Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Mar 6;103(5):103622. doi: 10.1016/j.psj.2024.103622

In-house ammonia induced lung impairment and oxidative stress of ducks

Bo Liu *,†,1, Yongjie Yang ‡,1, Yang Fu *, Yue Zhao *, Wenjing Chen *, Shi Wei , Xin Zuo *, Yongwen Zhu *, Hui Ye *, Minhong Zhang §, Peng Zhang ǁ, Lin Yang *, Wence Wang ⁎,2, Jie Pan #
PMCID: PMC10973188  PMID: 38513550

Abstract

Ammonia (NH3) is a toxic gas that in intensive poultry houses, damages the poultry health and induces various diseases. This study investigated the effects of NH3 exposure (0, 15, 30, and 45 ppm) on growth performance, serum biochemical indexes, antioxidative indicators, tracheal and lung impairments in Pekin ducks. A total of 288 one-day-old Pekin male ducks were randomly allocated to 4 groups with 6 replicates and slaughtered after the 21-d test period. Our results showed that 45 ppm NH3 significantly reduced the average daily feed intake (ADFI) of Pekin ducks. Ammonia exposure significantly reduced liver, lung, kidney, and heart indexes, and lowered the relative weight of the ileum. With the increasing of in-house NH3, serum NH3 and uric acid (UA) concentrations of ducks were significantly increased, as well as liver malondialdehyde (MDA), superoxide dismutase (SOD), and glutathione peroxidase (GPX-Px) contents. High NH3 also induced trachea and lung injury, thereby increasing levels of tumor necrosis factor-α (TNF-α) and interleukin-4 (IL-4) in the lung, and decreasing the mRNA expressions of zonula occludens 1 (ZO-1) and claudin 3 (CLDN3) in the lung. In conclusion, in-house NH3 decrease the growth performance in ducks, induce trachea and lung injuries and meanwhile increase the compensatory antioxidant activity for host protection.

Key words: ammonia, duck, growth performance, trachea, lung

INTRODUCTION

The environment in livestock and poultry houses plays an important role in the growth and reproduction of livestock and poultry (Qi et al., 2023). With the continuous expansion in livestock production and the increasing stocking density, in-house harmful gases have become one of the harmful factors affecting the breeding environment (Zeng et al., 2021). Carbohydrates and nitrogen-containing sulfur compounds in animal excrement produce odorous gases mainly composed of incomplete metabolites of animals under the action of microbial anaerobic fermentation, including NH3, hydrogen sulfide, indole, skatole, acetic acid, and butyric acid (Dai et al., 2015; Konkol et al., 2022).

Ammonia emissions have received increasing attention for their potentially negative impacts on farming environments, the ecosystem, and human or animal health (Langridge et al., 2012; Costa, 2017). In agricultural practices, the mean aerial NH3 concentrations in poultry houses typically range from 5 to 30 ppm (parts per million) (Ni et al., 2012; Bist et al., 2023). Several studies have recommended that NH3 levels in poultry houses should not exceed 25 ppm (Beker et al., 2004; Olanrewaju et al., 2008; David et al., 2015; Wei et al., 2015; Bist et al., 2023). However, empirical evidence indicates that NH3 concentrations in broiler houses often surpass 25 ppm and may escalate to as high as 50 ppm or even greater levels (Olanrewaju et al., 2008; Bist et al., 2023). Excessive NH3 concentration will affect the metabolism of brain and muscle cells, leading to NH3 poisoning (Tao et al., 2019; Grzinic et al., 2023).

Poultry is highly sensitive to NH3, and several studies focused on the growth performance of broilers. Seven-day-old Ross broilers exposed to 25 and 50 ppm NH3 were found to cause eye damage, resulting in decreased growth performance and metabolic functions (Olanrewaju et al., 2008; Bist et al., 2023). The feed conversion efficiency of commercial broilers, aged 1 to 21 d, significantly decreased as NH3 concentration increased within the range of 16 to 54 ppm (Yahav, 2004; Smith et al., 2016).

Simultaneously, NH3 stress also disrupts the respiratory mucosal barrier, resulting in immune and physiological dysfunctions in broilers (Grzinic et al., 2023). The respiratory tract serves as the primary defense. Inhaling NH3 harms the trachea and lung tissue, leading to inflammation and cellular necrosis (Bai et al., 2021). Furthermore, NH3 stress significantly increasing serum interleukin-1β (IL-1β) and interleukin-6 (IL-6) production, leading to systemic inflammation (Zhou et al., 2020). Ammonia exposure results in tracheitis cell infiltration, decline in barrier function and necrotic injury in pigs (Xing et al., 2016; Wang et al., 2021). Additionally, studies have reported the presence of basal inflammation and tracheal mucosa rupture following exposure to NH3 gas in chicken trachea (Wang et al., 2020).

Therefore, exposure to NH3 affects the respiratory and immune systems of animals, ultimately resulting in decreased growth performance. However, whether ducks exhibit distinct sensitivities to NH3 and tolerance amount remains to be studied. Our experiment investigated the growth performance, serum biochemical indexes, antioxidant performance, and the injury in lungs and trachea of Pekin ducks with different concentrations of NH3, and explored the NH3 stress and limitation in the early stage of ducks.

MATERIALS AND METHODS

Birds, Diets, and Experimental Design

All procedures used in this study were authorized by the Animal Protection and Use Committee of South China Agricultural University (approval ID 21004152). A total of 288 one-day-old Pekin male ducks were randomly divided into four groups and raised in breathing chambers. Each group consists of 6 replicates, with each replication containing 12 ducks. The control group was grown with NH3-free gas, and the other three experimental groups were continuously filled with ammonia gas, and the ammonia concentrations at different positions were randomly detected every hour with Gastec3 detector tubes (kit 800) and portable ammonia detector. The ammonia flow rate is calculated from the ventilation volume, the cabin size and the preset ammonia concentration. During the test period, the average measured values of ammonia concentration in the four cabins were (15 ± 3) ppm, (30 ± 3) ppm and (45 ± 3) ppm NH3, respectively. The trial lasted for 21 d. Feed and water were provided ad libitum. Keep the temperature at 33 ± 1°C for the first 3 d, then reduce it by until it reaches to 26°C. Maintain the relative humidity between 45% and 60%, and ensure 24-h lighting with 10 Lux.

The basal diet is according to nutrients requirement of meat ducks (NY/T 2122‐2012, 2012). The raw material composition and nutrition level are shown in Table 1.

Table 1.

Composition and nutrient content of standard diet in each group (air-dry basis, %).

Ingredient (%) Values (%) Nutrient level (%)2 Values (%)
Corn 62.00 ME, MJ/kg 12.14
Soybean meal 31.00 CP, % 19.09
Fishmeal 1.00 Ca, % 1.31
Talcum powder 1.20 NPP, % 0.42
CaHPO4 1.30 Lys, % 1.10
Wheat bran 2.00 Met + Cys, % 0.80
Premix1 1.50
1

The premix contains: multivitamin 0.02%, multimineral 0.10%, sodium chloride 0.30%, lysine 0.30%, methionine 0.14%, choline 0.10%, phytase 0.02%, composite enzyme 0.10%, mildew agent 0.05%, rice husk powder 0.37%. Multivitamin for each kg of ration: VA 12,000 IU; VD 3,000 IU; VE 30 mg; VK3 6 mg; VB1 3 mg; VB2 9 mg; VB6 6 mg; VB12 0.03 mg; D-Pantothenic Acid 60 mg; Folic Acid 1.5 mg; Biotin 0.18 mg. Multimineral for each kg of ration: iron ≥90 mg, cobalt ≥200 mg, copper ≥8 mg, zinc ≥70 mg, manganese ≥100 mg, iodine ≥0.6 mg, selenium ≥0.4 mg, moisture ≤10.0%.

2

Calculated value.

Growth Performance

At the 21 d of trial, 2 ducks with weights close to the average were selected for each repetition and fasted. A total of 10 mL of blood was collected from by severing the jugular vein, and centrifuged at 3,000 rpm for 10 min to prepare serum and aliquot it. The serum was stored in a tube at −20°C, and measured serum biochemical parameters.

After serum collection, the trachea, heart, liver, spleen, lung, bursa, and kidney were weighed. Representative samples of liver, lung, and trachea were rinsed with pre-chilled PBS (pH = 7.4), and quickly stored in liquid nitrogen. The alternate aspects of trachea and lung tissues were meticulously selected, sliced into 2 to 3 mm thickness, and immersed in formalin for fixation before histopathological analysis.

Growth Performance

Body weights of the ducks were recorded once every 7 d for the calculation of average daily gain (ADG), and daily feed consumption was recorded for the calculation of average daily feed intake (ADFI) and feed/gain ratio (F/G).

Relative Organ Weights

The weights of different organs (heart, liver, spleen, lung, kidney, and thymus) from the control and test groups were measured. The relative organ weights for each animal were then calculated as follows: absolute organ weight (g)

relativeorganweight=absoluteorganweight(g)bodyweightofducksonthedayofsacrifice(g)×100%

Relative Intestine Weight

The weights of the duodenum, jejunum, ileum, and cecal from 21-day-old Pekin ducks were measured. The relative organ weight of each segment of the intestine was calculated as shown above.

Measurement of Serum Biochemical and Antioxidant Indicators

Serum NH3, total protein (TP) (BCA method), albumin (ALB) (BCG method), globulin (GLB) (ELISA method), urea (UREA) (ELISA method), uric acid (UA) (ELISA method), and plasma glucose (GLU) (Hexokinase method) were determined using an Automatic Biochemistry Radiometer (Au640, Olympus). The absorbance was detected by UV-Vis spectrophotometry and calculated. Superoxide dismutase (SOD) (NBT method), glutathione peroxidase (GPX-Px) (Colorimetric method), total antioxidant capacity (T-AOC) (ABTS method), catalase (CAT) (Colorimetric method), and malondialdehyde (MDA) (TBA method) were determined using the kit provided by Nanjing Jiancheng Bioengineering Research Institute according to the operating procedures on the instruction manual.

Histomorphology Morphology of Trachea and Lungs

Pieces of trachea and lung tissues from birds were fixed in 4% paraformaldehyde. Fixed tissues were embedded in paraffin, then sectioned to 3 μm thickness and stained with hematoxylin-eosin (HE). Tissue sections were scanned with Pannoramic MIDI (3D Histech, Hungary) and then the pictures were analyzed with virtual microscope software (Pannoramic Viewer version 1.15.2, 3D Histech).

Liver Antioxidant Indexes Determination

For a representative liver tissue sample, add 9 times the volume of pre-cooled saline, and homogenize on an ice homogenizer (Ultra-Turrax T8, IKA, Germany) at 10,000 rpm for 10 s. At intervals of 10 s, 3 to 4 consecutive times, a 10% tissue homogenate was made. After homogenization, freeze the centrifuge at 4°C, 3,500 rpm for 10 min, and take the supernatant for later use.

The protein content of liver tissue was determined by the Coomassie Brilliant Blue method. The CAT, SOD, GPX-Px, T-AOC, and MDA were determined using the kit provided by Nanjing Jiancheng Bioengineering Research Institute according to the operating procedures on the instruction manual.

The lung cytokine indicators IL-1β, interleukin-4 (IL-4), IL-6 and tumor necrosis factor-α (TNF-α) were measured by ELISA kit. These measurements were conducted following the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

Relative Expression of Tight Junction Protein mRNA

Total RNA was extracted from tissues using the Magen HiPure Universal RNA Mini Kit (USG, Guangzhou), and the total RNA concentration was measured by the nucleic acid analyzer (ND-2,000, Gene Company Ltd), and detected by the agarose gel electrophoresis RNA integrity (Sangon Biological, China, Shanghai).

TaKaRa Prime Script TM RT reagent Kit with gDNA Eraser (Takara, Japan) was used to reverse transcribe RNA into cDNA.

Referring to Mallard's gene published on GenBank, the upstream and downstream primers of the target gene and the reference gene were designed on Primer Premier 5.0 software. The primers were synthesized by Shanghai Biotech Biotechnology Co., Ltd. Quantitative PCR was performed using the SYBR Green Quantitative PCR kit (Takara). The instrument was ABI 7500 (Applied Bio-systems, Foster City, CA). The reaction conditions were 95°C predenaturation for 30 s, and then 95°C for 5 s, annealed at 60°C for 40 cycles, extended at 30°C for 1 min and calculated the relative expression of each target gene by 2−ΔΔCt method. The details of the upstream and downstream primers of the internal and target genes were shown in Table 2.

Table 2.

Gene primer sequence, gene bank accession number, and product length.

Genes Primer sequence (5′-3′) Accession Number Size (bp)
OCLN F: GCTGGGCTACAACTACGGGT
R: ACGATGGAGGCGATGAGC
XM_013109403.1 240
CLDN3 F: GGCATCATATTCAGCACCTTC
R: GCCTTACGCACTACATCTTGG
XM_013108556.1 134
ZO-1 F: TCAGCGAGATGAACGAGCC
R: TCTGAAGGCTCTGACCTCTGG
XM_013104936.1 189
BCL2 F: ACCTGGTTCTGAATAAGTGGGAT
R: GGTTGTCTTCTCAGTGTTGCCT
XM_005028719.1 187
β-actin F: GCTATGTCGCCCTGGATTT
R: GGATGCCACAGGACTCCATAC
EF667345.1 160
CASP3 F: TGTTGAGGCAGACAGTGGACC
R: GGAGTAATAGCCTGGAGCAGTAGA
XM_005030494.1 100

Statistical Analysis

Data on growth performance and serum parameters were presented as the mean and pooled standard error of the mean (SEM). Other data are presented as the mean ± SEM. Data were analyzed by one-way analysis of variance (ANOVA) using the GLM program of the SAS software (SAS Institute, Inc., Cary, NC). Values of P < 0.05 were regarded as significant.

RESULTS

Growth Performance of Pekin Ducks

The initial body weight, final body weight, average daily feed intake (ADFI), average body weight gain (ADG), and F/G of ducks in different groups were measured (Table 3). Our results showed that different NH3 concentrations did not significantly change the final body weight, ADG, and F/G of Pekin ducks, while the concentration of NH3 at 45 ppm significantly decreased the ADFI of ducks (P < 0.05).

Table 3.

Effect of different NH3 concentrations on growth performance of Pekin ducks at 21 d of age.

Ammonia concentration (ppm) Initial body weight (g) Final body weight (kg) ADFI (g/d) ADG (g) F/G
0 55.28 1.24 101.40a 59.34 1.71
15 55.37 1.27 98.85a 58.58 1.69
30 54.78 1.19 98.76a 59.98 1.73
45 55.01 1.17 93.53b 55.80 1.68
SEM 0.25 0.02 1.62 1.34 0.02
P-Value 0.35 0.10 0.02 0.10 0.32
a-b

Means within a column subgroup with no common superscripts are significantly different at P < 0.05. Results are presented as means ± SEM (n = 6).

Organ Indexes and Relative Intestinal Weights of Pekin Ducks

Organ indexes and relative intestinal weights of 21-day-old Pekin ducks were shown in Table 4 and 5. The heart index was significantly decreased at 15 ppm and 30 ppm NH3 concentrations compared with that in the control group (P < 0.05). Meanwhile, the liver, lung and kidney indexes of Pekin ducks were extremely decreased with the increase of NH3 concentration (P < 0.01). Compared with the control group, the treatment of NH3 concentration at 15 ppm and 45 ppm significantly reduced the relative weight of the ileum in Pekin ducks (P < 0.05), but did not change the relative weight of other intestinal segments (Table 5).

Table 4.

Effect of different NH3 concentrations on organ index of Pekin ducks at 21 d of age (%).

Ammonia concentration (ppm) Heart Liver Spleen Lung Kidney Thymus
0 7.17a 34.81A 1.35 8.94A 10.54A 7.93
15 6.12b 32.61A 1.53 7.62B 9.85A 7.89
30 6.28b 33.20A 1.53 7.55B 9.97A 7.08
45 6.65ab 27.71B 1.36 7.39B 8.20B 6.61
SEM 0.23 2.00 0.10 0.36 0.37 0.66
P-Value 0.04 <0.01 0.39 <0.01 <0.01 0.28
a-b

Means within a column subgroup with no common superscripts are significantly different at P < 0.05.

A-B

Means within a column subgroup with no common superscripts are significantly different at P < 0.01. Results are presented as means ± SEM (n = 6).

Table 5.

Effect of different NH3 concentrations on relative intestinal weights of Pekin ducks at 21 d of age (%).

Ammonia concentration (ppm) Duodenum Jejunum Ileum Cecal
0 5.95 16.34 17.24a 2.86
15 5.84 15.54 15.45b 2.75
30 5.88 15.80 15.79b 2.80
45 5.87 15.05 15.31b 2.56
SEM 0.20 0.60 0.53 0.09
P-Value 0.98 0.52 0.04 0.16
a-b

Means within a column subgroup with no common superscripts are significantly different at P < 0.05. Results are presented as means ± SEM (n = 6).

Serum Biochemical Indicators in Ducks

The effects of different concentrations on the serum biochemical parameters of Pekin ducks were shown in Table 6. Ammonia extremely increased the plasma NH3 level of Pekin ducks with the increasing of in-house NH3 concentration (P < 0.01). Compared with the control group, NH3 significantly increased the serum UA content of Pekin ducks (P < 0.05). However, NH3 has no significant effect on TP, ALB, GLB, UREA, and GLU levels.

Table 6.

Effects of different concentrations of NH3 on serum biochemical parameters of Pekin ducks.

Ammonia concentration (ppm) Serum ammonia (μmol/L) TP (g/L) ALB (g/L) GLB (g/L) UA (μmol/L) UREA (mmol/L) GLU (mmol/L)
0 158.45C 29.97 11.90 18.07 191.67c 0.41 10.17
15 193.92BC 30.22 12.02 18.20 214.00ab 0.40 9.92
30 217.96B 29.50 11.77 17.73 263.33a 0.36 10.37
45 259.74A 29.37 11.72 17.65 272.20a 0.38 10.50
SEM 12.25 0.83 0.29 0.57 19.33 0.02 0.24
P-Value < 0.01 0.88 0.88 0.88 0.03 0.47 0.39
a-b

Means within a column subgroup with no common superscripts are significantly different at P < 0.05.

A-B

Means within a column subgroup with no common superscripts are significantly different at P < 0.01. Results are presented as means ± SEM (n = 6).

Effects of NH3 on Antioxidant Capacity of Serum and Liver

Our results showed that NH3 gas has no significant effect on serum antioxidant indexes (Table 7). MDA level in serum was increased with the NH3 increasing. Compared with the control group, 45 ppm NH3 significantly increased SOD, GSH-Px, and MDA contents in the liver (Table 8).

Table 7.

Effects of different NH3 concentrations on serum antioxidant capacity of Pekin ducks.

Ammonia concentration (ppm) CAT (U/mL) SOD (U/mL) GSH-Px (U/mL) MDA (nmol/mL) T-AOC (U/mL)
0 1.25 210.75 311.34 15.64 0.82
15 1.66 214.92 307.46 23.27 0.75
30 1.61 205.18 312.84 24.36 0.78
45 1.75 204.48 297.01 25.09 0.82
SEM 0.19 4.64 18.91 2.54 0.03
P-Value 0.30 0.36 0.93 0.07 0.35

a-bMeans within a column subgroup with no common superscripts are significantly different at P < 0.05. Results are presented as means ± SEM (n = 6).

Table 8.

Effects of different concentrations of NH3 on the liver antioxidant capacity of Pekin ducks.

Ammonia concentration (ppm) CAT (U/mg prot) SOD (U/mg prot) GSH-Px (U/mg prot) MDA (nmol/g prot) T-AOC (mmol/g prot)
0 60.08 76.38B 671.10B 10.33B 0.82
15 60.46 82.47B 612.10B 13.32B 0.75
30 64.12 148.19A 599.90B 13.05B 0.79
45 71.28 148.62A 1145.40A 24.22A 0.82
SEM 3.40 14.36 76.46 1.87 0.03
P-Value 0.10 < 0.01 < 0.01 < 0.01 0.35
A-B

Means within a column subgroup with no common superscripts are significantly different at P < 0.01. Results are presented as means ± SEM (n = 6).

Effects of Different NH3 Concentrations on the Trachea and Lungs Morphology

Respiratory capillaries and pulmonary atrial structures were seen in the lung tissue of the control group, and a large number of capillaries were surrounded by the respiratory capillaries (Figure 1A). When the NH3 concentration was increased to 15 ppm, inflammatory cells were aggregated in the parabronchial bronchus, and a large number of red blood cells were found in some of the parabronchial tubes and the lung chambers. When the NH3 concentration was increased to 30 ppm, the interlobular space increased, parabronchial hyperemia, localized infiltration of inflammatory cells in the tissue. When NH3 concentration increased to 45 ppm, focal infiltration of inflammatory cells in the tissue, vascular congestion and expansion, connective tissue hyperplasia (Figure 1B).

Figure 1.

Figure 1

HE staining of trachea and lungs of Pekin duck. (A) Micrographs of HE staining of the trachea, magnification 400 ×, scale: 200 μm. (B) Micrographs of HE staining of the lungs, 1 and 2 magnifications 400 ×, 3 and 4 magnifications 100 ×, scale 100 μm. (C) 1: control group; 2: 15 ppm group; 3: 30 ppm group; 4: 45 ppm group.

Effects of NH3 on the mRNA Expression of Tight Junction Protein in the Trachea and Lungs

Our results showed that NH3 has no significant effect on the mRNA expressions of BCL2, CASP3, and ZO-1 in trachea of Pekin ducks (Figure 2). The CLDN3 mRNA expression in 45 ppm group was enhanced compared with that of the control group (P < 0.05). But the relative mRNA expression of ZO-1 and CLDN3 in the lung were extremely reduced by NH3 in all treatment groups (P < 0.01) (Figure 3).

Figure 2.

Figure 2

Effects of NH3 on the mRNA expression of tight junction protein in the trachea. Results are presented as means ± SEM (n = 6).

Figure 3.

Figure 3

Effects of NH3 on the mRNA expression of tight junction protein in the lung (n = 6). Columns with different letters are considered significant. Results are presented as means ± SEM (n = 6).

Effects of NH3 on Cytokines Levels in Lung

As shown in Figure 4, NH3 had no significant effect on the cytokines IL-1β and IL-6 in the lung. NH3 extremely increased the level of the pro-inflammatory factor TNF-α in the 15 ppm group compared to the control group (P < 0.01). Meanwhile, 30 ppm and 45 ppm groups have the higher TNF-α levels compared with the control group. NH3 significantly increased the levels of the anti-inflammatory factor IL-4 in the 15 ppm group compared to the control group, but not in the 30 ppm and 45 ppm groups.

Figure 4.

Figure 4

Effect of NH3 on cytokines levels in lung. Columns with different letters are considered significant. Results are presented as means ± SEM (n = 6).

DISCUSSION

Due to the expansion of intensive farming scale and the increase of farming density, the harm to livestock and poultry caused by a large amount of ammonia discharged from livestock and poultry excreta was gradually aggravated (Zeng et al., 2021). In addition, excessive protein feed increased the nitrogen-containing organic matter in feed residues and excreta, which also led to an increase in ammonia emission and affects the growth of livestock and poultry (Dai et al., 2015; Konkol et al., 2022). This study investigated the effects of NH3 on the growth performance, serum biochemistry parameters and respiratory systems of meat ducks. Ammonia posed a health risk to both humans and animals, as it could cause local and systemic inflammation (Wu et al., 2017). Ammonia exposure caused ACE2 damage and pulmonary fibrosis in piglets (Wang et al., 2024). Poultry were susceptible to external irritation from NH3, and inhibiting the feeding center leads to decreased feed intake (David et al., 2015). In addition, high concentrations of NH3 can also reduce the animals internal heat loss, thereby suppressing their feed intake (Li et al., 2020). Excessive NH3 has immunotoxin effect on broilers, especially on spleen inflammation (An et al., 2019). However, the harmful effects of NH3 on the health of meat ducks have been rarely reported. Our research indicated that high NH3 concentration can significantly decreased the ADFI of meat ducks, and this effect becomed increasingly evident with higher NH3 concentrations.

Previous studies demonstrated the effects of environmental pollutant NH3 on different organs of chicken as the liver, heart, and thymus (Xing et al., 2019; Wang et al., 2020). Our organ indexes found that 45 ppm NH3 significantly reduce the relative weight of the liver and kidney, which indicated that a high concentration of NH3 gas damage the liver and kidney of ducks. According to the study, elevated levels of NH3 lead to pulmonary bleeding, suggesting that NH3 harmed the lungs (Zhang et al., 2015; Ma et al., 2023). Our findings suggested that elevated NH3 concentrations resulted in decreased relative lung weight, indicating anabatic impaired lung development by NH3 increasing. The relative heart weights in the 15 ppm and 30 ppm NH3 groups were significantly lower than that of the control group, indicating a certain degree of cardiac injury under ammonia-induced stress. The combination of NH3 with hemoglobin might reduce the oxygen-carrying capacity of hemoglobin, leading to chronic hypoxia in the body, and causing heart fatigue and failure, consequently an increasing in cardiac index (Grzinic et al., 2023). The specific effect of NH3 stimulation on the heart remains to be further studied.

Our results showed that serum NH3 concentration increased with the increase of NH3 gas concentration. Excessive serum NH3 causes the liver to produce more uric acid. Excessive inhalation of NH3 through the lungs induced the increasing of serum NH3, which is converted into uric acid in the liver. With the increase of serum NH3 concentration, the metabolic activities of muscle cells and nerve cells are hindered (Dasarathy et al., 2017). NH3 in the serum will inhibit the feeding center of livestock and poultry, reducing the food intake, causing NH3 poisoning in livestock and poultry, and death occurring in severe cases (Donsbough et al., 2010; Bist et al., 2023). It has been showed that NH3 gas also increased the serum NH3 content of Pekin ducks, and the UA content in the serum increased significantly with the increase of NH3 concentration, which significantly reduced feed intake and the development of liver, kidney, lung and other organs.

Ammonia affected the development of the intestinal tract, thereby impacting the growth performance of animals (Jin et al., 2017; Han et al., 2021). Our results showed that NH3 significantly reduced the ileum relative weight of Pekin ducks. In addition, NH3 also reduced the relative weight of the jejunum, but it did not reach a significant level. Studies have shown that NH3 also caused intestinal inflammation and intestinal microbiota disruption, affecting jejunal epithelial tight junctions and intestinal barrier function (Jin et al., 2017; Fan et al., 2023). However, the effects of NH3 on the intestinal microbiota and intestinal barrier of Pekin ducks remain to be studied.

T-AOC, SOD, GSH-Px, CAT activity, and MDA content indicated the overall antioxidant capacity of the body. Our study showed that 45 ppm NH3 significantly increased the activity of liver MDA and GSH-Px in ducks, and the liver SOD activity in higher NH3 groups also significantly increased. These results demonstrated high NH3 increased peroxidation or ROS level in host mechanism, and induced the enhancement of GSH-Px and SOD activities in liver for compensatory antioxidation (Wei et al., 2014; Xing et al., 2016). Studies have shown that ammonia has a close relationship between the lung and the liver. The lung inhales ambient ammonia, which directly leads to the increase of blood ammonia. Excessive blood ammonia promotes the liver to produce a large amount of uric acid, which further leads to the imbalance of uric acid metabolism and affects organ development. Therefore, the level of oxidative stress in the liver may serve as an indirect indicator of the overall oxidative stress status in the organism, including the lungs (Dasarathy et al., 2017). Oxidative stress in lung caused by ammonia may also be one of the causes of pneumonia (Gauthier et al., 2023).

Our results found that NH3 has a significant injury on the lungs, and as the NH3 concentration increased, the relative weight of the lungs decreased. Tracheal and lung HE morphology results revealed that exposure to NH3 caused detachment of tracheal epithelial cells, infiltration of inflammatory cells, submucosal edema, and proliferation of connective tissue. Studies have found that the tracheal pathological structure in NH3 containing pigs has been changed, with inflammatory cell infiltration, decreased barrier function, and necrotic damage (Xing et al., 2016; Wang et al., 2021). Other studies have found that after NH3 gas exposure, basal inflammation and tracheal mucosa rupture has been detected in chicken tracheal (Wang et al., 2020). As to the tight junction gene expression in lungs and tracheas, our results showed that BCL2, CASP3, ZO-1, and CLDN3 gene expressions in the trachea did no significant changed with NH3 increasing, but NH3 significantly reducing mRNA expression of ZO-1 and CLDN3 in the lungs, indicating that NH3 gas damaged the tight connection of the lung mucosa in ducks. To a certain extent, the destruction of the barrier accelerated the dissolution of NH3 gas from the air into the serum, causing higher serum NH3 level.

Excessive productions of IL-1, IL-6, and TNF-α would promote the inflammatory response, cause tissue damage, and play as stress-induced direct mediators (Meagher et al., 2007; Wang et al., 2019). Previous studies found that under hypoxic, ischemic, or stress conditions, IL-1 and IL-6 showed significant up-regulation and sustained secretion (Hartmann et al., 2000). IL-1β is the main secreted form of IL-1 in serum and interstitial fluid. IL-4 is a multifunctional anti-inflammatory cytokine produced by T cells or mast cells. Our results showed that NH3 gas significantly up-regulated levels of TNF-α and IL-4 in the lungs, indicating that NH3 gas caused the inflammatory response of the lungs in Pekin ducks, which is consistent with the results obtained from morphology results.

In summary, in-house NH3 significantly enhances liver MDA and GSH-Px acitivity, induced inpairment in lung and tracheal tissues, reduced ZO-1 and CLDN3 mRNA expression in lungs, while simultaneously elevated anti-inflammatory factor IL-4 and inflammatory factor TNF-α levels in ducks. These findings will help to improve our understanding of the possible injury mechanism of harmful gases in ducks.

ACKNOWLEDGMENTS

This paper was supported by South China Agricultural University. This study was sponsored by the National Science Fund for Outstanding Young Scholars (32222080), National Science Fund Project of China (32072751), Guangdong Province Natural Science Funds for Distinguished Young Scholar (2022B1515020016), National Key Research Program (2021YFD1300404, 2022YFD1300400 and 1301800), China Agriculture Research System (CARS-42-15), Modern Agricultural Industrial Technology System Innovation Team of Guangdong Province (2022KJ137), Natural Science Foundation of Guangdong Province (2019B1515210012), Guangdong Basic and Applied Basic Research Foundation (2022B1515130003).

Author Contributions: Bo Liu, Jie Pan, and Lin Yang designed the study. Bo Liu, Yongjie Yang, and Yang Fu acquired the data and performed experiments. Yue Zhao, Wenjing Chen, Bo Liu, Xin Zuo, and Shi Wei helped conduct the animal experiments. Yongwen Zhu, Hui Ye, Minhong Zhang and Peng Zhang advised on the data analysis. Yang Fu, Bo Liu, Jie Pan, and Wence Wang wrote the manuscript. All authors read and approved the manuscript.

Data Availability Statement: The data presented in this study are available upon reasonable request from the corresponding author.

Institutional Review Board Statement: This research was approved by the Animal Protection and Use Committee of South China Agricultural University (ID 21004152).

Informed Consent Statement: Not applicable.

DISCLOSURES

The authors declare no conflict of interest.

