Skip to main content
BMC Cancer logoLink to BMC Cancer
. 2005 Apr 8;5:36. doi: 10.1186/1471-2407-5-36

Mutation analysis of genes that control the G1/S cell cycle in melanoma: TP53, CDKN1A, CDKN2A, and CDKN2B

José Luis Soto 1, Carmen M Cabrera 1, Salvio Serrano 2, Miguel Ángel López-Nevot 1,✉
PMCID: PMC1097717  PMID: 15819981

Abstract

Background

The role of genes involved in the control of progression from the G1 to the S phase of the cell cycle in melanoma tumors in not fully known. The aim of our study was to analyse mutations in TP53, CDKN1A, CDKN2A, and CDKN2B genes in melanoma tumors and melanoma cell lines

Methods

We analysed 39 primary and metastatic melanomas and 9 melanoma cell lines by single-stranded conformational polymorphism (SSCP).

Results

The single-stranded technique showed heterozygous defects in the TP53 gene in 8 of 39 (20.5%) melanoma tumors: three new single point mutations in intronic sequences (introns 1 and 2) and exon 10, and three new single nucleotide polymorphisms located in introns 1 and 2 (C to T transition at position 11701 in intron 1; C insertion at position 11818 in intron 2; and C insertion at position 11875 in intron 2). One melanoma tumor exhibited two heterozygous alterations in the CDKN2A exon 1 one of which was novel (stop codon, and missense mutation). No defects were found in the remaining genes.

Conclusion

These results suggest that these genes are involved in melanoma tumorigenesis, although they may be not the major targets. Other suppressor genes that may be informative of the mechanism of tumorigenesis in skin melanomas should be studied.

Background

The transition from phase G1 to S of the cell cycle is controlled by sequential activation of cyclin/Cdk complexes (Cyclin-dependent kinases) [1]. Active cyclin/Cdk complexes phosphorylate and inactivate members of the retinoblastoma protein (Rb) family, which are negative regulators of G1 and S-phase progression, leading to the induction of E2F-regulated gene expression and cell proliferation. Inhibitors of cyclin/Cdk complexes, by binding to these complexes, negatively regulate cell cycle progression [2].

Two families of Cdk-inhibitors (CKI) control the actions mediated by cyclin/Cdk complexes. p21 (also called WAF1, and CDKN1A; MIM# 116899) [3] is the founding member of the Cip/Kip family of CKI, which also includes p27 [4] and p57 [5]. Another class of Cdk inhibitors, the so-called INK4 proteins (named for their ability to inhibit cdk4), specifically target the cyclin D-dependent kinases [6]. To date, four INK4 proteins have been identified: the founding member p16INK4a (CDKN2A; MIM# 600160) [7], and three other closely related genes designated p15INK4b (CDKN2B; MIM# 600431) [8], p18INK4c (MIM# 603369) [9] and p19INK4d (MIM# 600927) [9].

In response to irradiation and chemotherapy, p53 protein (MIM# 191170) is stabilised and mediates apoptosis and cell cycle arrest. Whereas the mechanisms of p53-dependent apoptosis are not well understood, p53-dependent cell cycle arrest is known to be primarily mediated by p21, a potent inhibitor of cyclin-dependent kinases that is transactivated by p53 and p73 [10]. In addition to p21, several other cell cycle regulators are induced by p53, such as GADD45 and members of the 14-3-3 family [11].

The TP53 suppressor gene and Cdk-inhibitors such as CDKN1A, CDKN2A, and CDKN2B are targets of tumoral process in different types of tumors [12,13]. Mutations in the TP53 gene occur frequently in skin tumors as basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) [14]. In human melanoma, TP53 mutations are apparently not commonly detected [15,16], and consist mainly of C to T transitions located on dipyrimidine sites originated by UV radiation [17]. In contrast, CDKN2A is deleted or mutated in human sporadic melanomas and derived cell lines [18], and it appears to be the predisposing mutation in some familial melanoma kindreds [19]. A low incidence of mutations has been described for the CDKN2B gene in sporadic melanoma tumors [20]; however, no structural defects have been detected in the CDKN1A gene in human melanoma.

In order to investigate the role of the genes involved in the control of G1/S phase cell cycle progression in human melanomas, the aim of our study was to determine the presence of mutations in TP53, CDKN1A, CDKN2A and CDKN2B genes in primary and metastatic melanomas and melanoma cell lines.

Methods

Tumor samples

Thirty-nine specimens of skin melanoma were obtained from the Department of Surgery at the Hospital Universitario San Cecilio of Granada, Spain (Table 1). Melanoma tumors were dissected from normal tissues in fresh samples under sterile conditions, and tumor tissues were frozen in liquid nitrogen and stored at -80°C until DNA isolation. DNA was obtained from peripheral blood from each patient. The following 9 melanoma cell lines were included in this study: MZ2-MEL, MEL-3.0, MEL-2.2, and Mi-13443 were provided by Dr. T. Boon (Ludwig Institute of Cancer Research, Brussels, Belgium); and M31-L, M42-L, M52-L, M34-L, and M59-L were established in our laboratory as described previously [21]. The clinical and pathological characteristics of primary melanoma tumors and derived metastases are described in Table 1. Of the 39 tumors studied, 14 were primary (36%) while the rest were metastatic (18 ganlionar metastases and 4 subcutaneous metastases).

Table 1.

Melanoma tumor samples

Tumor aHistopathology bBreslow (mm) Clark cTumor sample
M3 SSM 5.5 IV P
M4a NM - - Sm
M4b NM - - Sm
M5 - - - P
M6 - - - Nm
M7a SSM 4 IV Nm
M7b SSM 4 IV Sm
M8 SSM 0.5 II P
M13 SSM 3.9 III P
M18 NM 5 V Nm
M19 - - - Nm
M21 SSM 3.5 III P
M22 - - - Nm
M23 SSM 9 IV Nm
M24 ALM - - Nm
M31 SSM 3 IV Nm
M32 - - - Nm
M34 SSM 16 V P
M37 SSM 1.8 III Nm
M38 NM 9 V P
M40 NM 3.4 IV Nm
M42 NM 1.5 IV Nm
M43 SSM 2.5 IV P
M44a NM 10 IV P
M44b NM 10 IV Sm
M45 - - - Nm
M46 - - - P
M49 - - - P
M50 - - - Nm
M52 LMM - - Nm
M53 - - - Nm
M55 ALM - V Nm
M56 LMM 1 III P
M59 NM 10.1 III P
M60 SSM 3 III P
M71 NM - - P
M72 SSM 0.6 III P
M73 SSM 2.5 III P
M74 - - - Nm

aSSM (superficial spreading melanoma), NM (nodular melanoma), LMM (lentigo maligna melanoma), ALM (acral lentigo melanoma). bBreslow vertical tumor thickness. cP, primary melanoma; Nm, lymph node metastases; Sm, subcutaneous metastases.

DNA isolation

DNA was isolated from tumor samples and peripheral blood lymphocytes with the MicroTurboGen Genomic DNA Isolation Kit (Invitrogen, San Diego, California) and the Quiagen kit (Wetsburg, Leusden, The Netherlands) respectively.

Mutation analysis of TP53, CDKN1A, CDKN2A, and CDKN2B genes

Point mutations were detected by changes in single-stranded conformational polymorphism (SSCP) of DNA amplified by polymerase chain reaction (PCR), as described by Orita et al [22] with slight modifications [23]. TP53 exons 2–11, CDKN1A exon 2, CDKN2B exon 2, and CDKN2A exons 1–2 were amplified. The sequences of the primers used and fragments (bp) amplified are described in Table 2. All TP53 primers used were provided by Clontech (Human p53 Amplier Panels, Palo Alto, CA). A portion of TP53 intron 1, exon 2, intron 2 and exon 3 was amplified using the primers PU2 (sense) and PD3 (antisense). CDKN1A exon 2 was amplified in two overlapping fragments with the following primer pairs: p21-L1/p21-R1 and p21-L2/p21-R2 (Table 2).

Table 2.

Oligonucleotide primer sequences

TP53, exons 2 to 11 (GeneBank Accession: X54156)
Exon Primer Sequence 5'→3' Fragment (bp)
PU2 (sense) TCCTCTTGCAGCAGCCAGACTGC
PD3 (antisense) AACCCTTGTCCTTACCAGAACGTTG
4 PU4 (sense) CACCCATCTACAGTCCCCCTTGC 307
PD4 (antisense) CTCAGGGCAACTGACCGTGCAAG
5 PU5 (sense) CTCTTCCTACAGTACTCCCCTGC 211
PD5 (antisense) GCCCCAGCTGCTCACCATCGCTA
6 PU6 (sense) GATTGCTCTTAGGTCTGGCCCCTC 182
PD6 (antisense) GGCCACTGACAACCACCCTTAACC
7 PU7 (sense) GTGTTATCTCCTAGGTTGGCTCTG 139
PD7(antisense) CAAGTGGCTCCTGACCTGGAGTC
8 PU8 (sense) ACCTGATTTCCTTACTGCCTCTTGC 200
PD8 (antisense) GTCCTGCTTGCTTACCTCGCTTAC
9 PU9 (sense) GCCTCTTTCCTAGCACTGCCCAAC 102
PD9 (antisense) CCCAAGACTTAGTACCTGAAGGGTG
10 PU10 (sense) TGTTGCTGCAGATCCGTGGGCGT 130
PD10 (antisense) GAGGTCACTCACCTGGAGTGAGC
11 PU11 (sense) TGTGATGTCATCTCTCCTCCCTGC 153
PD11 (antisense) GGCTGTCAGTGGGGAACAAGAAGT

CDKN1A, exon 2 (GeneBank Accession: AF497972)
p21-L1 (sense) GATGTCCGTCAGAACCCATG 258
p21-R1 (antisense) TGCCTCCTCCCAACTCAT
p21-L2 (sense) ATGAGTTGGGAGGAGGCA 181
p21-R2 (antisense) ATGCTGGTCTGCCGCCGTT

CDKN2A, exons 1(GeneBank Accession: U12818) and 2 (GeneBank Accession: U12819)
1 MTS1-L1 (sense) GAAGAAAGAGGAGGGGCTG 340
MTS1R1 (antisense) GCGCTACCTGATTCCAATTC
2 p16-L2 (sense) GTCATGATGATGGGCAGC 307
p16-R2 (antisense) CTGAGGGACCTTCCGCG

CDKN2B, exon 2 (GeneBank Accession: AF513858)
MTS2-L2 (sense) TAAGTTTAACCTGAAGGTGG 500
MTS2-R (antisense) GGGTGGGAAATTGGGTAAG

Amplifications were performed using 100 ng genomic DNA and α32P-dCTP (300 Ci/mmol) in a final volume of 25 μl. The PCR conditions for TP53 exons 2–11 were as follows: 35 cycles at 95°C/30 s, 66°C/45 s and 72°C/1.5 min, with a 10 min extension after the last cycle. CDKN1A exon 2, CDKN2B exon 2, and CDKN2A exons 1–2 were amplified under the same PCR conditions: in a touchdown PCR procedure the temperature of the reaction was lowered by 1°C every second cycle from 68°C to 60°C, at which temperature 30 cycles were carried out.

Amplified samples (2.5 μl) were mixed with 9 μl of sequencing stop solution (USB, Cleveland, OH, USA), 1.5 μl of 0.08 N NaOH, and 15 μl of 0.1% SDS, denatured for 10 min at 95°C, and the samples were quickly cooled in dry ice. Samples of 3 μl were loaded onto a 6% non-denaturing acrylamide gel containing 10% glycerol, and run at room temperature for 4 h at 22 W. Gels were dried at 80°C under vacuum and exposed to x-ray films for 4–16 h.

DNA sequencing

Asymmetric PCR reactions were purified from agarose gels and reamplified. PCR products were cloned in the PCR 4-TOPO vector using the TOPO TA Cloning Kit for sequencing (Invitrogen, Groningen, The Netherlands). After transformation several clones were picked and sequenced. Sequence analysis was carried out with the Sequenase DNA Sequencing kit (USB), using α35S-dATP (DuPont-NEN, Boston, MA) incorporation. Aliquots of the reaction mixture were run on a 6% denaturing acrylamide gel.

Results

Intronic single nucleotide polymorphisms and heterozygous point mutations in the TP53 gene

Of a total of 39 melanoma tumors and 9 melanoma cell lines studied by PCR-SSCP, we detected defects in the TP53 gene in 8 of 39 (20.5%) melanoma tumors, and did not find any alteration in melanoma cell lines (Table 3). Mutation analysis showed three novel heterozygous single point mutations in the TP53 sequence and four different single nucleotide polymorphisms, three of which have not been described to date. All novel single point mutations and polymorphisms were compared with the IARC (International Agency for Research on Cancer) TP53 Mutation Database http://www-p53.iarc.fr/index.html.

Table 3.

Single nucleotide polymorphisms (SNPs) and mutations (M) in TP53, CDKN1A, CDKN2A, and CDKN2B genes

TP53
Tumor
M4 11827G>C (intron 2) (SNP)
11875insC (intron 2) (SNP)
M7 11827G>C (intron 2) (SNP)
11818insC (intron 2) (SNP)
11875insC (intron 2) (SNP)
M38 11827G>C (intron 2) (SNP)
11875insC (intron 2) (SNP)
M42 11701C>T (intron 1) (M)
11818insC (intron 2) (SNP)
11875insC (intron 2) (SNP)
M43 11875insC (intron 2) (SNP)
11818delC (intron 2) (M)
M53 11701C>T (intron 1) (SNP)
11827G>C (intron 2) (SNP)
11818insC (intron 2) (SNP)
11875insC (intron 2) (SNP)
M71 11701C>T (intron 1) (SNP)
11818insC (intron 2) (SNP)
11875insC (intron 2) (SNP)
M34 17628delC (codon 350: CTC→CTA, exon 10), stop codon at the beginning of exon 11 (M)
CDKN2A, exon 1
M13 g.149G>A, TGG (Trp)→TGA (stop codon) (M)
g.298T>C, CTC (Leu)→CCC (Pro) (M)

CDKN1A, and CDKN2B No alterations found

The G to C transversion found at position 11827 in TP53 intron 2 in M4, M7, M38 and M53 melanoma tumors was previously described by Oliva et al [24] (Figure 1). In this study, we found 3 new single nucleotide polymorphisms located at intron 1 and 2 of the TP53 gene when we compared genomic DNA from melanoma tumors and DNA from autologous PBLs with control PBLs (Figure 1). The C to T transition was found at position 11701 of TP53 intron 1 in melanoma tumors M53 and M71 (Figure 2); a C insertion was found at position 11818 of TP53 intron 2 in melanoma tumors M7, M42, M53 and M71; and a C insertion was found at position 11875 of TP53 intron 2 in melanoma tumors M7, M38, M42, M53, and M71 (Table 3).

Figure 1.

Figure 1

Single nucleotide polymorphisms detected in intron 1 and intron 2 sequences of the TP53 gene in melanoma tumors. Each polymorphism and its positions are indicated by an asterisk (*), to determinate the presence of the polymorphisms the DNA sequence from melanoma tumors and autologous PBLs were compared with control PBLs.

Figure 2.

Figure 2

New single nucleotide polymorphism found in intron 1 of the TP53 gene (C>T transition) at position 11701. (A) PCR-SSCP analysis of melanoma tumors. The arrow indicates the shifted band in melanoma tumor M71. DC, denaturing control; NDC, non-denaturing control. (B) DNA sequence of melanoma tumor M71 and autologous PBLs showing the C to T base change (shown by an asterisk *) at position 11701 compared with control PBLs.

A heterozygous C deletion in TP53 exon 10 at position 172628 produced a stop codon and truncated the p53 protein in melanoma tumor M34. Melanoma tumors M42 and M43 showed heterozygous single point mutations at TP53 introns 1 and 2. The C to T transition at position 11701 in intron 1, observed in melanoma tumor M42, contrasted with the absence of this transition in autologous PBLs. In contrast, a C insertion was found at position 11818 in intron 2 of TP53 in autologous PBLs, but this polymorphism was not seen in melanoma tumor M43 (Tale 3).

Mutation analysis of CDKN1A, CDKN2A, and CDKN2B Cdk (Cyclin-dependent kinases) inhibitors genes

Two heterozygous alterations in CDKN2A exon 1 were observed in melanoma tumor M13 one of which novel, whereas no defects were seen in the CDKN1A and CDKN2B genes. The G to A transition produced a stop codon at position 149 [25]; and the novel T to C transition at position 298 resulted in substitution of proline for leucine (Table 3).

