Skip to main content
NCBI home page
Journal of Orthopaedic Translation logoLink to Journal of Orthopaedic Translation
. 2024 Mar 23;45:178–187. doi: 10.1016/j.jot.2024.01.009

Cycloastragenol prevents bone loss via inhibiting osteoclast activity in glucocorticoid-induced osteonecrosis of the femoral head: An in vivo study

Gang Wang a,b,c, Chao Ma b, Liang Mo b,e, Jiazhi Chen d, Jinbo Yuan c, Jiake Xu a,c,⁎, Wei He b,e,f,⁎⁎
PMCID: PMC10973539  PMID: 38549807

Abstract

Background

Glucocorticoid-induced osteonecrosis of the femoral head (GIONFH) is a common bone and joint disease. There is currently a lack of effective treatment for GIONFH, and the disease progression may lead to total hip arthroplasty (THA). The exact mechanism of GIONFH pathogenesis remains unsettled, and emerging evidence indicates that the overactivation of osteoclasts plays a pivotal role in the occurrence and progression of this condition. Our previous study has shown that cycloastragenol (CAG), a triterpenoid saponin with multiple bioactivities, is a natural osteoclast inhibitor and has a protective effect on bone loss. However, its effect on GIONFH remains unclear.

Methods

In this study, methylprednisolone (MPS) (20 mg/kg) was administered via gluteal muscle injection to female Sprague–Dawley (SD) rats to induce GIONFH, and different doses of CAG (5 and 15 mg/kg) were dispensed intraperitoneally for intervention. Micro-CT screening and angiography were applied to determine the shaping of necrotic lesions, the loss of trabecular bone, and the change in the local blood supply. The molecular mechanism was established by Real-time qPCR and Western blotting. Hematoxylin and eosin (H&E) staining was performed to identify empty lacunae in the femoral head.

Results

CAG treatment shanked the necrotic lesion area, inhibited the trabecular bone loss, and improved the local blood supply in the femoral head. In addition, CAG medication lowered the ratio of Tnfsf11 (encoding RANKL) to Tnfrsf11b (encoding OPG) and the expression of osteoclast-specific genes, including Acp5 and Ctsk. Consistently, CAG treatment exhibited a dose-dependent weakening effect on the expression of osteoclastogenesis and bone resorption-related proteins, including TRAP, CTSK, and MMP9. CAG addition also alleviated the occurrence of empty lacunae in the subchondral region.

Conclusion

Our discoveries demonstrate that CAG is a potential option for hip preservation therapy in GIONFH patients.

Translational potential of this article

The protective effect of CAG on rats with GIONFH can be translated into clinical use.

Keywords: Cycloastragenol, Methylprednisolone, Osteoclast, Osteonecrosis of the femoral head

Graphical abstract

Image 1

Open in a new tab

Abbreviations

Acp5

acid phosphatase 5

BV/TV

bone volume/tissue volume

CAG

cycloastragenol

CTSK

cathepsin K

COR

coronal

EDTA

ethylenediaminetetraacetic

ECL

enhanced chemiluminescence

GCs

glucocorticoids;

GIONFH

glucocorticoid-induced osteonecrosis of the femoral head

H&E

hematoxylin and eosin

MPS

methylprednisolone

MMP9

matrix metallopeptidase 9

ONFH

osteonecrosis of the femoral head

PFA

paraformaldehyde

OPG

osteoprotegerin

RANK

receptor activator of nuclear factor-κB ligand

RANKL

receptor activator of nuclear factor-κB ligand

ROI

regions of interest

SAG

sagittal

SD

Sprague–Dawley

SMI

structure model index

Tb.Th

trabecular thickness

Tb. N

trabecular number

Tb.Pf

trabecular pattern factor

Tb.Sp

trabecular separation

TRA

transverse

THA

total hip arthroplasty

Tnfsf11

tumor necrosis factor ligand superfamily, member 11

Tnfrsf11

tumor necrosis factor receptor superfamily, member 11b

TRAP

tartrate-resistant acidic phosphatase.

The translational potential of this article

The protective effect of CAG on rats with GIONFH can be translated into clinical use.

1. Introduction

Glucocorticoids (GCs) are widely used in clinical practice due to their effectiveness. However, the intractable osteonecrosis of the femoral head (ONFH) following GCs over-use has raised great concern since the late 1950s [1,2]. GIONFH, like ONFH induced by hip trauma or alcoholism, is characterized by the progressive subchondral fracture caused by apoptosis of bone cells, usually resulting in the flattening of the femoral head and hip degeneration [3]. Symptoms of GIONFH vary at an early stage, and patients may complain of pain in the buttocks, groin, knee, or lower back, or the "silent hip" without pain. However, it appears to be difficult to provide timely diagnosis and treatment, and as a result, rapid and imperceptible progress could lead to the end stage of the disease [[4], [5], [6]]. Considering that GIONFH is prone to occur in young and middle-aged patients [7], finding a conservative treatment that helps to delay or prevent patients from receiving early THA is a high priority in practice. However, although several hypotheses co-exist, the pathological mechanism of GIONFH and disease progression are still unclear [8].

Recently, the role of osteoclasts in GIONFH has attracted increased attention, given that the bone erosion area has been proven to be the starting point of subchondral fracture of the femoral head [9]. The adverse effect of GCs overuse is commonly known to prolong the survival of osteoclasts, leading to increased bone resorption [10]. Interestingly, hyperactivity of osteoclasts was found in the femoral head of GIONFH mouse and patients, as determined by the increased number of TRAP (+) osteoclasts and osteoclast-associated genes including the receptor activator of nuclear factor-κB ligand (RANKL) and Cathepsin K (CTSK) [11,12]. What's more, enhanced osteoclast activity was proved to be positively correlated with the early progression of GIONFH, with evidence that the increased protein expression of RANKL in necrotic bone is correlated with the progression stage of GIONFH [13]. Recently, the efficacy of natural osteoclast inhibitors in the prophylaxis and treatment of GIONFH has been evaluated [[14], [15], [16]], indicative of their positive therapeutic potential.

