423. [DOI] [PubMed] [Google Scholar]
  26. Nishiwaki-Ohkawa T., Yoshimura T. Molecular basis for regulating seasonal reproduction in vertebrates. J Endocrinol. 2016;229:117–127. doi: 10.1530/JOE-16-0066. [DOI] [PubMed] [Google Scholar]
  27. Nordstrom J.O., Ousterhout L.E. Ahemeral light cycles and protein levels for older laying hens. Poult. Sci. 1983;62:525–531. doi: 10.3382/ps.0620525. [DOI] [PubMed] [Google Scholar]
  28. Nys Y., Bain M., Immerseel F.V. Pages 83–132 Food Science, Technology and Nutrition. Woodhead Publishing; Cambridge, UK: 2011. lmproving the safety and quality of eggs and egg products. [Google Scholar]
  29. Oh K.Y., Ruy B.G., Noh J.S., Choi D.S., Choe K.J. Analyses on the status of eggshell breakage in the step of egg conveyer system of the laying hen house. J. Livestock Housing Environ. 2008;14:47–52. [Google Scholar]
  30. Robinson F.E., Etches R.J. Ovarian steroidogenesis during follicular maturation in the domestic fowl (Gallus domesticus)1. Biol Reprod. 1986;35:1096–1105. doi: 10.1095/biolreprod35.5.1096. [DOI] [PubMed] [Google Scholar]
  31. Rodríguez-Navarro A.B., Marie P., Nys Y., Hincke M.T., Gautron J. Amorphous calcium carbonate controls avian eggshell mineralization: a new paradigm for understanding rapid eggshell calcification. J. Struct. Biol. 2015;190:291–303. doi: 10.1016/j.jsb.2015.04.014. [DOI] [PubMed] [Google Scholar]
  32. Shanawany M.M. The effect of ahemeral light and dark cycles on the performance of laying hens- (a review) World's Poult. Sci. J. 1982;38:120–126. [Google Scholar]
  33. Simon J., Mara B., Ulrich B., Christin H., Ingrid H., Stefanie P., Ahmad R.S., Annett W., Mirja R.W., Steffen W. Bone health or performance? Adaptation response of genetically divergent chicken layer lines to a nutritive calcium depletion. Animals. 2020;10:1645. doi: 10.3390/ani10091645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Siopes T.D., Neely E.R. Ahemeral lighting of turkey breeder hens. 1. Cycle length effects on egg production and egg characteristics. Poult. Sci. 1997;76:761–766. doi: 10.1093/ps/76.5.761. [DOI] [PubMed] [Google Scholar]
  35. Song M.Z., Jiao H.C., Zhao J.P., Wang X.J., Li H.F., Wang P., Ma B.S., Sun S.H., Lin H. Dietary supplementation of calcium propionate and calcium butyrate improves eggshell quality of laying hens in the late phase of production. Poult. Sci. 2022;59:64–74. doi: 10.2141/jpsa.0200127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sun C.J., Qu L., Yi G.Q., Yuan J.W., Duan Z.Y., Shen M.M., Qu L.J., Xu G.Y., Wang K.H., Yang N. Genome-wide association study revealed a promising region and candidate genes for eggshell quality in an F2 resource population. BMC Genom. 2015;16:565. doi: 10.1186/s12864-015-1795-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Spies A.A.B., Robinson F.E., Renema R.A., Feddes J.J.R., Zuidhof M.J., Fitzsimmons R.C. The effects of body weight and long ahemeral days on early production parameters and morphological characteristics of broiler breeder hens. Poult. Sci. 2000;79:1094–1100. doi: 10.1093/ps/79.8.1094. [DOI] [PubMed] [Google Scholar]
  38. Sun C.J., Duan Z.Y., Qu L.J., Zheng J.X., Yang N., Xu G.Y. Expression analysis for candidate genes associated with eggshell mechanical property. J. Integr. Agric. 2016;15:397–402. [Google Scholar]
  39. Wistedt A., Ridderstrale Y., Wall H., Holm L. Age-related changes in the shell gland and duodenum in relation to shell quality and bone strength in commercial laying hen hybrids. Acta. Vet. Scand. 2019;61:1–14. doi: 10.1186/s13028-019-0449-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wu T., Dong Y., Yang Z.Q., Kato H., Ni Y.H., Fu Z.W. Differential resetting process of circadian gene expression in rat pineal glands after the reversal of the light/dark cycle via a 24 h light or dark period transition. Chronobiol Int. 2009;26:793–807. doi: 10.1080/07420520903044208. [DOI] [PubMed] [Google Scholar]
  41. Wu T., Jin Y.X., Kato H., Fu Z.W. Light and food signals cooperate to entrain the rat pineal circadian system. J Neurosci Res. 2008;86:3039–3255. doi: 10.1002/jnr.21769. [DOI] [PubMed] [Google Scholar]
  42. Xins Q., Wang M.H., Jiao H.C., Zhao J.P., Li H.F., Wang X.J., Lin H. Prolonged scotophase within a 24 hour light regime improves eggshell quality by enhancing calcium deposition in laying hens. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Zhang Z.C., Du X.X., Lai S., Shu G., Zhu Q., Tian Y.F., Li D.Y., Wang Y., Yang J.D., Zhang Y., Zhao X.L. A transcriptome analysis for 24-hour continuous sampled uterus reveals circadian regulation of the key pathways involved in eggshell formation of chicken. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhang J.Q., Shen M., Zhu C.C., Yu F.X., Liu Z.Q., Nazim A., Sun S.C., Li K., Liu H.L. 3-Nitropropionic acid induces ovarian oxidative stress and impairs follicle in mouse. PloS One. 2014;9:e86589. doi: 10.1371/journal.pone.0086589. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES