Abstract
Methicillin-resistant (MR) Staphylococcus aureus (SA) and others, except for Staphylococcus aureus (SOSA), are common in healthcare-associated infections. SOSA encompass largely coagulase-negative staphylococci, including coagulase-positive staphylococcal species. Biofilm formation is encoded by the icaADBC operon and is involved in virulence. mecA encodes an additional penicillin-binding protein (PBP), PBP2a, that avoids the arrival of β-lactams at the target, found in the staphylococcal cassette chromosome mec (SCCmec). This work aims to detect mecA, the bap gene, the icaADBC operon, and types of SCCmec associated to biofilm in MRSA and SOSA strains. A total of 46% (37/80) of the strains were S. aureus, 44% (35/80) S. epidermidis, 5% (4/80) S. haemolyticus, 2.5% (2/80) S. hominis, 1.25% (1/80) S. intermedius, and 1.25% (1/80) S. saprophyticus. A total of 85% were MR, of which 95.5% showed mecA and 86.7% β-lactamase producers; thus, Staphylococcus may have more than one resistance mechanism. Healthcare-associated infection strains codified type I-III genes of SCCmec; types IV and V were associated to community-acquired strains (CA). Type II prevailed in MRSA mecA strains and type II and III in MRSOSA (methicillin-resistant staphylococci other than Staphylococcus aureus). The operon icaADBC was found in 24% of SA and 14% of SOSA; probably the arrangement of the operon, fork formation, and mutations influenced the variation. Methicillin resistance was mainly mediated by the mecA gene; however, there may be other mechanisms that also participate, since biofilm production is related to genes of the icaADBC operon and methicillin resistance was not associated with biofilm production. Therefore, it is necessary to strengthen surveillance to prevent the spread of these outbreaks both in the nosocomial environment and in the community.
Keywords: mec, healthcare-associated infections, biofilm, methicillin-resistant, Staphylococcus aureus, MRSA, SOSA
1. Introduction
Due to hospital microbiota, the environment, antimicrobial-resistant bacteria, invasive procedures and devices, immunosuppression, age, comorbidity, and length of stay [1,2], healthcare-associated infections (HAIs) constitute one of the main public health problems that threaten the lives of sick or immunocompromised patients, increasing the costs of hospital care, as well as increasing antimicrobial resistance morbidity and mortality [3,4,5]. Bacteria of the ESKAPE group (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli) have high diversity mechanisms of resistance to antimicrobials as an evolutionary strategy and due to adaptation and inadequate or excessive use of antibiotics [4]. Between 2016 and 2020, ESKAPE were the most isolated microorganisms in hospitals and were responsible for most HAIs with high virulence [4,6]. S. aureus is one of the main pathogens of both healthcare-associated and CA infections; because of their transmission routes, SCCmec typing, estimate prevalence, and antibiotic resistance, it is important to have a current epidemiological context [7,8]. MRSA infections have surged dramatically in the past 10–15 years and are increasingly becoming a major source of nosocomial infections that are associated with high morbidity and mortality. The incidence of MRSA infection ranges from 30 to 50 cases/100,000 population [9,10]; the range varies according to the development of the country and increases if the patient is immunocompromised. The 30 days in hospital mortality has been reported as 28.5% from a total of 221 patients [11].
Methicillin resistance in S. aureus is associated with the presence of the mecA gene that encodes the production of an unusual penicillin-binding protein (PBP), designated PBP2a, which weakens the affinity for β-lactam antibiotics [12]. A difference in biofilm formation by MRSA and methicillin-susceptible S. aureus (MSSA) has been suggested, but how only the presence of the SCCmec cassette or mecA influences this phenotype remains unclear. It has been reported that resistance to β-lactam antibiotics occurring in MRSA strains could be associated with the presence in the bacterial genome of transferable genomic islands, called SCCmec, where the mec gene determines resistance to methicillin. Within the different types of SCCmec, there may be mecA or mecC genes and resistance genes to other groups of antibiotics such as aminoglycosides, macrolides, lincosamides, streptogramins B, and tetracyclines [13].
However, the icaADBC operon is relevant in the PIA-dependent biofilms generated by MSSA. On the other hand, bap (biofilm-associated protein) is involved in the attachment to inert surfaces, intercellular adhesion, and biofilm formation and is a surface protein containing the LPXTG motif, which is responsible for the ica-independent biofilm formation in MRSA and MSSA strains [14]. Particularly, it is believed that mecA genes have been acquired from the Staphylococcus sciuri species group, which includes S. fleurettii, S. lentus, S. sciuri, S. stepanovicci, and S. vitulinus, found in soil, skin, and the mucous membranes of wild animals. S. fleurettii is an animal commensal bacterium that harbors the ancestral mecA gene, suggesting that MRSA probably acquired mecA from coagulase-negative staphylococci (SOSA) of animal origin. mecA and its new homologues (mecB, mecC, and mecD) share more than or equal to 70% nucleotide sequence similarity. The types designated reflect their chronological order of discovery: mecA was identified in S. aureus N315, mecB in M. caseolyticus, mecC in S. aureus LGA251, and mecD in M. caseolyticus IMD0819 [15]. The primary function of the original mecA gene was related to cell wall synthesis, but its evolution into a resistance determinant appears to have occurred via a stepwise process within the S. sciuri species group [16]. Particularly, mecB is flanked by β-lactam regulatory genes like mecR, mecI, and blaZ and is part of an 84.6-kb multidrug-resistance plasmid that harbors genes encoding additional resistances to aminoglycosides (aacA-aphD, aphA, and aadK) as well as macrolides (ermB) and tetracyclines (tetS) [17].
SOSA in animals is becoming more pathogenic increases antibiotic resistant and can potentially disseminate to humans [18]. In the U.S., mortality caused by MRSA remains the highest for any antibiotic-resistant pathogen, reported by the CDC to be at ~20,000 in 2018. Furthermore, there is increased recognition of the considerable clinical importance of methicillin-sensitive S. aureus strains. Some lineages such as sequence type (ST) 398 can have high virulence, causing fatal infections [19]. Thus, efforts have continued to evolve in preventing MRSA infections; it remains a major cause of increased mortality and morbidity, since infections caused by drug-resistant bacteria result in worse outcomes. Specific clones of MRSA are closely associated with virulence factors and drug susceptibility, and these trends are important as a basis for pathology, comorbidities, severity of infection, infectious disease care, treatment, and control. Particularly, the mortality rate due to S. aureus bacteremia is 20–30%, the mortality rate due to MRSA bacteremia is even higher at 20–50%, and the cure rate for MRSA infections is 50–60% [20]. In contrast to many other bacterial pathogens, which often rely on only one or a few toxins to promote disease, S. aureus produces an astounding array of virulent factors. These include a plethora of toxins and immune evasion factors and a vast array of protein and non-protein factors that enable host colonization during infection. While there has always been great interest in S. aureus virulence ever since this bacterium was first recognized as an important pathogen at the end of the 19th century, recent developments have increased research efforts into unraveling S. aureus virulence mechanisms [19].
Clones as ST5-1, ST5-II, ST36-II, ST45-II, and ST239 III of healthcare-associated MRSA can infect people in the hospital environment; however, CA-MRSA clones ST1-IV, ST5-IV, and ST8-IV [8] are the most representative from the community without predisposing risk factors [15]; these community-acquired infections by strains of MRSA (CA-MRSA) are genetically different from healthcare-associated MRSA (HA-MRSA). Unfortunately, CA-MRSA strains are multidrug-resistant and currently represent a hospital-acquired epidemic [21]. MRSA strains are resistant to β-lactams due to the acquisition of SCCmec that carries the mecA gene, which is responsible for methicillin resistance.
Other allotypes associated with SCCmec have been found, including type I, II, III, IV, and V, depending on the nature of the mec and ccr gene complexes, which favors the transmission of methicillin resistance to strains acquired in the community [13,22]. Another element of the genome is the icaADBC operon that encodes proteins involved in biofilm formation, as well as the bap gene that encodes the Bap protein involved in intercellular adhesion, the accumulation of bacterial cells, and the establishment of biofilms on inert surfaces [23,24]. The positive correlation between icaADBC and biofilm production in a high percentage of S. aureus isolated from patients with burns has been reported [25], since products of the ica locus and polysaccharide intercellular adhesin (PIA) are critical for intercellular bacterial adherence and biofilm formation [26]. In fact, icaA and icaD are the main actors of PIA synthesis, and the enzymatic activity of icaA increases in the presence of icaD. Extensive persistence of Staphylococcus species in hospital environments, as nosocomial behavior, is associated with strains carrying icaA and mecA [27]. In addition, there are other potential alternative mechanisms that contribute to biofilm formation, such as the PIA-independent biofilm mechanism and the microbial surface component recognizing adhesive matrix molecules (MSCRAMMs), which in S. aureus are covalently linked to the cell wall by sortase via the LPXTG motif, and include the following proteins: clfA and clfB, fib, fnbA and fnbB, cna (collagen-binding protein), ebps, and eno (laminin-binding protein) [28]; other mechanisms, including several environmental factors, such as glucose, NaCl, and ethanol, influence biofilm elaboration by affecting icaA and icaR expression. For instance, expression of icaA was unaffected by ethanol directly; however, it increased by repressing icaR transcription. Conversely, the induction of icaA expression by glucose or NaCl was icaR independent [29]. Thus, the study of these genetic markers could further lead to the design of new drugs aimed at biofilm inhibition by inducing the activity of all or some icaADBC operon repressors. Nowadays, there are no antibiofilm drugs to combat Staphylococcus infections [30].
Because HAIs are a threat to public health, it is important to understand the involvement of genes and the antibiotic resistance of MRSA and SOSA involved in HAIs [31]. The aim of this work was to detect mecA, the bap gene, the icaADBC operon, and types of SCCmec associated with biofilm production in MRSA and MRSOSA biofilm-forming healthcare-associated strains. icaADBC gene detection could vary, probably due to the arrangement of the operon, fork formation, and mutations. Despite all strains being BP, not all amplified icaADBC; therefore, BP may be due to other mechanisms or genes not studied in this work.
2. Materials and Methods
2.1. Strain Isolation and Identification
The isolation of the strains was carried out in a public hospital in Mexico City, with different clinical origins (cerebrospinal fluid, catheter, blood culture, respiratory tract secretions, and urine). The strains were identified by colony, microscopic morphology, conventional biochemical, catalase, oxidase, and coagulase tests [32] and by using Vitek 2.0® (Biomérieux, Lyon, France). This study did not involve humans [33].
2.2. Antibiotic Resistance Test of S. aureus Strains
Phenotypic MR was determined by the Kirby and Bauer method using cefoxitin (Ctx) 30 μg (BD BBL® Sensi-Disc® Antimicrobial discs) according to the CLSI (2016) document. Strains able to produce a halo equal to or higher than 22 mm were considered as sensitive to methicillin; values less than or equal to 21 mm were considered as resistant. The vancomycin profile was determined using Vitek 2.0®. Control strains were S. aureus ATCC 43330 resistant to cefoxitin, S. aureus ATCC 25923 sensitive to cefoxitin and vancomycin, and S. aureus USA300 resistant to cefoxitin and sensitive to vancomycin [34].
2.3. β-Lactamase Production
β-lactamase production was assessed using Cefinase® discs (BD BBL® Paper Disc) according to the manufacturer’s instructions. The formation of a pink color in the Cefinase® discs indicated positive production of β-lactamase. S. aureus ATCC 29213 was used as a positive control [35].
2.4. Determination of Biofilm Production
To determine biofilm production, 96-well bales with 9.0 × 108 CFU/mL of each Staphylococcus spp. were used in 100 μL of Müller–Hinton (MH) broth (Nunc MicroWell™). S. aureus ATCC 27543 at the same concentration was used as a positive control, and sterile MH broth was used as a negative control. The plates were incubated at 37 °C for 24 h.
To carry out the biofilm quantification, the culture medium was removed from the wells, and 100 μL of glutaraldehyde was added (Sunwise Chem Co., Shanghai, China) at 2.5% to each well and fixed for 1 min at room temperature. The excess was removed and washed with 100 μL of 1× PBS. Subsequently, each well was stained with crystal violet (CV) (Fisher Chemical, Pittsburgh, PA, USA) at 4% for 2 min; dye was done by aspiration, and the wells were washed twice with 100 μL of 1× PBS. The presence or absence of color was observed. Subsequently, the CV of each well was removed with 100 μL of alcohol: acetone solution 80:20 (v/v), adjusted to a final volume of 2 mL with the same solution; the biomass was quantified with spectrophotometric reading using a plate reader (BioRad iMark, Hercules, CA, USA) at 570 nm [34]. Each assay was performed in triplicate. Strains with an absorbance value < 0.001 were classified as null biofilm producers, values between 0.001 and 0.500 were weak biofilm producers, absorbance values of 0.501–0.900 were moderate biofilm producers, while those with absorbance values ≥ 0.901 were considered as high biofilm producers [36].
2.5. Genotypic Determination of mecA, icaADBC, and bap
The molecular detection of the methicillin resistance was conducted by the amplification of the mecA gene. To determine this gene and its relation to biofilm production, the gDNA of the isolated S. aureus strains was obtained by the guanidine method [34]. DNA integrity was determined by 2% agarose gel electrophoresis (1× TBE buffer at 150 V for 30 min), and purity was determined using Nanodrop equipment (Thermo Scientific, Waltham, MA, USA) through the relationship of absorbances at 260/280 nm. S. aureus ATCC 43300 was used as a positive control of the mecA gene, S. aureus ATCC 25923 was used as a negative control, and S. epidermidis ATCC 12228 was used as a positive control for the detection of icaADBC+ genes [34]. S. aureus ATCC 29247 was used as a negative control [37].
Six genes were amplified for the detection of biofilm formation of hospital-acquired strains. The primer sequences are presented in Table 1 [34,38]. The reaction mixture for gene amplification was: 2.5 μL of dNTP (2.5 mM), 2.5 μL of PCR buffer, 2 μL of MgCl2 solution (1.5 mM), 1 μL of required F and R primer (10 pmol), 1 µL of DNA solution (50 ng/µL), 0.2 µL (1 U/µL) of Taq polymerase (Thermo Scientific, USA), and nuclease-free water for a final mixture of 25 µL. The gene amplifications were carried out according to what was indicated by Martins et al., 2017, with some modifications. Initial denaturation at 94 °C/5 min for 30 cycles: denaturation at 94 °C/30 s, alignment 50 °C/30 s (icaA), 54 °C/60 s (icaBCD), 55 °C/30 s (mecA), and 56 °C/30 s (bap), and extension 72 °C/10 min (icaA and icaBCD) and 72 °C/5 min (mecA and bap), followed by a final extension at 72 °C/10 min [34,39].
Table 1.
| Gene | Sequence (5′-3′) | Annealing Temperature °C |
PCR Product Size (bp) |
|---|---|---|---|
| icaA | F: CGTTGATCAAGATGCACC | 59.2 | 319 |
| R: CCGCTTGCCATGTGTTG | 60.9 | ||
| icaB | F: TGGATTAACTTTGATGATATGG | 54.3 | 409 |
| R: AGGAAAAAGCTGTCACACC | 55.3 | ||
| icaC | F: GGTCAATGGTATGGCTATTT | 54.1 | 148 |
| R: CGAACAACACAGCGTTTC | 56.2 | ||
| icaD | F: GGTCAAGCCCAGACAGAG | 56.7 | 150 |
| R: GAAATTCATGACGAAAGTATC | 54.3 | ||
| mecA | F: TGGCTATCGTGTCACAATCG | 60.3 | 310 |
| R: CTGGAACTTGTTGAGCAGAG | 59.7 | ||
| bap | F: GGCGATGGTAAGAATGATGG | 60.3 | 515 |
| R: GCTGTTGAAGTTAATACTGTACCTGC | 59.7 |
The genotypic determination of the staphylococcal cassette chromosome mec (SCCmec) was carried out.
The amplification of the SCCmec genes associated with methicillin resistance was carried out from bacterial gDNA, using the oligonucleotides in Table 2 [40].
Table 2.
SCCmec type oligonucleotide sequences.
| Gene Type | Sequence (5′-3′) | Amplicon Size (bp) | Specificity |
|---|---|---|---|
| I | F: GCTTTAAAGAGTGTCGTTACAGG | 613 | SCCmec I |
| R: GTTCTCTCATAGTATGACGTCC | |||
| II | F: CGTTGAAGATGATGAAGCG | 398 | SCCmec II |
| R: CGAAATCAATGGTTAATGGACC | |||
| III | F: CCATATTGTGTACGATGCG | 280 | SCCmec III |
| R: CCTTAGTTGTCGTAACAGATCG | |||
| IVa | F: GCCTTATTCGAAGAAACCG | 776 | SCCmec IVa |
| R: CTACTCTTCTGAAAAGCGTCG | |||
| IVb | F: TCTGGAATTACTTCAGCTGC | 493 | SCCmec IVb |
| R: AAACAATATTGCTCTCCCTC | |||
| IVc | F: ACAATATTTGTATTATCGGAGAGC | 200 | SCCmec IVc |
| R: TTGGTATGAGGTATTGCTGG | |||
| IVd | F: CTCAAAATACGGACCCCAATACA | 881 | SCCmec IVd |
| R: TGCTCCAGTAATTGCTAAAG | |||
| V | F: GAACATTGTTACTTAAATGAGCG | 325 | SCCmec V |
| R: TGAAAGTTGTACCCTTGACACC |
For the SCCmec type identification, two groups were formed, the first one to identify types I, II, and III that correspond to healthcare-associated strains and the second to identify types IVa, IVb, IVc, IVd, and V that correspond to strains acquired in the community. In the first case, the mix contained water 9.5 μL; F and R of oligonucleotides type I, II, and III, 0.5 μL (0.2 pmol); PCR Master Mix (BioRad; CA, USA) 12.5 μL; and gDNA 2 μL (100 ng/μL). Amplification conditions for simple PCR for types I, II, and III were carried out according to what was indicated by Zhang et al. (2005) [40], with some modifications: one cycle of initial denaturation at 94 °C/5 min, 30 cycles of denaturation at 94 °C/1 min, annealing at 50 °C/1 min, and extension at 72 °C/2 min, followed by a final extension at 72 °C/10 min.
The second mix contained water 2 μL; primer F and R of oligonucleotides type V, type IVa, type IVb, type IVc, and type IVd, 1 μL; PCR Master Mix (BioRad, USA) 11 μL; and gDNA 2 μL (100 ng/μL). Amplification conditions for simple PCR for types IVa, IVb, IVc, IVd, and V were carried out according to what was indicated by Zhang et al. 2005 [40], with some modifications: one initial denaturation cycle at 94 °C/5 min, 10 denaturation cycles 94 °C/45 s, alignment 65 °C/45 s, extension 72 °C/90 s, 25 denaturation cycles 94 °C/45 s, alignment 55 °C/45 s, extension 72 °C/90 s, followed by a final extension at 72 °C/1 min. For the SCCmec gene, S. aureus RM911 (for SCCmec types I), S. aureus RM912 (for SCCmec II), S. aureus RM913 (for SCCmec types III), S. aureus RM914 (for SCCmec IV) was used as a positive control, and S. aureus RM917 (for SCCmec V) and sterile DNase-free water were included in each PCR as a negative control [41].
2.6. Statistical Analysis
The relationship between resistance to methicillin and biofilm formation was determined using the Student’s t statistical test.
3. Results
3.1. Strain Isolation and Identification
A total of 80 healthcare-associated Gram-positive cocci from the third level belonged to the Staphylococcus genera; among them, six different species were identified, 46% (37/80) belonged to S. aureus and 54% (43/80) to the SOSA species. We considered SOSA as all other non-aureus strains due to the coagulase-variable nature of some species [42]. A total of 35 SOSA strains belonged to S. epidermidis, 4 to S. haemolyticus, 2 to S. hominis, 1 to S. intermedius, and 1 to S. saprophyticus. In total 56.25% of the strains were isolated from the blood culture, 28.75% from the catheter, 6.25% from the cerebrospinal fluid, 6.25% from secretions of the respiratory tract, and 2.5% from urine. S. epidermidis could cause multidrug-resistant infection in immunocompromised patients, bacterial sepsis, foreign body-related infections, and biofilm-associated infections [43,44]. S. haemolyticus could cause severe infections like meningitis, endocarditis, prosthetic joint infections, bacteremia, septicemia, peritonitis, and otitis generally in immunocompromised patients and animals [45]. S. hominis is rarely a human pathogen, which could cause soft tissue infections and bacteremia in hospitalized patients [46]. S. intermedius is an animal pathogen and could be a pathogen in oncology for human patients [47]. S. saprophyticus is a urinary tract infection pathogen and in a few cases, bacteremia [48].
3.2. Antibiotic Resistance
A total amount of 85% (68/80) of Staphylococcus spp. were resistant to cefoxitin, 86% (32/37) of the strains were MRSA, and 84% (36/43) were MRSOSA (Table 3). Molecular surveillance of MRSA clones is important to understand their evolutionary dynamics for investigating outbreaks, propagating precautionary measures, as well as planning for appropriate treatment [49]. Additionally, the multidrug resistance complicates the treatment of patients infected with MRSA and MRSOSA strains; therefore, knowing the antibiotic pattern resistance could lead to a diminished hospital outbreak, dissemination of multidrug strains, mortality rates, and hospitalization cost and time.
Table 3.
Relationship of biofilm production in isolated strains and methicillin resistance, detection of β-lactamases, amplification of the mecA gene, and types of genes belonging to SCCmec in S. aureus and SOSA.
| Biofilm Production | SCCmec Type | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| MR % n |
β-Lactamase % n |
mecA % n |
Low % n |
Moderate % n |
High % n |
Total % n |
I % n |
II % n |
III % n |
IV % n |
|
| S. aureus | 86 | 100 | 96.8 | 24.3 | 45.9 | 29.72 | 46.20% | 3.22 | 45.16 | 22.5 | 16.1 |
| 32/37 | 32/32 | 31/32 | 9/37 | 17/37 | 11/37 | 37/80 | 1/31 | 14/31 | 7/31 | 5/31 | |
| ica %/n | |||||||||||
| A | 44.44 | 52.94 | 54.55 | ||||||||
| 4/9 | 9/17 | 6/11 | |||||||||
| B | 44.44 | 47.06 | 54.55 | ||||||||
| 2/9 | 6/17 | 4/11 | |||||||||
| C | 22.22 | 35.29 | 36.36 | ||||||||
| 1/9 | 4/17 | 3/11 | |||||||||
| D | 11.11 | 23.53 | 27.27 | ||||||||
| 4/9 | 8/17 | 6/11 | |||||||||
| SOSA | 83.7 | 75 | 94.4 | 9.3 | 39.5 | 51.11 | 53.80% | 0 | 38.23 | 38.23 | 14.7 |
| 36/43 | 27/36 | 34/36 | 4/43 | 17/43 | 22/43 | 43/80 | 0/34 | 13/34 | 13/34 | 5/34 | |
| ica %/n | |||||||||||
| A | 25 | 47.06 | 50 | ||||||||
| 1/4 | 8/17 | 11/22 | |||||||||
| B | 25 | 35.29 | 45.44 | ||||||||
| 1/4 | 5/17 | 8/22 | |||||||||
| C | 25 | 29.41 | 36.36 | ||||||||
| 1/4 | 0/17 | 5/22 | |||||||||
| D | 25 | 0 | 27.73 | ||||||||
| 1/4 | 6/17 | 10/22 | |||||||||
| Total | 85 | 86.7 | 95.5 | 16.2 | 42.5 | 41.2 | 1 | 1.54 | 41.54 | 30.7 | 15.4 |
| 68/80 | 59/68 | 65/68 | 13/80 | 34/80 | 33/80 | 80/80 | 1/65 | 27/65 | 20/65 | 10/65 | |
Finally, 14% (5/37) were SA no MR and 16% (7/43) were SOSA no MR. The percentage of resistance by all species different to SA is shown in Table 4.
Table 4.
Relationship of biofilm production in isolated strains and methicillin resistance, detection of β-lactamases, amplification of the mecA gene, and types of genes belonging to SCCmec in SOSA.
| Strain | MR | β-Lactamase | Biofilm | mecA | SSCmec | icaA | icaB | icaC | icaD |
|---|---|---|---|---|---|---|---|---|---|
|
S. epidermidis (35/80) 44% |
Resistance (28/35) 80% |
NS (8/28) 23% |
High (4/8) 50% |
+ | NA | − | − | − | − |
| Type III | − | − | − | − | |||||
| + | + | + | + | ||||||
| Moderate (3/8) 38% |
+ | Type II | − | − | − | − | |||
| Type III | + | − | − | − | |||||
| Type III | − | − | − | − | |||||
| Low (1/8) 13% |
+ | Type III | + | + | + | + | |||
| S (20/28) 57% |
High (12/20) 60% |
− | NA | + | + | − | + | ||
| + | Type III | − | − | − | − | ||||
| Type II | − | − | − | − | |||||
| + | − | − | + | ||||||
| + | + | + | + | ||||||
| Type III | − | − | − | − | |||||
| + | − | − | + | ||||||
| + | + | + | + | ||||||
| Type IV | − | − | − | − | |||||
| Moderate (7/20) 35% |
+ | Type II | − | − | − | − | |||
| + | + | − | + | ||||||
| Type III | − | − | − | − | |||||
| + | + | − | + | ||||||
| Type IV | − | − | − | − | |||||
| + | + | − | + | ||||||
| Low (1/20) 5% |
+ | Type II | − | − | − | − | |||
| Susceptible (7/35) 20% |
NS (6/7) 17% |
High (2/6) 33% |
− | NA | − | − | − | − | |
| + | + | − | + | ||||||
| Moderate (2/6) 33% |
− | NA | − | − | − | − | |||
| Low (2/6) 33% |
− | NA | − | − | − | − | |||
| S (1/7) 3% |
Moderate (1/1) 100% |
− | NA | + | − | − | − | ||
|
S. haemolyticus (4/80) 5% |
Resistance (4/4) 100% |
NS (1/4) 25% |
High (1/1) 100% |
+ | Type III | + | + | + | + |
| S (3/4) 75% |
High (1/3) 33% |
+ | Type II | − | − | − | − | ||
| Moderate (2/3) 67% |
+ | Type II | − | − | − | − | |||
| + | − | − | + | ||||||
|
S. hominis (2/80) 3% |
Resistance (2/2) 100% |
S (2/2) 100% |
High (1/2) 50% |
+ | Type IV | + | + | + | + |
| Moderate (1/2) 50% |
+ | Type IV | − | − | − | − | |||
|
S. intermedius (1/80) 1% |
Resistance (1/1) 100% |
NS (1/1) 100% |
High (1/1) 100% |
+ | Type II | − | − | − | − |
|
S. saprophyticus (1/80) 1% |
Resistance (1/1) 100% |
S (1/1) 100% |
Moderate (1/1) 100% |
+ | Type II | + | + | − | + |
“−” indicates absence of the gene; “+” indicates presence of the gene.
All strains isolated from the Staphylococcus genus were susceptible to vancomycin.
3.3. β-Lactamase Production
The presence of the enzyme was observed in 74% of the total strains (59/80); 54% (32/59) corresponded to MRSA strains, while 46% (27/59) corresponded to MRSOSA. A total of 86% (32/37) of S. aureus isolated strains, while only 63% (27/43) of SOSA, were producers of β-lactamases. MR β-lactamase producers are shown in Table 3. For each SOSA species, the percentage of β-lactamase production is shown in Table 4.
3.4. Determination of Biofilm Production
In general, 100% of the strains developed biofilm formation. Weak, moderate, and high production of S. aureus strains and SOSA are shown in Table 3. For each SOSA species, the percentage of biofilm production is shown in Table 4. S. aureus colonizes tissue surfaces in humans, causing chronic persistent infections that are difficult to cure due to its antibiotic recalcitrance and phenotypic adaptability, both of which are facilitated by its ability to develop biofilms [50]; thus, it is essential to develop strategies aimed at avoiding the production of biofilm by S. aureus and SOSA.
3.5. Genotypic Determination of mecA and SCCmec Types
The mecA gene of all strains amplified 310 bp [51]; 85% (68/80) of the strains were MR (Table 3). However, only 65 strains out of 68 amplified mecA, of which 84% (31/37) of the MR strains belonged to S. aureus and 79% (34/43) to other species. A total of 59 out of 68 MR strains were β-lactamase producers (Table 3), suggesting that Staphylococcus may have more than one resistance mechanism. Table 3 also shows the frequency of the types of SSCmec. The majority presented type II (41.54%, 27/65) and III (30.7%, 20/65) (Table 3), which confirms that most of the isolates came from healthcare-associated infections. For type V, no positive strains were obtained. Thus, 73.8% (48/65) of strains were classified as healthcare-associated infections; the rest were acquired in the community. It has been reported that SCCmec types II and III that exhibit multi-resistance also have genes for erythromycin and tetracycline resistance, while community-acquired MRSA strains (CA-MRSA) produce more virulent infections and infect healthy people outside of hospitals [52]. Strains of S. hominis, S. epidermidis, and S. aureus type IV related to CA could have zoonotic transmission dynamics; however, in this study, it was not investigated.
From that percentage, 70.9% (22/31) belonged to SA and 76.4% (26/34) to SOSA. In the case of the strains acquired in the community, 16.12% (5/31) were SA and 14.7% (5/34) were SOSA. Seven mecA positive strains did not amplify for any SCCmec type, from which four and three were MRSA and MRSOSA, respectively. Table 4 shows the expression of mecA and SSCmec genes, regarding the different percentage of biofilm and β-lactamase production, and MR to the different SOSA species.
3.6. Genotypic Determination of icaADBC and bap Genes
In general, it was found that 47.5% (38/80), 32.5% (26/80), 18.75% (15/80), and 41.25% (33/80) of the strains presented the genes icaA, icaB, icaC, and icaD, respectively. For strains of the genus aureus, an amplification ratio of 51.3% (19/37), 32.4% (12/37), 24.3% (9/37), and 43.24% (16/37) was found, and for SOSA strains, 44.1% (19/43) and 32.5% (14/43) were found, respectively. Table 3 shows the percentage of each gene of the ica operon by SA or SOSA. Table 4 shows the expression of the icaABCD gene, regarding the different types of SSCmec, expression of mecA, biofilm and β-lactamase production, and MR to the different SOSA species. Any of the strains amplified the bap gene.
The molecular size detected for each fragment gene were 319 bp for icaA; 409 bp for icaB; 148 bp for icaC, and 150 bp for icaD, which correspond with Zhang et al. (2005) [40].
Bap promotes adhesion to abiotic surfaces and induces strong intercellular adhesion by self-assembling into amyloid-like aggregates in response to the levels of calcium and pH in the environment. During infection, Bap enhances the adhesion to epithelial cells where it binds directly to the host receptor Gp96 and inhibits the entry of the bacteria into the cells [53]. Bap has been reported in bovine mastitis isolates of S. aureus and their absence in human clinical isolates, since Bap-mediated biofilm seems to be a system specialized for the conditions present in the mammary gland, where calcium concentration can reach the high values necessary to modulate Bap function (~10 mM). Thus, calcium serves as a regulator of Bap function; the fluctuations in the local calcium concentration should be higher than the binding affinity of the protein for the cation [54].
4. Discussion
According to the Pan American Health Organization (2021), Saphylococcus aureus is one of the microorganisms that has shown higher levels of resistance to various generations of antibiotics in recent times, becoming a public health problem classified as an “urgent health problem of global dimension” (PHAO, 2021). In fact, MRSA infections are one of the most serious multidrug-resistant threats, require longer hospitalization times, can represent up to 80% of healthcare-associated infections [41], and have higher mortality rates [55]. The WHO has suggested that people with methicillin-resistant S. aureus (MRSA) infections are 64% more likely to die than people with drug-sensitive infections (WHO, 2021). In Mexico, according to RHOVE (Bulletin of Infections Associated with Health Care Hospital Epidemiological Surveillance Network) 2022, S. aureus is the number five microorganism associated with healthcare-associated infections, with 2091 HAI reported in 2022. In 2023, RHOVE for the first trimester reported S. aureus as the number five microorganism that produces healthcare-associated infections in Mexico; in the second trimester, S. epidermidis was reported as number five, which represents almost 30% of infections acquired in Mexico hospitals [41].
In this study, 80 strains of different clinical origin were isolated from a tertiary public hospital in Mexico City, most of them confirmed as S. aureus and S. epidermidis (46% and 44%, respectively). The remaining strains represented 10% (8/80) and belonged to the haemolyticus, hominis, intermedius, and saprophyticus species. Negrete-González et al. (2020) [8] reported the isolation of 191 S. aureus from the emergency department, surgery, intensive care unit, internal medicine, gynecology, burn unit, and outpatient service from a hospital ubicated in San Luis Potosi, Mexico. López-Jácome et al. (2020) [56] reported the isolation of 96 strains from electric-burned patients in a referral burn hospital in Mexico City. Also, S. aureus MRSA has been reported in fishermen and horticulturists [57] from Guerrero, Mexico. On the other hand, S. epidermidis has been reported as a relevant microorganism based on its high ability to develop biofilm and small colony variants [58]. In Mexico, it has been isolated from children’s hospitals [59]. Martinez- Santos et al. (2022) [60] isolated 20 methicillin-resistant S. epidermidis from hospitalized patients with bloodstream infections from two different hospitals from Acapulco, Guerrero México, between 2003 and 2004, and 2017. Fernández-Rodríguez et al. (2021) [58] isolated S. epidermidis and variants of this microorganism from patients with monomicrobial prosthetic joint infection at Instituto Nacional de Rehabilitacion “Luis Guillermo Ibarra Ibarra” in Mexico City. This microorganism has also been isolated from feedings and feces of preterm neonates in Spain [61]. Globally, three multidrug-resistant, hospital-adapted lineages of S. epidermidis (two ST2 and one ST23) have emerged in recent decades and disseminated [62]. In the present work, it was found that S. aureus and S. epidermidis were the most abundant (37/80 and 35/80), which is relevant since these strains are MR and less susceptible to glycopeptides, which complicate the treatment, as has been suggested by Becker et al. (2014) [63] in other clones.
S. haemolyticus have been isolated from clinical samples [64] and S. hominis from joint prosthesis, periprosthetic tissue, joint fluids, and fluid sonication of the joint prosthesis of the hip and knee from Mexican patients in Guadalajara and Nuevo León [65]. S. hominis have also been isolated from the blood [66] of patients with surgical-site infections undergoing cardiovascular surgery through median sternotomy [67]. S. intermedius have been isolated from hepatic abscess in a patient from Mexico City [68].
One of the limitations of our study is that the collection of the strains cannot be described regarding the number of copy strains excluded, the duration, and the percentages of isolation, since they were kindly donated by the clinical analysis laboratory of different hospitals of the public sector in Mexico.
In 2021, Chen et al. [69] indicated that community-associated MRSA (CA-MRSA) has replaced HA-MRSA as the dominant epidemic strain, among which the Staphylococcus genus is found, which is consistent with our study, where we found 73.8% HA-MRSA and 26.15% CA-MRSA.
One of the main factors of resistance to glycopeptides is biofilm production, a mechanism used among the Staphylococcus group as a virulence factor [70]. The use of this strategy by the isolated strains was observed in our study, where 100% of the strains were biofilm producers with a weak, moderate, and high severity, of which 46.2% corresponded to S. aureus (24.3, 45.9, and 29.72 severity, respectively) and the 53.8% to SOSA (9.3, 39.5, and 51.11 severity, respectively), which could favor its resistance to antibiotics. The observed response is not different due to the origin of the sample; this may be due to a modification of the biofilm by regulatory mechanisms, depending on the environmental conditions or exposure to antibiotics, which increases resistance to them and even in the host immune defenses [71]. The icaABCD operation in isolates of S. aureus was associated with the formation of biofilms. Ghaioumy and col. (2021) [72] reported that from 46 clinical samples, 41% expressed icaA and icaD (6.3% and 59.4%, respectively), although icaC and icaB were not detected, and 100% of the isolates of S. aureus were biofilm producers. In our study, the expression of the genes icaA, icaB, icaC, and icaD (51.3%, 32.4%, 24.3%, and 43.24%, respectively), were detected in S. aureus, while in SOSA strains, the genes icaA and icaB (44.1% and 32.5%) were detected, and all the strains were biofilm producers. A study carried out by García et al. (2019) [34] at the Instituto Nacional de Rehabilitacion in Mexico City, with clinical samples of hospitalized patients, reported an expression of the icaADBC genes in S. aureus and Staphylococcus coagulase negative strains (91% and 92%, respectively), which was associated with the biofilm production in 100% of the strains.
It has been shown that some SOSA strains can produce biofilm through the expression of genes ica, Aap, and bap; the latter was reviewed for the strains of this study, but no strain was amplified; this may be because the strains in which it has been reported have been from veterinary studies, and those shown here are from clinical isolates, or because biofilm production is due to other genes not described in this study [73,74,75,76,77].
An important element in biofilm formation and one of the most studied, is the ica operon, a group of genes that encodes the production of PIA/PNGA, which mediates intercellular adhesion of bacteria and biofilm accumulation. However, in various studies, only icaA and icaD were amplified. In these positive strains, there was PIA formation; however, it has been evaluated that the presence of the entire operon acts together to increase biofilm production [74,76,77]. As mentioned, biosynthesis genes clustered in the ica operon contribute to the formation of biofilms; they have been identified in S. epidermidis, S. aureus, Bacillus subtilis, and in many Gram-negative bacteria [78]. Expression of the icaADBC operon appears tightly controlled in S. aureus, as evidenced by the fact that it is expressed at very low levels under in vitro growth conditions [78].
In our work, the percentage of detection of the icaADBC genes varied among strains, probably due to the arrangement of the operon, since it can form forks and thus interrupt transcription; it may also be incomplete due to a mutation in some part of it. In addition, biofilm production could be due to other mechanisms or genes not studied in this work. The amplification percentages of icaADBC genes S. aureus isolates were slightly increased with respect to SOSA. We expected that all the strains that showed greater biofilm production would present the complete ica operon; however, the detection of the ica operon was not possible in all strains. This may be because there are other genes involved in biofilm formation, such as the Aap; others related to a large group of receptor proteins (MSCRAMM) involved in the adhesion mechanism of the microorganism to the extracellular matrix of the host; the CcpA protein that has an important impact on the regulation of the operon, which in turn is involved in the synthesis of PIA; the SasG surface-associated Staphylococcus protein G; and other genes related to the production of polymers associated to biofilms such as extracellular teichoic acid [79].
Although the ica operon has been the most studied, in the literature, it is found that of the strains that produce biofilm, only 30% present high levels of PIA in vitro; the fact that PIA is not detected, could be present at levels not detectable or even absent, may suggests that the biofilms are composed mainly of teichoic acid and other protein components [74,79].
It has been reported that the resistance of S. aureus to β-lactam antibiotics is controlled by the BlaR13 receptor that senses β-lactams through acylation of its sensor domain, inducing transmembrane signaling and activation of the cytoplasm-oriented metalloprotease domain. This domain induces the expression of blaZ (β-lactamase PC1) and mecA (β-lactam-resistant cell wall transpeptidase PBP2a) [80], the latter encoding the alternative penicillin-binding protein, PBP2A, which is insensitive to antibiotics. Another reason for resistance is due to additional genetic adjustments to develop a high level of resistance [81]. Methicillin is a semisynthetic β-lactam resistant to β-lactamase. Antibiotic resistance by S. aureus has spread in epidemic waves, being a MRSA healthcare- associated infection, giving rise to HA-MRSA. More recently, CA-MRSA has emerged as a major clinical threat, creating a reservoir of MRSA within and outside of healthcare settings. CA-MRSA can be genetically distinguished from HA-MRSA, as it also has fewer antibiotic resistance properties and often produces the toxin Panton–Valentine leukocidin (PVL). However, there are now many examples of how CA-MRSA has spread to healthcare settings, blurring the distinction between the two types of MRSA. Additionally, MRSA can be harbored by livestock (livestock-associated MRSA [LA-MRSA]), where it can cause disease in those animals and be transmitted to humans through contact [81]. Another resistance mechanism is the secretion of β-lactamase enzymes that are encoded by mobile elements that are transferable between species, as is the case of the mecA gene that encodes the production of the penicillin-binding protein (PBP). This is the most common mechanism in strains of S. aureus and MRSA [82], which is consistent with our study, where we observed that 74% of the total strains were secretors of β-lactamase, from which 54% were MRSA and 46% MRSOSA, related to the 100% frequency of the resistance to methicillin of the strains isolated in our study. This resistance phenotype was like that reported by García et al. 2019 [34], where they found the mecA gene in 78% of the total clinical samples analyzed. On the contrary, the expression of the gene in our study was higher than that reported by Hashem et al. 2017 [83], where it is only expressed in 45% of S. aureus strains, 35% S. epidermidis, and 16.7% in other Staphylococcus species isolated from catheters. The CLSI recommends corroborating methicillin resistance with the detection of the mecA gene. Some authors mention that the detection of this gene is considered the gold standard, since it agrees with the disk diffusion test by 90%, as determined in this study [84]. It is worth mentioning that there are other resistance mechanisms not studied in this work that may also intervene and need further research.
The amplification of the SSCmec types was also carried out as a mobile element inserted in the chromosome of MRSA and MRSOSA that contains the set of mec genes, corresponding to the mecA genes and their regulators. The amplification was carried out in 65 of the 80 strains that amplified mecA; the majority presented type II, 41.54% (27/65), followed by type III, 30.77% (20/65), and type IV 15.38% (10/65); the amplified types were mostly IVa, with only one type IVc strain, and less frequently, type I representing 1.54% (1/65). Eight well-identified types of SCCmec were obtained. It is important to mention that types I, II, and III of SCCmec were HA-MRSA strains. However, since they are relatively large chromosomal “cassettes,” these allow a greater number of resistance genes to be housed for other antimicrobial agents; for this reason, healthcare-associated strains have greater resistance to several antimicrobials compared to those acquired in the community [40,78,85]. The SCC type of mec, where CA-MRSA with the smaller type IV element can maintain a growth rate and toxin production levels in vitro, compared to HA-MRSA with the larger type II, suggests a role in the ability of strains to compete in the community environment. CA-MRSA has evolved several times, where an evolutionary trade-off has been achieved between maintaining antibiotic resistance and enhanced pathogenicity, but without sacrificing overall fitness [81].
5. Conclusions
It was observed that 85% of the isolated strains (68/80) were resistant to methicillin, 95.58% (65/68) presented the mecA gene, and 86.77% (59/68) were β-lactamase producers. Methicillin resistance was mainly mediated by the mecA gene; however, there may be other regulatory mechanisms, such as the genes Mec1 and Bla1, that more effectively control the expression of mecA; Bla1 is more efficient because Mec1 is not present in MRSA clinical isolates. The Mec1 repressor and transmembrane MecR1 sensor protein regulate PBP2a synthesis, a penicillin-binding protein that has taken the place of the PBP, which is responsible for the cross-binding of peptidoglycan in MRSA, as has been suggested by Alghamdi et al. (2023) [52]; mecA and mecC genes may also originate in coagulase-negative staphylococci. In our study, 73.84% (48/65) of the isolated strains were hospital-acquired methicillin-resistant strains, with 48.14% (27/65) belonging to Type II. Another form of mec-independent resistance in clinical samples is MODSA (modified penicillin-binding protein S. aureus) strains, which have mutations in PBP2 and other PBPs present in the transpeptidase domain targeted by β-lactams; their level of resistance is low compared to that of mecA MRSA [86], which is a possible explanation not studied in this work. In the studied population, no vancomycin-resistant S. aureus strains were found, which reduces the risk of mortality, considering that this microorganism is a devastating agent due to its resistance to multiple drugs.
In this study, methicillin resistance was mainly mediated by the mecA gene; however, there may be other mechanisms that also participate, since biofilm production is related to genes of the icaADBC operon, and methicillin resistance was not associated with biofilm production. Therefore, it is necessary to strengthen surveillance to prevent the spread of these outbreaks both in the nosocomial environment and the community. MRSA isolates usually have higher biofilm-production ability, as MRSA mecA gene encodes PBP2a and inactivates the agr gene quorum-sensing regulator system, thereby enhancing biofilm formation, as has been suggested by Maharjan et al. (2022) [87]. In addition, this ability is specific to each strain and associated with different environmental conditions; it causes great resistance to the action of various antimicrobial agents, leading to persistence and recurrence of infections. Thus, other authors have suggested treatment with dispersion-enzyme B to reduce biofilm production in clinical MRSA strains [87].
Acknowledgments
This work’s authors thank Q. Carmen Melchor Díaz.
Author Contributions
Conceptualization, R.G.-V. (Rosa González-Vázquez) and M.G.C.-E.; methodology, R.G.-V. (Rosa González-Vázquez), M.G.C.-E. and M.d.R.H.-C.; validation, R.G.-V. (Rosa González-Vázquez), A.E.-G., S.G.-C., M.d.R.H.-C., R.G.-V. (Raquel González-Vázquez), A.L.E.-C., L.L.-P., W.T.-C., L.M.-R., F.M.-P., M.A.G.-N. and M.G.C.-E.; formal analysis, R.G.-V. (Rosa González-Vázquez), A.E.-G., S.G.-C., M.d.R.H.-C., R.G.-V. (Raquel González-Vázquez), A.L.E.-C., L.L.-P., W.T.-C., L.M.-R., F.M.-P., M.A.G.-N. and M.G.C.-E.; investigation, R.G.-V. (Rosa González-Vázquez), A.E.-G., S.G.-C., M.d.R.H.-C., R.G.-V. (Raquel González-Vázquez), A.L.E.-C., L.L.-P., W.T.-C., L.M.-R., F.M.-P., M.A.G.-N. and M.G.C.-E.; resources R.G.-V. (Rosa González-Vázquez), A.E.-G., S.G.-C. and M.G.C.-E.; data curation, R.G.-V. (Rosa González-Vázquez), A.E.-G., M.d.R.H.-C., R.G.-V. (Raquel González-Vázquez), A.L.E.-C., L.M.-R., F.M.-P., M.A.G.-N. and M.G.C.-E.; writing—original draft preparation, R.G.-V. (Rosa González-Vázquez), A.E.-G., S.G.-C., M.d.R.H.-C., R.G.-V. (Raquel González-Vázquez), A.L.E.-C., L.L.-P., W.T.-C., L.M.-R., F.M.-P., M.A.G.-N. and M.G.C.-E.; writing—review and editing, R.G.-V. (Rosa González-Vázquez), A.E.-G., S.G.-C., M.d.R.H.-C., R.G.-V. (Raquel González-Vázquez), A.L.E.-C., L.L.-P., W.T.-C., L.M.-R., F.M.-P., M.A.G.-N. and M.G.C.-E.; visualization, R.G.-V. (Rosa González-Vázquez), A.E.-G., R.G.-V. (Raquel González-Vázquez), A.L.E.-C., L.M.-R., F.M.-P., M.A.G.-N. and M.G.C.-E.; supervision, R.G.-V. (Rosa González-Vázquez), A.E.-G., S.G.-C., M.d.R.H.-C., R.G.-V. (Raquel González-Vázquez), A.L.E.-C., L.L.-P., W.T.-C., L.M.-R., F.M.-P., M.A.G.-N. and M.G.C.-E.; project administration, R.G.-V. (Rosa González-Vázquez), A.E.-G., M.G.C.-E.; funding acquisition, R.G.-V. (Rosa González-Vázquez), A.E.-G., S.G.-C. and M.G.C.-E. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Data are contained within the article.
Conflicts of Interest
The authors declare no conflicts of interest.
Funding Statement
Project SIP: 20160618 and 20230543, Instituto Politecnico Nacional-Escuela Nacional de Ciencias Biologicas.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Blot S., Ruppé E., Harbarth S., Asehnoune K., Poulakou G., Luyt C.E., Rello J., Klompas M., Depuydt P., Eckmann C., et al. Healthcare-associated infections in adult intensive care unit patients: Changes in epidemiology, diagnosis, prevention and contributions of new technologies. Intensive Crit. Care Nurs. 2022;70:103227. doi: 10.1016/j.iccn.2022.103227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cruz-López F., Martínez-Meléndez A., Garza-González E. How Does Hospital Microbiota Contribute to Healthcare-Associated Infections? Microorganisms. 2023;11:192. doi: 10.3390/microorganisms11010192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Dadgostar P. Antimicrobial Resistance: Implications and Costs. Infect. Drug Resist. 2019;12:3903–3910. doi: 10.2147/IDR.S234610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Arbune M., Gurau G., Niculet E., Iancu A.V., Lupasteanu G., Fotea S., Vasile M.C., Tatu A.L. Prevalence of Antibiotic Resistance of ESKAPE Pathogens Over Five Years in an Infectious Diseases Hospital from South-East of Romania. Infect. Drug Resist. 2021;14:2369–2378. doi: 10.2147/IDR.S312231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kamurai B., Mombeshora M., Mukanganyama S. Repurposing of Drugs for Antibacterial Activities on Selected ESKAPE Bacteria Staphylococcus aureus and Pseudomonas aeruginosa. Int. J. Microbiol. 2020;2020:8885338. doi: 10.1155/2020/8885338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Mulani M.S., Kamble E.E., Kumkar S.N., Tawre M.S., Pardesi K.R. Emerging Strategies to Combat ESKAPE Pathogens in the Era of Antimicrobial Resistance: A Review. Front. Microbiol. 2019;10:539. doi: 10.3389/fmicb.2019.00539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Abimannan N., Sumathi G., Krishnarajasekhar O.R., Sinha B., Krishnan P. Clonal clusters and virulence factors of methicillin-resistant Staphylococcus aureus: Evidence for community-acquired methicillin-resistant Staphylococcus aureus infiltration into hospital settings in Chennai, South India. Indian. J. Med. Microbiol. 2019;37:326–336. doi: 10.4103/ijmm.IJMM_18_271. [DOI] [PubMed] [Google Scholar]
- 8.Negrete-González C., Turrubiartes-Martínez E., Galicia-Cruz O.G., Noyola D.E., Martínez-Aguilar G., Pérez-González L.F., González-Amaro R., Niño-Moreno P. High prevalence of t895 and t9364 spa types of methicillin-resistant Staphylococcus aureus in a tertiary-care hospital in Mexico: Different lineages of clonal complex 5. BMC Microbiol. 2020;20:213. doi: 10.1186/s12866-020-01881-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Westgeest A.C., Buis D.T.P., Sigaloff K.C.E., Ruffin F., Visser L.G., Yu Y., Schippers E.F., Lambregts M.M.C., Tong S.Y.C., de Boer M.G.J., et al. Global Differences in the Management of Staphylococcus aureus Bacteremia: No International Standard of Care. Clin. Infect. Dis. 2023;77:1092–1101. doi: 10.1093/cid/ciad363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lam J.C., Stokes W. The Golden Grapes of Wrath—Staphylococcus aureus Bacteremia: A Clinical Review. Am. J. Med. 2023;136:19–26. doi: 10.1016/j.amjmed.2022.09.017. [DOI] [PubMed] [Google Scholar]
- 11.Kim S.H., Jeon M., Jang S., Mun S.J. Factors for mortality in patients with persistent Staphylococcus aureus bacteremia: The importance of treatment response rather than bacteremia duration. J. Microbiol. Immunol. Infect. 2023;56:1007–1015. doi: 10.1016/j.jmii.2023.07.010. [DOI] [PubMed] [Google Scholar]
- 12.Ramandinianto S.C., Khairullah A.R., Effendi M.H. MecA gene and methicillin-resistant Staphylococcus aureus (MRSA) isolated from dairy farms in East Java, Indonesia. Biodiversitas. 2020;21:3562–3568. doi: 10.13057/biodiv/d210819. [DOI] [Google Scholar]
- 13.Mlynarczyk-Bonikowska B., Kowalewski C., Krolak-Ulinska A., Marusza W. Molecular Mechanisms of Drug Resistance in Staphylococcus aureus. Int. J. Mol. Sci. 2022;23:8088. doi: 10.3390/ijms23158088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Hernández-Cuellar E., Tsuchiya K., Valle-Ríos R., Medina-Contreras O. Differences in Biofilm Formation by Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus Strains. Diseases. 2023;11:160. doi: 10.3390/diseases11040160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Lakhundi S., Zhang K. Methicillin-Resistant Staphylococcus aureus: Molecular Characterization, Evolution, and Epidemiology. Clin. Microbiol. Rev. 2018;31:e00020-18. doi: 10.1128/CMR.00020-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lade H., Kim J.S. Molecular Determinants of β-Lactam Resistance in Methicillin-Resistant Staphylococcus aureus (MRSA): An Updated Review. Antibiotics. 2023;12:1362. doi: 10.3390/antibiotics12091362. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Becker K., van Alen S., Idelevich E.A., Schleimer N., Seggewiß J., Mellmann A., Kaspar U., Peters G. Plasmid-Encoded Transferable mecB-Mediated Methicillin Resistance in Staphylococcus aureus. Emerg. Infect. Dis. 2018;24:242–248. doi: 10.3201/eid2402.171074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ocloo R., Nyasinga J., Munshi Z., Hamdy A., Marciniak T., Soundararajan M., Newton-Foot M., Ziebuhr W., Shittu A., Revathi G., et al. Epidemiology and antimicrobial resistance of staphylococci other than Staphylococcus aureus from domestic animals and livestock in Africa: A systematic review. Front. Vet. Sci. 2022;9:1059054. doi: 10.3389/fvets.2022.1059054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Cheung G.Y.C., Bae J.S., Otto M. Pathogenicity and virulence of Staphylococcus aureus. Virulence. 2021;12:547–569. doi: 10.1080/21505594.2021.1878688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Shimizu M., Mihara T., Ohara J., Inoue K., Kinoshita M., Sawa T. Relationship between mortality and molecular epidemiology of methicillin-resistant Staphylococcus aureus bacteremia. PLoS ONE. 2022;17:e0271115. doi: 10.1371/journal.pone.0271115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Shambat S., Nadig S., Prabhakara S., Bes M., Etienne J., Arakere G. Clonal complexes and virulence factors of Staphylococcus aureus from several cities in India. BMC Microbiol. 2012;12:64. doi: 10.1186/1471-2180-12-64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Chongtrakool P., Ito T., Ma X.X., Kondo Y., Trakulsomboon S., Tiensasitorn C., Jamklang M., Chavalit T., Song J.H., Hiramatsu K. Staphylococcal cassette chromosome mec (SCCmec) typing of methicillin-resistant Staphylococcus aureus strains isolated in 11 Asian countries: A proposal for a new nomenclature for SCCmec elements. Antimicrob. Agents Chemother. 2006;50:1001–1012. doi: 10.1128/AAC.50.3.1001-1012.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Tormo M., Úbeda C., Martí M., Maiques E., Cucarella C., Valle J., Foster T.J., Lasa Í., Penadés J.R. Phase-variable expression of the biofilm-associated protein (Bap) in Staphylococcus aureus. Microbiology. 2007;153:1702–1710. doi: 10.1099/mic.0.2006/005744-0. [DOI] [PubMed] [Google Scholar]
- 24.Yang C.H., Su P.W., Moi S.H., Chuang L.Y. Biofilm Formation in Acinetobacter Baumannii: Genotype-Phenotype Correlation. Molecules. 2019;24:1849. doi: 10.3390/molecules24101849. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Al-shimmary S., Ahmed S.M., Abdullah N., Almohaidi A. The Role of Genetic Variation for icaA Gene Staphylococcus aureus in Producing Biofilm. Hospital. 2021;3:4. doi: 10.25258/ijddt.11.2.28. [DOI] [Google Scholar]
- 26.Mir Z., Nodeh Farahani N., Abbasian S., Alinejad F., Sattarzadeh M., Pouriran R., Dahmardehei M., Mirzaii M., Khoramrooz S.S., Darban-Sarokhalil D. The prevalence of exotoxins, adhesion, and biofilm-related genes in Staphylococcus aureus isolates from the main burn center of Tehran, Iran. Iran. J. Basic. Med. Sci. 2019;22:1267–1274. doi: 10.22038/ijbms.2019.34908.8291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ahmad S., Rahman H., Qasim M., Nawab J., Alzahrani K.J., Alsharif K.F., Alzahrani F.M. Staphylococcus epidermidis Pathogenesis: Interplay of icaADBC Operon and MSCRAMMs in Biofilm Formation of Isolates from Pediatric Bacteremia in Peshawar, Pakistan. Medicina. 2022;58:1510. doi: 10.3390/medicina58111510. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Khasawneh A.I., Himsawi N., Abu-Raideh J., Salameh M.A., Al-Tamimi M., Al Haj Mahmoud S., Saleh T. Status of Biofilm-Forming Genes among Jordanian Nasal Carriers of Methicillin-Sensitive and Methicillin-Resistant Staphylococcus aureus. Iran. Biomed. J. 2020;24:386–398. doi: 10.29252/ibj.24.6.381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yu L., Hisatsune J., Kutsuno S., Sugai M. New Molecular Mechanism of Superbiofilm Elaboration in a Staphylococcus aureus Clinical Strain. Microbiol. Spectr. 2023;11:e0442522. doi: 10.1128/spectrum.04425-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Seethalakshmi P.S., Rajeev R., Kiran G.S., Selvin J. Promising treatment strategies to combat Staphylococcus aureus biofilm infections: An updated review. Biofouling. 2020;36:1159–1181. doi: 10.1080/08927014.2020.1857743. [DOI] [PubMed] [Google Scholar]
- 31.Rodríguez-Acelas A.L., de Abreu Almeida M., Schmarczek Figueiredo M., Monteiro Mantovani V., Mattiello R., Cañon-Montañez W. Validity and reliability of the RAC adult infection risk scale: A new instrument to measure healthcare-associated infection risk. Res. Nurs. Health. 2021;44:672–680. doi: 10.1002/nur.22139. [DOI] [PubMed] [Google Scholar]
- 32.Firdausy A.F., Walidah Z., Mufidah K., Rahmadhany A.N., Ningrum N.D., Adila A. Antimicrobial activity of metabolites produced by novel coagulase-negative Staphylococ CI (CNS) isolated from fermented dairy products in Malang, Indonesia. J. Microbiol. Biotechnol. Food Sci. 2023;12:e9200. doi: 10.55251/jmbfs.9200. [DOI] [Google Scholar]
- 33.Córdova-Espinoza M.G., Giono-Cerezo S., Sierra-Atanacio E.G., Escamilla-Gutiérrez A., Carrillo-Tapia E., Carrillo-Vázquez L.I., Mendoza-Pérez F., Leyte-Lugo M., González-Vázquez R., Mayorga-Reyes L. Isolation and Identification of Multidrug-Resistant Klebsiella pneumoniae Clones from the Hospital Environment. Pathogens. 2023;12:634. doi: 10.3390/pathogens12050634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.García A., Martínez C., Juárez R.I., Téllez R., Paredes M.A., Herrera M.D.R., Giono S. Methicillin resistance and biofilm production in clinical isolates of Staphylococcus aureus and coagulase-negative Staphylococcus in México. Biomedica. 2019;39:513–523. doi: 10.7705/biomedica.4131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Matono T., Nagashima M., Mezaki K., Motohashi A., Kutsuna S., Hayakawa K., Ohmagari N., Kaku M. Molecular epidemiology of β-lactamase production in penicillin-susceptible Staphylococcus aureus under high-susceptibility conditions. J. Infect. Chemother. 2018;24:153–155. doi: 10.1016/j.jiac.2017.10.014. [DOI] [PubMed] [Google Scholar]
- 36.Stepanovic S., Vukovic D., Dakic I., Savic B., Svabic-Vlahovic M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods. 2000;40:175–179. doi: 10.1016/S0167-7012(00)00122-6. [DOI] [PubMed] [Google Scholar]
- 37.Diemond-Hernández B., Solórzano-Santos F., Leaños-Miranda B., Peregrino-Bejarano L., Miranda-Novales G. Production of icaADBC-encoded polysaccharide intercellular adhesin and therapeutic failure in pediatric patients with Staphylococcal device-related infections. BMC Infect. Dis. 2010;10:68. doi: 10.1186/1471-2334-10-68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Martins K.B., Faccioli P.Y., Bonesso M.F., Fernandes S., Oliveira A.A., Dantas A., Zafalon L.F., Cunha M. Characteristics of resistance and virulence factors in different species of coagulase-negative staphylococci isolated from milk of healthy sheep and animals with subclinical mastitis. J. Dairy. Sci. 2017;100:2184–2195. doi: 10.3168/jds.2016-11583. [DOI] [PubMed] [Google Scholar]
- 39.García-Barreto A.A. Biofilm de Staphylococcus spp. de Origen Intrahospitalario: Genes asociados (Tesis) Instituto Politécnico Nacional; Mexico City, México: 2010. [Google Scholar]
- 40.Zhang K., McClure J.A., Elsayed S., Louie T., Conly J.M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 2005;43:5026–5033. doi: 10.1128/JCM.43.10.5026-5033.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Shokravi Z., Haseli M., Mehrad L., Ramazani A. Distribution of Staphylococcal cassette chromosome mecA (SCCmec) types among coagulase-negative Staphylococci isolates from healthcare workers in the North-West of Iran. Iran. J. Basic. Med. Sci. 2020;23:1489–1493. doi: 10.22038/ijbms.2020.48481.11127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Humphries Romney M., Magnano P., Burnham Carey-Ann D., Dien Bard J., Dingle Tanis C., Callan K., Westblade Lars F. Evaluation of Surrogate Tests for the Presence of mecA-Mediated Methicillin Resistance in Staphylococcus capitis, Staphylococcus haemolyticus, Staphylococcus hominis, and Staphylococcus warneri. J. Clin. Microbiol. 2020;59:e02290-20. doi: 10.1128/JCM.02290-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Nguyen T.H., Park M.D., Otto M. Host Response to Staphylococcus epidermidis Colonization and Infections. Front. Cell Infect. Microbiol. 2017;7:90. doi: 10.3389/fcimb.2017.00090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Oliveira F., Rohde H., Vilanova M., Cerca N. Fighting Staphylococcus epidermidis Biofilm-Associated Infections: Can Iron Be the Key to Success? Front. Cell Infect. Microbiol. 2021;11:798563. doi: 10.3389/fcimb.2021.798563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Eltwisy H.O., Twisy H.O., Hafez M.H., Sayed I.M., El-Mokhtar M.A. Clinical Infections, Antibiotic Resistance, and Pathogenesis of Staphylococcus haemolyticus. Microorganisms. 2022;10:1130. doi: 10.3390/microorganisms10061130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Uddin O., Hurst J., Alkayali T., Schmalzle S.A. Staphylococcus hominis cellulitis and bacteremia associated with surgical clips. IDCases. 2022;27:e01436. doi: 10.1016/j.idcr.2022.e01436. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Hauptmann L., Midic D., Eigendorff F., Malouhi A., Theis B., Kißler H., Rödel J., Prims F., Hochhaus A., Scholl S., et al. Staphylococcus intermedius infection with splenic abscesses in a patient with acute lymphoblastic leukemia. Ann. Hematol. 2023;102:1609–1611. doi: 10.1007/s00277-023-05208-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Hur J., Lee A., Hong J., Jo W.Y., Cho O.H., Kim S., Bae I.G. Staphylococcus saprophyticus Bacteremia originating from Urinary Tract Infections: A Case Report and Literature Review. Infect. Chemother. 2016;48:136–139. doi: 10.3947/ic.2016.48.2.136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Junaidi N., Shakrin N., Desa M.N.M., Yunus W. Dissemination Pattern of Hospital-Acquired Methicillin-Resistant Staphylococcus aureus and Community-Acquired MRSA Isolates from Malaysian Hospitals: A Review from a Molecular Perspective. Malays. J. Med. Sci. 2023;30:26–41. doi: 10.21315/mjms2023.30.2.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Bhattacharya M., Wozniak D.J., Stoodley P., Hall-Stoodley L. Prevention and treatment of Staphylococcus aureus biofilms. Expert. Rev. Anti Infect. Ther. 2015;13:1499–1516. doi: 10.1586/14787210.2015.1100533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Elhassan M.M., Ozbak H.A., Hemeg H.A., Elmekki M.A., Ahmed L.M. Absence of the mecA Gene in Methicillin Resistant Staphylococcus aureus Isolated from Different Clinical Specimens in Shendi City, Sudan. Biomed. Res. Int. 2015;2015:895860. doi: 10.1155/2015/895860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Alghamdi B.A., Al-Johani I., Al-Shamrani J.M., Alshamrani H.M., Al-Otaibi B.G., Almazmomi K., Yusof N.Y. Antimicrobial resistance in methicillin-resistant Staphylococcus aureus. Saudi J. Biol. Sci. 2023;30:103604. doi: 10.1016/j.sjbs.2023.103604. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Arrizubieta M.a.J.s., Toledo-Arana A., Amorena B., Penadés J.R., Lasa I. Calcium inhibits bap-dependent multicellular behavior in Staphylococcus aureus. J. Bacteriol. 2004;186:7490–7498. doi: 10.1128/JB.186.22.7490-7498.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Valle J., Fang X., Lasa I. Revisiting Bap multidomain protein: More than sticking bacteria together. Front. Microbiol. 2020;11:613581. doi: 10.3389/fmicb.2020.613581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Sáinz-Rodríguez R., de Toro-Peinado I., Valverde-Troya M., Bermúdez Ruíz M.P., Palop-Borrás B. Evaluation of a rapid assay for detection of PBP2a Staphylococcus aureus. Rev. Esp. Quimioter. 2019;32:370–374. [PMC free article] [PubMed] [Google Scholar]
- 56.López-Jácome L.E., Chávez-Heres T., Becerra-Lobato N., García-Hernández M.d.L., Vanegas-Rodríguez E.S., Colin-Castro C.A., Hernández-Durán M., Cruz-Arenas E., Cerón-González G., Cervantes-Hernández M.I., et al. Microbiology and Infection Profile of Electric Burned Patients in a Referral Burn Hospital in Mexico City. J. Burn. Care Res. 2020;41:390–397. doi: 10.1093/jbcr/irz177. [DOI] [PubMed] [Google Scholar]
- 57.Jiménez J.T., Mata Y.C.O., Díaz D.I.O., Damián L.L., Salgado J.P., Forero A.F., Ledezma J.C.R. Portadores asintomáticos de Staphylococcus aureus meticilino resistentes (MRSA) en pescadores y horticultores de Guerrero, México. J. Negat. No Posit. Results. 2020;5:1482–1489. doi: 10.19230/jonnpr.3755. [DOI] [Google Scholar]
- 58.Fernández-Rodríguez D., Colín-Castro C.A., Hernández-Durán M., López-Jácome L.E., Franco-Cendejas R. Staphylococcus epidermidis small colony variants, clinically significant quiescent threats for patients with prosthetic joint infection. Microbes Infect. 2021;23:104854. doi: 10.1016/j.micinf.2021.104854. [DOI] [PubMed] [Google Scholar]
- 59.Cabrera-Contreras R., Santamaría R.I., Bustos P., Martínez-Flores I., Meléndez E., Morelos R., Barbosa-Amezcua M., González-Covarrubias V., Silva-Herzog E., Soberón X. Genomic diversity of prevalent Staphylococcus epidermidis multidrug-resistant strains isolated from a Children’s Hospital in México City in an eight-years survey. PeerJ Preprints. 2019;20:e8068. doi: 10.7717/peerj.8068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Martínez-Santos V.I., Torres-Añorve D.A., Echániz-Aviles G., Parra-Rojas I., Ramírez-Peralta A., Castro-Alarcón N. Characterization of Staphylococcus epidermidis clinical isolates from hospitalized patients with bloodstream infection obtained in two time periods. PeerJ. 2022;10:e14030. doi: 10.7717/peerj.14030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Moles L., Gómez M., Moroder E., Bustos G., Melgar A., del Campo R., Rodríguez J.M. Staphylococcus epidermidis in feedings and feces of preterm neonates. PLoS ONE. 2020;15:e0227823. doi: 10.1371/journal.pone.0227823. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Lee J.Y.H., Monk I.R., Gonçalves da Silva A., Seemann T., Chua K.Y.L., Kearns A., Hill R., Woodford N., Bartels M.D., Strommenger B., et al. Global spread of three multidrug-resistant lineages of Staphylococcus epidermidis. Nat. Microbiol. 2018;3:1175–1185. doi: 10.1038/s41564-018-0230-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Becker K., Heilmann C., Peters G. Coagulase-negative staphylococci. Clin. Microbiol. Rev. 2014;27:870–926. doi: 10.1128/CMR.00109-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Martínez-Meléndez A., Morfín-Otero R., Villarreal-Treviño L., Camacho-Ortíz A., González-González G., Llaca-Díaz J., Rodríguez-Noriega E., Garza-González E. Molecular epidemiology of coagulase-negative bloodstream isolates: Detection of Staphylococcus epidermidis ST2, ST7 and linezolid-resistant ST23. Braz. J. Infect. Dis. 2016;20:419–428. doi: 10.1016/j.bjid.2016.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Ortega-Peña S., Franco-Cendejas R., Salazar-Sáenz B., Rodríguez-Martínez S., Cancino-Díaz M.E., Cancino-Díaz J.C. Prevalence and virulence factors of coagulase negative Staphylococcus causative of prosthetic joint infections in an orthopedic hospital of Mexico. Cirugia y cirujanos. 2019;87:428–435. doi: 10.24875/CIRU.19000690. [DOI] [PubMed] [Google Scholar]
- 66.Mendoza-Olazarán S., Morfin-Otero R., Rodríguez-Noriega E., Llaca-Díaz J., Flores-Treviño S., González-González G.M., Villarreal-Treviño L., Garza-González E. Microbiological and Molecular Characterization of Staphylococcus hominis Isolates from Blood. PLoS ONE. 2013;8:e61161. doi: 10.1371/journal.pone.0061161. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Jiménez-González M.d.C., Mejía-Aguirre B., Ascencio-Montiel I.d.J. Microorganismos aislados en pacientes con mediastinitis poscirugía cardiaca en un hospital de cardiología de la Ciudad de México. Gaceta médica de México. 2023;159:17–23. doi: 10.24875/GMM.22000163. [DOI] [PubMed] [Google Scholar]
- 68.Valenzuela J.M.D.S., Galindo L.F.P., Mancinas Z.O.G., Ponce A.B.C.C., Degante C.F. A rare hepatic abscess by Streptococcus intermedius complicated with hepatobronchial fistula: A case report. Eur. J. Med. Case Rep. 2021;5:66–70. doi: 10.24911/ejmcr/173-1585170840. [DOI] [Google Scholar]
- 69.Chen H., Yin Y., van Dorp L., Shaw L.P., Gao H., Acman M., Yuan J., Chen F., Sun S., Wang X., et al. Drivers of methicillin-resistant Staphylococcus aureus (MRSA) lineage replacement in China. Genome Med. 2021;13:171. doi: 10.1186/s13073-021-00992-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Stewart E.J., Payne D.E., Ma T.M., VanEpps J.S., Boles B.R., Younger J.G., Solomon M.J. Effect of Antimicrobial and Physical Treatments on Growth of Multispecies Staphylococcal Biofilms. Appl. Environ. Microbiol. 2017;83:e03483-16. doi: 10.1128/AEM.03483-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Schilcher K., Horswill A.R. Staphylococcal Biofilm Development: Structure, Regulation, and Treatment Strategies. Microbiol. Mol. Biol. Rev. 2020;84:e00026-19. doi: 10.1128/MMBR.00026-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Ghaioumy R., Tabatabaeifar F., Mozafarinia K., Mianroodi A.A., Isaei E., Morones-Ramírez J.R., Afshari S.A.K., Kalantar-Neyestanaki D. Biofilm formation and molecular analysis of intercellular adhesion gene cluster (icaABCD) among Staphylococcus aureus strains isolated from children with adenoiditis. Iran. J. Microbiol. 2021;13:458–463. doi: 10.18502/ijm.v13i4.6969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Cucarella C., Tormo M.Á., Knecht E., Amorena B., Lasa Í., Foster T.J., Penadés J.R. Expression of the biofilm-associated protein interferes with host protein receptors of Staphylococcus aureus and alters the infective process. Infect. Immun. 2002;70:3180–3186. doi: 10.1128/IAI.70.6.3180-3186.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Contreras J.J., Sepúlveda M. Bases moleculares de la infección asociada a implantes ortopédicos. Rev. Chil. Infectología. 2014;31:309–322. doi: 10.4067/S0716-10182014000300010. [DOI] [PubMed] [Google Scholar]
- 75.Seidl K., Goerke C., Wolz C., Mack D., Berger-Bächi B., Bischoff M. Staphylococcus aureus CcpA affects biofilm formation. Infect. Immun. 2008;76:2044–2050. doi: 10.1128/IAI.00035-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Namvar A.E., Asghari B., Ezzatifar F., Azizi G., Lari A.R. Detection of the intercellular adhesion gene cluster (ica) in clinical Staphylococcus aureus isolates. GMS Hyg. Infect. Control. 2013;8:Doc03. doi: 10.3205/dgkh000203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Eftekhar F., Dadaei T. Biofilm Formation and Detection of IcaAB Genes in Clinical Isolates of Methicillin Resistant Staphylococcus aureus. Iran. J. Basic. Med. Sci. 2011;14:132–136. doi: 10.22038/IJBMS.2011.4978. [DOI] [Google Scholar]
- 78.Francois P., Renzi G., Pittet D., Bento M., Lew D., Harbarth S., Vaudaux P., Schrenzel J. A novel multiplex real-time PCR assay for rapid typing of major staphylococcal cassette chromosome mec elements. J. Clin. Microbiol. 2004;42:3309–3312. doi: 10.1128/JCM.42.7.3309-3312.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Speziale P., Pietrocola G., Foster T.J., Geoghegan J.A. Protein-based biofilm matrices in Staphylococci. Front. Cell. Infect. Microbiol. 2014;4:171. doi: 10.3389/fcimb.2014.00171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Alexander J.A.N., Worrall L.J., Hu J., Vuckovic M., Satishkumar N., Poon R., Sobhanifar S., Rosell F.I., Jenkins J., Chiang D., et al. Structural basis of broad-spectrum β-lactam resistance in Staphylococcus aureus. Nature. 2023;613:375–382. doi: 10.1038/s41586-022-05583-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Bilyk B.L., Panchal V.V., Tinajero-Trejo M., Hobbs J.K., Foster S.J. An Interplay of Multiple Positive and Negative Factors Governs Methicillin Resistance in Staphylococcus aureus. Microbiol. Mol. Biol. Rev. 2022;86:e0015921. doi: 10.1128/mmbr.00159-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Bush K., Bradford Patricia A. Epidemiology of β-Lactamase-Producing Pathogens. Clin. Microbiol. Rev. 2020;33:e00047-19. doi: 10.1128/CMR.00047-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Hashem A.A., Abd El Fadeal N.M., Shehata A.S. In vitro activities of vancomycin and linezolid against biofilm-producing methicillin-resistant staphylococci species isolated from catheter-related bloodstream infections from an Egyptian tertiary hospital. J. Med. Microbiol. 2017;66:744–752. doi: 10.1099/jmm.0.000490. [DOI] [PubMed] [Google Scholar]
- 84.Madhavan A., Sachu A., Balakrishnan A., Vasudevan A., Balakrishnan S., Vasudevapanicker J. Comparison of PCR and phenotypic methods for the detection of methicillin resistant Staphylococcus aureus. Iran. J. Microbiol. 2021;13:31–36. doi: 10.18502/ijm.v13i1.5489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Chen L., Mediavilla J.R., Oliveira D.C., Willey B.M., de Lencastre H., Kreiswirth B.N. Multiplex real-time PCR for rapid Staphylococcal cassette chromosome mec typing. J. Clin. Microbiol. 2009;47:3692–3706. doi: 10.1128/JCM.00766-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Peacock S.J., Paterson G.K. Mechanisms of Methicillin Resistance in Staphylococcus aureus. Annu. Rev. Biochem. 2015;84:577–601. doi: 10.1146/annurev-biochem-060614-034516. [DOI] [PubMed] [Google Scholar]
- 87.Maharjan S., Ansari M., Maharjan P., Rai K.R., Sabina K.C., Kattel H.P., Rai G., Rai S.K. Phenotypic detection of methicillin resistance, biofilm production, and inducible clindamycin resistance in Staphylococcus aureus clinical isolates in Kathmandu, Nepal. Trop. Med. Health. 2022;50:71. doi: 10.1186/s41182-022-00460-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data are contained within the article.