Cycloastragenol (CAG) is a triterpene aglycone that comes from Astragali Radix (Huangqi) with a scope of bioactivities including antioxidant, anti-inflammatory, anti-aging, and so on [17]. In addition to these known properties, the potential role of CAG in improving bone metabolism has also attracted attention [18]. Encouragingly, a previous study by Yu demonstrated that CAG treatment resulted in boosted osteogenic differentiation in MC3T3-E1 cells and attenuated bone loss in aged or d-galactose-treated rats [19]. Subsequently, Wu found that CAG addition reversed the suppression of osteogenic differentiation in MC3T3-E1 cells and bone loss in zebrafish, both induced by GCs [20]. In our recent work, CAG intervention dose-dependently inhibited osteoclast differentiation and bone resorption in bone marrow mono/macrophages stimulated by RANKL, and CAG injection also alleviated bone erosion in ovariectomized mice [21]. In this study, an MPS-induced GIONFH model was generated in rats, and different doses of CAG were evaluated for its therapeutic effect. Genes and proteins related to the formation and function of osteoclasts were also investigated to clarify the biological effect of CAG on osteoclasts.

2. Materials and methods

2.1. Materials and reagents

CAG (purity >98%) was commercially available from Herbpurify Co., Ltd (Chengdu, China). MPS (purity >99%) was obtained from Apexbio (Houston, TX). Primary antibodies included anti-CTSK (sc-48353) and anti-β-actin (sc-47778) from Santa Cruz (San Jose, CA), anti-TRAP (ab191406) from Abcam (Cambridge, UK), and anti-MMP9 (10375-2-AP) from Proteintech (Wuhan, China). Secondary antibodies were purchased from BD Pharmingen (San Diego, CA). Barium sulfate contrast (25000 mesh, 0.3 μm) from Xianwan Chemical (Guangzhou, China) and antiseptic gel from Likang Co., Ltd (Shanghai, China) were prepared as a contrast medium for angiography following the previous description [22]. Heparin sodium was produced by Haitong Pharmaceutical Co., Ltd (Chengdu, China). Hematoxylin and eosin (H&E) staining solutions were purchased from Servicebio Co., Ltd (Wuhan, China).

2.2. Animal preparation

This study on animals was approved by the Animal Ethics Committee of Guangzhou University of Chinese Medicine (GZUCM) (Ethics NO. 20190722001). In brief, twenty-four SPF grade SD rats (females; 9-week-old; 223.30 ± 12.88 g) ordered from the Animal Experiment Center of GZUCM were randomly assigned into four equal groups (n = 6), which included the control group (rats injected with equivalent 0.9% NaCl), MPS group (rats treated with 20 mg/kg MPS to induce GIONFH), low-dose CAG treatment group (rats treated with MPS in the presence of 5 mg/kg CAG), and high-dose CAG treatment group (rats treated with MPS in the presence of 15 mg/kg CAG). Rats were housed in one cage per group in a 12-h day–night alternating environment.

2.3. Experiments design

The GIONFH rat model was established following the previous method [23]. Briefly, rats in the MPS group received a total of nine injections of MPS on the first to the third day of each week for three consecutive weeks, alternatively on both sides of the gluteus. For the CAG treatment groups, different doses of CAG were injected into the abdominal cavity of rats following the MPS injection at the same time points of the MPS injection. For the control group, an equal volume of NaCl was administered intraperitoneally to rats, also at the same time points. After that, all rats underwent recuperation for three weeks before sacrifice. During the procedure, no antibiotics were applied, and body weight changes were weekly recorded.

2.4. BaSO4 heart perfusion

After the recuperation, all rats received anesthesia and three rats in each group were randomly picked for angiography. Based on the previous protocols [[22], [23], [24]], the rats were sacrificed and underwent thoracotomy to expose the heart. A perfusion needle was then pierced into the left ventricle to reach the aortic arch. After the right atrial appendage was punctured, heparin (50 IU/ml) was injected to clear the blood in the circulation, and 4% paraformaldehyde (PFA) was employed for fixation. 30% (v/w) BaSO4 solution was pressurized until the mesentery was filled with a contrast medium. These rats were then refrigerated overnight before their femoral heads were harvested.

2.5. qPCR assay

The left femoral head of the rest rats was cut off and immediately put into liquid nitrogen for tissue grinding. Briefly, 100 μL of TRIzol reagent (Thermo Fisher Scientific, Carlsbad, CA) and 20 μL of a chloroform substitute auxiliary reagent (ECOTOP, China) were added to 10 mg of bone powder for routine RNA extraction. Following the manufacturer's instructions, RNA was reverse transcribed using the RevertAid First strand cDNA Synthesis Kit on a ProFlex system (Thermo Fisher Scientific, Germany). Subsequently, a 10 μL mixture of the cDNA, paired primers (Table .1), and SYBR® Green were added to the repeated wells of a 96-well plate, and the QuantStudio 3 system (Thermo Fisher Scientific, USA) was utilized for qPCR reaction. The parameters were set as follows: 95 °C for 10 min, 55 cycles at 95 °C for 15 s, and 72 °C for 40 s. The relative expression level of the target gene was determined using the 2-ΔΔCT method, represented as the ratio to the reference gene.

Table 1.

Primers for qPCR assay.