Discussion

Polymorphisms versus mutations in the TP53 gene in human melanoma

The major carcinogenic agent in most skin cancers is well established as solar ultraviolet light [26]. This is absorbed in DNA, with the formation of UV-specific dipyrimidine photoproducts. About 50% of all skin cancers exhibit TP53 mutations [17], and these mutations are characterised by a specific signature attributed to the UVB part of the solar spectrum. The impact of UVB radiation can be clearly inferred from the characteristic point mutations in TP53 found in human SCC and BCC, consisting of C to T or CC to TT transitions at dipirymidine sites [27]. These findings contrast with the situation in human melanomas, in which TP53 mutations are not commonly detected. The results of the present study support earlier findings that such mutations are indeed infrequent in this type of tumour. The influence of UVB radiation in these mutations is not clear. TP53 mutations in primary melanoma tumors induced by UVB radiation have been described previously by Zerp et al [16]. However, in the tumors examined in our study we did not find TP53 alterations originated by UVB radiation (Table 3). In contrast, we detected two new mutations located in intronic sequences (C deletion at position 11818 in intron 2, and C to T transition at position 11701 in intron 1) (Table 3) and the novel C deletion at codon 350 of TP53 exon 10 which produced a stop codon and truncated protein. More than 90% of the mutations reported in non-melanoma skin cancers and different types of tumors are clustered between exons 4 and 8 [28]. This region is highly conserved throughout evolution and contains the DNA-binding domain of p53, which is essential for its activity [29]. This contrasts with the trans-activation domain (encodes by exons 2 and 3) and the regulatory region (encodes by exons 9 to 11), where few mutations have been described. Therefore, the TP53 single nucleotide polymorphisms detected in these melanoma tumors appear to be their most frequent characteristic.

At least twelve intronic polymorphisms have been described in the human TP53 gene. These include between others a VNTR (variable number tandem repeat) region [30] and HaeIII restriction fragment length polymorphism (RFLP) [31] in intron 1, a G to C transversion in intron 2 [24], a 16 bp duplication in intron 3 (5'-gacctggagggctggg-3') [32], a MspI RFLP in intron 6 (G to A transition at 61 bp downstream of exon 6) [33,34], a G to C transversion at 37 bp upstream to exon 7 [35], an ApaI RFLP in intron 7 [36], and A to T transversion in intron 10 [37]http://www.iarc.fr/p53/polymorphisms. The melanoma tumors and melanoma cell lines studied here showed the G to C transversion at position 11827 of TP53 intron 2, previously described by Oliva et al [24] in four melanoma tumors (M4, M7, M38, and M53), and three new single nucleotide polymorphisms: C to T transition at position 11701 of TP53 intron 1; C insertion at position 11818 of TP53 intron 2; and C insertion at position 11875 of TP53 intron 2 (Figure 1). Moreover, we found three new heterozygous single point mutations in the TP53 gene (Table 3), the incidence of mutations detected in the TP53 gene accounted for only 7.7% (3 of 39 melanoma tumors) in contrast to 18% (7 of 39 melanoma tumors) of single nucleotide polymorphisms found in these tumors.

Associations between cancer phenotypes and inherited TP53 intronic polymorphisms have been observed in studies of epithelial cancers including ovarian, breast, colon, thyroid, nasopharyngeal, lung cancer, and thyroid [34,35,38-40]. The frequency of G to C transition at position 11827 in intron 2 of TP53 gene (3 of 39 melanoma tumors, 7.7%) is low compared to the frequency of the A1 allele (G to C transition at position 11827) described previously in Caucasian individuals [41]. The polymorphisms that we detected in these melanoma tumors may play a role in the risk of developing skin melanoma in these patients.

Alterations in cyclin-Cdk inhibitors: CDKN1A, CDKN2A, and CDKN2B

Our results revealed the low incidence of mutations in cyclin-Cdk inhibitors in both melanoma tumors and melanoma cell lines. We detected only two mutations in exon 1 of the CDKN2A gene, both in melanoma tumor M13: G to A transition at position 149 producing a stop codon [25], and the novel missense mutation Leu298 (leucine → proline). The low incidence of CDKN2A mutations found in primary melanomas is concordant with previous reports [42,43]. In contrast, melanomas cell lines show a high incidence of mutations in CDKN2A, with homozygous deletion being the main mechanism of alteration [42]. These results suggest that in sporadic melanoma tumors, CDKN2A might not be a target of mutation, whereas in familial melanoma this mutation accounts for approximately 10% of all cases of tumors.

Conclusion

We conclude that although none of the cell cycle regulators analysed here can be singled out as a main mutation target for melanoma tumorigenesis, G1/S checkpoint defects are one of the significant factors in the development of melanoma tumors. However, this influence appear to be low in tumors, unlike the situation in melanoma cell lines. Other suppressor genes will be investigated to identify the main targets in the pathogenesis of melanoma.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

JLS carried out the molecular genetic studies of SSCP and DNA sequencing. CMC participated in the manuscript drafted. SS participated in the design of the study. MALN participated in the design, coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1471-2407/5/36/prepub

Acknowledgments

Acknowledgements

This study was supported by FISS grant 021542 from the Spanish Ministry of Health. We thank K. Shashok for checking the use of English in the manuscript.

Contributor Information

José Luis Soto, Email: jlsoto@umh.es.

Carmen M Cabrera, Email: mcabrm@fundacionhvn.org.

Salvio Serrano, Email: salvio@ugr.es.

Miguel Ángel López-Nevot, Email: miguel.lopez.nevot.sspa@juntadeandalucia.es.

References

  1. Ekholm SV, Reed SI. Regulation of G1 cyclin-dependent kinases in the mammalian cell cycle. Curr Opin Cell Biol. 2000;12:676–684. doi: 10.1016/S0955-0674(00)00151-4. [DOI] [PubMed] [Google Scholar]
  2. Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 1999;13:1501–1512. doi: 10.1101/gad.13.12.1501. [DOI] [PubMed] [Google Scholar]
  3. El-Deiry W, Tokino T, Velculescu V, Levy D, Parsons R, Trent J, Lin D, Mercer WE, Kinzler K, Vogelstein B. WAF1, a potential mediator of p53 tumor suppression. Cell. 1993;75:817–825. doi: 10.1016/0092-8674(93)90500-P. [DOI] [PubMed] [Google Scholar]
  4. Toyoshima H, Hunter T. p27, a novel inhibitor of G1 cyclin/cdk protein kinase activity, is related to p21. Cell. 1994;78:67–74. doi: 10.1016/0092-8674(94)90573-8. [DOI] [PubMed] [Google Scholar]
  5. Lee MH, Reynisdottir I, Massagué J. Cloning of p57KIP2, a cylin-dependent kinase inhibitor with unique domain structure and tissue distribution. Genes Dev. 1995;9:639–649. doi: 10.1101/gad.9.6.639. [DOI] [PubMed] [Google Scholar]
  6. Ruas M, Peters G. The p16INKa/CDKN2A tumor suppressor and its relatives. Biochim Biophys Acta. 1998;1378:F115–F177. doi: 10.1016/S0304-419X(98)00017-1. [DOI] [PubMed] [Google Scholar]
  7. Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell cycle control causing specific inhibition of cyclin D/CDK4. Nature. 1993;366:704–707. doi: 10.1038/366704a0. [DOI] [PubMed] [Google Scholar]
  8. Hannon GJ, Beach D. p15INK4b is a potential effector of TGFβ-induced cell cycle arrest. Nature. 1994;371:257–261. doi: 10.1038/371257a0. [DOI] [PubMed] [Google Scholar]
  9. Hirai H, Roussel MF, Kato J, Ashmun RA, Sherr CJ. Novel INK4 proteins, p19 and p18, are specific inhibitors of the cyclin D-dependent kinases CDK4 and CDK6. Mol Cell Biol. 1995;15:2672–2681. doi: 10.1128/mcb.15.5.2672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Lohrum M, Vousden K. Regulation and function of the p53-related proteins: same family, different rules. Trends Cell Biol. 2000;10:197–202. doi: 10.1016/S0962-8924(00)01736-0. [DOI] [PubMed] [Google Scholar]
  11. Rich T, Allen RL, Wyllie AH. Defying death after DNA damage. Nature. 2000;407:777–783. doi: 10.1038/35037717. [DOI] [PubMed] [Google Scholar]
  12. Yonghas T, Quian H, Chuanyuan L, Yandell DW. Deletions and point mutations of p16, p15 genes in primary tumors and tumors cell lines. Chin Med Sci J. 1999;14:200–205. [PubMed] [Google Scholar]
  13. Kawamura M, Ohnishi H, Guo SX, Sheng XM, Minegishi M, Hanada R, Horibe K, Hongo T, Kaneko Y, Bessho F, Yanagisawa M, Sekiga T, Hayashi Y. Alterations of the p53, p21, p16, p15 and RAS genes in childhood T-cell acute lymphoblastic leukemia. Leuk Res. 1999;23:115–126. doi: 10.1016/S0145-2126(98)00146-5. [DOI] [PubMed] [Google Scholar]
  14. Moles JP, Moyret C, Guillot B, Jeanteur P, Guilhou JJ, Theillet C, Basset-Seguin N. p53 gene mutations in human epithelial skin cancers. Oncogene. 1993;8:583–588. [PubMed] [Google Scholar]
  15. Hartmann A, Blaszyk H, Cunningham JS, McGovern RM, Schroeder JS, Helander S, Pittelkow MR, Sommer SS, Kovach JS. Overexpression and mutations of p53 in metastatic malignant melanomas. Int J Cancer. 1996;67:313–317. doi: 10.1002/(SICI)1097-0215(19960729)67:3<313::AID-IJC1>3.0.CO;2-U. [DOI] [PubMed] [Google Scholar]
  16. Zerp SF, Elsas van A, Peltenburg LTC, Schrier PI. P53 mutations in human cutaneous melanoma correlate with sun exposure but are not always involved in melanogenesis. Br J Cancer. 1999;79:921–926. doi: 10.1038/sj.bjc.6690147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Giglia-Mari G, Sarasin A. TP53 mutations in human skin cancers. Hum Mutat. 2003;21:217–228. doi: 10.1002/humu.10179. [DOI] [PubMed] [Google Scholar]
  18. Bartkova J, Lukas J, Guldberg P, Alsner J, Kirkin AF, Zeuthen J, Bartek J. The p16-cyclin D/Cdk4-pRb pathway as a functional unit frequently altered in melanoma pathogenesis. Cancer Res. 1996;56:5475–5483. [PubMed] [Google Scholar]
  19. Liggett WH, Jr, Sidransky D. Role of the p16 tumor suppressor gene in cancer. J Clin Oncol. 1998;16:1197–1206. doi: 10.1200/JCO.1998.16.3.1197. [DOI] [PubMed] [Google Scholar]
  20. Matsumura Y, Nishigori C, Yagi T, Imamura S, Takebe H. Mutations of p16 and p15 tumor suppressor genes and replication errors contribute independently to the pathogenesis of sporadic malignant melanoma. Arch Dermatol Res. 1998;290:175–180. doi: 10.1007/s004030050286. [DOI] [PubMed] [Google Scholar]
  21. Kirkin AF, Petersen TR, Olsen AC, Li L, thor Straten P, Zeuthen J. Generation of human-melanoma-specific T lymphocyte clones defining novel cytolytic targets with panels of newly established melanoma cell lines. Cancer Immunol Immunother. 1995;41:71–76. doi: 10.1007/s002620050202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using polymerase chain reaction. Genomics. 1989;5:874–879. doi: 10.1016/0888-7543(89)90129-8. [DOI] [PubMed] [Google Scholar]
  23. Prosser J. Detecting single-base mutations. TIBTECH. 1993;11:238. doi: 10.1016/0167-7799(93)90135-V. [DOI] [PubMed] [Google Scholar]
  24. Oliva MR, Saez GT, Latres E, Cordon-Cardo C. A new polymorphic site in intron 2 to TP53 characterizes LOH in human tumors by PCR-SSCP. Diagn Mol Pathol. 1995;4:54–58. doi: 10.1097/00019606-199503000-00010. [DOI] [PubMed] [Google Scholar]
  25. Holland EA, Schmid H, Kefford RF, Mann GJ. CDKN2A (P16(INK4a)) and CDK4 mutation analysis in 131 Australian melanoma probands: effect of family history and multiple primary melanomas. Genes Chromosomes Cancer. 1999;25:339–348. doi: 10.1002/(SICI)1098-2264(199908)25:4<339::AID-GCC5>3.0.CO;2-H. [DOI] [PubMed] [Google Scholar]
  26. Cleaver JE, Crowley E. UV damage, DNA repair and skin carcinogenesis. Front Biosci. 2002;7:d1024–1043. doi: 10.2741/A829. [DOI] [PubMed] [Google Scholar]
  27. Ziegler A, Leffell DJ, Kunala S, Sharma HW, Gailani M, Siman JA, Halperin AJ, Baden HP, Shapiro PE, Bale AE, Brash DE. Mutation hotspots due to sunlight in the p53 gene of non-melanoma skin cancers. Proc Natl Acad Sci USA. 1993;90:4216–4220. doi: 10.1073/pnas.90.9.4216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Soussi T. The p53 tumour suppressor gene: a model for molecular epidemiology of human cancer. Mol Med Today. 1996;2:32–37. doi: 10.1016/1357-4310(96)88756-9. [DOI] [PubMed] [Google Scholar]
  29. Mendoza-Rodriguez CA, Cerbon MA. Tumor suppressor gene p53: mechanisms of action in cell proliferation and death. Rev Invest Clin. 2001;53:266–273. [PubMed] [Google Scholar]
  30. Hahn M, Serth J, Fislage R, Wolfes H, Allhoff E, Jonas V, Pingoud A. Polymerase chain reaction detection of a highly polymorphic VNTR segment in intron 1 of the human p53 gene. Clin Chem. 1993;39:549–550. [PubMed] [Google Scholar]
  31. Ito T, Seyama T, Hayashi T, Mizuno T, Iwamoto KS, Tsuyama N, Dohi K, Nakamura N, Akiyama M. Hae III polymorphism in intron 1 of the human p53 gene. Human Genet. 1994;93:222. doi: 10.1007/BF00210619. [DOI] [PubMed] [Google Scholar]
  32. Lazar V, Hazard F, Bertin F, Janin N, Bellet D, Bressac B. Simple sequence repeat polymorphism within the p53 gene. Oncogene. 1993;8:1703–1705. [PubMed] [Google Scholar]
  33. Peller S, Kopilova Y, Slutzki S, Halevy A, Kvitko K, Rother V. A novel polymorphism in intron 6 of the human p53 gene: a possible association with cancer predisposition and susceptibility. DNA Cell Biol. 1995;14:983–990. doi: 10.1089/dna.1995.14.983. [DOI] [PubMed] [Google Scholar]
  34. Mavridou D, Gornall R, Campbell IG, Eccles DM. TP53 intron 6 polymorphism and the risk of ovarian and breast cancer. Br J Cancer. 1998;77:676–677. doi: 10.1038/bjc.1998.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Hillebrandt S, Streffer C, Demidchik EP, Biko J, Reiners C. Polymorphisms in the p53 gene in thyroid tumours and blood samples of children from areas in Belarus. Mutat Res. 1997;381:201–207. doi: 10.1016/s0027-5107(97)00169-3. [DOI] [PubMed] [Google Scholar]
  36. Prosser J, Condie A. Biallelic ApaI polymorphism of the human p53 gene (TP53) Nucleic Acids Res. 1991;19:4799. doi: 10.1093/nar/19.17.4799-a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Buller RE, Skilling JS, Kaliszewski S, Niemann T, Anderson B. Absence of significant germline p53 mutations in ovarian cancer patients. Gynecol Oncol. 1995;58:368–374. doi: 10.1006/gyno.1995.1244. [DOI] [PubMed] [Google Scholar]
  38. Sjalander A, Birgander R, Athlin L, Stenling R, Rutegard J, Beckman L, Beckman G. p53 germline haplotypes associated with increased risk for colorectal cancer. Carcinogenesis. 1995;16:1461–1464. doi: 10.1093/carcin/16.7.1461. [DOI] [PubMed] [Google Scholar]
  39. Birgander R, Sjalander A, Rannug A, Alexandrie AK, Sundberg MI, Seidergard J, Tornling G, Beckman G, Beckman L. p53 polymorphisms and haplotypes in lung cancer. Carcinogenesis. 1995;16:2233–2236. doi: 10.1093/carcin/16.9.2233. [DOI] [PubMed] [Google Scholar]
  40. Birgander R, Sjalander A, Zhou Z, Fan C, Beckman L, Beckman G. p53 polymorphisms and haplotypes in nasopharyngeal cancer. Hum Hered. 1996;46:49–54. doi: 10.1159/000154325. [DOI] [PubMed] [Google Scholar]
  41. Ge H, Lam WK, Lee J, Wong MP, Fu KH, Yew WW, Lung ML. Detection and evaluation of p53 intron 2 polymorphism in lung carcinomas in Hong Kong. Int J Cancer. 1996;69:120–124. doi: 10.1002/(SICI)1097-0215(19960422)69:2<120::AID-IJC9>3.0.CO;2-2. [DOI] [PubMed] [Google Scholar]
  42. Ruiz A, Puig S, Lynch M, Castel T, Estivell X. Retention of the CDKN2A locus and low frequency of point mutations in primary and metastatic cutaneous malignant melanoma. Int J Cancer. 1998;76:312–316. doi: 10.1002/(SICI)1097-0215(19980504)76:3<312::AID-IJC4>3.0.CO;2-Y. [DOI] [PubMed] [Google Scholar]
  43. Sauroja I, Smeds J, Vlaykova T, Kumar R, Talve L, Hahka-Kemppinen M, Punnonen K, Jansen CT, Hemminki K, Pyrhonen S. Analysis of G(1)/S checkpoint regulators in metastatic melanoma. Genes Chromosomes Cancer. 2000;28:404–414. doi: 10.1002/1098-2264(200008)28:4<404::AID-GCC6>3.0.CO;2-P. [DOI] [PubMed] [Google Scholar]

Articles from BMC Cancer are provided here courtesy of BMC

RESOURCES