REFERENCES

  1. An Y., Xing H., Zhang Y., Jia P., Gu X., Teng X. The evaluation of potential immunotoxicity induced by environmental pollutant ammonia in broilers. Poult. Sci. 2019;98:3165–3175. doi: 10.3382/ps/pez135. [DOI] [PubMed] [Google Scholar]
  2. Bai S., Peng X., Wu C., Cai T., Liu J., Shu G. Effects of dietary inclusion of Radix Bupleuri extract on the growth performance, and ultrastructural changes and apoptosis of lung epithelial cells in broilers exposed to atmospheric ammonia. J. Anim. Sci. 2021;99:skab313. doi: 10.1093/jas/skab313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beker A., Vanhooser S.L., Swartlzander J.H., Teeter R.G. Atmospheric ammonia concentration effects on broiler growth and performance. J. Appl. Poult. Res. 2004;13:5–9. [Google Scholar]
  4. Bist R.B., Subedi S., Chai L., Yang X. Ammonia emissions, impacts, and mitigation strategies for poultry production: a critical review. J. Environ. Manage. 2023;328 doi: 10.1016/j.jenvman.2022.116919. [DOI] [PubMed] [Google Scholar]
  5. Costa A. Ammonia concentrations and emissions from finishing pigs reared in different growing rooms. J. Environ. Qual. 2017;46:255–260. doi: 10.2134/jeq2016.04.0134. [DOI] [PubMed] [Google Scholar]
  6. Dai X., Saha C.K., Ni J., Heber A.J., Blanes-Vidal V., Dunn J.L. Characteristics of pollutant gas releases from swine, dairy, beef, and layer manure, and municipal wastewater. Water Res. 2015;76:110–119. doi: 10.1016/j.watres.2015.02.050. [DOI] [PubMed] [Google Scholar]
  7. Dasarathy S., Mookerjee R.P., Rackayova V., Rangroo T.V., Vairappan B., Ott P., Rose C.F. Ammonia toxicity: from head to toe? Metab. Brain Dis. 2017;32:529–538. doi: 10.1007/s11011-016-9938-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. David B., Mejdell C., Michel V., Lund V., Moe R.O. Air quality in alternative housing systems may have an impact on laying hen welfare. Part II-Ammonia. Animals (Basel). 2015;5:886–896. doi: 10.3390/ani5030389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Donsbough A.L., Powell S., Waguespack A., Bidner T.D., Southern L.L. Uric acid, urea, and ammonia concentrations in serum and uric acid concentration in excreta as indicators of amino acid utilization in diets for broilers. Poult. Sci. 2010;89:287–294. doi: 10.3382/ps.2009-00401. [DOI] [PubMed] [Google Scholar]
  10. Fan L., Xia Y., Wang Y., Han D., Liu Y., Li J., Fu J., Wang L., Gan Z., Liu B., Fu J., Zhu C., Wu Z., Zhao J., Han H., Wu H., He Y., Tang Y., Zhang Q., Wang Y., Zhang F., Zong X., Yin J., Zhou X., Yang X., Wang J., Yin Y., Ren W. Gut microbiota bridges dietary nutrients and host immunity. Sci. China Life Sci. 2023;66:2466–2514. doi: 10.1007/s11427-023-2346-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gauthier A.G., Lin M., Zefi S., Kulkarni A., Thakur G.A., Jr A.C.R., Mantell L.L. GAT107-mediated α7 nicotinic acetylcholine receptor signaling attenuates inflammatory lung injury and mortality in a mouse model of ventilator-associated pneumonia by alleviating macrophage mitochondrial oxidative stress via reducing MnSOD-S-glutathionylation. Redox Biol. 2023;60 doi: 10.1016/j.redox.2023.102614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Grzinic G., Piotrowicz-Cieslak A., Klimkowicz-Pawlas A., Gorny R.L., Lawniczek-Walczyk A., Piechowicz L., Olkowska E., Potrykus M., Tankiewicz M., Krupka M., Siebielec G., Wolska L. Intensive poultry farming: a review of the impact on the environment and human health. Sci. Total Environ. 2023;858 doi: 10.1016/j.scitotenv.2022.160014. [DOI] [PubMed] [Google Scholar]
  13. Han H., Zhou Y., Liu Q., Wang G., Feng J., Zhang M. Effects of ammonia on gut microbiota and growth performance of broiler chickens. Animals (Basel) 2021;11:1716. doi: 10.3390/ani11061716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hartmann G., Tschop M., Fischer R., Bidlingmaier C., Riepl R., Tschop K., Hautmann H., Endres S., Toepfer M. High altitude increases circulating interleukin-6, interleukin-1 receptor antagonist and C-reactive protein. Cytokine. 2000;12:246–252. doi: 10.1006/cyto.1999.0533. [DOI] [PubMed] [Google Scholar]
  15. Jin Y., Wu S., Zeng Z., Fu Z. Effects of environmental pollutants on gut microbiota. Environ. Pollut. 2017;222:1–9. doi: 10.1016/j.envpol.2016.11.045. [DOI] [PubMed] [Google Scholar]
  16. Konkol D., Popiela E., Skrzypczak D., Izydorczyk G., Mikula K., Moustakas K., Opalinski S., Korczynski M., Witek-Krowiak A., Chojnacka K. Recent innovations in various methods of harmful gases conversion and its mechanism in poultry farms. Environ. Res. 2022;214:113825. doi: 10.1016/j.envres.2022.113825. [DOI] [PubMed] [Google Scholar]
  17. Langridge J.M., Lack D., Brock C.A., Bahreini R., Middlebrook A.M., Neuman J.A., Nowak J.B., Perring A.E., Schwarz J.P., Spackman J.R., Holloway J.S., Pollack I.B., Ryerson T.B., Roberts J.M., Warneke C., de Gouw J.A., Trainer M.K., Murphy D.M. Evolution of aerosol properties impacting visibility and direct climate forcing in an ammonia-rich urban environment. J. Geophys. Res. Atmos. 2012;117 [Google Scholar]