Genes Forward (5′‐3') Reverse (3′‐5')
Tnfsf11 CGTTTGCTCACCTCACCATC GCCTGAAGCAAATGTTGGCG
Tnfrsf11b CGTCATCGAAAGCACCCTGT TGGTAGGCACAGCAAACCTG
Acp5 AACATCCCCTGGTACGTGCT TCGGAATTGCCACACAGCAT
Ctsk GGCGGCTATATGACCACTGC CACTTAGCTGCCTTTGCCGT
Actb AGATCAAGATCATTGCTCCTCCTG CAGCTCAGTAACAGTCCGCC
Open in a new tab

2.6. Western blotting assay

After cryogenic grinding, the powdered bone tissue was mixed and centrifuged together with radioimmunoprecipitation protein lysate buffer (Beyotime, Shanghai, China) on ice for 30 min. The supernatant enriched with protein was then boiled with sodium dodecyl sulfate loading buffer (Beyotime) at 100 °C for 5 min. Routine electrophoresis was done in 10% gel at 110 V for 1.5 h. After that, proteins were moved to a polyvinylidene fluoride membrane (Millipore, Billerica, MA) at 300 mA for 2 h. After a 60-min blockage of 5% skimmed milk, the strip was rinsed and soaked in the primary antibody at 4 °C overnight. The next day, secondary antibody incubation was conducted at room temperature (RT) for 2 h. The strip was then mounted on the GelDoc XR + system (Bio-Rad, Hercules, CA) for imaging using enhanced chemiluminescence (ECL) buffer (Thermo Fisher Scientific, Carlsbad, CA). The protein expression was measured using Image J, and the relative expression of the stated genes was converted into a ratio to that of the housekeeping protein.

2.7. Micro-CT assay on bone and vessels

The right femoral head of all rats was transferred to 4% PFA for a two-day long fixation within 24 h after sacrifice. The specimens were then scanned at a voxel of 9 μm per pixel by the Skyscan 1176 micro-CT scanner (Bruker, Kontich, Belgium). The data sets of all samples were then imported into the supporting software including NRecon and DataViewer to generate image sets of different planes in a consistent pose. The two-dimensional (2D) images of the horizontal plane were then put into CTAn, and two cylindrical regions of interest (ROI) called ROI 1 and ROI 2 with the same height (1 mm) and radius (0.65 mm) were selected on both sides of the epiphysis [25]. Bone parameters including bone volume/tissue volume (BV/TV), trabecular thickness (Tb. Th), trabecular number (Tb. N), trabecular separation (Tb. Sp), trabecular pattern factor (Tb. Pf), and structure model index (SMI) were calculated by CTAn and three-dimensional (3D) images were reconstructed by CTVox. To observe the intraosseous vessels, the image set of the femoral head was imported into CTVox, and the grayscale threshold when a significant difference was found between the bone and contrast medium was set as a template for all groups.

2.8. Histological analysis

For pathological observation, an equal number (n = 3) of femurs were randomly selected in each group after CT scanning. Firstly, the femurs were decalcified by immersion in 14% ethylenediaminetetraacetic (EDTA) (NeoFroxx, Germany) at 37 °C for 2 weeks, with daily changes of the solution. The samples underwent routine ethanol dehydration and paraffin embedding. Sections with a thickness of 5 μm were generated on an RM 2155 Biocut Microtome (Leica, Germany) and loaded on glass slides for H&E staining following the previous description [12]. Slide scanning was automatically performed on a Panoramic MIDI digital slide scanner (3DHistech, Hungary). The ratio of empty lacunae within the femoral head was analyzed using SlideViewer software (3DHistech, Hungary).

2.9. Statistical methodology

All quantitative data were generated from three or more independent trials and expressed as mean ± Sprague-Dawley. Comparison between multiple groups was performed using One-way ANOVA analysis in GraphPad Prism 9.0. The difference was considered significant with a p < 0.05.

3. Results

3.1. Survival condition and body weight change in CAG-treated GIONFH rats

This experiment was carried out according to the flow chart shown in Fig. 1A. All six rats in each group tolerated the whole experiment and their weekly body weight changes were recorded. As shown in Fig. 1B and C, no difference exists between these groups regarding baseline body weight both at the time of purchase (week 0) and after acclimation (week 1). Interestingly, there was a sustained and substantial decrease in body weight during the MPS induction period for three weeks (weeks 2–4) with or without CAG. However, this trend was rapidly reversed in the recuperation stage for three weeks (weeks 5–7) (Fig. 1D).

Figure 1.

Figure 1

Open in a new tab

Flow chart of CAG intervention in MPS-induced GIONFH in rats and changes in body weight of rats (A) Modeling illustration of how to induce GIONFH in rats using MPS and to evaluate CAG's potential effect. (B) There was no difference in the baseline level of body weight between all the groups at week 0. (C) There was no difference in the level of body weight between different groups after 1 week of adaptive feeding. (D) Body weight changes at each week unrevealed the weight loss effect of MPS on rats, which was reversed after discontinuation. CAG: cycloastragenol; GIONFH: glucocorticoid-induced osteonecrosis of the femoral head; MPS: methylprednisolone.

3.2. CAG alleviates vessel deterioration in the femoral head of GIONFH rats

To observe the vessel distribution of the femoral head in CAG-treated rats, BaSO4 was perfused into the vasculature of rats after anesthesia. As seen in Fig. 2, the femoral head vessels were rich in the control group, while MPS intervention resulted in sparse vessel distribution in the GIONFH group. In contrast, a dose-dependent increase in blood supply was found in the CAG-treated groups.

Figure 2.

Figure 2

Open in a new tab

Typical images of BaSO4angiograph in the femoral head of CAG-treated GIONFH rats. The red zone represents the intraosseous vessels filled with contrast medium, and the white dashed line represents the outline of the femoral head. CAG: cycloastragenol; GIONFH: glucocorticoid-induced osteonecrosis of the femoral head; MPS: methylprednisolone. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

3.3. CAG reduces necrotic cavities formation in the femoral head of GIONFH rats

To determine whether CAG treatment affects the shaping of the necrotic cavity, the rat's femoral head was subjected to micro-CT scanning, and 2D and 3D images of different slices were generated for observation. As shown in Fig. 3, MPS stimulation resulted in the formation of large-scale necrotic lesions in the superior and medial regions of the femoral head epiphysis, whereas a dose-dependent reduction was observed in the corresponding area of the femoral head in CAG-injected rats.

Figure 3.

Figure 3

Open in a new tab

Representative images of necrosis area in CAG-treated GIONFH rats. The black area above the epiphysis of the femoral head (white arrow) represents the necrotic cavity induced by MPS. CAG: cycloastragenol; COR: coronal; GIONFH: glucocorticoid-induced osteonecrosis of the femoral head; MPS: methylprednisolone; SAG, sagittal; TRA: transverse.

3.4. CAG restricts bone loss in the femoral head of GIONFH rats

To clarify CAG's effect on the bone loss of GIONFH, two equally sized cylindrical trabecular regions spanning the epiphysis (ROI1 and ROI2) were selected for comparison. As shown in Fig. 4A, MPS-induced rarefaction of cancellous bone was detected in two regions, which was more intuitive in ROI2. Correspondingly, the trabecular bone appeared denser in the CAG-treated groups, and this situation was more obvious in the high-dose group. The comparison of bone parameters demonstrated consistent results. In terms of ROI1, MPS induction decreased BV/TV and Tb. Th, and at the same time increased Tb. Sp, Tb.Pf and SMI, but the Tb. N variation was not significant (Fig. 4B). In terms of ROI2, MPS induction was accompanied by the decline of BV/TV, Tb. Th and Tb. N, and the rise of Tb.Sp, Tb.Pf and SMI (Fig. 4C). Conversely, administration of CAG witnessed simultaneous improvements in trabecular parameters in both regions, with up-regulation occurring in BV/TV, Tb. Th, Tb. N, and down-regulation in Tb.Sp, Tb.Pf, and SMI (Fig. 4B–C).

Figure 4.

Figure 4

Open in a new tab

CAG alleviates bone loss in the femoral head of MPS-induced GIONFH rats (A) Representative images acquired by micro-CT show that CAG alleviated MPS-induced GIONFH in rats. The red rectangle on the COR plane and the red round on the TRA plane represent the range of the ROI on both sides of the epiphysis. (B) Quantitative comparison of bone parameters in ROI 1 of the femoral head in each group. (C) Quantitative comparison of bone parameters in the ROI 2 of the femoral head in each group. n = 6. *p < 0.05, **p < 0.01, ***p < 0.001. BV/TV: bone volume/tissue volume; CAG: cycloastragenol; COR: coronal; GIONFH: glucocorticoid-induced osteonecrosis of the femoral head; MPS: methylprednisolone; SMI: structure model index; TRA: transverse; Tb. N: trabecular number; Tb.Pf: trabecular pattern factor; Tb.Sp: trabecular separation; Tb.Th: trabecular thickness. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

3.5. CAG decreases osteoclast activity in the femoral head of GIONFH rats

To explicit the influence of CAG on osteoclast activity in rats, the osteoclastic gene and protein expressions were detected using qPCR and Western blot, separately. As expected, qPCR analysis revealed a significant increase in the ratio of Tnfsf11 (encoding RANKL) to Tnfrsf11b (encoding OPG), as well as in the expression of Acp5 and Ctsk after MPS intervention (Fig. 5A–C). However, after the treatment of different doses of CAG, these three parameters decreased in varying degrees, with the most pronounced decrease observed in the high-dose group. Similarly, Western blot detected boosted expressions of TRAP, MMP9, and CTSK protein in the femoral head of rats receiving MPS injection, while the expression of these proteins exhibited a dose-dependent decline after CAG treatment (Fig. 5D–G).

Figure 5.

Figure 5

Open in a new tab

CAG inhibits MPS-induced hyperactivity of osteoclasts in rats (A–C) qPCR revealed that CAG treatment of 5 and 15 mg/kg dose-dependently decreased the Tnfsf11/Tnfrsf11b ratio and the gene expression of osteoclast markers, including Acp5 and Ctsk. (D) Typical Western blot images of TRAP, MMP9, CTSK, and β‐actin protein in MPS-induced rats treated with different doses of CAG. (E–G) Histogram demonstrating the protein expression of TRAP, MMP9, and CTSK in the femoral head of MPS-induced GIONFH rats were decreased by CAG treatment, with β-actin as a reference gene. n = 3. *p < 0.05, **p < 0.01, ***p < 0.001.. CAG: cycloastragenol; MPS: methylprednisolone; Tnfsf11: tumor necrosis factor ligand superfamily, member 11; Tnfrsf11: tumor necrosis factor receptor superfamily, member 11b; Acp5, acid phosphatase 5; Ctsk, Cathepsin K; TRAP: tartrate-resistant acidic phosphatase; MMP9: matrix metallopeptidase 9.

3.6. CAG lessens empty lacunae generation in the femoral head of GIONFH rats

To reveal the influence of CAG on MPS-induced necrotic area formation in the rat femoral head, the samples were decalcified and received H&E staining. Generally, empty bone lacunae are regarded as an index of bone necrosis occurrence [12]. As presented in Fig. 6A, MPS intervention led to the emergence of numerous empty lacunae above the epiphysis. In contrast, 5 and 15 mg/kg CAG administration dose-dependently suppressed empty lacunae to take place. Consistently, quantitative analysis proved that the ratio of empty lacunae increased substantially after MPS injection, while a step-like decrease was brought about by different doses of CAG treatment (Fig. 6B).

Figure 6.

Figure 6

Open in a new tab

CAG restrains MPS-induced necrotic area formation in rats (A) Typical H&E staining photograph exhibiting MPS-induced GIONFH in rats, different doses of CAG were added for intervention. Empty lacunae (necrotic area) and bone lacunae above the epiphysis are separately marked by black arrows and green arrows (B) Quantification of empty lacunae ratio in the femoral head of MPS-induced GIONFH rats with CAG treatment or not. n = 3. *p < 0.05, ***p < 0.001. CAG, cycloastragenol; MPS, methylprednisolone; H&E, hematoxylin & eosin; GIONFH, glucocorticoid-induced osteonecrosis of the femoral head. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

4. Discussion

Given the lack of understanding of pathological mechanisms, effective strategies for GIONFH treatment remain an open question in practice. Left untreated in the early stage, many patients will experience rapid disease progression and eventually require THA, which can be disastrous if it fails. Although lipid-lowering, anticoagulant, antioxidant, and other strategies have been reported in preclinical studies, their effects on GIONFH still need to be further determined [26]. As a supplement or alternative, many TCM herbal formulations are prescribed for GIONFH patients in Chinese clinics or wards to alleviate symptoms and promote bone repair [[27], [28], [29]]. In recent years, osteoclast inhibition has attracted high interest as a potential preventive or therapeutic strategy for GIONFH [15,30,31]. In the present study, the protective effect of CAG on MPS-induced GIONFH in rats was identified, in which suppression of osteoclast hyperactivity may play a critical part.

Osteoclasts are multinucleated cells derived from the mono/macrophages, which differentiate and mature under the stimulation of RANKL and absorb bone by releasing TRAP, MMP9, CTSK, and other enzymes [32]. GCs have been established to directly prolong the lifespan of osteoclasts, resulting in rapid and early bone loss [10]. Interestingly, gene knockout aiming at enhancing RANKL-induced osteoclast activation was found to aggravate MPS-induced bone wasting in mice [30]. In contrast, inhibition of RANKL-induced osteoclastogenesis in mice by gene knockout attenuated bone loss caused by MPS use [31]. Osteoclast hyperactivity serves as a contributing factor in the development of GIONFH, favorable evidence includes that the osteoclast numbers and CTSK expression in the femoral head of affected patients were significantly higher than that of the controls [12] and that the expression of RANKL increased with stage in GIONFH patients [13]. In our study, qPCR and Western blot experiments also confirmed that MPS injection significantly increases the gene and protein expression of CTSK in the femoral head of rats, while a dose-related reduction was observed after CAG intervention, suggesting that CAG treatment could suppress hyperactivity of osteoclast in GIONFH.

During the progression of GIONFH, the structure of subchondral trabeculae was destroyed due to the excessive activity of osteoclasts [13]. Generally, the continuous activity of osteoclasts is considered to cause damage to the trabecular structure in less than three weeks [33]. Indeed, micro-CT scanning and H&E staining of the rat femoral head validate that the three-week MPS injection led to the engendering of extensive necrotic foci and empty lacuna above the epiphysis. Besides, consistent with previous studies, the micro-CT assay in our study also revealed the impairment of MPS on trabeculae bone, in which Tb. Sp, Tb. Pf and SMI were enhanced while BV/TV, Tb. Th and Tb. N were declined [34]. Conversely, these trends were reversed in a dose-dependent manner under treatment of CAG. These pieces of evidence highlight that CAG could promote necrotic bone repair involved in osteoclast inhibition.

Bone is the most vascularized tissue that requires a constant blood supply to maintain healthy bone remodeling [35]. However, pathological factors like GCs overuse could hamper the vascular system and restrict blood flow of the femoral head, resulting in the occurrence and progression of GIONFH [36]. Given the cost advantage and exemption from decalcification steps, BaSO4 has been recommended as a contrast medium to display the intraosseous vessels in the femoral head [24,37]. Encouragingly, BaSO4 angiography presented that CAG treatment alleviated blood supply compromised by MPS injection, which may be an advantageous factor for improved bone repair in GIONFH.

GIONFH is a complicated disease characterized by abnormal bone metabolic processes. Notably, we observed abnormal chondrocyte phenotypes in the femoral head of the MPS-treated group (Fig. 6), which is consistent with other studies [38]. Consistently, chondrocyte hypertrophy in the femoral head of GIONFH model was detected with increased hypertrophy markers, including RUNX2, MP9, MMP13, and Col10a1 [39]. Utilizing H&E, toluidine blue, and saffron O staining, Wang showed an exaggerated proliferation of chondrocytes in the femoral head of GIONFH model, which may be linked to the over-active autophagy in these cells due to GCs exposure [40]. Originated from mesenchymal stem cells, chondrocyte differentiation was shown to be boosted by GCs treatment via enhancing the expression of extracellular matrix genes [41]. However, the precise mechanisms remain to be explored in the future.

As a promising natural bone protective compound, CAG has been reported to improve osteogenic differentiation inhibited by GCs and alleviate osteoclastogenesis and bone resorption induced by RANKL [20,21]. In this research, CAG was verified to promote bone repair of GIONFH by inhibiting osteoclastic hyperactivity. Considering the multidirectional regulation of CAG on bone remodeling, it is rational to assume that the protective effect of CAG on GIONFH may rely on the multifactorial cooperation of bone and endothelial cells, which needs to be further explored.

5. Limitations

There were several shortcomings in this study. For example, it would be more informative to show TRAP staining in individual osteoclasts and their locations as well as quantitative angiography for visualizing the vasculature in the femoral head. Furthermore, the underlying mechanism by which CAG affects osteoclasts in GIONFH need to be further elucidated.

6. Conclusions

CAG could prevent the formation of necrotic foci and promote bone repair in the femoral head of GIONFH rats, which is achieved by inhibiting hyperactive osteoclasts. CAG could be recommended as an alternative to GIONFH therapy.

Data availability statement

All supporting data of this paper are included in this article/Material, and further inquiries can be directed to the corresponding authors.

Author contributions

GW was responsible for writing and revising the manuscript; GW and CM performed animal modeling, angiography, qPCR, and Western blot assay. JC and JY performed micro-CT scanning and H&E staining. GW and JY conducted data analysis and figure designing. JX and WH supervised the study and jointly determined the final manuscript.

Ethics statement

The study was reviewed and approved by the Animal Ethics Committee of Guangzhou University of Chinese Medicine (NO. 20190722001).

Fundings

This work was supported by National Natural Science Foundation of China (82350710800 and 82374470), Shenzhen Medical Research Fund (B2302005), Australian National Health and Medical Research Council (APP1163933), Visiting Program for Graduate Students from Guangzhou University of Chinese Medicine (GZUCM) ([2017]74), Discipline collaborative innovation team project of double first-class and high-level university of GZUCM (No. 2021XK05).

Authorship statement

All persons who meet authorship criteria are listed as authors, and all authors certify that they have participated sufficiently in the work to take public responsibility for the content, including participation in the concept, design, analysis, writing, or revision of the manuscript. Each author certifies that this material or part thereof has not been published in another journal, that it is not currently submitted elsewhere, and that it will not be submitted elsewhere until a final decision regarding publication of the manuscript in Journal of Orthopaedic Translation has been made.

Indicate the specific contributions made by each author (list the authors’ initials followed by their surnames, e.g., Y.L. Cheung). The name of each author must appear at least once in each of the three categories below.

Declarations of competing interest

A conflict of interest occurs when an individual's objectivity is potentially compromised by a desire for financial gain, prominence, professional advancement or a successful outcome. The Editors of the Journal of Orthopaedic Translation strive to ensure that what is published in the Journal is as balanced, objective and evidence-based as possible. Since it can be difficult to distinguish between an actual conflict of interest and a perceived conflict of interest, the Journal requires authors to disclose all and any potential conflicts of interest.

Section I

The authors whose names are listed immediately below certify that they have NO affiliations with or involvement in any organization or entity with any financial interest (such as honoraria; educational grants; participation in speakers’ bureaus; membership, employment, consultancies, stock ownership, or other equity interest; and expert testimony or patent-licensing arrangements), or non-financial interest (such as personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in this manuscript.

Section II

The authors whose names are listed immediately below report the following details of affiliation or involvement in an organization or entity with a financial or non-financial interest in the subject matter or materials discussed in this manuscript. Please specify the nature of the conflict on a separate sheet of paper if the space below is inadequate.

Acknowledgments

The authors acknowledge the facilities and scientific and technical assistance of the National Imaging Facility, a National Collaborative Research Infrastructure Strategy (NCRIS) capability, at the Centre for Microscopy, Characterisation, and Analysis, The University of Western Australia.

Contributor Information

Gang Wang, Email: 1013116763@qq.com.

Chao Ma, Email: 297898562@qq.com.

Liang Mo, Email: moliang2020@126.com.

Jiazhi Chen, Email: chenjiazhi@gdcri.com.

Jinbo Yuan, Email: jinbo.yuan@uwa.edu.au.

Jiake Xu, Email: jiake.xu@siat.ac.cn.

Wei He, Email: heweiboneresearch@163.com.

References

  • 1.Pietrogrande V., Mastromarino R. 1957. Osteopatia da prolungato trattamento cortisonico. [Google Scholar]
  • 2.Heimann W.G., Freiberger R.H. Avascular necrosis of the femoral and humeral heads after high-dosage corticosteroid therapy. N Engl J Med. 1960;263:672–675. doi: 10.1056/NEJM196010062631404. [DOI] [PubMed] [Google Scholar]
  • 3.Guerado E., Caso E. The physiopathology of avascular necrosis of the femoral head: an update. Injury. 2016;47(Suppl 6):S16–s26. doi: 10.1016/S0020-1383(16)30835-X. [DOI] [PubMed] [Google Scholar]
  • 4.Hauzeur J.P., Malaise M., de Maertelaer V. A prospective cohort study of the clinical presentation of non-traumatic osteonecrosis of the femoral head: spine and knee symptoms as clinical presentation of hip osteonecrosis. Int Orthop. 2016;40:1347–1351. doi: 10.1007/s00264-015-3079-x. [DOI] [PubMed] [Google Scholar]
  • 5.Zhao F.C., Hu H.X., Zheng X., Cang D.W., Liu X., Zhang J.Z., et al. Clinical analysis of 23 cases of steroid-associated osteonecrosis of the femoral head with normal initial magnetic resonance imaging presentation. Medicine. 2017;96 doi: 10.1097/MD.0000000000008834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Musso E.S., Mitchell S.N., Schink-Ascani M., Bassett C.A. Clinical orthopaedics and related research; 1986. Results of conservative management of osteonecrosis of the femoral head. A retrospective review; pp. 209–215. [PubMed] [Google Scholar]
  • 7.Fukushima W., Fujioka M., Kubo T., Tamakoshi A., Nagai M., Hirota Y. Nationwide epidemiologic survey of idiopathic osteonecrosis of the femoral head. Clin Orthop Relat Res. 2010;468:2715–2724. doi: 10.1007/s11999-010-1292-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wang A., Ren M., Wang J. The pathogenesis of steroid-induced osteonecrosis of the femoral head: a systematic review of the literature. Gene. 2018;671:103–109. doi: 10.1016/j.gene.2018.05.091. [DOI] [PubMed] [Google Scholar]
  • 9.Hamada H., Takao M., Sakai T., Sugano N. Subchondral fracture begins from the bone resorption area in osteonecrosis of the femoral head: a micro-computerised tomography study. Int Orthop. 2018;42:1479–1484. doi: 10.1007/s00264-018-3879-x. [DOI] [PubMed] [Google Scholar]
  • 10.Jia D., O'Brien C.A., Stewart S.A., Manolagas S.C., Weinstein R.S. Glucocorticoids act directly on osteoclasts to increase their life span and reduce bone density. Endocrinology. 2006;147:5592–5599. doi: 10.1210/en.2006-0459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Weinstein R.S., Hogan E.A., Borrelli M.J., Liachenko S., O'Brien C.A., Manolagas S.C. The Pathophysiological sequence of glucocorticoid-induced osteonecrosis of the femoral head in male mice. Endocrinology. 2017;158:3817–3831. doi: 10.1210/en.2017-00662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chen K., Liu Y., He J., Pavlos N., Wang C., Kenny J., et al. Steroid-induced osteonecrosis of the femoral head reveals enhanced reactive oxygen species and hyperactive osteoclasts. Int J Biol Sci. 2020;16:1888–1900. doi: 10.7150/ijbs.40917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.He M.C., Zhang J., Chen X.J., Shen Y.S., Fang B., Qin Y.X., et al. Osteoclastic activity was associated with the development of steroid-induced osteonecrosis of femoral head. Artif Cell Nanomed Biotechnol. 2020;48:1036–1046. doi: 10.1080/21691401.2020.1774596. [DOI] [PubMed] [Google Scholar]
  • 14.Xu X., Shen Y., Lv H., Zhao J., Li X., Gao L., et al. Tanshinone I mitigates steroid-induced osteonecrosis of the femoral head and activates the Nrf2 signaling pathway in rats. Evid base Compl Alternative Med : eCAM. 2021;2021 doi: 10.1155/2021/8002161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wang D., Liu Y., Tang D., Wei S., Sun J., Ruan L., et al. Induction of PI3K/Akt-Mediated apoptosis in osteoclasts is a key approach for buxue Tongluo Pills to treat osteonecrosis of the femoral head. Front Pharmacol. 2021;12 doi: 10.3389/fphar.2021.729909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Nan K., Pei J.P., Fan L.H., Zhang Y.K., Zhang X., Liu K., et al. Resveratrol prevents steroid-induced osteonecrosis of the femoral head via miR-146a modulation. Ann N Y Acad Sci. 2021;1503:23–37. doi: 10.1111/nyas.14555. [DOI] [PubMed] [Google Scholar]
  • 17.Yu Y., Zhou L., Yang Y., Liu Y. Cycloastragenol: an exciting novel candidate for age-associated diseases. Exp Ther Med. 2018;16:2175–2182. doi: 10.3892/etm.2018.6501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Salvador L., Singaravelu G., Harley C.B., Flom P., Suram A., Raffaele J.M. A natural product telomerase activator lengthens telomeres in humans: a randomized, double blind, and placebo controlled study. Rejuvenation Res. 2016;19:478–484. doi: 10.1089/rej.2015.1793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yu Y., Wu J., Li J., Liu Y., Zheng X., Du M., et al. Cycloastragenol prevents age-related bone loss: evidence in d-galactose-treated and aged rats. Biomed Pharmacother. 2020;128 doi: 10.1016/j.biopha.2020.110304. [DOI] [PubMed] [Google Scholar]
  • 20.Wu J., Zeng Z., Li Y., Qin H., Zuo C., Zhou C., et al. Cycloastragenol protects against glucocorticoid-induced osteogenic differentiation inhibition by activating telomerase. Phytother Res : PTR. 2021;35:2034–2044. doi: 10.1002/ptr.6946. [DOI] [PubMed] [Google Scholar]
  • 21.Wang G., Ma C., Chen K., Wang Z., Qiu H., Chen D., et al. Cycloastragenol attenuates osteoclastogenesis and bone loss by targeting RANKL-induced Nrf2/Keap1/ARE, NF-κB, Calcium, and NFATc1 Pathways. Front Pharmacol. 2021;12 doi: 10.3389/fphar.2021.810322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Liu Y., Liu Q., Yang Z., Lin J., Wu X., Huang Z., et al. vol. 2019. Contrast media & molecular imaging; 2019. (Comparison of three-dimensional micro-CT angiography of cervical spinal cord between two contrast agents). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Tao S.C., Yuan T., Rui B.Y., Zhu Z.Z., Guo S.C., Zhang C.Q. Exosomes derived from human platelet-rich plasma prevent apoptosis induced by glucocorticoid-associated endoplasmic reticulum stress in rat osteonecrosis of the femoral head via the Akt/Bad/Bcl-2 signal pathway. Theranostics. 2017;7:733–750. doi: 10.7150/thno.17450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Qiu X., Shi X., Ouyang J., Xu D., Zhao D. A method to quantify and visualize femoral head intraosseous arteries by micro-CT. J Anat. 2016;229:326–333. doi: 10.1111/joa.12475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pei J., Fan L., Nan K., Li J., Shi Z., Dang X., et al. Excessive activation of TLR4/NF-κB interactively suppresses the canonical Wnt/β-catenin pathway and induces SANFH in SD rats. Sci Rep. 2017;7 doi: 10.1038/s41598-017-12196-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Qi X., Zeng Y. Biomarkers and pharmaceutical strategies in steroid-induced osteonecrosis of the femoral head: a literature review. J Int Med Res. 2015;43:3–8. doi: 10.1177/0300060514554724. [DOI] [PubMed] [Google Scholar]
  • 27.Li Z.R., Cheng L.M., Wang K.Z., Yang N.P., Yang S.H., He W., et al. Herbal Fufang Xian Ling Gu Bao prevents corticosteroid-induced osteonecrosis of the femoral head-A first multicentre, randomised, double-blind, placebo-controlled clinical trial. Journal of orthopaedic translation. 2018;12:36–44. doi: 10.1016/j.jot.2017.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Liu G.H., Ji W.B., Liu J.T., Jiang H. [Clinical observation of Yishen Huoxue decoction(YSHXD) for the treatment of non-traumatic osteonecrosis of femoral head at early and middle stage] Zhongguo gu shang = China journal of orthopaedics and traumatology. 2019;32:1003–1007. doi: 10.3969/j.issn.1003-0034.2019.11.006. [DOI] [PubMed] [Google Scholar]
  • 29.Huang Z., Fu F., Ye H., Gao H., Tan B., Wang R., et al. Chinese herbal Huo-Gu formula for the treatment of steroid-associated osteonecrosis of femoral head: a 14-year follow-up of convalescent SARS patients. Journal of orthopaedic translation. 2020;23:122–131. doi: 10.1016/j.jot.2020.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Liu Y., Shan H., Zong Y., Lin Y., Xia W., Wang N., et al. IKKe in osteoclast inhibits the progression of methylprednisolone-induced osteonecrosis. Int J Biol Sci. 2021;17:1353–1360. doi: 10.7150/ijbs.57962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhou Z., Lin Y., Pan C., Wang N., Zhou L., Shan H., et al. IL-15 deficiency alleviates steroid-induced osteonecrosis of the femoral head by impact osteoclasts via RANKL-RANK-OPG system. Immun Ageing : I & A. 2020;17:19. doi: 10.1186/s12979-020-00190-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Delaissé J.M., Andersen T.L., Engsig M.T., Henriksen K., Troen T., Blavier L. Matrix metalloproteinases (MMP) and cathepsin K contribute differently to osteoclastic activities. Microsc Res Tech. 2003;61:504–513. doi: 10.1002/jemt.10374. [DOI] [PubMed] [Google Scholar]
  • 33.Wang C., Wang X., Xu X.L., Yuan X.L., Gou W.L., Wang A.Y., et al. Bone microstructure and regional distribution of osteoblast and osteoclast activity in the osteonecrotic femoral head. PLoS One. 2014;9 doi: 10.1371/journal.pone.0096361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wang L., Zhang L., Pan H., Peng S., Zhao X., Lu W.W. Abnormal subchondral bone microstructure following steroid administration is involved in the early pathogenesis of steroid-induced osteonecrosis. Osteoporosis international : a journal established as result of cooperation between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA. 2016;27:153–159. doi: 10.1007/s00198-015-3225-8. [DOI] [PubMed] [Google Scholar]
  • 35.Kular J., Tickner J., Chim S.M., Xu J. An overview of the regulation of bone remodelling at the cellular level. Clin Biochem. 2012;45:863–873. doi: 10.1016/j.clinbiochem.2012.03.021. [DOI] [PubMed] [Google Scholar]
  • 36.Iuchi T., Akaike M., Mitsui T., Ohshima Y., Shintani Y., Azuma H., et al. Glucocorticoid excess induces superoxide production in vascular endothelial cells and elicits vascular endothelial dysfunction. Circ Res. 2003;92:81–87. doi: 10.1161/01.res.0000050588.35034.3c. [DOI] [PubMed] [Google Scholar]
  • 37.Chen Y.Y., Wu X.S., Tian Y.Y., Zhao P., Sun S.W., Yang C.B. Evaluation of femoral head perfusion by contrast-enhanced ultrasound in a rabbit model of steroid-induced osteonecrosis. J Ultrasound Med : official journal of the American Institute of Ultrasound in Medicine. 2020;39:987–995. doi: 10.1002/jum.15184. [DOI] [PubMed] [Google Scholar]
  • 38.Jiang H., Wang W., Mao Y., Jiang L., Yu J., Zhu X., et al. Morroniside-mediated mitigation of stem cell and endothelial cell dysfunction for the therapy of glucocorticoid-induced osteonecrosis of the femoral head. Int Immunopharm. 2024;127 doi: 10.1016/j.intimp.2023.111421. [DOI] [PubMed] [Google Scholar]
  • 39.Sun J., Wang Y., Li Y., Zhao G. Downregulation of PPARγ by miR-548d-5p suppresses the adipogenic differentiation of human bone marrow mesenchymal stem cells and enhances their osteogenic potential. J Transl Med. 2014;12:168. doi: 10.1186/1479-5876-12-168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wang Q.R., Yang Z.Y., Zhang W.L., Li Q.H., Kang P.D. Abnormal hyperplasia of chondrocytes in a rat model of glucocorticoid-induced osteonecrosis of the femoral head. Eur Rev Med Pharmacol Sci. 2022;26:6536–6549. doi: 10.26355/eurrev_202209_29752. [DOI] [PubMed] [Google Scholar]
  • 41.Derfoul A., Perkins G.L., Hall D.J., Tuan R.S. Glucocorticoids promote chondrogenic differentiation of adult human mesenchymal stem cells by enhancing expression of cartilage extracellular matrix genes. Stem cells (Dayton, Ohio) 2006;24:1487–1495. doi: 10.1634/stemcells.2005-0415. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All supporting data of this paper are included in this article/Material, and further inquiries can be directed to the corresponding authors.

Articles from Journal of Orthopaedic Translation are provided here courtesy of Chinese Speaking Orthopaedic Society

RESOURCES