  18. Li D., Tong Q., Shi Z., Zheng W., Wang Y., Li B., Yan G. Effects of Cold Stress and Ammonia Concentration on Productive Performance and Egg Quality Traits of Laying Hens. Animals (Basel) 2020;10:2252. doi: 10.3390/ani10122252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ma W., Fu Y., Zhu S., Xia D., Zhai S., Xiao D., Zhu Y., Dione M., Ben L., Yang L., Wang W. Ochratoxin A induces abnormal tryptophan metabolism in the intestine and liver to activate AMPK signaling pathway. J. Anim. Sci. Biotechnol. 2023;14:125. doi: 10.1186/s40104-023-00912-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Meagher M.W., Johnson R.R., Young E.E., Vichaya E.G., Lunt S., Hardin E.A., Connor M.A., Welsh C.J. Interleukin-6 as a mechanism for the adverse effects of social stress on acute Theiler's virus infection. Brain Behav. Immun. 2007;21:1083–1095. doi: 10.1016/j.bbi.2007.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ni B.J., Ruscalleda M., Smets B.F. Evaluation on the microbial interactions of anaerobic ammonium oxidizers and heterotrophs in Anammox biofilm. Water Res. 2012;46:4645–4652. doi: 10.1016/j.watres.2012.06.016. [DOI] [PubMed] [Google Scholar]
  22. Olanrewaju H.A., Thaxton J.P., Dozier W.R., Purswell J., Collier S.D., Branton S.L. Interactive effects of ammonia and light intensity on hematochemical variables in broiler chickens. Poult. Sci. 2008;87:1407–1414. doi: 10.3382/ps.2007-00486. [DOI] [PubMed] [Google Scholar]
  23. Qi F., Zhao X., Shi Z., Li H., Zhao W. Environmental factor detection and analysis technologies in livestock and poultry houses: a review. Agriculture (Basel). 2023;13:1489. [Google Scholar]
  24. Smith S., Meade J., Gibbons J., McGill K., Bolton D., Whyte P. Impact of direct and indirect heating systems in broiler units on environmental conditions and flock performance. J. Integr. Agric. 2016;15:2588–2595. [Google Scholar]
  25. Tao Z., Xu W., Zhu C., Zhang S., Shi Z., Song W., Liu H., Li H. Effects of ammonia on intestinal microflora and productive performance of laying ducks. Poult. Sci. 2019;98:1947–1959. doi: 10.3382/ps/pey578. [DOI] [PubMed] [Google Scholar]
  26. Wang H., Zeng X., Zhang X., Liu H., Xing H. Ammonia exposure induces oxidative stress and inflammation by destroying the microtubule structures and the balance of solute carriers in the trachea of pigs. Ecotox. Environ. Saf. 2021;212 doi: 10.1016/j.ecoenv.2021.111974. [DOI] [PubMed] [Google Scholar]
  27. Wang H., Zhang Y., Han Q., Xu Y., Hu G., Xing H. The inflammatory injury of heart caused by ammonia is realized by oxidative stress and abnormal energy metabolism activating inflammatory pathway. Sci. Total Environ. 2020;742 doi: 10.1016/j.scitotenv.2020.140532. [DOI] [PubMed] [Google Scholar]
  28. Wang W., Zhai S., Xia Y., Wang H., Ruan D., Zhou T., Zhu Y., Zhang H., Zhang M., Ye H., Ren W., Yang L. Ochratoxin A induces liver inflammation: involvement of intestinal microbiota. Microbiome. 2019;7:151. doi: 10.1186/s40168-019-0761-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wang X., Zhang D., Zhu Y., Li D., Shen L., Wang Q., Gao Y., Li X., Yu M. Protein lysine acetylation played an important role in NH3-induced AEC2 damage and pulmonary fibrosis in piglets. Sci. Total Environ. 2024;908 doi: 10.1016/j.scitotenv.2023.168303. [DOI] [PubMed] [Google Scholar]
  30. Wei F.X., Hu X.F., Sa R.N., Liu F.Z., Li S.Y., Sun Q.Y. Antioxidant capacity and meat quality of broilers exposed to different ambient humidity and ammonia concentrations. Genet. Mol. Res. 2014;13:3117–3127. doi: 10.4238/2014.April.17.8. [DOI] [PubMed] [Google Scholar]
  31. Wei F.X., Hu X.F., Xu B., Zhang M.H., Li S.Y., Sun Q.Y., Lin P. Ammonia concentration and relative humidity in poultry houses affect the immune response of broilers. Genet. Mol. Res. 2015;14:3160–3169. doi: 10.4238/2015.April.10.27. [DOI] [PubMed] [Google Scholar]
  32. Wu Y.N., Yan F.F., Hu J.Y., Chen H., Tucker C.M., Green A.R., Cheng H.W. The effect of chronic ammonia exposure on acute-phase proteins, immunoglobulin, and cytokines in laying hens. Poult. Sci. 2017;96:1524–1530. doi: 10.3382/ps/pew454. [DOI] [PubMed] [Google Scholar]
  33. Xing H., Luan S., Sun Y., Sa R., Zhang H. Effects of ammonia exposure on carcass traits and fatty acid composition of broiler meat. Anim Nutr. 2016;2:282–287. doi: 10.1016/j.aninu.2016.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Xing H., Peng M., Li Z., Chen J., Zhang H., Teng X. Ammonia inhalation-mediated mir-202-5p leads to cardiac autophagy through PTEN/AKT/mTOR pathway. Chemosphere. 2019;235:858–866. doi: 10.1016/j.chemosphere.2019.06.235. [DOI] [PubMed] [Google Scholar]
  35. Yahav S. Ammonia affects performance and thermoregulation of male broiler chickens. Anim. Res. 2004;53:289–293. [Google Scholar]
  36. Zeng X., Liu R., Li Y., Li J., Zhao Q., Li X., Bao J. Excessive ammonia inhalation causes liver damage and dysfunction by altering gene networks associated with oxidative stress and immune function. Ecotox. Environ. Saf. 2021:217. doi: 10.1016/j.ecoenv.2021.112203. [DOI] [PubMed] [Google Scholar]
  37. Zhang J., Li C., Tang X., Lu Q., Sa R., Zhang H. High Concentrations of atmospheric ammonia induce alterations in the hepatic proteome of broilers (Gallus gallus): an iTRAQ-based quantitative proteomic analysis. PLoS One. 2015;10 doi: 10.1371/journal.pone.0123596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhou Y., Liu Q.X., Li X.M., Ma D.D., Xing S., Feng J.H., Zhang M.H. Effects of ammonia exposure on growth performance and cytokines in the serum, trachea, and ileum of broilers. Poult. Sci. 2020;99:2485–2493. doi: 10.1016/j.psj.2019.12.063. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES